REVIEW / SYNTHESE

Molecular methods for the diagnosis andcharacterization of Cryptococcus: a review

Jose Julio Costa Sidrim, Ana Karoline Freire Costa, Rossana Aguiar Cordeiro,Raimunda Samia Nogueira Brilhante, Fernanda Edna Araujo Moura, Debora SouzaCollares Maia Castelo-Branco, Manoel Paiva de Araujo Neto, and Marcos FabioGadelha Rocha

Abstract: Cryptococcosis is a fungal infection caused by yeasts of the genus Cryptococcus, with Cryptococcus neoformansand Cryptococcus gattii as the primary pathogenic species. This disease is a threat to immunocompromised patients, espe-cially those who have AIDS. However, the disease has also been described in healthy individuals. The tests used to iden-tify these microorganisms have limitations that make final diagnosis difficult. However, currently there are specific genesequences that can be used to detect C. neoformans and C. gattii from clinical specimens and cultures. These sequencescan be used for identification, typing, and the study of population genetics. Among the main identification techniques arehybridization, which was the pioneer in molecular identification and development of specific probes for pathogen detec-tion; PCR and other PCR-based methods, particularly nested PCR and multiplex PCR; and sequencing of specific genomicregions that are amplified through PCR, which is especially useful for diagnosis of cryptococcosis caused by unconven-tional Cryptococcus sp. Concerning microorganism typing, the following techniques have shown the best ability to differ-entiate between fungal serotypes and molecular types: PCR fingerprinting, PCR–RFLP, AFLP, and MLST. Thus, theaccumulation of data generated by molecular methods can have a positive impact on monitoring resistant strains and treat-ing diseases.

Key words: Cryptococcus, diagnosis, molecular methods.

Resume : La cryptococcose est une infection fongique causee par les levures du genre Cryptococcus, Cryptococcus neo-formans et Cryptococcus gattii constituant les deux principales especes pathogenes. Cette maladie menace les patients im-munovulnerables, specialement ceux qui sont atteints du SIDA. Cependant, cette maladie a aussi ete decrite chez desindividus consideres en bonne sante. Les tests utilises pour identifier ces microorganismes ont des limitations qui rendentle diagnostic final difficile. Cependant, on connaıt actuellement des sequences geniques specifiques qui peuvent etre utili-sees pour detecter C. neoformans et C. gattii a partir d’echantillons et de cultures cliniques. Ces sequences peuvent servira l’identification, au typage et a l’etude de la genetique de la population. Parmi les principales techniques d’identification,on retrouve l’hybridation, une des premieres a permettre l’identification moleculaire et le developpement de sondes specifi-ques pour detecter les pathogenes; la PCR et les autres methodes derives de la PCR, notamment la PCR emboıtee et laPCR multiplexe; et le sequencage de regions specifiques du genome amplifiees par PCR et qui sont particulierement utilesau diagnostic de la cryptococcose causee par les especes non conventionnelles de Cryptococcus sp. En ce qui concerne letypage de microorganismes, les techniques suivantes se sont averees les meilleures pour differencier les serotypesfongiques et les types moleculaires: l’empreinte PCR, la PCR–RFLP et la MLST. Ainsi, l’accumulation de donnees gene-rees par les methodes moleculaires peut avoir un impact positif sur le suivi des souches resistantes et dans le traitement dela maladie.

Mots-cles : Cryptococcus, diagnostic, methodes moleculaires.

[Traduit par la Redaction]

Received 6 December 2009. Revision received 16 March 2010. Accepted 6 April 2010. Published on the NRC Research Press Web siteat cjm.nrc.ca on 15 June 2010.

J.J.C. Sidrim, R.A. Cordeiro,1 R.S.N. Brilhante, and F.E.A. Moura. Specialized Medical Mycology Center, Federal University ofCeara, Rua Coronel Nunes de Melo, s/n, Rodolfo Teofilo, Fortaleza, Ceara 60430270, Brazil.A.K.F. Costa, D.S.C.M. Castelo-Branco, M.P.A. Neto, and M.F.G. Rocha. Specialized Medical Mycology Center, Federal Universityof Ceara, Rua Coronel Nunes de Melo, s/n, Rodolfo Teofilo, Fortaleza, Ceara 60430270, Brazil; Faculty of Veterinary, PostgraduateProgram in Veterinary Science, State University of Ceara, Av. Paranjana, 1700, Fortaleza, Ceara 60.740-903, Brazil.

1Corresponding author (e-mail: rossanacordeiro@ufc.br).

445

Can. J. Microbiol. 56: 445–458 (2010) doi:10.1139/W10-030 Published by NRC Research Press

IntroductionCryptococcosis is a systemic mycosis caused primarily by

fungi belonging to the Cryptococcus neoformans complex,whose members are C. neoformans and Cryptococcus gattii(Bovers et al. 2008a). Based on specific antigens of the mu-copolysaccharide capsule, subtyping data, and phylogeneticanalyses, the C. neoformans complex is divided into C. neo-formans var. grubii (serotype A), C. neoformans var. neofor-mans (serotype D), and C. gattii (serotypes B and C).Serotype AD is frequently considered a fifth serotype of thecomplex. Other rare hybrid serotypes, occurring between C.neoformans and C. gattii, such as BD and AB, have alsobeen described (Katsu et al. 2004; Lin and Heitman 2006;Bovers et al. 2008b).

Cryptococcus neoformans var. grubii is cosmopolitan, oc-curring in many environmental sources, such as accumulatedbird excreta, especially from pigeons, as well as decompos-ing vegetal matter and tree hollows (Granados and Casta-neda 2005; Costa et al. 2009). Cryptococcus neoformansvar. neoformans also occurs in many environmental sources,but is predominantly described in Europe (Martinez et al.2001). Cryptococcus gattii has been frequently described inthe literature in association with Eucalyptus spp. trees, par-ticularly in tropical and subtropical regions (Randhawa etal. 2003; Granados and Castaneda 2006). The species of theC. neoformans complex are capable of causing infection inhumans and other animals, though C. neoformans occursmore frequently in immunocompromised individuals, andthe resultant disease can be grave and potentially fatal, evenwhen treated. The species C. gattii, on the other hand, hasbeen primarily described in immunocompetent individuals(Duncan et al. 2006; Qazzafi et al. 2007; Wilbur and Hey-borne 2009).

The prevailing laboratory investigation model for crypto-coccosis is based on direct examination, fungal isolation, bi-ochemical tests, and immunodiagnosis. However, theseprocedures have limitations that can hinder the final diagno-ses (Huston and Mody 2009). Phenotypic tests, for example,are laborious, time consuming, and sometimes imprecise be-cause of the subjectivity of interpreting the results (Wenge-nack and Binnicker 2009). Semiautomated and automatedmethods for yeast identification, such as API 20C AUX andVITEK, have allowed results to be obtained within approxi-mately 72 h. However, these tests have their own limita-tions, since they depend on complementary tests forcomplete identification of the isolate (Gundes et al. 2001;Massonet et al. 2004). In immunological diagnosis, the oc-currence of false-positive results has been observed becauseof cross-reactions with rheumatoid factors, Trichosporonspp., and gram-negative rod contamination (Huston andMody 2009).

Currently, although not applied in routine diagnosis, thereare molecular methods available for the detection of specificgene sequences of the C. neoformans complex from clinicalspecimens and cultures (Paschoal et al. 2004; Bovers et al.2007). Molecular tools have high detection sensitivity andspecificity, with the potential to overcome the limitations ofconventional diagnosis, and they can be employed for iden-tification, typing, and molecular epidemiology studies(Magee et al. 2003; Leaw et al. 2006). This paper is a liter-

ature review, from a historical perspective, of the main mo-lecular tools and techniques based on DNA detection,identification, and typing of the primary agents of crypto-coccosis, obtained from clinical specimens.

