Phylogenetic Analysis of the Cytochrome P450 3 (CYP3) Gene Family

Phylogenetic Analysis of the Cytochrome P450 3 (CYP3) Gene Family

Andrew G. McArthur,1 Tove Hegelund,2 Rachel L. Cox,3,* John J. Stegeman,3 Mette Liljenberg,2

Urban Olsson,2 Per Sundberg,2 Malin C. Celander2

1 The Josephine Bay Paul Center for Comparative Molecular Biology and Evolution, Marine Biological Laboratory, Woods Hole,

MA 02543, USA2 Department of Zoology, Goteborg University, Box 463, SE 405 30 Goteborg, Sweden3 Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543, USA

Received: 17 December 2002 / Accepted: 4 March 2003

Abstract. Cytochrome P450 genes (CYP) constitutea superfamily with members known from the Bacte-ria, Archaea, and Eukarya. The CYP3 gene familyincludes the CYP3A and CYP3B subfamilies. Mem-bers of the CYP3A subfamily represent the dominantCYP forms expressed in the digestive and respiratorytracts of vertebrates. The CYP3A enzymes metabo-lize a wide variety of chemically diverse lipophilicorganic compounds. To understand vertebrate CYP3diversity better, we determined the killifish (Fundulusheteroclitus) CYP3A30 and CYP3A56 and the ballpython (Python regius) CYP3A42 sequences. Weperformed phylogenetic analyses of 45 vertebrateCYP3 amino acid sequences using a Bayesian ap-proach. Our analyses indicate that teleost, diapsid,and mammalian CYP3A genes have undergone in-dependent diversification and that the ancestral ver-tebrate genome contained a single CYP3A gene.Most CYP3A diversity is the product of recent geneduplication events. There is strong support forplacement of the guinea pig CYP3A genes within therodent CYP3A diversification. The rat, mouse, andhamster CYP3A genes are mixed among several ro-dent CYP3A subclades, indicative of a complex his-tory involving speciation and gene duplication.

Phylogenetic analyses suggest two CYP3A gene du-plication events early in rodent history, with the ratCYP3A9 and mouse Cyp3a13 clade having a sisterrelationship to all other rodent CYP3A genes. Inprimate history, the human CYP3A43 gene appearsto have a sister relationship to all other known pri-mate CYP3A genes. Other, more recent gene dupli-cations are hypothesized to have occurredindependently within the human, pig, rat, mouse,guinea pig, and fish genomes. Functional analysessuggest that gene duplication is strongly tied to ac-quisition of new function and that convergent evo-lution of CYP3A function may be frequent amongindependent gene copies.

Key words: Cytochrome P450 — CYP3A —Phylogeny — Vertebrata — Mammalia —Rodentia

Introduction

The cytochrome P450 (CYP) superfamily comprisesover 2000 known genes and has bacterial, archaeal,and eukaryotic representatives. It has been suggestedthat all eukaryotic CYP genes have evolved from asingle ancestral gene (Nebert and Gonzalez 1987).Within known CYP diversity, the CYP3 gene familyis believed to have diverged between 800 and 1100million years ago (Nebert and Gonzalez 1987;Gonzalez 1990). This gene family has two identified

J Mol Evol (2003) 57:200–211DOI: 10.1007/s00239-003-2466-x

*Current address: Laboratory of Aquatic Biomedicine, Marine

Biology Laboratory, Woods Hole, MA 02543, USA

Correspondence to: Dr. Malin Celander; email: malin.celander@

zool.gu.se

subfamilies, CYP3A and CYP3B, the latter recentlydiscovered in the pufferfish (Takifugu rubripes) ge-nome.The CYP3A subfamily has multiple members in

several vertebrate species, which in human and rat areclustered on chromosomes 7 and 6, respectively(Simmons et al. 1985; Brooks et al. 1988; Spurr et al.1989). The functional diversity of the CYP3A sub-family is extraordinary. Over 50% of all drugs in usetoday are substrates and/or inhibitors of mammalianCYP3A enzymes. In addition to therapeutic drugs,CYP3A enzymes also are involved in the metabolismof endogenous hormones, bile acids, fungal and plantproducts, and environmental pollutants (reviewed byMaurel 1996; Thummel and Wilkinson 1998; Gu-engerich 1999). CYP3A activities thus provide abroad biochemical defense against bioaccumulationof endogenous and exogenous lipophilic compoundsto toxic levels. This further is achieved by the stra-tegic localization of CYP3A enzymes in the gastro-intestinal and respiratory tracts, which are the firsttargets for ingested and inhaled foreign compounds(De Wazier et al. 1990; Kolars et al. 1992; Anttilaet al. 1997; Celander et a1. 2000; Hegelund andCelander 2003).The CYP3A subfamily has been most thoroughly

investigated in mammals (reviewed by Maurel 1996).Catalytic and immunochemical data suggested thepresence of CYP3A-like enzymes in nonmammalianvertebrates, including fish, amphibians, reptiles, andbirds (Schuetz et al. 1992; Celander et al. 1996; Roniset al. 1998; Yawetz et al. 1998; Ertl et al. 1999). Theexistence of CYP3A gene orthologues in fish andchicken has been confirmed by recent cloning work(Celander and Stegeman 1997; Lee et al. 1998; Kull-man et al. 2000; Kullman and Hinton 2001; Ourlin etal. 2000). To date, there have been approximately 60complete or partial CYP3A cDNA sequences re-ported to the P450 nomenclature committee (listed athttp://drnelson.utmem.edu/nelsonhomepage.html).However, the current nomenclature does not reflectorthologous relationships among CYP3A genes fromdifferent animals. Multiple CYP3A genes have beenisolated from individual species, suggesting CYP3Adiversity likely includes both orthology and paralogy(Nelson et al. 1996). In a previous study, ortholo-gous relationships between certain rodent CYP3Agenes were suggested using the neighbor-joiningand maximum-parsimony methods (Celander andStegeman 1997). Overall, phylogenetic relationshipsbetween CYP3A genes have received little attention.Here we investigated CYP3 diversification further

by performing Bayesian phylogenetic analyses of43 CYP3A amino acid sequences, as well as sepa-rate analysis of subsequences involved in substraterecognition. We increased the sampling of mamma-lian CYP3A diversity and included additional

nonmammalian CYP3A sequences. Since fish andreptiles represent key branch points in vertebrateevolution, we determined and included CYP3Asequences from the teleost killifish (Fundulus hetero-clitus) and from the ball python (Python regius). Toexamine additionally the evolution of CYP3A func-tion, we combined phylogenetic analysis with statis-tical analysis of sequence divergence in the context ofthe predicted substrate recognition sites.

