93 (2006) 104–115www.elsevier.com/locate/ydbio

Developmental Biology 2

MusTRD can regulate postnatal fiber-specific expression

Laura L. Issa 1, Stephen J. Palmer 1, Kim L. Guven, Nicole Santucci, Vanessa R.M. Hodgson,Kata Popovic, Josephine E. Joya, Edna C. Hardeman ⁎

Muscle Development Unit, Children’s Medical Research Institute, Wentworthville, NSW 2145, Australia

Received for publication 6 June 2005; revised 21 December 2005; accepted 20 January 2006Available online 21 February 2006

Abstract

Human MusTRD1α1 was isolated as a result of its ability to bind a critical element within the Troponin I slow upstream enhancer (TnIslowUSE) and was predicted to be a regulator of slow fiber-specific genes. To test this hypothesis in vivo, we generated transgenic mice expressinghMusTRD1α1 in skeletal muscle. Adult transgenic mice show a complete loss of slow fibers and a concomitant replacement by fast IIA fibers,resulting in postural muscle weakness. However, developmental analysis demonstrates that transgene expression has no impact on embryonicpatterning of slow fibers but causes a gradual postnatal slow to fast fiber conversion. This conversion was underpinned by a demonstrablerepression of many slow fiber-specific genes, whereas fast fiber-specific gene expression was either unchanged or enhanced. These data areconsistent with our initial predictions for hMusTRD1α1 and suggest that slow fiber genes contain a specific common regulatory element that canbe targeted by MusTRD proteins.© 2006 Elsevier Inc. All rights reserved.

Keywords: MusTRD; GTF2IRD1; TFII-I; Muscle fiber types; Transcription; Transgenic

Introduction

Adult skeletal muscle is a heterogeneous tissue composed ofindividual fibers with varying contraction speeds and metabolicproperties. Specification of these fiber types during muscledevelopment is thought to occur by a combination of intrinsicgenetic programming in myogenic cells (Pin et al., 2002;DiMario and Stockdale 1997) and external induction, mainlyvia signals from the contacting motoneuron or as a result ofmechanical load (reviewed in Hughes and Salinas, 1999; Pette2001). In the developing rodent embryo, there are two distinctperiods of myogenic differentiation resulting in the formation ofprimary and secondary myotubes (Ontell and Kozeka, 1984;Ontell et al., 1988; Harris et al., 1989; Duxson et al., 1989;Venuti et al., 1995). Primary myotubes initially express slowmyosin heavy chain (MyHC), whereas secondary myotubes donot (Kelly and Rubinstein 1980; Harris et al., 1989; Condon etal., 1990a,b). In muscles that retain large numbers of slow fibers

⁎ Corresponding author.E-mail address: ehardeman@cmri.usyd.edu.au (E.C. Hardeman).

1 These authors contributed equally to this work.

0012-1606/$ - see front matter © 2006 Elsevier Inc. All rights reserved.doi:10.1016/j.ydbio.2006.01.019

in adult life (e.g., soleus), most primary myotubes selectivelybecome adult slow fibers (Kelly and Rubinstein 1980; Zhangand McLennan 1998). In adult muscles that have relatively fewslow fibers, most of the primary myotubes gradually lose slowMyHC expression and can eventually contribute to all adultmyofiber types (reviewed in Gunning and Hardeman 1991;Zhang and McLennan 1998).

The ability of muscle fibers to change fiber-specific geneexpression patterns in response to environmental cues in adultlife, otherwise known as muscle plasticity, is partly controlledby signals from the contacting motor neurons. The criticalelement of this signal is related to the frequency of electricalstimulation rather than the nature of the neuron itself (Buller etal., 1960; reviewed in Pette, 2001). The pathways that transducethe signal from the motor nerve to the nucleus to induce fiberconversion remain unclear, but there is compelling evidence of arole for calcineurin (Chin et al., 1998; Dunn et al., 1999; Dellinget al., 2000, Naya et al., 2000; Serrano et al., 2001, Parsons etal., 2003). The transcription factors involved in developmentalfiber type patterning or adult muscle plasticity are also not yetestablished. However, genes of the myogenic regulatory factor(MRF) family, including myogenin and MyoD, and the MEF2

105L.L. Issa et al. / Developmental Biology 293 (2006) 104–115

family have all been implicated (Hughes et al., 1993, 1999; Wuet al., 2000, 2001). However, MEF2 and MRF factors areessential for the expression of all muscle specific genes, bothfast and slow. It is likely that other uncharacterized factors havea more direct impact on fiber-specific gene expression byworking synergistically with MEF2 and MRF family members.In this regard, the transcriptional co-activator PGC-1α wasrecently shown to be an important player since constitutiveexpression in the muscles of transgenic mice causes awidespread conversion to an oxidative metabolism (Lin et al.,2002). Other candidates that have recently emerged includeTEF-1 (Karasseva et al. 2003) Six1 and Eya1 (Grifone et al.2004) and Blimp1 for embryonic slow fiber patterning in thezebrafish (Baxendale et al. 2004).

To investigate fiber-specific gene regulation in greater detail,we have analyzed an enhancer element that controls the slowfiber-specific gene troponin I slow (TnIslow), on the assumptionthat the regulatory mechanisms that control one slow fiber-specific gene will be common to all slow fiber-specific genes.The upstream region of the TnIslow gene was examined in anextensive series of functional assays, which led to the isolationof an upstream enhancer region of the human gene (TnIslowUSE) and a slow upstream regulatory element (SURE) in the ratgene that contained the slow fiber-specific regulatory elements(Corin et al., 1995; O'Mahoney et al., 1998; Calvo et al., 1999,2001). In both studies, refined mapping narrowed the essentialcomponent to a DNA binding site resembling an initiator (Inr)-like element (O'Mahoney et al., 1998; Calvo et al., 2001). Toisolate sequence-specific DNA binding proteins that recognizethis element, the DNA fragment was used as bait in a yeast one-hybrid screen of human muscle cDNAs resulting in the isolationof a novel protein originally termed MusTRD1 (muscle TFII-Irepeat domain-containing protein 1; O'Mahoney et al., 1998),but since the isolation of various splice isoforms, now calledhMusTRD1α1. This factor was subsequently isolated in anidentical study as GTF3 (Calvo et al., 2001). hMusTRD1α1 hasbeen shown to bind to the Inr-like element of the USE in asequence-specific fashion (O'Mahoney et al., 1998; Calvo et al.,2001; Polly et al., 2003).

The gene encoding hMusTRD1α1 is termed GTF2IRD1,general transcription factor II-I repeat domain-containingprotein 1, due to its homology with the transcription factorTFII-I. HMusTRD1α1 contains five repeat domains, eachcontaining a putative helix–loop–helix motif, that shareapproximately 70% amino acid homology with those of thetranscription factor TFII-I (Roy et al., 1997), a protein that wasoriginally isolated on the basis of its ability to bind to Inrelements (Roy et al., 1991). However, experiments indicate thatTFII-I and hMusTRD1α1 have similar, but distinct, DNAbinding sites (O'Mahoney et al., 1998; Tussie-Luna et al., 2001).