Detection and identification

DNA–DNA hybridization methods andelectrokaryotyping

The hybridization of nucleic acids, a technique based onthe intrinsic complementarity property of nitrogen bases,was developed around 1975 and was one of the first meth-ods applied in molecular studies of several pathogens (Au-lakh et al. 1981; Sambrook et al. 1989). Historically, thefirst molecular studies of C. neoformans, based on the anal-ysis of DNA segments, were performed through the use ofhybridization-based methods (Aulakh et al. 1981).

DNA–DNA hybridization was a very useful method forthe development of specific probes and contributed to pio-neer studies of the main cryptococcosis pathogenic species(Aulakh et al. 1981). Particularly, the Southern blot tech-nique, which allows the identification of specific DNA frag-ments that had previously been separated in an agarose gel,is one of the main methods applied to the initial recognitionof specific genic regions of C. neoformans and C. gattii. Inthis respect, some studies are noteworthy, such as those per-formed by Restrepo and Barbour (1989), who used specificprobes for 18S and 25S genes of the ribosomal DNA(rDNA) of Saccharomyces cerevisiae. These were capableof hybridizing with homologous restriction fragmentspresent in C. neoformans DNA sequences that had previ-ously been cleaved with restriction enzymes. Additionally,other studies performed by Varma and Kwon-Chung (1989),who used a restriction enzyme cleaved mitochondrial DNAprobe to compare the restriction pattern of isolates of C.neoformans and C. gattii, were of great importance, by al-lowing observation of a high degree of heterogeneity be-tween the analyzed species.

At the end of the 1980s, the first studies on electropho-retic separation of large C. neoformans DNA moleculeswere also of great relevance. Electrokaryotyping was thepioneer technique in C. neoformans chromosome analysis.It consists of an electrophoresis technique that aims to sepa-rate large DNA fragments, through DNA reorientation in anagarose gel, under the action of alternate electric fields (Po-lacheck and Lebens 1989). This technique was originally ap-plied in S. cerevisiae chromosome separation, and since thenmany empirical protocols have been proposed to enhancethe separation of large DNA molecules. These have resultedin the formulation of different methodologies, such ascontour-clamped homogeneous electric field (CHEF) and or-thogonal field alternation gel electrophoresis, with the for-mer most commonly applied (Schwartz and Cantor 1984;Birren and Lai 1993; Herschleb et al. 2007). Polacheck andLebens (1989) were the first to visualize C. neoformans andC. gattii chromosomes, through the orthogonal field alterna-tion gel electrophoresis system, which revealed that the 2species have different numbers of chromosome bands. Per-fect et al. (1989) employed the CHEF technique, followedby blotting of the resultant chromosomes, after electropho-retic separation. These authors also subjected fungal DNA

446 Can. J. Microbiol. Vol. 56, 2010

Published by NRC Research Press

restriction fragments to the Southern blot test, which en-abled determination of restriction patterns that were charac-teristic for the serotypes of the C. neoformans complex.Electrokaryotyping is still considered a very laborious tech-nique, and nowadays its use for the study of cryptococcosisis more limited (Martins et al. 2007).

In the 1990s, DNA–DNA hybridization techniques andelectrokaryotyping were frequently used for the study ofcryptococcosis and its main causative agents. Although theyare independent methodologies, many authors chose to usethem together to increase the knowledge of C. neoformansand C. gattii, by recognizing epidemiological markers(Spitzer and Spitzer 1992) and detecting genetic diversityamong isolates (Polacheck et al. 1992; Varma and Kwon-Chung 1992; Varma et al. 1995).

For a long time, DNA–DNA hybridization techniqueswere thought to be a promising methodology to detect spe-cific sequences of the C. neoformans complex. However,these methods were expensive and laborious, since they re-quired the performance of a previous electrophoresis, prepa-ration of denaturant buffer, acquisition of nitrocellulose ornylon membrane for DNA impregnation, construction ofspecific radioactively or enzymatically marked probes, andacquisition of adequate detection equipment. Commerciallyavailable nucleic acid hybridization probes, under the brandname AccuProbes, were introduced in 1992 by Gen-Probe,Inc., for use with a limited number of fungi. At first, Accu-Probes were only available for C. neoformans. However,sale of this probe was discontinued in the mid 1990s be-cause of a lack of demand (Huffnagle and Gander 1993;Wengenack and Binnicker 2009). So now there are no specifickits or probes commercially available for detection of theC. neoformans complex through DNA–DNA hybridization.

With the emergence of alternative technologies allowingfaster and more economical diagnosis of cryptococcosis,DNA–DNA hybridization started to be more useful for thedevelopment of academic research, to determine varietiesand genotypes of the fungus obtained from different geo-graphic areas; in combination with polymerase chain reac-tion (PCR), to confirm a specific amplification product; orcombined with analysis of a restriction pattern in compara-tive studies of genomic hybridization in silico, to obtainprobes for drawing physical maps (Schein et al. 2002; Play-ford et al. 2006; Hu et al. 2008).

Currently, the Luminex xMAP technique is a molecularapproach that employs the principle of hybridization. Thistechnique uses a group of microspheres of different colorsthat can represent approximately 100 different target sequen-ces, which are interpreted through flow cytometry with spe-cific software. The detection is performed using a lowsample volume and single laboratory procedure, saving oninputs and providing greater ability to obtain faster results(Dunbar 2006). The xMAP technology has been used to de-tect fungal species, and there are now commercial kits avail-able for detection of viruses and bacteria (Bovers et al.2007). However, there are no commercial kits available fordetection of the C. neoformans complex. Thus, it is neces-sary to develop the probes to be used in advance. The com-pany that sells the necessary equipment and reagents for thismethod is Luminex Corporation (Austin, Tex., USA), andfor some countries the purchase price is still very high.

The Luminex xMAP technique presents high detectionspecificity and sensitivity and has been successfully per-formed to identify C. neoformans and C. gattii, isolatedfrom humans or animals or directly from clinical specimens,especially from cerebrospinal fluid (CSF) samples (Diaz andFell 2005; Bovers et al. 2007). Furthermore, this method hasallowed the identification of fungal varieties, serotypes, andgenotypes, with perspectives for application in molecular ep-idemiology studies (Diaz and Fell 2005; Bovers et al. 2007).Some important studies to develop routine diagnosis meth-ods have been performed to identify C. neoformans and C.gattii: (1) Diaz and Fell (2005) developed and validated 8probes, which derived from fungal intergenic sequence(IGS) analysis. These probes were used to study environ-mental and clinical isolates obtained from different geo-graphical regions throughout the world. They proved to bespecific and sensitive in determining the variety and geno-type of the isolates of the C. neoformans complex; (2) Bo-vers et al. (2007) typed fungal clinical isolates fromcultures and CSF samples from patients with neurocrypto-coccosis, through the use of rDNA IGS1-based probes; (3)Landlinger et al. (2009) demonstrated in a recent study theuse of Luminex xMAP for the simultaneous identificationof clinically relevant fungal species, including C. neofor-mans, applying species-specific, internal transcribed spacer2 (ITS2) based probes. Thus, although the use of LuminexxMAP for the diagnosis of cryptococcosis is still in theprocess of stabilization, this method has been steadily re-placing traditional molecular methods and immnoassays,with the advantage of enabling the simultaneous analysis ofseveral parameters through the use of a small sample vol-ume. These characteristics have attracted the interest ofmany researchers and reference centers in the diagnosis ofthis mycosis.