Materials and Methods

Animals and Sampling

Adult killifish (Fundulus heteroclitus) of both sexes, weighing about

10 g, were captured in minnow traps in salt marshes (Scorton

Creek, Cape Cod, MA). The fish were transported to the labora-

tory in Woods Hole, MA, in aerated salt water. The fish were killed

by a cervical transection, and the livers quickly dissected out, flash-

frozen, and stored in liquid nitrogen.

The ball python (Python regius) was from Arhus University in

Denmark and transported to the Department of Zoology, Gote-

borg University, Sweden. The snake, weighing 900 g, was housed in

glass terrarium (150 · 60 · 60 cm) with free access to water and a12-h light: 12-h dark photoperiod. The terrarium was equipped

with a heating lamp to provide a temperature gradient between 25

and 35�C, which allowed for behavioral thermoregulation. Thesnake appeared healthy and had fasted for more than 6 weeks

before sampling. The snake was anesthetized by an intraperitoneal

injection of 15–20 mg kg)1 sodium pentobarbital and euthanized

by a subsequent intravenous overdose injection of sodium pento-

barbital. The liver from the ball python was quickly dissected out,

flash-frozen, and stored in liquid nitrogen.

Tissue Preparation

Livers from two adult killifish of both sexes were pooled and

pulverized under liquid nitrogen. The total RNA fraction was

immediately isolated using RNA Stat-60 (Tel-Test Inc., Friends-

wood, TX). The poly(A)+ mRNA fraction was subsequently iso-

lated using the minioligo(dT) cellulose spin column kit (5¢fi3¢Prime Inc., Boulder, CO).

The liver from the ball python was homogenized and the total

RNA fraction was isolated using the TRI reagent (Sigma–Aldrich

Chemicals, Stockholm, Sweden).

Liver microsomes from killifish and ball python were isolated

and Western blot analysis of CYP3A immunoreactive proteins was

performed as described by Celander et al. (1996).

Isolation of Killifish CYP3A30 cDNA

Isolation of a 400-bp partial killifish hepatic CYP3A30 cDNA se-

quence, corresponding to amino acids 313 to 436, using reverse

transcriptase polymerase chain reaction (RT-PCR) has been de-

scribed elsewhere (Celander and Stegeman 1997). The complete

killifish CYP3A30 sequence was isolated in two fragments using a

rapid amplification of cDNA ends (RACE) approach, according to

the Marathon RACE procedure (Clontech Laboratories Inc., Palo

Alto, CA), the internal CYP3A30 gene specific primers (GSP) listed

in Table 1. The RACE reactions were carried out using a touch-

down protocol with the following profile: initial melting at 94�C for30 s followed by 5 cycles at 94�C for 5 s and 72�C for 4 min, 5 cyclesat 94�C for 5 s and 70�C for 4 min, followed by 25 cycles at 94�C

201

for 5 s and 68�C for 4 min, all concluded by an extension at 68�Cfor 5 min. The RACE reactions were conducted in two separate

reaction mixtures using 0.75 lg poly(A)+ killifish liver mRNA astemplate, the 3A30 GSP forward 3¢2 primer for the 3¢-end RACEreaction and the 3A30 GSP reverse 5¢10 primer for the 5¢-endRACE reaction. Nested PCR was subsequently performed for each

RACE reaction using the 3A30 GSP forward 3¢17 and the 3A30GSP reverse 5¢9 primers and the touchdown PCR profile describedabove. The RACE products were separated from agarose using the

Gene-Clean kit (Bio 101, Inc., Carlsbad, CA) and cloned into the

pGEM T-easy vector system (Promega, Madison, WI). Plasmid

DNA from four separate clones from each RACE reaction was

isolated using the maxi-prep boiling method (Sambrook et al.

1989). Plasmid DNA was sequenced using a LI-COR 4000 se-

quencer (LI-COR, Inc., Lincoln, NE) and the SequiTherm EXCEL

Long Read DNA-Sequencing Polymerase (Epicentre Technologies,

Madison, WI).

For confirmation, the complete coding sequence (cds) of the

killifish CYP3A30 was subsequently obtained in one fragment by

RT-PCR using the GeneAmp RNA PCR kit (Perkin Elmer, Ap-

plied Biosystems, Stockholm, Sweden) and the 3A30 DGP N-

terminal and C-terminal primers, listed in Table 1, as follows:

Killifish total liver RNA (1 lg) was reverse transcribed withpriming by random hexamers. Amplification was performed in the

same tube with the 3A30 N-terminal forward primer DGP Fw N-

terminal with gap, which lacks three nucleotides corresponding to

positions 13 to 15 present in all other known CYP3A cDNA se-

quences. The presence of this three nucleotide gap in the CYP3A30

gene was confirmed by the lack of PCR products using the de-

generate primer DGP N-terminal without this gap and the same

3A30 GSP Rev C-terminal primer used as the reverse primer.

Touchdown PCR was initiated by melting at 95�C for 1 min 45 sfollowed by 5 cycles of denaturation at 95�C for 5 s and annealingat 70�C for 2 min, 5 cycles of denaturation at 95�C for 5 s andannealing at 68�C for 2 min, and 35 cycles of denaturation at 95�Cfor 5 s and annealing at 65�C for 2 min, concluded by an extensionat 65�C for 2 min. The PCR product was reamplified to get de-tectable levels of CYP3A30 DNA using 35 cycles of denaturation at

95�C for 105 s, annealing at 45�C for 30 s, extension at 72�C for 30s, and an extension at 72�C for 7 min.

The CYP3A30 PCR product was separated from agarose using

the Jet-Sorb kit (Genomed, Saveen, Malmo, Sweden) and cloned

into the pGEM T-easy vector system (Promega, Scandinavian

Diagnostic Services, Falkenberg, Sweden). Plasmid DNA from five

individual clones was isolated using the QIAprep miniprep kit

(Qiagen, Merck Eurolab, Stockholm, Sweden). Sequencing was

conducted using an Alf Express II DNA automatic sequencer

(Amersham Pharmacia Biotechnology, Uppsala, Sweden), and the

thermosequenase fluorescent-labeled primer cycle sequencing kit

with 7-deaza-dGTP (Amersham Pharmacia Biotechnology). The

sequence reactions were performed using Cy5-labeled M13 forward

and reverse primers as well as a number of Cy5-labeled internal

CYP3A30 GSP primers listed in Table 1. Isolation of killifish

CYP3A56 cds is described by Hegelund and Celander (2003).

Isolation of Ball Python CYP3A42 cDNA

Degenerate primers were designed targeted to conserved regions in

chicken, fish, and mammalian CYP3A cDNA sequences (Table 1).