To address the potential functions of hMusTRD1α1 and theimpact of this transcription factor on slow fiber-specific geneexpression patterns, we produced transgenic mice expressinghMusTRD1α1 throughout all skeletal muscle from the earlieststage of development. Adult hMusTRD1α1 transgenic micewere found to lack slow fibers in the hindlimb muscles as shownby the reduction in slow myofilament gene expression in the

expected regions. However, fetal patterning of slow fibersoccurred as normal and the loss of slow fibers was due topostnatal fiber conversion. Thus, hMusTRD1α1 can function asa repressor of slow fiber-specific genes, and the inferredMusTRD binding sites within these slow fiber-specific genesrepresent a potential common regulatory element. EnforcedhMusTRD1α1 expression has no impact on the fetal patterningphase of fiber type differentiation, suggesting that this stage iscontrolled by a different molecular mechanism.

Materials and methods

Plasmids and production of transgenic animals

The transgenic construct TnIslowUSE-95X1nucZ has been describedpreviously (O'Mahoney et al., 1998). To generate the hMusTRD1α1 transgene,the CMV promoter of pcDNA3.1+ (Clontech) was first replaced with the humanskeletal actin promoter (Brennan and Hardeman, 1993), and the full-lengthhMusTRD1α1 cDNA was inserted into the multiple cloning site between theHSA promoter and the bovine growth hormone polyadenylation site. Thetransgene constructs were isolated from the vector and microinjected intofertilized oocytes of C57BL/6 X DBA/2J F1 (designated B6D2) mice usingstandard methods (Hogan et al., 1986).

Northern blot analysis

The level of transgene expression between lines was estimated using RNAextracted from the gastrocnemius muscles of representative 8-week-old mice,and the relative levels of transgene expression in various muscle types wasestimated using pooled RNA from 3 transgenic and 3 wild-type siblings of line22. For the analysis of myofilament gene expression in muscles of transgenicmice, total RNA was extracted from pooled extensor digitorum longus (EDL)and soleus muscles isolated from the hindlimbs of five 8-week-old mice fromeach transgenic line and from five wild-type littermates. Total RNA wasextracted using the method of Chomczynski and Sacchi (1987), electrophoresedusing standard procedures (Sambrook et al., 1989) and blotted on Hybond N+membrane (Amersham Biosciences) using the manufacturer's protocol. Probeswere produced by labeling DNA fragments with [32P]-dCTP using DECApri-meII (Ambion) random primer labeling and purified with ProbeQuant G-50micro columns (Amersham Biosciences). Hybridization of probes wasperformed in Ultrahyb solution (Ambion) or the hybridization solution ofChurch and Gilbert (1984). The level of transgene expression was estimatedusing a probe made from a 300-bp BamHI fragment from the 5′ end of thehMusTRD1 cDNA. The fiber-specific gene probes have all been describedpreviously (Wade et al., 1990; Sutherland et al., 1991; Hailstones et al., 1992;Zhu et al., 1995) except for troponin T slow (TnTslow) and troponin C slow/cardiac (TnTCslow/cardiac). These were produced from RT-PCR fragmentsusing first-strand cDNA synthesized from mouse muscle RNA as a template andthe following primers: TnTslow TGACGCCAAGAAGAAGAAAG, TTGAGT-TACAGATGGGACAC; TnCslow/cardiac CAGAGGAGCAGAAGAATGAG,AAGACCAGCATCTACTCCAC. RNA loading was analyzed using an 18Sribosomal RNA probe (Sutherland et al., 1991) or the ethidium bromide stainingof 28S and 18S ribosomal RNA.

Western blot analysis

Skeletal muscle tissue was homogenized as described previously (Kee et al.,2004). The protein concentration of the homogenates was measured using aBCA protein assay kit according to the manufacturer's protocol (PierceChemical Co.). Equal volumes of protein (40 μg) were analyzed on 12% SDS-PAGE gels and protein transferred onto PVDF membranes (Millipore, Inc).Ponceau S staining of the membranes was used to determine equal loading of thesamples. Blots were blocked in 5% skim milk for 1 h at room temperature thenincubated with either polyclonal rabbit anti-manganese-superoxide dismutase(1 μg/ml; Stressgen Biotechnologies Co.) or polyclonal rabbit anti-human

106 L.L. Issa et al. / Developmental Biology 293 (2006) 104–115

myoglobin (1 μg/ml; Dako Co.) antibody for 1 h at room temperature followedby four washes with TBS/0.1%Tween20. HRP-labeled secondary antibody(BioRad) was added at 1:10,000 dilution for 1 h at room temperature. Detectionwas carried out using the SuperSignal West Pico Chemiluminescence detectionsystem (Pierce Chemical Co.) on FujiFilm RX Hyperfilm.

Developmental time-course RT-PCR analysis

Hindlimbs from prenatal mice and muscles from postnatal mice wereisolated and stored in RNAlater (Ambion Inc.), and RNA was extractedusing Tri Reagent (Sigma) according to the protocol provided. First-strandcDNA synthesis reactions were performed using 1 μg of total RNA, oligo(dT) primer (Promega), and M-MLV reverse transcriptase (Promega). Controlreactions containing no reverse transcriptase were set up concurrently. PCRreactions were performed using the synthesized cDNA as template and thefollowing primers: GAPDH GACAAAATGGTGAAGGTCGG, TGGCATG-GACTGTGGTCATG; Gtf2ird1 TACAGCACTTCGATGCCCAACCAC,GATCCCACTTCTCTGACTTGTCATG; hMusTRD1α1 transgene transcriptCAAGAGAAAGCGGGTCTCGG, AGAAGGCACAGTCGAGGCTG; TnI-slow CGGAAGTTGAGAGGAAATCC, AGCGTCGAACATCTTCTTGC;and myosin light chain 2 slow (MLC2slow) CCTCGAACTCTCCAGAG-GTG, CACCTGAGGCTGTGGTTCAG.

Histochemistry and MyHC immunochemistry

Muscle samples were embedded in OCT compound (Tissue-Tek) and frozenin isopentane cooled in liquid nitrogen. Cryostat sections of varying thickness(10–20 μm) were fixed for 2 min in 2% paraformaldehyde in PBS.Immunohistochemical staining for MyHC was performed using standardmethods. Briefly, fixed sections were washed in PBS and blocked overnightin 10% goat serum in PBS. After rinsing in PBS, sections were incubated withsupernatant from hybridomas secreting antibodies against MyHC type I (BA-F8;Borrione et al., 1988), type IIA or IIB (SC-71 and BF-F3; Schiaffino et al.,1989). After 3 rinses in PBS, the sections were exposed to horseradishperoxidase-conjugated goat anti-mouse antibody (Dako) diluted 1/100 in 10%goat serum in PBS. The sections were rinsed a further 3 times and stained withDAB peroxidase substrate kit (Vector).

Homozygous TnIslowUSE-95X1nucZ transgenics (Corin et al., 1995) wereintercrossed with hemizygous hMusTRD1α1 transgenics (line 22) to produceoffspring that were all hemizygous for the TnIslowUSE-95X1nucZ reporter, halfof which also contained the hMusTRD1α1 transgene. At 17.5 dpc embryos weredissected and the tail removed for DNA genotyping and the hindlimbs frozen forcryosectioning. At 2 weeks of age, mice were sacrificed, and the soleus and EDLmuscles were collected for MyHC immunohistochemistry and detection of β-galactosidase activity.

Sections were observed using an Olympus BX50 microscope usingOlympus Uplan F1 10× (0.3), 20× (0.5), and 40× (0.75) objectives. Imageswere captured using a Spot camera (V1.4.0) and Spot software (DiagnosticInstruments). Images were edited and composed using Adobe Photoshop.