PCRAmong the several techniques to manipulate and obtain

data from DNA, PCR (which arose in the late 1980s) en-abled amplification of small and specific segments of thegenome, allowing in vitro obtainment of multiple copies ofa specific region of the total DNA (Sambrook et al. 1989;Saiki et al. 1985). This technique has allowed advances inthe diagnosis of cryptococcosis with sufficiently high sensi-tivity and specificity to detect minimal amounts of the spe-cies of the C. neoformans complex. Besides this, it is a fastand easily executed method and costs less than hybridiza-tion. In addition, this technique can be completely auto-mated and applied to identify the fungus from contaminatedsamples and (or) mixed cultures. PCR can also be used inassociation with other techniques, which are described inthe section on typing, making it a valuable tool for molecu-lar epidemiology studies.

Nested PCR, multiplex PCR, and real-time PCR havebeen the most used variant methodologies of PCR to iden-tify C. neoformans and C. gattii. Several target sequences,described later, have been applied to identify the C. neofor-mans complex, among which URA5, CAP59, M13, and ITS(18S, 5.8S, and 28S) stand out (Table 1).

The ITS region of rDNA has been the most frequentlyused region in detecting fungal sequences, especially be-cause of its high degree of variation compared to that of

Sidrim et al. 447

Published by NRC Research Press

Table 1. Main molecular techniques and specific targets used for the identification of C. neoformans and C. gattii.

Technique Targets Advantages Disadvantages Reference

IdentificationHybridization Repetitive and poly-

morphic DNAHigh sensitivity and specificity Expensive and laborious Spitzer and Spitzer 1992

PCR ITS and 5.6S rRNA High sensitivity and specificity; quicknessand feasibility

Presence of contaminants in extraction andreaction phases

Paschoal et al. 2004

Nested PCR ITS rDNA High sensitivity and specificity Presence of contaminants in reaction Rappelli et al. 1998Multiplex PCR Serotype specific Amplification of 2 or more loci in only 1 re-

action; small amounts of extracted DNAInterference due to the presence of poly-

morphism; reagent competition; possiblenonspecific products

Leal et al. 2008

Real-time PCR 18S/28 rRNA High sensitivity and specificity; detection ofgene expression levels; quickness

Interference in the final analyze due to con-tamination with genomic DNA; requirestechnical ability and support; expensive

Levy et al. 2008

TypingPCR fingerprinting Microsatellite (GACA)4 Previous knowledge of target sequences is

not necessary; use of short primers; poly-morphism detection

Standardization of the technique accordingto the conditions of each laboratory

Hafner et al. 2005

RAPD Minisatellite (M13) Previous knowledge of target sequences isnot necessary; use of short primers; poly-morphism detection

Standardization of the technique accordingto the conditions of each laboratory

Capoor et al. 2008

PCR–RFLP Urease Specificity; hybridization phase can beskipped

Decreased sensitivity in case of isolated mu-tations

Meyer et al. 2003

AFLP Capsule High sensitivity and specificity; high resolu-tion and sampling power; detection of ge-netic variability

Greater number of phases, larger number ofreagents, expensive

Enache-Angoulvant et al. 2007

MLST IGS, capsule, laccase, ur-ease, phospholipase

Reproducible and unambiguous; completelyautomated analysis, simultaneous analysisof multiple loci

Limitations in the differentiation of strainswhen genes are very conserved

Chen et al. 2008

448C

an.J.

Microbiol.

Vol.

56,2010

Publishedby

NR

CR

esearchPress

other ribosomal DNA regions (e.g., SSU and LSU) and itsexistence in approximately 100 copies per haploid genome(Hsu et al. 2003). By using this region as a target for ampli-fication in PCR, it has been possible to detect the DNA ofC. neoformans directly from clinical samples, such as inCSF (Paschoal et al. 2004). Additionally, this region hasalso been applied for the detection of rare pathogens of thisgenus, obtained from different sources, such as Cryptococ-cus laurentii from oropharyngeal swabs (Bauters et al.2001); Cryptococcus magnus from cat ear canal swabs(Kano et al. 2004), the first report of the fungus in this ani-mal species; and Cryptococcus adeliensis in mixed cultures(Leaw et al. 2006).

It is noteworthy that the DNA sequencing technique,which has been described since the late 1970s, was not useduntil the mid 1990s for the analysis of PCR-amplified ge-netic sequences of Cryptococcus spp. (Tolkacheva et al.1994; Shandu et al. 1995). The combination of both methodsincreased the informative value of PCR, which led to theemergence of a new era for data analysis, with perspectivesfor obtaining further information beyond laboratory identifi-cation, such as microevolution, virulence, and epidemiology(Sambrook et al. 1989; Cox et al. 2000; Pryce et al. 2006;Qazzafi et al. 2007).

Other genetic targets have been successfully employed todetect and identify the species of the C. neoformans com-plex, such as the capsular region. Kano et al. (2001) per-formed direct detection and subsequent sequencing of C.neoformans var. neoformans serotype D from subcutaneousnodule biopsy samples from a cat, through PCR amplifica-tion of the CAP59 gene, which encodes the proteins in-volved in capsule production.

Some caveats must be mentioned concerning the PCRtechnique, such as false-positive results due to the high sen-sitivity of the method, since it is not always clear whether apositive diagnosis is associated with active disease or colo-nization (Hayette et al. 2001). However, these interferencesare rare, and the protocol and reagents used in this techniqueare better established and increasingly more specific, includ-ing those for C. neoformans and C. gattii (Wengenack andBinnicker 2009). Nowadays, PCR is the main moleculartechnique used for several purposes in the study of the mainetiological agents of cryptococcosis (Kang et al. 2009; Wen-genack and Binnicker 2009).

Nested PCRAmong the most-used PCR-based techniques for detection

and identification of C. neoformans and C. gattii, nestedPCR stands out. In it, the template DNA used in the reactionis the product of a previous amplification (Bialek et al.2002). This technique is very useful, especially when height-ened detection sensitivity and specificity are desirable(Bialek et al. 2004).

A work of great relevance in this area was that performedby Rappelli et al. (1998). They developed a nested PCR pro-tocol for the detection of C. neoformans and C. gattii fromCSF samples obtained from patients with neurocryptococco-sis. The selected amplification target was the ITS region ofrDNA, and 100% of the analyzed samples were positive.The specificity and sensitivity of the technique were tested,the former by using DNA from other microorganisms, which

did not amplify, and the latter by testing different dilutionsof fungal DNA samples, which resulted in the amplificationof up to 10 fungal cells/mL.

The same technique was employed by Bialek et al.(2002), who detected the microorganism directly from braintissue samples of mice experimentally infected with C. neo-formans. The final amplification of the 18S region of therDNA was performed with specific primers for C. neofor-mans. Thus, the authors demonstrated the potential of thisprotocol for diagnosing cryptococcosis.

More recently, 2 cases of primary lymphonodular abdomi-nal cryptococcosis were reported, where the diagnosis wasestablished through nested PCR. In these cases, the employ-ment of molecular tools was extremely important for diag-nostic confirmation, since there were atypical clinicalmanifestations that led only to the suspicion of cryptococco-sis due to the presence of capsulated cells on direct exami-nation (Zou et al. 2006). Hence, nested PCR has beenrecognized as a fast, sensitive, and specific methodology forthe diagnosis of cryptococcosis. In 2008, Putignani and col-leagues showed that the use of nested PCR, followed by se-quencing of the ITS2 region, was fundamental for diagnosticconfirmation of cryptococcosis associated with inflammatoryreconstitution syndrome, since the culture and histopathol-ogy were negative (Putignani et al. 2008).