A 700-bp CYP3A42 cDNA sequence from ball python liver was

obtained by RT-PCR using the GeneAmp RNA PCR kit (Perkin

Elmer, Applied Biosystems). Total snake liver RNA (1 lg) was re-verse transcribed with priming by random hexamers. Amplification

was performed in the same tube with a degenerate forward primer

targeted to amino acids 183–189 and a degenerate reverse primer

targeted to amino acids 440–446 (Table 1). PCR was initiated by

melting at 95�C for 30 s followed by 35 cycles at 95�C for 105 s,42�C for 15 s, and 72�C for 30 s, all concluded by an extension at72�C for 7 min. The PCR product was reamplified to get detectablelevels of CYP3A42 DNA using 35 cycles at 95�C for 105 s, 54�C for15 s, and 72�C for 30 s and an extension at 72�C for 7 min.The PCR product was separated from agarose using the Jet-

Sorb kit (Genomed, Saveen) and cloned into the pGEM T-easy

vector system (Promega, Scandinavian Diagnostic Services). Plas-

mid DNA from five individual clones was isolated using the

QIAprep miniprep kit (Qiagen, Merck Eurolab). Sequencing was

performed using an Alf Express II DNA automatic sequencer

(Amersham Pharmacia Biotechnology), as outlined above, using

Cy5-labeled M13 primers.

Table 1. Oligonucleotides, degenerate primers (DGP), and gene-specific primers (GSP) used for reverse transcriptase–polymerase chain

reaction (RT-PCR), rapid amplification of cDNA ends (RACE), and DNA sequencing

Name/position Sequence (5¢ fi 3¢) Application

Isolation and sequencing of killifish CYP3A30 complete coding sequence (cds)

3A30 GSP Fw 3¢2 CGATGCTACCTTCCCCAACAAGGCTC 3¢-RACE3A30 GSP Fw 3¢17 GGCATCGTGATTCCAAAGGACATGGTTG 3¢-RACE3A30 GSP Rev 5¢9 GGAATCACGATGCCATTTATCTCCACGG 5¢-RACE3A30 GSP Rev 5¢10 TCTCTCAGGTTTGAACGCCTCTGGTTC 5¢-RACEDGP Fw N-terminal ATGGGTTACTTYCYITACTTIHCCSCTGAG RT-PCR

DGP Fw N-terminal with gap ATGGGTTACTTYTACTTHHCCSCTGAGACA RT-PCR cds

3A30 GSP Rev C-terminal CAAACACATCAAAATCTGCCATTTTGAC RT-PCR cds

Fw M13 Cy5-GGTAACGCCAGGGTTTTCC Sequencing

Rev M13 Cy5-GGAATTTGTGAGCGGATAACA Sequencing

3A30 GSP Fw 3¢2 Cy5-CGATGCTACCTTCCCCAACAAGGCTC Sequencing

3A30 GSP Fw 495 Cy5-GGACGAACCATTAGACCTGAAG Sequencing

3A30 GSP Rev 5¢8 Cy5-GCGGCGATGGGGAACAATCGGAG Sequencing

3A30 GSP Rev 591 Cy5-GTTGTTCAGCGAGTCGATGTCTAC Sequencing

Isolation and sequencing of ball python CYP3A42 partial sequences

DGP Fw, a.a. 183 to l89 TACAGYATGGAYGTRGTHAC RT-PCR

DGP Rev, a.a. 441 to 446 CSCATRCCRATRCAGTTYCT RT-PCR

Fw M13 Cy5-GGTAACGCCAGGGTTTTCC Sequencing

Rev M13 Cy5-GGAATTTGTGAGCGGATAACA Sequencing

202

Phylogenetic Analyses

CYP3A sequences used for phylogenetic analyses were retrieved

from GenBank by extensive BLAST searches and are listed in

Table 2. Amino acid sequences for phylogenetic analyses were

aligned using ClustalX 1.81 (Thompson et al. 1997), with manual

correction using MacClade 4.0fc4 (Maddison and Maddison 2000).

Gaps and highly divergent or ambiguous regions of the alignments

were excluded from analyses. The pufferfish CYP3B1 and CYP3B2

sequences were designated as outgroups, thus rooting the CYP3A

tree using an ancient gene duplication within the CYP3 gene

family. Two additional pufferfish sequences, CYP3A47 and CY-

P3A50P, were not included due to their poor alignment with other

CYP3A sequences. We treated rat CYP3A1 and CYP3A23 as the

same gene, in accordance with earlier reports suggesting that these

genes might represent allelic variants (Ribeiro and Lechner 1992;

Kirita and Matsubara 1993; Nagata et al. 1999). In addition, we

assumed that guinea pig CYP3A14 and CYP3A20 represented the

same gene. The alignment is available upon request.

Phylogenetic relationships of the CYP3 sequences were assessed

using a Bayesian statistical procedure, as implemented by the

computer program MrBayes (Huelsenbeck and Ronquist 2001).

MrBayes performs a Metropolis-coupled Markov chain Monte

Carlo (MC3) estimation of posterior probabilities (Shoemaker et al.

1999; Lewis 2001; Huelsenbeck et al. 2002). We performed MC3

estimation of posterior probabilities using noninformative prior

probabilities, the JTT + I + G (Jones et al. 1992) substitutionmodel with inclusion of unequal amino acid frequencies, and four

Table 2. GenBank accession numbers of cytochrome P450 (CYP) amino acid sequences used in the present study, with identity to human

CYP3A4 (= 100%)

Gene Species Accession No. Identity with human CYP3A4 (%)