MyHC gel electrophoresis

Protein extracts from muscle tissue were made by crushing snap-frozenwhole muscles in extraction buffer (0.3 M NaCl, 150 mM NaPO4 pH 6.5,100 mM sodium pyrophosphate, 1 mM MgCl2, 10 mM EDTA, 1.4 mM β-mercaptoethanol). These samples were separated by high-resolution SDS-PAGEand silver stained as described previously (Butler-Browne and Whalen, 1984).

Fig. 1. Generation of transgenic mice expressing hMusTRD1α1 in skeletalmuscle. (A) Northern blot analysis of relative transgene expression in skeletalmuscle of the hMusTRD1α1 lines (1α1) and a wild-type control (C). RNAloading was assessed by hybridization with a probe for 18S rRNA (18S). (B)Northern blot analysis of relative transgene expression in individual musclesfrom line 22: heart, tongue (Tong), diaphragm (Dia), pectoral (Pec), quadriceps(Quad), gastrocnemius (Gas), soleus (Sol), and extensor digitorum longus(EDL). Top panel was probed for hMusTRD1α1, bottom panel showscorresponding 28S and18S rRNA bands stained with ethidium bromide. (C)Mean body weight of hMusTRD1α1 transgenic lines at 7 weeks of age. N N 20for all samples. Black bars = males, grey bars = females.

Results

Enforced expression of hMusTRD1α1 in transgenic mice

Transgenic lines were produced that express hMusTRD1α1under the control of the human skeletal actin promoter. Thispromoter directs expression from the onset of myotube

differentiation through to adult myofibers (Brennan andHardeman, 1993; Miniou et al., 1999). In this study, transgenetranscripts were detectable at 13.5 days post coitum (dpc) inRNA extracted from whole hindlimbs and gradually increasedin a pattern similar to endogenous myofilament genes (Fig. 6).Expression directed by this promoter is highly skeletal muscle-specific, although biased towards fast fibers, and low levels ofexpression can occur in the heart (Fig. 1B). Relative transgeneexpression levels were determined in the individual lines usingNorthern blot analysis of gastrocnemius muscle RNA (Fig. 1A).Line 22 had the highest level of transgene expression and wasthe primary choice for most of the studies.

The body weights of male and female transgenic mice werecompared with non-transgenic littermates at 7 weeks of age(Fig. 1C) and did not differ significantly from controls in alllines examined. Adult transgenic mice from some lines showeddetectable signs of kyphoscoliosis that could be observed from

107L.L. Issa et al. / Developmental Biology 293 (2006) 104–115

gross physical appearance and by X-ray radiography (data notshown). These mice were of normal appearance in all otherregards.

Slow fibers are lost in the hindlimbs of hMusTRD1α1 mice

MyHC isoform expression was analyzed in muscle sectionsto determine the effect of hMusTRD1α1 on fiber composition.

Fig. 2. Expression analysis of the MyHC proteins demonstrates a complete loss of sfrom an 8-week-old hMusTRD1α1 transgenic mouse (Tg) and a wild-type sibling (WTIn the transgenic section, there is a complete absence of slow fibers and a compensatormarks the boundary of the soleus muscle within each section. (B and C) Transverse sfrom a 7-week-old hMusTRD1α1 transgenic mouse (line 22) and a wild-type littermatand MyHC-IIB. In soleus muscles, the size and the fiber number do not show anymuscles, the size and fiber number are the same, but the few slow fibers normally presare replaced by IIA fibers. Calibration bars represent = 1 mm. (D) Silver stained high-ran adult heart (H), postnatal hindlimb (PN), and soleus muscles from two 7 week-old(emb) MyHC-embryonic; (neo) MyHC-neonatal; (α) MyHC-α; (I) MyHC-I; (IIA) M

Transverse sections of the lower hindlimb (crural block) from 8-week-old transgenic mice were stained using antibodies directedagainst MyHC type I (slow) and fast type IIA. The sections ofadult wild-type control animals show the expected pattern of afew scattered slow fibers throughout muscles surrounding thefibula and approximately 50% slow fibers in the soleus muscle(Fig. 2A). Fast IIA fibers are greater in number but are mostlyconcentrated in the muscles surrounding the fibula and comprise

low fibers in hMusTRD1α1 transgenic mice. (A) Near-adjacent crural sections), immunostained with antibodies against MyHC-I (slow) andMyHC-IIA (fast).y increase in MyHC-IIA fibers. (T) Tibia; (F) fibula; (S) soleus. The black outlineections cut at the midpoint of isolated soleus muscles (B) and EDL muscles (C)e. The sections are immunostained using antibodies against MyHC-I, MyHC-IIAsignificant difference, but the MyHC composition is radically altered. In EDLent in the wild type are missing in the transgenic muscle. It is assumed that theseesolution SDS-PAGE analysis of MyHC composition using protein extracts fromhMusTRD1α1 line 22 transgenic mice (1α1) and two wild-type siblings (WT).yHC-IIA; (IIX) MyHC-IIX.

Fig. 3. Most slow fiber-specific myofilament genes are repressed by theexpression of the hMusTRD1α1 transgene. (A) Northern blot analysis of RNAextracted from the soleus and EDL muscles of 7-week-old hMusTRD1α1transgenic mice (lines 22 and 42) compared to wild-type controls (WT). Probesinclude TnIslow TnTslow, TnCslow/cardiac, MLC1slow, MLC2slow; αtropomyosin slow (αTms) troponin I fast (TnIf), α tropomyosin fast (αTmf),myosin light chain 1/3 (MLC1/3), and β tropomyosin (βTm; expressed in bothfast and slow fibers). Loading was assessed using a probe for 18s rRNA (18s).(B) Western blot analysis of proteins extracted from wild-type and transgenicanterior tibialis (TA), gastrocnemius(GAS), soleus (SOL), and EDL muscles.Blots were probed with antibodies against manganese superoxide dismutase(SOD) and myoglobin (MGB).

108 L.L. Issa et al. / Developmental Biology 293 (2006) 104–115

most of the remaining 50% within the soleus. In contrast, slowfiber staining was almost completely absent in transgenichMusTRD1α1 mice (Fig. 2A). However, the number of fastIIA-positive fibers was proportionately increased such that thesoleus muscle was almost entirely composed of fast IIA fibers(Figs. 2A, B). It is also clear that the proportion of IIA fibers isgreatly increased throughout the crural muscles (Fig. 2A). Toestablish whether the apparent loss of slow fibers was due to areduction in muscle size or fiber numbers, individual soleus andEDL muscles were dissected from 7-week-old mice, cut at themidpoint, sectioned, and the fiber types determined. Thediameter of the soleus and EDL muscles and the numbers offibers they contained were indistinguishable between thehMusTRD1α1 mice and their wild-type siblings (Figs. 2B, Cand data not shown). However, the soleus muscles from thetransgenic animals were almost entirely composed of fast IIAfibers and contained very fewMyHC-I-positive fibers (Fig. 2B).The number of slow fibers in the EDL muscle is normally quitelow (approximately 5%) as seen in the wild-type control, butthese fibers were not seen in the EDL sections from thehMusTRD1α1 mice (Fig. 2C). The relative proportions of fastIIA and fast IIB fibers in the EDL appeared to be unaffected bythe expression of the transgene (Fig. 2C).