Caution is required when using other molecular methods,especially concerning the presence of contaminants, sincemolecular detection is very sensitive, over 100 times moresensitive than conventional PCR, and obtaining unspecificproducts is possible (Bialek et al. 2004). However, whencompared to the other molecular techniques described inthis review, nested PCR has been less frequently used to de-tect C. neoformans and C. gattii (Putignani et al. 2008).

Multiplex PCRMultiplex PCR allows the amplification of 2 or more loci

in only 1 reaction and can be performed quickly with asmaller amount of DNA. This makes it another promisingmethod for microbiological diagnostic purposes (Edwardsand Gibbs 1994; QIAGEN 2008). Its application in the studyof cryptococcosis has been primarily related to the identifi-cation of C. neoformans and C. gattii, including their sero-types, with different combinations of primers to obtainmore sensitive and specific results, or in association withother molecular techniques, such as real-time PCR (Luo andMitchell 2002; Ito-Kuwa et al. 2007; Leal et al. 2008). Ad-ditionally, multiplex PCR has also been used to determinethe mating-type profile of fungal isolates (Esposto et al.2004).

Multiplex PCR has been employed to detect C. neofor-mans from cultures, using the following as target sequence:the ITS region and specific primers for the C. neoformanscomplex (Luo and Mitchell 2002); sequences that are associ-ated with fungal aminotransferases and DNA polymerases(Horta et al. 2002; Casali et al. 2003); and codifying regionsfor laccase and (or) capsule production (Ito-Kuwa et al.2007). Recently, Leal et al. (2008) described a multiplexPCR protocol based on amplification of the ITS region withspecies-specific primers. The results allowed rapid differen-tiation between C. neoformans and C. gattii from environ-mental and clinical isolates from humans and other animals.

Sidrim et al. 449

Published by NRC Research Press

The chosen technique showed specificity and sensitivity thatwere comparable with those of laboratory diagnosis.

Multiplex PCR can present some disadvantages comparedto conventional PCR, such as the presence of polymor-phisms and competition between primers for the target se-quences and reagents present (Edwards and Gibbs 1994;QIAGEN 2008). Additionally, this technique requires strictstechiometric control of the reaction components to avoidfalse results (Henegariu et al. 1997).

Currently, there are several described protocols for the di-agnosis of cryptococcosis through multiplex PCR. However,this technique is being replaced by more recent molecularmethods or is being used in association with these newermethods.

Real-time PCRCurrently, one of the most revolutionary methods for the

diagnosis of pathogens is real-time PCR. This technique,which combines the chemistry of conventional PCR with ad-justment to obtain much higher sensitivity levels, enablesthe evaluation of the number of molecules produced percycle (Vollmer et al. 2008). It is one of the most modernmethods applied to the study of cryptococcosis and its mainetiologic agents for rapid and precise detection and identifi-cation of C. neoformans and C. gattii from cultures or di-rectly from clinical specimens. Additionally, this techniqueallows assessment of the expression of genes that are relatedto microorganism virulence (Amjad et al. 2004; Espy et al.2006; Jain et al. 2009).

In a comparative study, Bialek et al. (2002) showed thatreal-time PCR is faster than nested PCR for detection offungal species and also provided quantitative results. Hsu etal. (2003), seeking to confirm the species of Cryptococcusspp. and Candida spp. obtained from clinical isolates, em-ployed real-time PCR with species-specific primers andproved that the technique is remarkably fast and highly sen-sitive and specific for pathogen detection.

Recently, real-time PCR has also been successfully em-ployed for the diagnostic confirmation of pericarditis causedby C. neoformans, through amplification of the 18S and 28SrRNA genes. In this case, the method enabled the amplifica-tion from the culture samples, as well as directly from thepericardiac fluid (Levy et al. 2008).

Veron et al. (2009) developed a real-time PCR protocolwith the TaqMan system for cryptococcosis diagnosis. Sam-ples that were positive for fungal isolation were confirmedthrough this molecular technique, and no false-negative re-sults were detected among samples that were negative forfungal growth. Additionally, the tested protocol presentedhigh detection sensitivity and specificity.

Since real-time PCR is one of the most modern tech-niques in molecular biology, it still requires expensive mate-rial and specialized equipment (Amjad et al. 2004; Espy etal. 2006). However, it is one of the most frequently appliedDNA-based methods for the diagnosis of cryptococcosiswhen compared to other PCR-based techniques.

Thus, the detection and identification of C. neoformansand C. gattii through hybridization methods, as well as elec-trokaryotyping, have promoted great advances in the studyof these microorganisms, with perspectives for use in labora-tory diagnosis. In particular, PCR-based techniques have al-

lowed faster, less laborious pathogen diagnosis with highsensitivity and specificity. However, even with more ad-vanced technologies, such as Luminex xMAP and real-timePCR, there is no commercially available specific identifica-tion kit, based on the techniques described above, for theidentification of C. neoformans and C. gattii.

TypingMolecular techniques for microorganism typing have al-

lowed advances in diagnosis and comprehension of the ge-netic relationship among the studied agents, enhancingphylogenetic and epidemiological knowledge on thesepathogens. Methods of molecular typing of the C. neofor-mans complex allow distinction between serotypes and mo-lecular types of the fungus, depending on the techniqueemployed. Not all molecular typing methods are equally dis-criminatory. PCR fingerprinting, randomly amplified poly-morphic DNA (RAPD), PCR – restriction fragment lengthpolymorphism (RFLP), amplified fragment length polymor-phism (AFLP), and multilocus sequence typing (MLST) arethe most commonly used for the C. neoformans complex(Table 2).

PCR fingerprinting and RAPDOne of the main advances in the 1990s with the develop-

ment of molecular methods for C. neoformans complex typ-ing was the discovery of PCR-based molecular markers. Theidea of using shorter primers based on arbitrary sequencesduring amplification, which eliminates the need of previ-ously knowing the sequence, has provided greater discrimi-natory capacity for typing based on molecular methodswhen compared to biochemical and serological analyses.DNA-based techniques for typing normally use genomicDNA extracted from culture yeasts cells (Frases et al.2009), and they allow fast differentiation of C. neoformansand C. gattii with sufficient sensitivity and specificity to de-tect inter- and intra-variety differences (Meyer et al. 1999;Frases et al. 2009). As for identification, many target se-quences have been used for typing C. neoformans and C.gattii, such as ITS rRNA and rDNA (18S, 5.8S, and 28S)and URA5, CNLAC1, CAP59, CAP64, PBL1, M13, andGACA4.

PCR fingerprinting is considered one of the fastest molec-ular techniques for detecting band patterns. It can be per-formed to confirm a determined molecular type in sporadicdisease cases or during studies of molecular epidemiology(Mueller and Wolfenbarger 1999; Sun and Xu 2007; Ramoset al. 2008).

This technique was originally described by Jeffreys et al.(1987). It is based on the detection of hypervariable repeti-tive sequences of human DNA. For conventional DNA fin-gerprinting, Southern blot was initially performed with thegenomic DNA of interest for the detection of minisatelliteand microsatellite sequences. Nowadays, instead of Southernblotting, conventional PCR is performed prior to DNA fin-gerprinting. This technique has been used to identify geneticvariabilities between humans and other animals, as well asbetween plants and fungi (Meyer et al. 1993).