CYP3A1 Rat (Rattus norvegicus) P04800 73


CYP3A3 Human (Homo sapiens) NP_000767 98

CYP3A4 Human (Homo sapiens) P08684 100


CYP3A6 Rabbit (Oryctolagus cuniculus) P11707 75


CYP3A8 Monkey (Macaca fasicularis) P33268 93


CYP3A10 Hamster (Mesocricetus auratius) Q64148 67

Cyp3a11 Mouse (Mus musculus) NP_031844 72

CYP3A12 Dog (Canis familiaris) P24463 79


CYP3A14 Guinea pig (Cavia porcellus) Q64417 72




CYP3A18 Rat (Rattus norvegicus) Q64581 68

CYP3A20 Guinea pig (Cavia porcellus) BAA08568 72

CYP3A21 Marmoset (Callithrix jacchus) D31921 89

CYP3A23 Rat (Rattus norvegicus) CAA65482 71

CYP3A24 Sheep (Ovis aries) Q29496 78

Cyp3a25 Mouse (Mus musculus) AAF15303 71

CYP3A26 Dog (Canis familiaris) AAN47145 78

CYP3A27 Rainbow trout (Oncorhynchus mykiss) O42563 54

CYP3A28 Cow (Bos taurus) P79102 72

CYP3A29 Pig (Sus scrofa) P79401 77

CYP3A30 Killifish (Fundulus heteroclitus) AAF14117 59

CYP3A31 Hamster (Mesocricetus auratius) O70537 68

CYP3A37 Chicken (Gallus gallus) CAB62060 58

CYP3A38 Medaka (Oryzias latipes) AAG35209 56

CYP3A39 Pig (Sus scrofa) BAB85669 77

CYP3A40 Medaka (Oryzias latipes) Q98T91 56


CYP3A42 Ball python (Python regius) AAG33639 57


Cyp3a44 Mouse (Mus musculus) BAB20498 69

CYP3A45 Rainbow trout (Oncorhynchus mykiss) AAK58569 54

CYP3A46 Pig (Sus scrofa) BAB85672 78

CYP3A48 Pufferfish (Fugu rubripes) PNCa 50

CYP3A49 Pufferfish (Fugu rubripes) PNCa 49

CYP3A56 Killifish (Fundulus heteroclitus) AAN38837 59

CYP3A Carp (Ctenopharyngodon idella) AAL16897 53

CYP3B1 Pufferfish (Fugu rubripes) PNCa 40

CYP3B2 Pufferfish (Fugu rubripes) PNCa 40

a Data mining discovery posted on the P450 nomenclature committee web site (http://drnelson.utmem.edu/nelsonhomepage.html)

203

incrementally heated Markov chains with different random starting

trees. The Markov chains were run for 1 million generations, with

sampling of topologies every 100 generations. Posterior probabili-

ties of topologies, clades, and parameters were estimated from the

sampled topologies after removal of MC3 burn-in.

To examine the relationship between catalytic activity and

variation in CYP3 substrate recognition sites (SRS), phylogenetic

analysis of putative SRS sequences, as suggested by Gotoh (1992),

was performed using maximum parsimony. The SRS alignment is

available upon request. We did not perform model-based phylo-

genetic analyses due to the short length of this alignment. Parsi-

mony analysis was performed using the PAUP 4.0 program

(Swofford 2000), with global rearrangements and five random se-

quence addition replicates. Confidence was assessed using 1000

bootstrap replicates under the same heuristic search strategy using

the PAUP 4.0 program (Swofford 2000).

Functional Analyses

To understand better the functional evolution of CYP3A enzymes,

we performed a functional analysis of the amino acid alignment in

the context of the hypothesized phylogenetic tree using the com-

puter program DIVERGE (Gu and Vander Velden 2002). DI-

VERGE detects site-specific changes in evolutionary rates in amino

acid sequences within a given phylogenetic tree (reviewed by

Gaucher et al. 2002). Specifically, DIVERGE detects site-specific

altered functional constraints by comparing site-specific evolu-

tionary rates among subclades within the phylogenetic tree. Sites

that have significantly different evolutionary rates among subclades

may have been subject to divergent functional evolution. We used

DIVERGE in this manner to test the null hypothesis of no changes

in site-specific evolutionary rates among CYP3A subclades and to

predict sites in the alignment having altered functional constraints.

DIVERGE measures change in site-specific evolutionary rates us-

ing the coefficient of evolutionary functional divergence (h), whereh = 0 indicates no change and values approaching h = 1 reflect

increasing functional divergence. Specifically, h measures site-

specific divergence from a homogenous G model of among-site ratevariation.

Results

The killifish CYP3A30 and CYP3A56 and the ballpython CYP3A42 sequences were deposited in Gen-Bank under accession numbers AF105068,AY143428, and AF319041, respectively. Western blotanalysis revealed the presence of two or three CYP3Aimmunoreactive proteins in liver microsomes fromkillifish and ball python (Fig. 1), which may beproducts of different CYP3A genes in these non-mammalian vertebrates.The final CYP3 amino acid alignment included

475 characters, of which 341 were parsimony infor-mative and 81 constant, after exclusion of poorlyaligned regions. There were no significant differencesin amino acid content among the sampled CYP3Agenes as indicated by v2 test. The length of the MC3

burn-in was 10,000 of 1 million generations, resultingin a sample of 9900 trees for estimation of posteriorprobabilities. Replicate analyses provided very simi-lar estimates of posterior probabilities, providing

evidence that convergence was obtained and mixingwas adequate. Overall resolution of CYP3A phylog-eny was high, as indicated by posterior probabilities(Fig. 2). Preliminary analyses of a nucleotide align-ment gave very similar results (data not shown), sowe focus our discussion on the amino acid results.The teleost, diapsid (snake and chicken), and mam-malian CYP3A sequences formed three separatesubclades, each of which was strongly supported. Theanalysis strongly supported the placement of theCYP3A phylogenetic root between the fish clade andthe diapsid + mammalian clade.Within the mammalian subtree, the ungulate +

dog and the primate CYP3A sequences each formeddistinct clades with high posterior probabilities (Fig.2), and additional support exists for their commonancestry (P= 0.94; Fig. 2). There was strong supportfor the placement of human CYP3A43 at the base ofthe primate clade. The topology and posterior prob-abilities supported common ancestry of the rabbitCYP3A6 with the primate + ungulate + dogCYP3A clade. However, the rabbit CYP3A6 was notclosely related to any of the sampled CYP3A se-quences.There were three strongly supported clades of rat,

mouse, and hamster CYP3As (Fig. 2): clade I—rat3A9 and mouse 3a13; clade II—rat 3A1/3A23 and3A2, mouse 3a11, 3a16, 3a41, and 3a44, and hamster3A31; and clade III—rat 3A18, mouse 3a25, andhamster 3A10. A fourth, strongly supported cladeconsisted entirely of guinea pig CYP3As, placed ro-bustly within the rodent CYP3A genes. However,support for placement of rat CYP3A9 and mouseCYP3a13 with the other rodent CYP3As was weak(P = 0.70). Overall, phylogenetic relationships

Fig. 1. Western blot analysis of CYP3A immunoreactive proteins

in microsomal fractions from livers from killifish and ball python,

stained with polyclonal antibodies against rainbow trout CYP3A

proteins and detected using enhanced chemoluminescence.