As an independent assessment of myosin heavy chainisoform expression, protein extracts of soleus muscles frommice at 7 weeks post partum were analyzed by high-resolutionSDS-PAGE followed by silver staining (Fig. 2D). As expected,the soleus muscles of wild-type mice contained MyHC-IIA,MyHC-IIX, and MyHC-I. MyHC-IIX is often found in thesoleus muscle of younger mice and gradually disappears withage (Agbulut et al., 2003), which explains the presence of thisband in the wild-type sample. In contrast, protein extracts fromhMusTRD1α1 soleus muscles contained decreased levels ofMyHC-I and increased intensity of a band corresponding toMyHC-IIA. However, because this band was relatively intense,it is possible that small amounts of MyHC-IIX and neonatalMyHC may also have co-migrated with MyHC-IIA. Minorbands corresponding to embryonic MyHC and α-cardiac MyHCwere also detected.

hMusTRD1α1 specifically represses the expression of slowfiber-specific genes

Immunohistochemistry analysis of MyHC expression inhMusTRD1α1 transgenic mice demonstrated a specific repres-sion of MyHC-I. To test whether other slow fiber-specific geneshad been similarly affected, representative genes wereexamined by Northern analysis using RNA extracted fromtransgenic and wild-type soleus and EDL muscles (Fig. 3A).Transcripts encoding TnIslow, TnTslow, TnCslow/cardiac,MLC1slow, MLC2slow, and α-tropomyosin slow were onlydetectable in the soleus muscle extracts due to their slow fiberspecificity. With the exception of MLC2slow, all of the slowfiber-specific genes showed reduced expression in the soleusmuscles of two different transgenic lines. The levels of mRNAencoding the corresponding fast fiber-specific isoforms fromthese gene families showed evidence of upregulation in

response to expression of the transgene, particularly in line22, which is the highest expressing hMusTRD1α1 transgenicline.

In contrast, levels of myoglobin and superoxide dismutase,as examples of metabolic enzymes involved in oxygen uptakeand mitochondrial function, show no detectable differencebetween the transgenic and the wild-type samples (Fig. 3B).This is not surprising since the metabolism of slow fibers andfast IIa fibers is similar.

Repression of TnIslow by hMusTRD1α1 occurs through theUSE

To determine if repression of TnIslow is mediated via theregion of the TnIslow gene that contains the MusTRD binding

109L.L. Issa et al. / Developmental Biology 293 (2006) 104–115

site, hMusTRD1α1 mice were mated with a transgenic lineexpressing β-galactosidase under the control of the TnIslowUSE (Fig. 4A; Corin et al., 1995; O'Mahoney et al., 1998). Insections of isolated soleus muscle from TnIslowUSE-95X1nucZ mice, transgenic β-galactosidase reporter expres-sion was restricted to fibers containing MyHC-I as reportedpreviously (Figs. 4B, D). However, in sections of the soleusmuscle from mice hemizygous for the hMusTRD1α1 transgeneand the TnIslowUSE-95X1nucZ reporter, the number ofmyonuclei containing β-galactosidase were reduced (Figs.4C, E). To address this question quantitatively, reporter activitywas measured using a luminescent β-galactosidase assay onprotein extracts from soleus and EDL muscles sampled from 7different mice (Fig. 4F). Double hemizygous hMusTRD1α1/TnIslowUSE-95X1nucZ mice had approximately half the levelof β-galactosidase activity in the soleus muscles comparedwith littermates hemizygous for the TnIslowUSE-95X1nucZreporter alone. Endogenous TnIslow is expressed in alldeveloping muscle fibers (Sutherland et al. 1991, 1993;Calvo et al. 1999). To address whether the activity of theUSE reporter transgene is influenced by the embryonicexpression of hMusTRD1α1, crural sections from 17.5 dpctransgenic animals were stained for β-galactosidase activity(Figs. 4G, H). It was determined that hMusTRD1α1 expressionhad no effect on USE activation in the hindlimb muscles duringlate fetal development.

hMusTRD1α1 does not impact on the developmentalpatterning of fiber type

In order to understand the ontogeny of the slow fiber loss inhMusTRD1α1 transgenics, fiber types were examined usingimmunohistochemistry on crural sections from mice ranging inage from 2 days to 6 weeks post partum (Fig. 5). At 2 days afterbirth, the wild-type crural sections showed numerous MyHC-I-positive fibers in the majority of muscles including the soleusmuscle, which had approximately 50% positive fibers. Over thenext 4–6 weeks, the number of slow fibers in muscles other thanthe soleus gradually decreased until the adult pattern wasachieved at approximately 6 weeks. In the hMusTRD1α1transgenic animals, the distribution and numbers of slow fibersin the crural block were indistinguishable from the wild type atday 2 after birth. However, between 1 and 4 weeks, the numberof MyHC-I-positive fibers and the intensity of stainingdiminished throughout the crural muscles until, at 6 weeksvirtually no MyHC-I fibers could be seen (Fig. 5).

The onset of MyHC-IIA expression was also monitored.MyHC-IIA, MyHC-IIB, and MyHC-IIX are not expressed inthe distal hindlimb until after birth whereupon they graduallyreplace neonatal MyHC and also MyHC-I in most cruralmuscles (Agbulut et al., 2003; Lu et al., 1999). As expected,MyHC-IIA was not detectable by immunohistochemistry at 2days post partum in either wild-type or transgenic cruralmuscles. However, at 1 week after birth, MyHC-IIA-positivestaining was weakly detectable in crural sections of the wild-type and hMusTRD1α1 animals (Fig. 5), suggesting that theonset and patterning of MyHC-IIA expression was unaffected

by the presence of the transgene. By 2 weeks after birth,numerous strongly positive fast IIA fibers could be seen in thewild-type sections, particularly in the soleus where approxi-mately 50% of fibers were stained (Fig. 5). In thehMusTRD1α1 mice at 2 weeks, the number of fast IIA fiberswas noticeably increased above normal levels such that nearlyall fibers in the soleus showed some positive staining (Fig. 5)albeit at a variable intensity. Based on the comparisons withadjacent sections stained with MyHC-I, the more weaklystaining fibers represent hybrid MyHC-I/MyHC-IIA fibers inthe process of conversion from slow to IIA. Between 2 weeksand 6 weeks, the number and intensity of fast IIA fibersincreased in the transgenic sections as the number and intensityof MyHC-I fibers declined.

Since fetal fiber type patterns were unaffected inhMusTRD1α1 transgenic muscles, transgene expressionduring development was analyzed by RT-PCR to ensurethat the transgene was expressed consistently. Transgenictranscripts were detectable at 13.5 dpc and increased steadilyin a pattern similar to endogenous myofilament genes. Inaddition, the levels of endogenous mouse MusTRD tran-scripts were determined using primers that detect all knownisoforms, and expression was found to peak during the latefetal stage (Gtf2ird1, Fig. 6). The levels of endogenousTnIslow and MLC2slow were also determined by RT-PCRand in agreement with previous reports, MLC2slow wasfound to have a relatively late onset of gene expression (Zhuet al. 1991; Sutherland et al. 1993). Levels of TnIslow werefound to be initially unaffected by the expression of thehMusTRD1α1 transgene, but at 3 weeks after birth, thetranscript is below detectable levels in transgenic musclesamples, and levels are clearly reduced in adult transgenicsoleus samples. In contrast, the level of MLC2slow geneexpression is not affected by the presence of hMusTRD1α1at any stage of development. These findings match resultsfrom the Northern analysis and predictions based on theimmunohistological developmental analysis.