One of the pioneer works in DNA fingerprint typing ofC. neoformans and C. gattii was performed by Meyer et al.(1993), who used oligonucleotide primers to amplify hyper-

450 Can. J. Microbiol. Vol. 56, 2010

Published by NRC Research Press

Table 2. Genotyping methods and information retrieved for Cryptococcus neoformans complex species.

Method and target Primers (5’?3’) Reaction Typing information acquired Reference

Fingerprinting: M13 GAGGGTGGCGGTTCT (1) 94 8C, 20 s; 50 8C, 1 min; 72 8C,20 s (35 cycles); (2) final extensioncycle for 6 min at 72 8C

Grouped C. neoformans and C.gattii strains into 8 previouslyestablished molecular types:VNI, VNII, VNIII; VNIV,VGI, VGII, VGIII, VGIV

Meyer et al. 2003

Sequencing: ITS1–5.8S–ITS1

ATGTCCTCCCAAGCCCTCGACTCCGTTAAGACCTCTGAACACCGTACTC

(1) Initial denaturation at 94 8C, 2 min;(2) 94 8C, 45 s; 61 8C, 1 min; 72 8C,2 min (35 cycles); (3) final extensioncycle at 72 8C, 10 min

Recent description of new ITSgenotype and RAPD patternin C. gattii

Kang et al. 2009

RAPD: primers A-1and A-2

ATTGCGTCCA ATGGATCGGC (1) Initial denaturation at 94 8C, 4 min;(2) 94 8C, 2 min; 32 8C, 2 min; 72 8C,2 min (35 cycles); (3) final extensioncycle at 72 8C, 10 min

PCR–RFLP: CAP59 CCTTGCCGAAGTTCGAAACGAATCGGTGGTTGGATTCAGTGT

(1) Initial denaturation at 94 8C, 7 min;(2) 94 8C, 30 s; 60 8C, 30 s; 72 8C,30 s (3 cycles); (3) 94 8C, 30 s, 58 8C,30 s, 72 8C, 30 s (3 cycles); (4) 94 8C,30 s; 55 8C, 30 s; 72 8C, 30 s (3 cy-cles); (5) 94 8C, 30 s, 52 8C, 30 s,72 8C, 30 s (28 cycles); (6) final ex-tension at 72 8C, 15 min

Identification of C. neoformansand C. gattii serotypes: A, B,C, D, AD

Enache-Angoulvant et al.2007

AFLP: EcoRI and MseI First reaction: EcoRI and MseI core sequences (1) 72 8C, 2 min; (2) 94 8C (20 cycles),20 s; (3) 56 8C, 30 s; 4. 72 8C; 2 min

Grouped C. neoformans and C.gattii isolates into 6 geno-types: AFLP1, AFLP2,AFLP3, AFLP4, AFLP5,AFLP6

Boekhout et al. 2001

Second reaction: EcoRI-AC FAM and MseI-G (1) 94 8C, 2 min; (2) 20 s at 94 8C, 20 s,66 8C, 30 s (10 cycles and decreasing1 8C every step of the cycle); (3)72 8C, 2 min; (4) 94 8C, 20 s, 56 8C,30 s (25 cycles); (5) 72 8C, 2 min

Sidrim

etal.

451

Publishedby

NR

CR

esearchPress

variable DNA sequences of these microorganisms. Sincethen, several studies have been conducted to improve thetechnique for identification of the C. neoformans complexserotypes (Chen et al. 1997). Besides serotype determina-tion, PCR fingerprinting based studies have enabled the clas-sification of clinical and environmental isolates of the C.neoformans complex into 8 major molecular types (basedon DNA polymorphic sequences, observed by the presenceof reproducible and specific bands): VNI (C. neoformansvar. grubii serotype A1), VNII (C. neoformans var. grubiiserotype A2), VNIII (C. neoformans serotype AD), VNIV(C. neoformans var. neoformans serotype D), and VGI,VGII, VGIII, and VGIV (C. gattii serotypes B and C)(Table 1). However, there still is no exact correlation be-tween serotype and molecular type for C. gattii (Sorrell etal. 1996; Lin and Heitman 2006).

In one case of primary cutaneous cryptococcosis, besidesconventional microbiological tests, the diagnosis was com-plemented by PCR fingerprinting, through the amplificationof DNA microsatellite sequences to determine the moleculartype involved. It was possible to corroborate that C. neofor-mans var. neoformans serotype D was the most prevalentagent of cutaneous cryptococcosis (Hafner et al. 2005). Thatwas one of the strategies applied to study the outbreak ofcryptococcosis that occurred in Vancouver, Canada, in2004, where it was found that most isolates belonged to mo-lecular type VGII, considered the most virulent genotype ofthis species. This case clearly shows how molecular typingcan be relevant for better understanding of the epidemiolog-ical aspects of the disease in a certain region (Kidd et al.2004). Once all the characteristics are determined, the stud-ies will no longer be strictly epidemiological, and the resultsobtained will provide useful information to diagnose andtreat the disease (Sorrell 2001).

The true role of these molecular types and their correla-tion with clinical and environmental findings have yet to bestudied (Sorrell et al. 2001; Hoang et al. 2004). A literaturesearch shows there is an interesting database on genetic typ-ing of the C. neoformans complex that has aroused research-ers’ interest in the microorganism and the disease. Tworecent curious facts are noteworthy: (1) clinical and environ-mental isolates with the same genotype, as determined byAFLP and MLST (techniques described later), after inocula-tion in mice, presented different virulence profiles, since theclinical isolates were more virulent (Litvintseva and Mitch-ell 2009); (2) the relationship observed between subtypesVGIIa and VGIIb of C. gattii and in vitro antifungal sus-ceptibility presented statistically significant differences be-tween the subtypes and minimum inhibitory concentrationsfound (Iqbal et al. 2010).

The RAPD technique, which consists of genomic DNAamplification through simple primers with arbitrary nucleo-tide sequences, detects polymorphism without informationon a specific nucleotide sequence, working as a geneticmarker (Williams et al. 1990). This method allows differen-tiation of varieties, serotypes, and molecular types of themain pathogenic species of the genus (Sansinforiano et al.2001; Litvintseva et al. 2005). It has been used to study thegenetic variability of Cryptococcus spp. from different sour-ces (Garcia-Hermoso et al. 1999) as well as to determine thegenetic profile of strains obtained from HIV-positive pa-

tients from a certain geographic region (Ngamwongsatit etal. 2005) or from different anatomical sites (Capoor et al.2008).

By the early 1990s, RAPD had already been used to char-acterize the genetic profile of several microorganisms (Ha-drys et al. 1992). With this idea, some studies wereperformed to adapt the technique to determine serotypesand molecular types of C. neoformans and C. gattii (Hayneset al. 1995; Ruma et al. 1996).

The use of arbitrary sequences of different primers al-lowed identifying the molecular types involved in 9 casesof human cryptococcosis in northeastern Australia. In thiswork, 2 isolates showed the VGI molecular type, while theother 7 strains presented the VGII pattern, diverging fromother Australian regions, where the predominant moleculartype is VGI. Such divergence is probably related to the eco-logical niches found in the different regions studied (Chen etal. 1997). Besides this, application of the RAPD techniquehas aided the characterization of multiple strains involvedin cases of cryptococcosis, as well as the identification ofstrains responsible for episodes of reinfection (Casadevalland Spitzer 1995).