204

among the rodent CYP3A genes suggest gene dupli-cation events early in rodent history.The six putative substrate recognition sites (SRS 1

to SRS 6; see Fig. 4), as suggested by Gotoh (1992),of various CYP3 amino acid sequences were analyzedseparately (76 characters). Maximum parsimonyanalysis of SRS (Fig. 3) agreed with the analysis ofthe larger data set, presented above (Fig. 2). The SRStree, rooted with the pufferfish CYP3B1 and CYP3B2clade, included fish and mammalian CYP3A sub-

clades. Within the mammalian SRS subclade, therewere four clades: clade I—rat 3A9 and mouse 3a13;clade II—hamster 3A10, rat 3A18, and mouse 3a25;clade III—rat 3A1/3A23 and 3A2, mouse 3a11, 3a16,3a41, and 3a44, and hamster 3A31; and cladeIV—human 3A3, 3A4, 3A5, 3A7, and 3A43, ma-caque 3A8, and marmoset 3A21 (Fig. 3).In addition to phylogenetic analyses, we analyzed

site-specific divergence of evolutionary rates topredict sites in the amino acid sequences undergoing

Fig. 2. The phylogenetic tree with the best maximum likelihood

score found by MC3. A better tree may exist, as MC3 is a stochastic

sampling method. Bayesian posterior probabilities are superim-

posed on the tree. The tree is rooted using pufferfish CYP3B1 and

CYP3B2 sequences. Horizontal branch lengths are representative

of evolutionary change. Node labels A and B represent rodent

CYP3 subclades examined in the functional analyses using the

computer program DIVERGE.

205

divergent functional evolution. These functionalanalyses were based on pairwise comparison of fiveCYP3A subclades: fish CYP3As, artiodactyl + dogCYP3As, primate CYP3As, and two rodent CYP3Asubclades (A and B, in Fig. 2). The coefficients ofevolutionary functional divergence (h) for each pair-wise comparison are presented in Table 3. As ex-pected, there was a significant divergence in site-specific evolutionary rates between the fish CYP3Aclade and all other CYP3A clades (Table 3). Themagnitude ranged from moderate (h = 0.48), com-pared to primate CYP3As, to extreme (h = 1.00),

compared to artiodactyl + dog CYPAs. The primateCYP3A sequences appeared to have the lowestfunctional divergence, with h being insignificant forall pairwise comparisons except with fish CYP3Asequences (Table 3). All other pairwise comparisonsof h were significant, with the most notable involvingthe rodent CYP3A subclade B (Table 3). In fact, thefunctional divergence between the two rodentCYP3A subclades, A and B, was as great as thatbetween the rodent and the fish CYP3A subclades.Site-specific analysis of h revealed a nonrandom

distribution of divergent functional constraints along

Fig. 3. Most parsimonious tree for

aligned putative CYP3 substrate recogni-

tion sites (SRS). The tree is rooted using the

putative SRS of pufferfish CYP3B1 and

CYP3B2 sequences. Bootstrap values are

superimposed on the tree. Branch lengths

are meaningless.

206

the CYP3 alignment (Fig. 4). Analysis using DI-VERGE did not find evidence of functional diver-gence of three of the six substrate recognition sites(SRS): SRS 1, 5, and 6. SRS 3 and 4 exist in broaderregions of putative functional divergence, while onlya portion of SRS 2 had significant divergence of site-specific evolutionary rates. Four regions that did notinclude a SRS sequence (two of them single aminoacids between the H and the I helices) were addi-tionally predicted to have undergone functional di-vergence. We note that alignment gaps may haveplayed a role in separating regions of functional di-vergence. The magnitude of h varied among individ-ual sites in the alignment and among pairwisecomparisons, but all sites outlined in Fig. 3 had h >0.90 for comparison of the two rodent CYP3Asubclades. As closer examination of the site-specific hscores may aid the design of functional experiments,the complete set of scores for each pairwise compar-ison of CYP3A clades is available upon request.

Discussion

In this study, we performed phylogenetic analyses ofthe vertebrate CYP3 gene family. We used completeamino acid sequences as well as subsequences in-volved in substrate recognition, with considerableconsensus among the analyses. The high degree ofsequence identity among fish, snake, chicken, andmammalian CYP3A genes (Table 2) indicates that theCYP3A subfamily has been well conserved duringvertebrate evolution. However, the multiplicity ofCYP3A genes within species also shows that CYP3Afunctions may be variously distributed among para-logues. Our phylogenetic analysis emphatically illus-trates that the current nomenclature does not reflectorthologous relationships among CYP3A genes.However, we do not yet venture to propose a newnomenclature, given the current poor sampling ofmammalian CYP3 diversity.Phylogenetic analysis of CYP3 amino acid se-

quences produced a well-resolved tree with high

support of nodes throughout, as provided by pos-terior probability scores (Fig. 2). The number ofgenerations to run any Bayesian phylogenetic analy-sis is unknown (Huelsenbeck et al. 2002), but separateanalyses of our data provided very similar estimatesof posterior probabilities and they are most likelyunbiased estimates. As outlined by Huelsenbeck et al.(2002), posterior probabilities generally are higherthan nonparametric bootstrap estimates. They shouldbe interpreted as the probability that a given clade istrue, given our data and assumptions.The overall phylogenetic pattern of the CYP3A

portion of the tree is very striking, as it illustrates thatmost CYP3A diversity is the product of recent geneduplication events. The vertebrate tree suggests thatthe ancestral mammalian genome contained a singleCYP3A gene and that CYP3A diversification oc-curred via gene duplication events after the origin ofthe ungulates, rodents, and primates. Only the pri-mates and rodents exhibit evidence of gene duplica-tion events occurring prior to speciation events. Ourresults reject the null hypothesis that mammalianCYP3A diversity is the product of gene duplicationevents in early mammalian history. Similarly, post-speciation gene duplication also generated CYP3Adiversity within the teleost fish. Independent geneduplication events in each species are suggestive ofacquisition of new functions due to adaptations todifferent environments.The CYP3A phylogenetic subtrees partly mirror

vertebrate evolution in that teleost, diapsid, andmammalian CYP3A genes form distinct clades.Within the mammalian clade, rodent, ungulate, andprimate CYP3A genes form distinct lineages. Phylo-genetic placement of guinea pig within the rodentshas recently been debated (e.g., Reyes et al. 2000).There was strong support for placement of the guineapig CYP3A genes within the rodent CYP3A diversi-fication. The rabbit CYP3A6 gene was not placedwithin any of the major clades, most likely a result oflimited taxon sampling. Adding CYP3A genes fromother mammalian taxa, including nonplacental

Table 3. Tests of the null hypothesis of no change in site-specific evolutionary rates among the five largest CYP3A subclades (containing

more than two genes; see Fig. 2), as implemented by the computer program DIVERGEa

Rodent CYP3As

Fish CYP3As Artiodactyl + Dog CYP3As Primate CYP3As Subclade A Subclade B

Fish CYP3As — 1.00 ± 0.16 0.48 ±0.17 0.71 ± 0.16 0.92 ± 0.16

Artiodactyl + dog CYP3As 37.48* — 0.13 ± 0.21 0.63 ± 0.24 0.52 ± 0.20

Primate CYP3As 7.34* 0.33 — 0.33 ± 0.23 0.42 ± 0.22

Rodent CYP3As

Subclade A 19.37* 6.96* 2.03 — 0.96 ± 0.29

Subclade B 32.80* 6.66* 3.78 10.82* —

a Measures of the coefficient of evolutionary functional divergence (h) and their standard error are presented above the diagonal. Values of habove 0.50 up to 1.00 reflect increasing functional divergence. Likelihood ratio test observed values for the test of the null hypothesis of

h = 0 are presented below the diagonal. Scores with significant rejection (p < 0.05) of the null hypothesis are marked with an asterisk.