Discussion

We have shown that the enforced expression of hMusTRD1α1in the muscle tissue of mice results in the complete loss of slowmuscle fibers. It is clear that the mechanism involved ispostnatal fiber conversion based on several observations.Firstly, at 2 days after birth, there is no detectable differencebetween the number and the distribution of slow fibers withinthe crural muscles of transgenic and wild-type mice. Between 1and 6 weeks after birth, the numbers of slow fibers decline untilno MyHC-I expressing fibers are visible. The number ofMyHC-IIA fibers increases concurrently until the soleus muscleis almost entirely composed of MyHC-IIA fibers. This effectdoes not involve any change in body weight, myofiber numberor size, or overt signs of fiber degeneration. Finally, by closeexamination of adjacent crural sections from 2- to 4-week-oldmice, it is possible to find numerous fibers that are positive forboth MyHC-I and MyHC-IIA, indicating that these are hybridfibers in the process of conversion.

110 L.L. Issa et al. / Developmental Biology 293 (2006) 104–115

Fig. 5. Slow fibers develop normally in MusTRD1α1 transgenic mice, but undergo gradual postnatal fiber conversion. Near-adjacent crural sections of wild-type miceat 2 days (2d), 1, 2, and 6 weeks (w) after birth immunostained for MyHC-I and MyHC-IIA and a similar series of sections from transgenic hMusTRD1α1 (line 22)mice. Each panel shows the soleus, outlined in black, and the surrounding muscles. Calibration bar = 1 mm and applies to all the sections in the row.

111L.L. Issa et al. / Developmental Biology 293 (2006) 104–115

Analysis of MyHC protein isoforms extracted from soleusmuscle supports the immunohistochemistry results but alsoindicates the presence of MyHC-α and embryonic MyHC.MyHC-α is normally only found in the heart, mandibular, andextraocular muscles (Schiaffino and Reggiani, 1996) and in thespindle fibers of skeletal muscle (Pedrosa et al., 1990), but hasbeen found to be expressed transiently in fibers undergoing a

Fig. 4. hMusTRD1α1 represses the TnIslowUSE in vivo. (A) Reporter construct prehMusTRD1α1 expression in vivo. The construct contains a β-galactosidase cassettTnIslow upstream enhancer (USE −1035 to −875), the TnIslow minimal promoteruntranslated region (TK). (B and D) Transverse section of soleus muscle from a moMyHC-I and histochemically stained for β-galactosidase expression. β-GalactosidTransverse section of soleus muscle from a mouse hemizygous for TnIslowUSE-95Xand β-galactosidase activity. (F) Histograms of β-galactosidase activity in extracts frtransgene only (black bars) or both the reporter transgene and the hMusTRD1α1 transthe contralateral muscle in the panels above. (G and H) Crural sections from 17.5 dpContains the reporter only, and (H) contains the reporter and the hMusTRD1α1 tran

fast to slow transition in experimental models (Peuker et al.,1999). Therefore, it is possible that MyHC-α is expressedtransiently during this experimentally induced form of slow tofast conversion. The presence of MyHC-embryonic is usuallytaken as an indicator of muscle regeneration. However, sectionsof hMusTRD1α1 transgenic muscle did not show typicalindicators of regeneration including activated macrophages or

sent in the TnIslowUSE-95X1nucZ transgenic mice used to assess the effect ofe with a nuclear localization signal (nls-LacZ) under the control of the human(-95) attached to the first non-coding exon (Ex1) and the thymidine kinase 5′use hemizygous for the TnIslowUSE-95X1nucZ transgene immunostained forase expression is found exclusively in nuclei within slow fibers. (C and E)1nucZ and hMusTRD1α1 demonstrating the inhibition of both MyHC-I stainingom soleus and EDL muscles of individual mice containing the reporter cassettegene (grey shaded bars). *Indicates readings from the mice used for sectioning ofc mice containing the reporter transgene stained for β-galactosidase activity. (G)sgene.

Fig. 6. The hMusTRD1α1 transgene is expressed from the onset of muscledifferentiation and endogenous MusTRD (Gtf2ird1) peaks during late fetaldevelopment. RT-PCR analysis using RNA extracts from embryonic hindlimbsor post natal muscles. Time points include 13.5 dpc, 15.5 dpc, 17.5 dpc,newborn (NB), 3 weeks (3W) and 8 weeks (adult; soleus (SOL), EDL). Primerpairs span introns in all cases except for the intronless transgenic construct,where potential contamination from genomic DNAwas ruled out by comparisonwith no reverse transcriptase controls (data not shown).

112 L.L. Issa et al. / Developmental Biology 293 (2006) 104–115

fibers with centralized nuclei (data not shown). It is possible thatthe MyHC-embryonic expression is a reaction to the acuterepression of MyHC-I created in these mice.

These data position hMusTRD1α1 as an attractive candidatemolecule for the control of fiber type specification. The simplest

Fig. 7. Possible model of MusTRD function in TnIslow regulation and proposed mechline) contains conserved E-Box, MEF2, and CACC-Box consensus sequences in the rea loss of slow fiber-specific gene expression (Corin et al., 1995; O'Mahoney et alexpressed strongly during early myotube formation and binds to the Inr-like elemencombination with unknown patterning factors. As muscle fibers mature, MusTRD lespecific maintenance factors. Enforced transgenic expression of MusTRD during ad

hypothesis would invoke hMusTRD1α1 expression in fastfibers, thus repressing slow fiber gene expression. However,Gtf2ird1 transcript levels are very low in adult mouse skeletalmuscle, and differences in levels of expression between fast andslow muscles are very minor (Calvo et al., 2001; Tay et al.,2003); although, it is possible that isoform differences create adeeper complexity (Tay et al., 2003; Vullhorst and Buonanno,2003). Calvo et al. (2001) demonstrated that expression ofmouse Gtf2ird1 in muscle was strongest during fetal andregenerative myogenesis and made the alternative suggestionthat hMusTRD1α1 played a role in the fetal program of fiber-specific gene expression, setting up a “molecular memory” thatpersists into adulthood. However, we have shown that enforcedexpression of the hMusTRD1α1 transgene during muscledevelopment does not appear to disrupt the fetal patterningprogram. An alternative possibility is that the fetal pattern offiber-specific gene expression is set up by other factors acting ondifferent sites, while MusTRD proteins facilitate this process byoccupation of the Inr-like binding site. Enforced transgenicexpression during this period may have no effect since MusTRDproteins are already abundant. Once the myofibers begin tomature and a pattern is established, MusTRD levels drop,exposing the Inr-like element to factors that are critical for thesubsequent process of remodeling and adult maintenance,modulated by signals originating at the motor neuron (see Fig.7). Enforced transgenic expression during this period would

anism for repression in the transgenic mice. The TnIslow USE (horizontal blacklative order shown. Deletion or mutation of the Inr-like (INR-L) element leads to., 1998; Calvo et al., 1999, 2001), demonstrating its central role. MusTRD ist to facilitate the establishment of the embryonic program of gene activation invels decline, exposing the Inr-like element to regulatory control by adult fiber-ult life leads to displacement of these factors, resulting in gene silencing.

113L.L. Issa et al. / Developmental Biology 293 (2006) 104–115

have a severe impact due to the displacement of the maintenancefactors.