For over 10 years, RAPD has been used to differentiateserotypes of the C. neoformans complex. During a pioneer-ing study, Aoki et al. (1999) developed oligonucleotidesbased on fungal-specific sequences (aminotransferase andDNA polymerase codifying sequences) through analysis ofthe RAPD profile of clinical strains of C. neoformans. Cur-rently, the use of RAPD for typing isolates of C. neoformansand C. gattii has been replaced by more recent methods thathave greater capacity to differentiate band patterns. Thesenewer methods are described next.

PCR–RFLP, AFLP, and MLSTPCR–RFLP and AFLP have proven to be specific tech-

niques for rapid detection of serotypes and molecular typesof the C. neoformans complex (Boekhout et al. 2001; La-touche et al. 2003). PCR–RFLP is very similar to RFLP,but, with the development of even more specific primers,genomic DNA fragments are initially submitted to PCR,making the probe hybridization step unnecessary, and after-wards are cleaved with restriction enzymes (Nosanchuk etal. 2000; Panneerchelvam and Norazmi 2003).

Molecular epidemiology studies have shown that PCR–RFLP can be applied not only to determine a possible rela-tionship among molecular types of clinical and environmen-tal isolates of the C. neoformans complex, but also todiagnose specific cases of cryptococcosis when it is desir-able to obtain more information on a given strain, with thetarget sequence of the gene URA5 one of the most fre-quently used during the amplification reaction (Nosanchuket al. 2000; Meyer et al. 2003; Kidd et al. 2004). BesidesURA5, other targets have been employed for molecular typ-ing associated with the use of restriction enzymes, such asthe amplification of the capsular gene CAP59 (Enache-Angoulvant et al. 2007; Okabayashi et al. 2007).

AFLP, which is one of the most advanced techniques forobtaining a great number of molecular markers distributedwithin prokaryotic and eukaryotic genomes, is another alter-native for typing the C. neoformans complex (Bovers et al.2008b). It essentially consists of 4 phases: genomic DNA

452 Can. J. Microbiol. Vol. 56, 2010

Published by NRC Research Press

cleavage with restriction enzymes; ligation of specific adapt-ers to the sticky ends of the cleaved genomic fragments; am-plification of a fraction of the segments generated by PCRwith specific primers to recognize sequences in the adapter;and separation of the subset of amplified fragments throughhigh-resolution gel electrophoresis (Applied Biosystems2007). AFLP is more efficient than PCR–RFLP because itcombines high specificity, high resolution, and high sam-pling power into one technique. Besides this, AFLP is excel-lent at detecting genetic variability, since it simultaneouslyexplores the presence or absence of polymorphism of the re-striction sites. It is more specific than RAPD because of theuse of longer primers in the PCR cycles, which avoids thecompetition that occurs during the PCR phase of RAPD.

AFLP, besides grouping C. neoformans complex speciesin 6 molecular types, that is, AFLP1–AFLP6 (Boekhout etal. 2001), has been used as an alternative molecular methodto type all 5 serotypes of the C. neoformans complex. Somestudies have reported the use of AFLP for comparison of re-sults obtained through other typing techniques. For serotyp-ing, both methods are normally in agreement, with theexception of serotype AD, which has frequently been char-acterized as A or D through serotyping techniques and asAD through molecular techniques (Barreto de Oliveira et al.2004; Enache-Angoulvant et al. 2007; Leal et al. 2008).

Among the main limitations of AFLP are the greater num-ber of phases involved in the procedure, the larger numberof reagents and laboratory devices, and the quality of the re-quired DNA, which is a crucial factor for the technique’ssuccess (Mueller and Wolfenbarger 1999; Panneerchelvamand Norazmi 2003; Applied Biosystems 2007). Nowadays,the use of AFLP for typing the C. neoformans complex hasalso been associated with virulence studies (Litvintseva andMitchell 2009; Byrnes et al. 2009b).

Among molecular typing techniques, MLST is one of themost important tools for global epidemiological and popula-tion structure studies (Enright and Spratt 1999; Meyer et al.2009). This method, which is based on the variation of thenucleotide sequence of multiple housekeeping genes —such as those that encode capsule, urease, phospholipase,and laccase production — has been of great value for deter-mining circulating genotypes of the C. neoformans complexin different parts of the world (Litvintseva et al. 2006; Chenet al. 2008; Hiremath et al. 2008).

MLST has some advantages, especially because it ishighly reproducible and unambiguous; furthermore, it canbe almost totally analyzed in silico. In other words, afteramplification and sequencing of the desired regions, theanalysis is completely done through specific computer pro-grams that can be exchanged between laboratories. More-over, the data generated can be used to differentiateisolates, investigate evolutionary relationships, and suggestareas of study to the scientific, medical, and veterinary com-munities (Maiden et al. 1998; Enright and Spratt 1999; Sul-livan et al. 2006).

The MLST technique has been of great importance formolecular typing of the primary agents of cryptococcosis,and it has been particularly useful for understanding the epi-demiology of the disease in some cases. This technique re-vealed the dispersion of a more virulent and rare genotypeof C. gattii (VGIIa) during the epidemic outbreak of the dis-

ease that occurred in Vancouver from 1999 to 2003 (Kidd etal. 2005). The method has also been described for typing ofstrains involved in isolated cases of the disease in humansand other animals (MacDougall et al. 2007; Upton et al.2007; Byrnes et al. 2009a, 2009b), as well as in studies con-cerning the population structure, reproductive means, anddispersion and environmental recombination of C. neofor-mans var. grubii (serotype A) (Litvintseva et al. 2006; Chenet al. 2008; Feng et al. 2008; Hiremath et al. 2008).

Recently, the Cryptococcal Working Group I (genotypingof C. neoformans and C. gattii) of the International Societyfor Human and Animal Mycology published a study describ-ing the consensus MLST scheme for C. neoformans and C.gattii. They proposed the following set of genetic loci as aninternational standard for multilocus sequences: CAP59,GPD1, LAC1, PLB1, SOD1, URA5, and IGS1 (Meyer et al.2009).

Microorganism molecular typing plays a much broaderrole than simple determination of genetic patterns that char-acterize a certain strain. The development of molecular tech-niques for microorganism typing has brought newpossibilities to the fields of taxonomy, identification, and di-agnosis, as well as shedding more light on microorganismphylogeny and evolution.

Final considerationsIn mycology, the micromorphological, biochemical, and

(or) serologic characteristics of a given organism frequentlydirect pathogen identification. However, these strategies arenot always sufficient for laboratory diagnosis of cryptococ-cosis.

The approach of using molecular methods to improve di-agnosis of this mycosis, through the analysis of defined re-gions of the fungal genome present in clinical samples, hascaused rapid introduction of molecular techniques into thestudy of this disease, with perspectives and applications forlaboratory diagnosis.

Molecular tools also have enabled the identification of in-frequently described species, such as those of the C. lauren-tii complex, and can provide more comprehensive resultsthan conventional diagnosis, enhancing understanding of theepidemiology and natural history of cryptococcosis. Further-more, these techniques can be employed to monitor the pres-ence and the establishment of genotypes, even the mostvirulent ones, in a given population, since they allow thestudy of environmental species diversity. Hence, the accu-mulation of data generated by molecular methods shouldhave a positive impact on monitoring of resistant strainsand treatment of diseases.