207

mammals and additional lagomorph sequences, mayimprove resolution of overall mammalian CYP3Aphylogeny.Placement of the human CYP3A43 gene at the

base of the primate clade suggests an early gene du-plication event in primate evolution. Moreover,placement of the macaque CYP3A8 sequence withthe human CYP3A3, CYP3A4, and CYP3A5 genessuggests that a portion of human CYP3A diversity isthe product of CYP3A gene duplication events thatoccurred before the origin of hominids. The diversityof the human CYP3A subfamily, as a result of geneduplication events, is supported by the clustering ofhuman CYP3A genes on chromosome 7q21-q22.1(Brooks et al. 1988; Spurr et al. 1989; Finta andZaphiropoulus 2000). Five human CYP3A sequenceshave been reported to the P450 nomenclature com-mittee: CYP3A3, CYP3A4, CYP3A5, CYP3A7, andCYP3A43. However, the human CYP3A locus con-tains only four genes, CYP3A4, CYP3A5, CYP3A7,and CYP3A43, as well as three pseudogenes, whereasa CYP3A3 gene has not been found in the vicinity ofthis locus (Gellner et al. 2001). The CYP3A3 se-quence is 98% identical to CYP3A4 and is not ex-pressed (Bork et al. 1989). In fact, it has beenproposed that CYP3A3 represents either an unusualallelic variant or a sequencing artifact (Guengerich1999). It is now believed that CYP3A3 represents atranscript variant of the CYP3A4 gene (NCBI Loc-usLink Report at www.ncbi.nlm.nih.gov:80/Locu-sLink). The close relationship of CYP3A3 andCYP3A4 is confirmed by our phylogenetic analyses.The rat, mouse, and hamster CYP3A sequences

were placed in three separate subclades (Figs. 2 and3). Origination of rodent CYP3A diversity likely in-volved a series of gene duplication events during ro-dent diversification. Phylogenetic analyses suggesttwo CYP3A gene duplication events early in rodenthistory, with the rat CYP3A9/mouse Cyp3a13 cladehaving a sister relationship to all other rodentCYP3A genes (P = 0.70; Fig. 2). Other, more recentduplications are hypothesized to have occurred in-dependently within the rat, mouse, and guinea piggenomes. This indicates that rodent CYP3A diversityconsists of both orthologous and paralogous genes.For example, Cyp3a13, 3a25, and 3a11/16/41/44 mayrepresent orthologous mouse genes and could be used

in designing new knockout models in studies of drugmetabolism. There are no guinea pig CYP3A genes inany of the major rodent subclades. Either the guineapig genome has lost genes produced by the earlierrodent gene duplication events or more guinea pigCYP3A genes have yet to be sampled.Phylogenetic diversity of CYP3A genes conceiv-

ably reflects CYP3A functional and/or regulatorydiversity. The distribution of rodent CYP3A codingsequences thus may reflect functional differencesamong these enzymes. Diversification of drug me-tabolizing CYP enzymes has been suggested to bedetermined predominantly by the six SRS and it hasbeen shown that the SRS are more variable than therest of the sequence (Gotoh 1992). The rodent clade3A10/3A18/3a25 SRSs differs from all other CYP3Asequences analyzed in T119 (SRS 1), in 1210 (SRS 2),and in A/S309 (SRS 4). Studies using site-directedmutagenesis of human CYP3A4 showed that theS119 residue in SRS 1 and the L210 residue in SRS 2are involved in substrate specificity and responsive-ness to a-naphthoflavone (Harlow and Halpert 1997;Stevens et al. 1999; Khan and Halpert 2000). Theserodent enzymes also differ from other CYP3Aisoenzymes in positions M294 and A295 in SRS 4,which generally is a conserved region that forms partof the I-helix. The rodent clade (3A9/3a13) SRS dif-fers from all other CYP3A sequences analyzed inthree positions, D/N123 (SRS 1), G371 (SRS 5), andK479 (SRS 6). Interestingly, the female dominantCYP3A9 enzyme differs in catalytic activity com-pared to the male dominant CYP3A1 and CYP3A18enzymes in rat (Jager et al. 1999). SRS 6 is believed tobe involved in substrate docking, and mutants(S478Y, L479F, and G480R) showed different cata-lytic activities compared to wild-type CYP3A4 (Khanand Halpert 2000).Statistical analysis of the CYP3 amino acid

alignment in the context of the phylogenetic treesuggests that the six SRS are not equally important tofunctional divergence and that broad regions of theprotein, comprising most of the F, G, H, and I helices(human CYP3A4 three-dimensional structure mod-eled by Szklartz and Halpert [1997]), have been underhistorical adaptive pressure (Fig. 4). Our resultssuggest that SRS 1, 5, and 6 are performing a con-served, universal CYP3A function, while SRS 2, 3,

Fig. 4. Alignment of pufferfish CYP3B1 and representatives of

the five largest CYP3A clades outlined in Fig. 2. Dots represent

identity with the pufferfish CYP3B1 sequence and dashes represent

alignment gaps. Below the alignment, asterisks represent sites with

constant amino acids in the complete 43-sequence alignment.

Similarly, colons represent sites with only conserved amino acid

substitutions in the complete 43-sequence alignment. Boxes indi-

cate the six substrate recognition sites (SRS). Shaded regions rep-

resent sites with evidence of functional divergence of CYP3A

sequences, as predicted by the computer program DIVERGE (h>0.50 for at least one of the pairwise comparisons in Table 3). The

positions of the most relevant helices and the heme-binding site are

marked under the sequences. Two regions, one at the end of the

alignment and another before SRS 4, are presented in gray letters

and were not used in either phylogenetic or functional analyses due

to poor alignment with other CYP3A sequences.

b

209

and 4 within the F, G, and I helices are involved infunctional differences among CYP3A enzymes.Comparison of functional divergence among differentCYP3A subclades predicted the same suite of aminoacids undergoing functional divergence, although themagnitude of site-specific divergence varied amongpairwise comparisons (Table 3). These sites are wor-thy of future experimental examination and may beimportant for, e.g., drug design. The very strongsignal for functional divergence between fish and allother CYP3A genes is likely a result of adaptations todifferent environmental pressures, including chemicalstressors. In contrast, the strong signal for divergencebetween the two rodent CYP3A subclades stronglysuggests that gene duplication within rodent genomesis associated with acquisition of new functions. Sincemost CYP3A diversity is the product of recent geneduplication, it is possible that independent CYP3Aenzymes in different mammals may have convergentfunction. As such, the CYP3A nomenclature shouldbe revised to reflect phylogenetic and functional re-lationships rather than similarity in sequence. In-creased sampling of CYP3 diversity and expandedfunctional investigations will shed more light on theevolution of CYP3 function and allow developmentof a stable nomenclature.