The experimental use of the hMusTRD1α1 transgenic micepresents a unique opportunity to analyze slow fiber-specificgene regulation at the molecular level and increases ourunderstanding of the key elements within the slow fiber-specific gene enhancers. hMusTRD1α1 was isolated on thebasis of its ability to bind specifically to the Inr-like sequencewithin the TnIslow USE, which is critical for slow fiber-specificexpression (O'Mahoney et al., 1998; Calvo et al., 2001; Polly etal., 2003). hMusTRD1α1 has also been shown to act as arepressor, most likely through interactions with proteins that areassociated with chromatin organization and can directly repressthe TnIslow USE in cell culture assays (Polly et al., 2003; Calvoet al., 2001; Tussie-Luna et al., 2002a,b). Therefore, it isunsurprising to find that enforced muscle expression ofhMusTRD1α1 represses a LacZ reporter transgene driven bya promoter/enhancer containing the human TnIslow USE.Furthermore, hMusTRD1α1 expression leads to repression ofthe endogenous mouse TnIslow gene, together with all otherslow fiber-specific genes tested, with the exception ofMLC2slow. Although it is impossible to rule out the possibilityof an indirect mechanism, it is much more likely, given theavailable evidence, that hMusTRD1α1 binds directly to the Inrelement within the TnIslow USE as well as other DNA bindingsites within other slow fiber-specific genes and represses theirexpression. This model predicts, therefore, that all slow fiber-specific genes, with the exception of MLC2slow, contain acommon slow fiber-specific regulatory element that can bedirectly recognized and repressed by hMusTRD1α1. The lackof impact on the MLC2slow gene suggests that the regulatorymechanism that controls the expression of this gene in skeletalmuscle differs from other slow fiber-specific genes. It isinteresting to note that MLC2slow is unusual in that, unlikeother slow fiber-specific genes, it is not expressed in newlyformed myotubes (Zhu et al. 1991; Sutherland et al. 1993), andthe later onset of expression correlates with the establishment ofmature innervation patterns. Therefore, slow fiber-specificexpression of this gene may be primarily regulated via theCACC box andMEF2 binding sites as has been proposed (Esseret al. 1999) and excluded from the regulatory system underexamination in this study.

Fast fiber-specific genes showed evidence of upregulation inresponse to the expression of the hMusTRD1α1 transgene. Thisis most likely due to a compensatory response caused by the lossof slow fiber-specific gene expression. MyHC-IIA expression isgreatly enhanced in the soleus muscle of transgenic mice, but therelative proportions of MyHC-IIA and MyHC-IIB in EDLmuscles are similar to wild type. Therefore, it is unnecessary toinvoke a direct effect of the transgene on fast fiber-specific geneexpression, but it remains a possibility.

The hMusTRD1α1 transgene had no impact on fetal fibertype patterning, as shown by MyHC-I staining, USE-LacZpatterns, and the RT-PCR results, in spite of the demonstrableexpression of the transgene from the beginning of muscledifferentiation. This implies that the embryonic and postnatalregulatory mechanisms that control slow fiber-specific gene

expression differ at the molecular level. This fits with a growingbody of evidence in support of a dual differentiation programfor fiber type, involving the establishment of a basic embryonicpattern, followed by a perinatal remodeling program that adaptsthe basic pattern in response to various cues. Recent work hasshown that calcineurin is necessary for the maintenance of slowmuscle fibers in adults but plays no part in their embryonicpatterning (Oh et al., 2005). In rodents and chicks, subpopula-tions of embryonic myoblasts have been shown to have arestricted fate prior to myotube formation (Pin et al., 2002;DiMario and Stockdale, 1997), and the process of primary andsecondary myogenesis establishes two molecularly distinct setsof myotubes that have differing fate potential (Kelly andRubinstein 1980; Harris et al., 1989; Duxson et al., 1989; Venutiet al., 1995; Zhang and McLennan 1998). Furthermore, work inthe zebrafish has begun to reveal a mechanism for fast and slowmuscle fiber formation that relies on patterning of the myoblastpopulation by sonic hedgehog signals emanating from thenotochord (Currie and Ingham 1996; Blagden et al., 1997; Royet al., 2001) and involves the transcription factor Blimp1(Baxendale et al., 2004). Ultimately, these data must beintegrated with the large body of literature that demonstratesthe vital role of the motor neuron in the later fetal stages of fibertype specification (Condon et al., 1990a,b; Fredette andLandmesser 1991; Wilson and Harris 1993; Ashby et al.,1993) and the ongoing control of muscle plasticity in the adult(reviewed in Gundersen 1998; Pette, 2001).

Acknowledgments

We thank Prof. Peter Rowe and Peter Gunning for the criticalreview of the manuscript, Gillian Butler-Browne and CarolynSewry for the critical evaluation of the data, and Luana Ferrara,Eric Chen, Wendy Thornton, and the support staff from theCMRI Biofacility. This work was supported by an NHMRCgrant to ECH.

References

Agbulut, O., Noirez, P., Beaumont, F., Butler-Browne, G., 2003. Myosin heavychain isoforms in postnatal muscle development of mice. Biol. Cell 95,399–406.

Ashby, P.R., Wilson, S.J., Harris, A.J., 1993. Formation of primary andsecondary myotubes in aneural muscles in the mouse mutant peronealmuscular atrophy. Dev. Biol. 156, 519–528.

Baxendale, S., Davison, C., Muxworthy, C., Wolff, C., Ingham, P.W., Roy, S.,2004. The B-cell maturation factor Blimp-1 specifies vertebrate slow-twitchmuscle fiber identity in response to Hedgehog signaling. Nat. Genet. 36,88–93.

Blagden, C.S., Currie, P.D., Ingham, P.W., Hughes, S.M., 1997. Notochordinduction of zebrafish slow muscle mediated by Sonic hedgehog. GenesDev. 11, 2163–2175.

Borrione, A.C., Zanellato, A.M., Saggin, L., Mazzoli, M., Azzarello, G.,Sartore, S., 1988. Neonatal myosin heavy chains are not expressed in Ni-induced rat rhabdomyosarcoma. Differentiation 38, 49–59.

Brennan, K.J., Hardeman, E.C., 1993. Quantitative analysis of the human alpha-skeletal actin gene in transgenic mice. J. Biol. Chem. 268, 719–725.

Buller, A.J., Eccles, J.C., Eccles, R.M., 1960. Interactions between motoneur-ones and muscles in respect of the characteristic speeds of their responses.J. Physiol. 150, 417–439.

114 L.L. Issa et al. / Developmental Biology 293 (2006) 104–115

Butler-Browne, G.S., Whalen, R.G., 1984. Myosin isozyme transitionsoccurring during the postnatal development of the rat soleus muscle. Dev.Biol. 102, 324–334.

Calvo, S., Venepally, P., Cheng, J., Buonanno, A., 1999. Fiber-type-specifictranscription of the troponin I slow gene is regulated by multiple elements.Mol. Cell. Biol. 19, 515–525.

Calvo, S., Vullhorst, D., Venepally, P., Cheng, J., Karavanova, I., Buonanno, A.,2001. Molecular dissection of DNA sequences and factors involved in slowmuscle-specific transcription. Mol. Cell. Biol. 21, 8490–8503.

Chin, E.R., Olson, E.N., Richardson, J.A., Yang, Q., Humphries, C., Shelton,J.M., Wu, H., Zhu, W., Bassel-Duby, R., Williams, R.S., 1998. Acalcineurin-dependent transcriptional pathway controls skeletal musclefiber type. Genes Dev. 12, 2499–2509.

Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation byacid guanidinium thiocyanate–phenol–chloroform extraction. Anal. Bio-chem. 162, 156–159.

Church, G.M., Gilbert, W., 1984. Genomic sequencing. Proc. Natl. Acad. Sci.U. S. A. 81, 1991–1995.

Condon, K., Silberstein, L., Blau, H.M., Thompson,W.J., 1990a. Differentiationof fiber types in aneural musculature of the prenatal rat hindlimb. Dev. Biol.138, 275–295.

Condon, K., Silberstein, L., Blau, H.M., Thompson, W.J., 1990b. Developmentof muscle fiber types in the prenatal rat hindlimb. Dev. Biol. 138, 256–274.

Corin, S.J., Levitt, L.K., O'Mahoney, J.V., Joya, J.E., Hardeman, E.C., Wade, R.,1995. Delineation of a slow-twitch-myofiber-specific transcriptional elementby using in vivo somatic gene transfer. Proc. Natl. Acad. Sci. U. S. A. 92,6185–6189.

Currie, P.D., Ingham, P.W., 1996. Induction of a specific muscle cell type by ahedgehog-like protein in zebrafish. Nature 382, 452–455.

Delling, U., Tureckova, J., Lim, H.W., De Windt, L.J., Rotwein, P., Molkentin,J.D., 2000. A calcineurin-NFATc3-dependent pathway regulates skeletalmuscle differentiation and slow myosin heavy-chain expression. Mol. Cell.Biol. 20, 6600–6611.

DiMario, J., Stockdale, F., 1997. Both myoblast lineage and innervationdetermine fiber type and are required for expression of the slow myosinheavy chain 2 gene. Dev. Biol. 188, 167–180.

Dunn, S.E., Burns, J.L., Michel, R.N., 1999. Calcineurin is required for skeletalmuscle hypertrophy. J. Biol. Chem. 274, 21908–21912.

Duxson, M.J., Usson, Y., Harris, A.J., 1989. The origin of secondary myotubesin mammalian skeletal muscles: ultrastructural studies. Development 107,743–750.

Esser, K., Nelson, T., Lupa-Kimball, V., Blough, E., 1999. The CACC box andmyocyte enhancer factor-2 sites within the myosin light chain 2 slowpromoter cooperate in regulating nerve-specific transcription in skeletalmuscle. J. Biol. Chem. 274, 12095–12102.

Fredette, B.J., Landmesser, L.T., 1991. A reevaluation of the role of innervationin primary and secondary myogenesis in developing chick muscle. Dev.Biol. 143, 19–35.

Grifone, R., Laclef, C., Spitz, F., Lopez, S., Demignon, J., Guidotti, J.E.,Kawakami, K., Xu, P.X., Kelly, R., Petrof, B.J., Daegelen, D., Concordet,J.P., Maire, P., 2004. Six1 and Eya1 expression can reprogram adultmuscle from the slow-twitch phenotype into the fast-twitch phenotype.Mol. Cell. Biol. 24, 6253–6267.

Gundersen, K., 1998. Determination of muscle contractile properties: theimportance of the nerve. Acta Physiol. Scand. 162, 333–341.

Gunning, P., Hardeman, E., 1991. Multiple mechanisms regulate muscle fiberdiversity. FASEB J. 5, 3064–3070.

Hailstones, D., Barton, P., Chan-Thomas, P., Sasse, S., Sutherland, C.,Hardeman, E., Gunning, P., 1992. Differential regulation of the atrialisoforms of the myosin light chains during striated muscle development.J. Biol. Chem. 267, 23295–23300.

Harris, A.J., Duxson, M.J., Fitzsimons, R.B., Rieger, F., 1989. Myonuclearbirthdates distinguish the origins of primary and secondary myotubes inembryonic mammalian skeletal muscles. Development 107, 771–784.

Hogan, B., Constantini, F., Lacy, E., 1986. Manipulating the Mouse Embryo.Cold Spring Harbor Laboratory Press, Cold Spring Harbor.

Hughes, S.M., Salinas, P.C., 1999. Control of muscle fiber and motoneurondiversification. Curr. Opin. Neurobiol. 9, 54–64.

Hughes, S.M., Taylor, J.M., Tapscott, S.J., Gurley, C.M., Carter, W.J., Peterson,C.A., 1993. Selective accumulation of MyoD and myogenin mRNAs in fastand slow adult skeletal muscle is controlled by innervation and hormones.Development 118, 1137–1147.

Hughes, S.M., Chi, M.M., Lowry, O.H., Gundersen, K., 1999. Myogenininduces a shift of enzyme activity from glycolytic to oxidative metabolism inmuscles of transgenic mice. J. Cell Biol. 145, 633–642.

Karasseva, N., Tsika, G., Ji, J., Zhang, A., Mao, X., Tsika, R., 2003.Transcription enhancer factor 1 binds multiple muscle MEF2 and A/T-richelements during fast-to-slow skeletal muscle fiber type transitions. Mol.Cell. Biol. 23, 5143–5164.

Kee, A.J., Schevzov, G., Nair-Shalliker, V., Robinson, C.S., Vrhovski, B.,Ghoddusi, M., Qiu, M.R., Lin, J.J.C., Weinberger, R., Gunning, P.W.,Hardeman, E.C., 2004. Sorting of a non-muscle tropomyosin to a novelcytoskeletal compartment in skeletal muscle results in muscular dystrophy.J. Cell Biol. 166, 685–696.

Kelly, A.M., Rubinstein, N.A., 1980. Why are fetal muscles slow? Nature 288,266–269.

Lin, J., Wu, H., Tarr, P.T., Zhang, C.Y., Wu, Z., Boss, O., Michael, L.F.,Puigserver, P., Isotani, E., Olson, E.N., Lowell, B.B., Bassel-Duby, R.,Spiegelman, B.M., 2002. Transcriptional co-activator PGC-1 alpha drivesthe formation of slow-twitch muscle fibers. Nature 418, 797–801.

Lu, B.D., Allen, D.L., Leinwand, L.A., Lyons, G.E., 1999. Spatial and temporalchanges in myosin heavy chain gene expression in skeletal muscledevelopment. Dev. Biol. 216, 312–326.

Miniou, P., Tiziano, D., Frugier, T., Roblot, N., Le Meur, M., Melki, J., 1999.Gene targeting restricted to mouse striated muscle lineage. Nucleic AcidsRes. 27, e27.

Naya, F.J., Mercer, B., Shelton, J., Richardson, J.A., Williams, R.S., Olson,E.N., 2000. Stimulation of slow skeletal muscle fiber gene expression bycalcineurin in vivo. J. Biol. Chem. 275, 4545–4548.

Oh, M., Rybkin, I.I., Copeland, V., Czubryt, M.P., Shelton, J.M., van Rooij, E.,Richardson, J.A., Hill, J.A., De Windt, L.J., Bassel-Duby, R., Olson, E.N.,Rothermel, B.A., 2005. Calcineurin is necessary for the maintenance but notembryonic development of slow muscle fibers. Mol. Cell. Biol. 25,6629–6638.

O'Mahoney, J.V., Guven, K.L., Lin, J., Joya, J.E., Robinson, C.S., Wade, R.P.,Hardeman, E.C., 1998. Identification of a novel slow-muscle-fiber enhancerbinding protein, MusTRD1. Mol. Cell. Biol. 18, 6641–6652.