Advances in ‘‘omics’’ technologies might culminate inmore efficient and faster methods for microbiological diag-nosis, through the combination of several procedures, suchas the use of mass spectrometry. One of the areas of greaterinterest among non-DNA based methods is microorganismidentification and classification through detection of othercharacteristic molecules, such as proteins, peptides, and sec-ondary metabolites, all of which can be used as biomarkers.Further studies will likely lead to the development of othercombined methodologies that enhance and facilitatediagnosis.

Sidrim et al. 453

Published by NRC Research Press

ReferencesAmjad, M., Kfoury, N., Cha, R., and Mobarak, R. 2004. Quantifi-

cation and assessment of viability of Cryptococcus neoformansby LightCycler amplification of capsule gene mRNA. J. Med.Microbiol. 53(12): 1201–1206. doi:10.1099/jmm.0.45742-0.PMID:15585498.

Aoki, F.H., Imai, T., Tanaka, R., Mikami, Y., Taguchi, H.,Nishimura, N.F., et al. 1999. New PCR primer pairs specific forCryptococcus neoformans serotype A or B prepared on the basisof random amplified polymorphic DNA fingerprint pattern ana-lyses. J. Clin. Microbiol. 37(2): 315–320. PMID:9889210.

Applied Biosystems. 2007. AFLP microbial fingerprinting protocol.Applied Biosystems, Foster City, Calif.

Aulakh, H.S., Straus, S.E., and Kwon-Chung, K.J. 1981. Geneticrelatedness of Filobasidiella neoformans (Cryptococcus neofor-mans) and Filobasidiella bacillispora (Cryptococcus bacillis-porus) as determined by deoxyribonucleic acid basecomposition and sequence homology studies. Int. J. Syst. Evol.Microbiol. 31(1): 97–103. doi:10.1099/00207713-31-1-97.

Barreto de Oliveira, M.T., Boekhout, T., Theelen, B., Hagen, F.,Baroni, F.A., Lazera, M.S., et al. 2004. Cryptococcus neofor-mans shows a remarkable genotypic diversity in Brazil. J. Clin.Microbiol. 42(3): 1356–1359. doi:10.1128/JCM.42.3.1356-1359.2004. PMID:15004118.

Bauters, T.G.M., Swinne, D., Boekhout, T., Noens, L., and Nelis,H.J. 2001. Repeated isolation of Cryptococcus laurentii fromthe oropharynx of an immunocompromized patient. Mycopatho-logia, 153(3): 133–135. doi:10.1023/A:1014551200043.

Bialek, R., Weiss, M., Bekure-Nemariam, K., Najvar, L.K.,Alberdi, M.B., Graybill, J.R., and Reischl, U. 2002. Detectionof Cryptococcus neoformans DNA in tissue samples by nestedand real-time PCR assays. Clin. Diagn. Lab. Immunol. 9(2):461–469. PMID:11874894.

Bialek, R., Kern, J., Herrmann, T., Tijerina, R., Cecenas, L.,Reischl, U., and Gonzalez, G.M. 2004. PCR assays for identifi-cation of Coccidioides posadasii based on the nucleotide se-quence of the antigen 2/proline-rich antigen. J. Clin. Microbiol.42(2): 778–783. doi:10.1128/JCM.42.2.778-783.2004. PMID:14766853.

Birren, B., and Lai, E. 1993. Switch intervals and resolution inpulsed field gels. In Pulsed field gel electrophoresis. A practicalguide. Academic Press, San Diego, Calif. pp. 107–20.

Boekhout, T., Theelen, B., Diaz, M., Fell, J.W., Hop, W.C.J.,Abeln, E.C.A., et al. 2001. Hybrid genotypes in the pathogenicyeast Cryptococcus neoformans. Microbiology, 147(4): 891–907. PMID:11283285.

Bovers, M., Diaz, M.R., Hagen, F., Spanjaard, L., Duim, B.,Visser, C.E., et al. 2007. Identification of genotypically diverseCryptococcus neoformans and Cryptococcus gattii isolates byLuminex xMAP technology. J. Clin. Microbiol. 45(6): 1874–1883. doi:10.1128/JCM.00223-07. PMID:17442792.

Bovers, M., Hagen, F., and Boekhout, T. 2008a. Diversity of theCryptococcus neoformans–Cryptococcus gattii species complex.Rev. Iberoam. Micol. 25(1): S4–S12. doi:10.1016/S1130-1406(08)70019-6. PMID:18338917.

Bovers, M., Hagen, F., Kuramae, E.E., Hoogveld, H.L., Dromer, F.,St-Germain, G., and Boekhout, T. 2008b. AIDS patient deathcaused by novel Cryptococcus neoformans � C. gattii hybrid.Emerg. Infect. Dis. 14(7): 1105–1108. doi:10.3201/eid1407.080122. PMID:18598632.

Byrnes, E.J., III, Bildfell, R.J., Dearing, P.L., Valentine, B.A., andHeitman, J. 2009a. Cryptococcus gattii with bimorphic colonytypes in a dog in western Oregon: additional evidence for ex-

pansion of the Vancouver Island outbreak. J. Vet. Diagn. Invest.21(1): 133–136. PMID:19139515.

Byrnes, E.J., III, Li, W., Lewit, Y., Perfect, J.R., Carter, D.A., Cox,G.M., et al. 2009b. First reported case of Cryptococcus gattii inthe Southeastern USA: implications for travel-associated acqui-sition of an emerging pathogen. PLoS One, 4(6): 1–12. doi:10.1371/journal.pone.0005851.

Capoor, M.R., Mandal, P., Deb, M., Aggarwal, P., and Banerjee, U.2008. Current scenario of cryptococcosis and antifungal susceptibil-ity pattern in India: a cause for reappraisal. Mycoses, 51(3): 258–265. doi:10.1111/j.1439-0507.2007.01478.x. PMID:18399907.

Casadevall, A., and Spitzer, E.D. 1995. Involvement of multipleCryptococcus neoformans strains in a single episode of crypto-coccosis and reinfection with novel strains in recurrent infectiondemonstrated by random amplification of polymorphic DNA andDNA fingerprinting. J. Clin. Microbiol. 33(6): 1682–1683.PMID:7650217.

Casali, A.K., Goulart, L., Rosa e Silva, L.K., Ribeiro, A.M.,Amaral, A.A., Alves, S.H., et al. 2003. Molecular typing of clin-ical and environmental Cryptococcus neoformans isolates in theBrazilian state Rio Grande do Sul. FEMS Yeast Res. 3(4): 405–415. doi:10.1016/S1567-1356(03)00038-2. PMID:12748052.

Chen, S.C.A., Currie, B.J., Campbell, H.M., Fisher, D.A., Pfeiffer,T.J., Ellis, D.H., and Sorrell, T.C. 1997. Cryptococcus neofor-mans var. gattii infection in northern Australia: existence of anenvironmental source other than known host eucalypts. Trans.R. Soc. Trop. Med. Hyg. 91(5): 547–550. doi:10.1016/S0035-9203(97)90021-3. PMID:9463664.

Chen, J., Varma, A., Diaz, M.R., Litvintseva, A.P., Wollenberg,K.K., and Kwon-Chung, K.J. 2008. Cryptococcus neoformansstrains and infection in apparently immunocompetent patients,China. Emerg. Infect. Dis. 14(5): 755–762. doi:10.3201/eid1405.071312. PMID:18439357.

Costa, A.K., Sidrim, J.J., Cordeiro, R.A., Brilhante, R.S.N.,Monteiro, A.J., and Rocha, M.F. 2009. Urban pigeons (Columbalivia) as a potential source of pathogenic yeast: a focus on anti-fungal susceptibility of Cryptococcus strains in Northeast Brazil.Mycopathologia, . doi:10.1007/s11046-009-9245-1.