Acknowledgments. This research received financial support from

the Faculty of Science, Goteborg University, VR, to M.C.C. and

P.S., MISTRA and the Carl Trygger Foundation to M.C.C., and

the National Institutes of Health (Grant P42-ES07381) to J.J.S.

A.G.M. was supported by funds to M. Sogin from the G. Unger

Vetlesen Foundation and NASA Astrobiology Cooperative

Agreement NCC2-1054. The ball python snake was kindly pro-

vided by Dr. Tobias Wang, Arhus University, Denmark. We thank

Drs. Seth Kullman and David Hinton, Duke University, Durham,

NC, for sharing the medaka CYP3A40 sequence and Drs. Manuel

Baader and Urs Meyer, University of Basel, Basel, Switzerland, for

sharing the chicken CYP3A37 sequence. We also thank Dr. James

Halpert, University of Texas Medical Branch, Galveston, and Dr.

Michael Waterman, Vanderbilt University, Nashville, TN, for

valuable comments on the manuscript. We also are very grateful to

Drs. Sibel Karchner, Wade Powell, and Maya Said at the Woods

Hole Oceanographic Institution for helpful discussions regarding

RACE and DNA sequencing. The experiment was approved by the

Ethical Committee of Animal Research in Goteborg (license

numbers: killifish, 230/99; ball python, 101/99).

References

Anttila S, Hukkanen J, Hakkola J, Stjernvall T, Beaune P,

Edwards RJ, Boobis AR, Pelkonen O, Raunio H (1997)

Expression and localization of CYP3A4 and CYP3A5 in

human lung. Am J Respir Cell Mol Biol 16:242–249

Bork RW, Muto T, Beaune PH, Srivastava PK, Lloyd RS,

Guengerich FP (1989) Characterization of mRNA species

related to human liver cytochrome P-450 nifedipine oxidase

and the regulation of catalytic activity. J Biol Chem 264:910–

919

Brooks BA, McBride OW, Dolphin CT, Farrall M, Scambler PJ,

Gonzalez FJ, Idle JR (1988) The gene CYP3 encoding

P450PCN1 (nifedipine oxidase) is tightly linked to the gene

COL1A2 encoding collagen type 1 alpha on 7q21-q22.1. Am J

Hum Genet 43:280–284

Celander M, Stegeman JJ (1997) Isolation of a cytochrome P450

3A cDNA sequence (CYP3A30) from the marine teleost

Fundulus heteroclitus and phylogenetic analyses of CYP3A

genes. Biochem Biophys Res Commun 236:306–312

Celander M, Buhler DR, Forlin L, Goksøyr A, Miranda CL,

Woodin BR, Stegeman JJ (1996) Immunochemical relation-

ships of cytochrome P4503A-like proteins in teleost fish. Fish

Physiol Biochem 15:323–332

Celander MC, Moore MJ, Stegeman JJ (2000) Cellular locali-

zation of CYP3A proteins in various tissues from pilot

whale (Globicephala melas). Environ Toxicol Pharmacol 8:

245–253

De Waziers I, Cugnenc PH, Yang CS, Leroux J-P, Beaune PH

(1990) Cytochrome P450 isoenzymes, epoxide hydrolase and

glutathione transferase in rat and human hepatic and extrahe-

patic tissues. J Pharmacol Exper Ther 243:387–394

Ertl RP, Bandiera SM, Buhler DR, Stegeman JJ, Winston G (1999)

Immunochemical analysis of liver microsomal cytochromes

P450 of the American alligator, Alligator mississippiensis.

Toxicol Appl Pharmacol 157:157–165

Finta C, Zaphiropoulus PG (2000) The human cytochrome P450

3A locus. Gene evolution by capture of downstream exons.

Gene 260:13–23

Gaucher EA, Gu X, Miyamoto MM, Benner SA (2002) Predicting

functional divergence in protein evolution by site-specific rate

shifts. Trends Biochem Sci 27:315–321

Gellner K, Eiselt R, Hustert E, Arnold H, Koch I, Haberl M,

Deglmann CJ, Burk O, Buntefuss D, Escher S, Bishop C,

Koebe H-G, Brinkmann U, Klenk H-P, Kleine K, Meyer UA,

Wojnowski L (2001) Genomic organization of the human

CYP3A locus: Identification of a new, inducible CYP3A gene.

Pharmacogenetics 11:111–121

Gonzalez FJ (1990) Molecular genetics of the P-450 superfamily.

Pharm Ther 45:1–38

Gotoh O (1992) Substrate recognition sites in cytochrome P450

family 2 (CYP2) proteins inferred from comparative analyses of

amino acid and coding nucleotide sequences. J Biol Chem

267:83–90

Gu X, Vander Velden K (2002) DIVERGE: Phylogeny-based

analysis for functional-structural divergence of a protein family.

Bioinformatics 18:500–501

Guengerich FP (1999) CYTOCHROME P-450 3A4: Regulation

and role in drug metabolism. Annu Rev Pharmacol Toxicol

39:1–17

Harlow GR, Halpert JR (1997) Alanine-scanning mutagenesis of a

putative substrate recognition site in human cytochrome P450

3A4. J Biol Chem 272:5396–5402

Hegelund T, Celander MC (2003) Hepatic versus extrahepatic ex-

pression of CYP3A30 and CYP3A56 in adult killifish (Fundulus

heteroclitus). Aquat1 Toxicol (in press)

Huelsenbeck JP, Ronquist F (2001) MRBAYES: Bayesian infer-

ence of phylogenetic trees. Bioinformatics 17:754–755

Huelsenbeck JP, Larget B, Miller RE, Ronquist F (2002) Potential

applications and pitfalls of Bayesian inference of phylogeny.