Ontell, M., Kozeka, K., 1984. The organogenesis of murine striated muscle: acytoarchitectural study. Am. J. Anat. 171, 133–148.

Ontell, M., Bourke, D., Hughes, D., 1988. Cytoarchitecture of the fetal murinesoleus muscle. Am. J. Anat. 181, 267–278.

Parsons, S.A., Wilkins, B.J., Bueno, O.F., Molkentin, J.D., 2003. Alteredskeletal muscle phenotypes in calcineurin Aalpha and Abeta gene-targetedmice. Mol. Cell. Biol. 23, 4331–4343.

Pedrosa, F., Soukup, T., Thornell, L.E., 1990. Expression of an alpha cardiac-likemyosin heavy chain in muscle spindle fibers. Histochemistry 95, 105–113.

Pette, D., 2001. Historical Perspectives: plasticity of mammalian skeletalmuscle. J. Appl. Physiol. 90, 1119–1124.

Peuker, H., Conjard, A., Putman, C.T., Pette, D., 1999. Transient expression ofmyosin heavy chain MHCI alpha in rabbit muscle during fast-to-slowtransition. J. Muscle Res. Cell Motil. 20, 147–154.

Pin, C.L., Hrycyshyn, A.W., Rogers, K.A., Rushlow, W.J., Merrifield, P.A.,2002. Embryonic and fetal rat myoblasts form different muscle fiber types inan ectopic in vivo environment. Dev. Dyn. 224, 253–266.

Polly, P., Haddadi, L.M., Issa, L.L., Subramaniam, N., Palmer, S.J., Tay, E.S.,Hardeman, E.C., 2003. hMusTRD1alpha1 represses MEF2 activation of thetroponin I slow enhancer. J. Biol. Chem. 278, 36603–36610.

Roy, A.L., Meisterernst, M., Pognonec, P., Roeder, R.G., 1991. Cooperativeinteraction of an initiator-binding transcription initiation factor and thehelix–loop–helix activator USF. Nature 354, 245–248.

Roy, A.L., Du, H., Gregor, P.D., Novina, C.D., Martinez, E., Roeder, R.G.,1997. Cloning of an inr- and E-box-binding protein, TFII-I, that interactsphysically and functionally with USF1. EMBO J. 16, 7091–7104.

Roy, S., Wolff, C., Ingham, P.W., 2001. The u-boot mutation identifies aHedgehog-regulated myogenic switch for fiber-type diversification in thezebrafish embryo. Genes Dev. 15, 1563–1576.

115L.L. Issa et al. / Developmental Biology 293 (2006) 104–115

Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning. Cold SpringHarbor Laboratory Press, Cold Spring Harbor.

Schiaffino, S., Reggiani, C., 1996. Molecular diversity of myofibrillar proteins:gene regulation and functional significance. Physiol. Rev. 76, 371–423.

Schiaffino, S., Gorza, L., Sartore, S., Saggin, L., Ausoni, S., Vianello, M.,Gundersen, K., Lomo, T., 1989. Three myosin heavy chain isoforms in type2 skeletal muscle fibers. J. Muscle Res. Cell Motil. 10, 197–205.

Serrano, A.L., Murgia, M., Pallafacchina, G., Calabria, E., Coniglio, P., Lomo,T., Schiaffino, S., 2001. Calcineurin controls nerve activity-dependentspecification of slow skeletal muscle fibers but not muscle growth. Proc.Natl. Acad. Sci. U. S. A. 98, 13108–13113.

Sutherland, C.J., Elsom, V.L., Gordon, M.L., Dunwoodie, S.L., Hardeman,E.C., 1991. Coordination of skeletal muscle gene expression occurs latein mammalian development. Dev. Biol. 146, 167–178.

Sutherland, C.J., Esser, K.A., Elsom, V.L., Gordon, M.L., Hardeman, E.C.,1993. Identification of a program of contractile protein gene expressioninitiated upon skeletal muscle differentiation. Dev. Dyn. 196, 25–36.

Tay, E.S., Guven, K.L., Subramaniam, N., Polly, P., Issa, L.L., Gunning, P.W.,Hardeman, E.C., 2003. Regulation of alternative splicing of Gtf2ird1 and itsimpact on slow muscle promoter activity. Biochem. J. 374, 359–367.

Tussie-Luna, M.I., Bayarsaihan, D., Ruddle, F.H., Roy, A.L., 2001. Repressionof TFII-I-dependent transcription by nuclear exclusion. Proc. Natl. Acad.Sci. U. S. A. 98, 7789–7794.

Tussie-Luna, M.I., Bayarsaihan, D., Seto, E., Ruddle, F.H., Roy, A.L., 2002.Physical and functional interactions of histone deacetylase 3 with TFII-I familyproteins and PIASxbeta. Proc. Natl. Acad. Sci. U. S. A. 99, 12807–12812.

Tussie-Luna,M.I., Michel, B., Hakre, S., Roy, A.L., 2002. The SUMOubiquitin-protein isopeptide ligase family member Miz1/PIASxbeta/Siz2 is atranscriptional cofactor for TFII-I. J. Biol. Chem. 277, 43185–43193.

Venuti, J.M., Morris, J.H., Vivian, J.L., Olson, E.N., Klein, W.H., 1995.Myogenin is required for late but not early aspects of myogenesis duringmouse development. J. Cell Biol. 128, 563–576.

Vullhorst, D., Buonanno, A., 2003. Characterization of general transcriptionfactor 3, a transcription factor involved in slow muscle-specific geneexpression. J. Biol. Chem. 278, 8370–8379.

Wade, R., Eddy, R., Shows, T.B., Kedes, L., 1990. cDNA sequence, tissue-specific expression, and chromosomal mapping of the human slow-twitchskeletal muscle isoform of troponin I. Genomics 7, 346–357.

Wilson, S.J., Harris, A.J., 1993. Formation of myotubes in aneural rat muscles.Dev. Biol. 156, 509–518.

Wu, H., Naya, F.J., McKinsey, T.A., Mercer, B., Shelton, J.M., Chin, E.R.,Simard, A.R., Michel, R.N., Bassel-Duby, R., Olson, E.N., Williams, R.S.,2000. MEF2 responds to multiple calcium-regulated signals in the control ofskeletal muscle fiber type. EMBO J. 19, 1963–1973.

Wu, H., Rothermel, B., Kanatous, S., Rosenberg, P., Naya, F.J., Shelton, J.M.,Hutcheson, K.A., DiMaio, J.M., Olson, E.N., Bassel-Duby, R., Williams,R.S., 2001. Activation of MEF2 by muscle activity is mediated through acalcineurin-dependent pathway. EMBO J. 20, 6414–6423.

Zhang, M., McLennan, I.S., 1998. Primary myotubes preferentially mature intoeither the fastest or slowest muscle fibers. Dev. Dyn. 213, 147–157.

Zhu, H., Garcia, A.V., Ross, R.S., Evans, S.M., Chien, K.R., 1991. Aconserved 28-base-pair element (HF-1) in the rat cardiac myosin light-chain-2 gene confers cardiac-specific and alpha-adrenergic-inducibleexpression in cultured neonatal rat myocardial cells. Mol. Cell. Biol. 11,2273–2281.

Zhu, L., Lyons, G.E., Juhasz, O., Joya, J.E., Hardeman, E.C., Wade, R., 1995.Developmental regulation of troponin I isoform genes in striated muscles oftransgenic mice. Dev. Biol. 169, 487–503.