Syst Biol 51:673–688

Jager W, Correia MA, Bornheim LM, Mahnke A, Hanstein WG,

Xue L, Benet LZ (1999) Ethynylestradiol-mediated induction of

hepatic CYP3A9 in female rats: Implication for cyclosporine

metabolism. Drug Metab Dispos 27:1505–1511

Jones DT, Taylor WR, Thornton JM (1992) The rapid generation

of mutation data matrices from protein sequences. Comput

Appl Biosci 8:275–282

210

Khan KK, Halpert JR (2000) Structure function analysis of human

cytochrome P450 3A4 using 7-alkoxycoumarins as active-site

probes. Arch Biochem Biophys 373:335–345

Kirita S, Matsubara T (1993) cDNA cloning and characterization

of a novel member of steroid-induced cytochrome P450 3A in

rats. Arch Biochem Biophys 307:253–358

Kolars JC, Schmiedlin-Ren P, Dobbins III WO, Schuetz J,

Wrighton SA, Watkins PB (1992) Heterogeneity of cytochrome

P450IIIA expression in rat gut epithelia. Gastroenterology

102:1186–1198

Kullman SW, Hinton DE (2001) Identification, characterization,

and ontogeny of a second cytochrome P450 3A gene from the

fresh water teleost medaka (Oryzias latipes). Mol Reprod Dev

58:149–158

Kullman SW, Hamm JT, Hinton DE (2000) Identification and

characterization of a cDNA encoding cytochrome P450 3A

from the fresh water teleost medaka (Oryzias latipes). Arch

Biochem Biophys 380:29–38

Lee S-J, Wang-Buhler J-L, Cok I, Yu T-S, Yang Y-H, Miranda

CL, Lech J, Buhler DR (1998) Cloning, sequencing, and tissue

expression of CYP3A27, a new member of the CYP3A sub-

family from embryonic and adult rainbow trout livers. Arch


Lewis PO (2001) Phylogenetic systematics turns over a new leaf.

Trends Ecol Evol 16:30–37

Maddison WP, Maddison DR (2000) MacClade, version 4.0b10.

Sinauer Associates, Sunderland, MA

Maurel P (1996) The CYP3 family. In: Ioannides C (ed) Cyto-

chromes P450 metabolic and toxicological aspects. CRC Press,

Boca Raton, FL, pp 241–270

Nagata K, Ogino M, Shimada M, Miyata M, Gonzalez FJ,

Yamazoe Y (1999) Structure and expression of the rat CYP3A1

gene: isolation of the gene (P450/6bB) and characterizationof the recombinant protein. Arch Biochem Biophys 362:242–

253

Nebert DW, Gonzalez FJ (1987) P450 genes: Structure, evolution,

and regulation. Annu Rev Biochem 56:945–993

Nelson DR, Koymans L, Kamataki T, Stegeman JJ, Feyereisen R,

Waxman DJ, Waterman MR, Gotoh O, Coon MJ, Estabrook

RW, Gunsalus IC, Nebert DW (1996) P450 superfamily: Up-

date on new sequences, gene mapping, accession numbers and

nomenclature. Pharmacogenetics 6:1–42

Ourlin J-C, Baader M, Fraser D, Halpert JR, Meyer UA (2000)

Cloning and functional expression of a first inducible avian

cytochrome P450 of the CYP3A subfamily (CYP3A37). Arch


Reyes A, Pesole G, Saccone C (2000) Long-branch attraction

phenomenon and the impact of among-site rate variation on

rodent phylogeny. Gene 259:177–187

Ribeiro V, Lechner MC (1992) Cloning and characterization of a

novel CYP3A1 allelic variant: Analysis of CYP3A1 and

CYP3A2 sex-hormone-dependent expression reveals that the

CYP3A2 gene is regulated by testosterone. Arch Biochem

Biophys 293:147–152

Ronis MJJ, Celander M, Badger T (1998) Cytochrome P450 en-

zymes in the kidney of the bobwhite quail (Colinus virginianus):

Induction and inhibition by ergosterol biosynthesis inhibiting

fungicides. Comp Biochem Physiol 121C:221–229

Sambrook J, Fritsch EF, Maniatis T (1989) In: Nolan C, Ferguson

M (eds) Molecular cloning, a laboratory manual, 2nd ed. Cold

Spring Harbor Laboratory Press, Cold Spring Harbor, NY

Schuetz EG, Schuetz JD, McLean Grogan W, Naray-Fejes-Toth

A, Fejes-Toth G, Raucy J, Guzelian P, Gionela K, Watlington

CO (1992) Expression of cytochrome P450 3A in amphibian,

rat and human kidney. Arch Biochem Biophys 294:206–

214

Shoemaker JS, Painter IS, Weir BS (1999) Bayesian statistics in

genetics. Trends Genet 15:354–357

Simmons DL, Lalley PA, Kasper CB (1985) Chromosomal as-

signments of genes coding for components of the mixed-func-

tion oxidase system in mice. Genetic localization of the

cytochrome P-450PCN and P-450PB gene families and the

NADPH-cytochrome P-450 oxidoreductase and epoxide hy-

dratase genes. J Biol Chem 260:515–521

Spurr NK, Gough AC, Stevenson K, Wolf CR (1989) The human

cytochrome P450 locus: Assignment to chromosome 7q22-qter.

Hum Genet 81:171–174

Stevens JC, Domanski TL, Harlow GR, White RB, Orton E,

Halpert JR (1999) Use of the steroid derivative RPR 106541 in

combination with site-directed mutagenesis for enhanced cyto-

chrome P-450 3A4 structure/function analysis. J Pharmacol

Exp Ther 290:594–602

Swofford DL (2000) PAUP*. Phylogenetic analysis using parsi-

mony (* and other methods), version 4.0. Sinauer Associates,

Sunderland, MA

Szklarz G, Halpert JR (1997) Molecular modelling of cytochrome

P450 3A4. J Comput Mol Design 11:265–272

Thompson JD, Gibson TJ, Plewiak F, Jeanmougin F, Higgins DG

(1997) The ClustalX windows interface: Flexible strategies for

multiple sequence alignment aided by quality analysis tools.

Nucleic Acids Res 24:4876–4882

Thummel KE, Wilkinson GR (1998) In vitro and in vivo drug in-

teractions involving human CYP3A. Annu Rev Pharmacol

Toxicol 38:389–430

Yawetz A, Woodin BR, Stegeman JJ (1998) Cytochromes P450 in

liver of the turtle Chrysemys picta picta and the induction and

partial purification of CYP1A-like proteins. Biochim Biophys

Acta 1381:12–26

211

Phylogenetic Analysis of the Cytochrome P450 3 (CYP3) Gene Family

Documents

Transcript of Phylogenetic Analysis of the Cytochrome P450 3 (CYP3) Gene Family