Cox, G.M., Mukherjee, J., Cole, G.T., Casadevall, A., and Perfect,J.R. 2000. Urease as a virulence factor in experimental crypto-coccosis. Infect. Immun. 68(2): 443–448. doi:10.1128/IAI.68.2.443-448.2000.

Diaz, M.R., and Fell, J.W. 2005. Use of a suspension array for rapididentification of the varieties and genotypes of the Cryptococcusneoformans species complex. J. Clin. Microbiol. 43(8): 3662–3672. doi:10.1128/JCM.43.8.3662-3672.2005. PMID:16081894.

Dunbar, S.A. 2006. Applications of Luminex xMAP technology forrapid, high-throughput multiplexed nucleic acid detection. Clin.Chim. Acta, 363(1–2): 71–82. doi:10.1016/j.cccn.2005.06.023.PMID:16102740.

Duncan, C., Stephen, C., and Campbell, J. 2006. Clinical character-istics and predictors of mortality for Cryptococcus gattii infec-tion in dogs and cats of southwestern British Columbia. Can.Vet. J. 47(10): 993–998. PMID:17078248.

Edwards, M.C., and Gibbs, R.A. 1994. Multiplex PCR: advantages,development, and applications. Genome Res. 3(4): S65–S75.doi:10.1101/gr.3.4.S65.

Enache-Angoulvant, A., Chandenier, J., Symoens, F., Lacube, P.,Bolognini, J., Douchet, C., et al. 2007. Molecular identificationof Cryptococcus neoformans serotypes. J. Clin. Microbiol.45(4): 1261–1265. doi:10.1128/JCM.01839-06. PMID:17287323.

Enright, M.C., and Spratt, B.G. 1999. Multilocus sequence typing.Trends Microbiol. 7(12): 482–487. doi:10.1016/S0966-842X(99)01609-1. PMID:10603483.

454 Can. J. Microbiol. Vol. 56, 2010

Published by NRC Research Press

Esposto, M.C., Cogliati, M., Tortorano, A.M., and Viviani, M.A.2004. Determination of Cryptococcus neoformans var. neofor-mans mating type by multiplex PCR. Clin. Microbiol. Infect.10(12): 1089–1104. doi:10.1111/j.1469-0691.2004.00972.x.

Espy, M.J., Uhl, J.R., Sloan, L.M., Buckwalter, S.P., Jones, M.F.,Vetter, E.A., et al. 2006. Real-time PCR in clinical microbiol-ogy: applications for routine laboratory testing. Microbiol. Rev.19(1): 165–256. doi:10.1128/CMR.19.1.165-256.2006.

Feng, X., Yao, Z., Ren, D., Liao, W., and Wu, J. 2008. Genotypeand mating type analysis of Cryptococcus neoformans and Cryp-tococcus gattii isolates from China that mainly originated fromnon-HIV-infected patients. FEMS Yeast Res. 8(6): 930–938.doi:10.1111/j.1567-1364.2008.00422.x. PMID:18671745.

Frases, S., Ferrer, C., Sanchez, M., and Colom-Valiente, M.F.2009. Molecular epidemiology of isolates of the Cryptococcusneoformans species complex from Spain. Rev. Iberoam. Micol.26(2): 112–117. doi:10.1016/S1130-1406(09)70021-X. PMID:19631160.

Garcia-Hermoso, D., Janbon, G., and Dromer, F. 1999. Epidemio-logical evidence for dormant Cryptococcus neoformans infec-tion. J. Clin. Microbiol. 37(10): 3204–3209. PMID:10488178.

Granados, D.P., and Castaneda, E. 2005. Isolation and characteriza-tion of Cryptococcus neoformans varieties recovered from nat-ural sources in Bogota, Colombia, and study of ecologicalconditions in the area. Microb. Ecol. 49(2): 282–290. doi:10.1007/s00248-004-0236-y. PMID:15965721.

Granados, D.P., and Castaneda, E. 2006. Influence of climatic con-ditions on the isolation of members of the Cryptococcus neofor-mans species complex from trees in Colombia from 1992–2004.FEMS Yeast Res. 6(4): 636–644. doi:10.1111/j.1567-1364.2006.00090.x. PMID:16696660.

Gundes, S.G., Gulenc, S., and Bingol, R. 2001. Comparative per-formance of Fungichrom I, Candifast and API 20C Aux systemsin the identification of clinically significant yeasts. J. Med. Mi-crobiol. 50(12): 1105–1110. PMID:11761197.

Hadrys, H., Balick, M., and Schierwater, B. 1992. Applications ofrandom amplified polymorphic DNA (RAPD) in molecular ecol-ogy. Mol. Ecol. 1(1): 55–63. doi:10.1111/j.1365-294X.1992.tb00155.x. PMID:1344984.

Hafner, C., Linde, H.J., Vogt, T., Breindl, G., Tintelnot, K.,Koellner, K., et al. 2005. Primary cutaneous cryptococcosis andsecondary antigenemia in a patient with long-term corticosteroidtherapy. Infection, 33(2): 86–89. doi:10.1007/s15010-005-4095-3. PMID:15827877.

Hayette, M.P., Vaira, D., Susin, F., Boland, P., Christiaens, G.,Melin, P., and De Mol, P. 2001. Detection of Aspergillus speciesDNA by PCR in bronchoalveolar lavage fluid. J. Clin. Micro-biol. 39(6): 2338–2340. doi:10.1128/JCM.39.6.2338-2340.2001.PMID:11376086.

Haynes, K.A., Sullivan, D.J., Coleman, D.C., Clarke, J.C.K.,Emilianus, R., Atkinson, C., and Cann, K.J. 1995. Involvementof multiple Cryptococcus neoformans strains in a single episodeof cryptococcosis and reinfection with novel strains in recurrentinfection demonstrated by random amplification of polymorphicDNA and DNA fingerprinting. J. Clin. Microbiol. 33(1): 99–102. PMID:7699075.

Henegariu, O., Heerema, N.A., Dlouhy, S.R., Vance, G.H., andVogt, P.H. 1997. Multiplex PCR: critical parameters and step-by-step protocol. Biotechniques, 23(3): 504–511. PMID:9298224.

Herschleb, J., Ananiev, G., and Schwartz, D.C. 2007. Pulsed-fieldgel electrophoresis. Nat. Protoc. 2(3): 677–684. doi:10.1038/nprot.2007.94. PMID:17406630.

Hiremath, S.S., Chowdhary, A., Kowshik, T., Randhawa, H.S.,

Sun, S., and Xu, J. 2008. Long-distance dispersal and recombi-nation in environmental populations of Cryptococcus neofor-mans var. grubii from India. Microbiology, 154(5): 1513–1524.doi:10.1099/mic.0.2007/015594-0. PMID:18451060.

Hoang, L.M.N., Maguire, J.A., Doyle, P., Fyfe, M., and Roscoe,D.L. 2004. Cryptococcus neoformans infections at VancouverHospital and Health Sciences Centre (1997–2002): epidemiol-ogy, microbiology and histopathology. J. Med. Microbiol.53(9): 935–940. doi:10.1099/jmm.0.05427-0. PMID:15314203.

Horta, J.A., Staats, C.C., Casali, A.K., Ribeiro, A.M., Schrank, I.S.,Schrank, A., and Vainstein, M.H. 2002. Epidemiological aspectsof clinical and environmental Cryptococcus neoformans isolatesin the Brazilian state Rio Grande do Sul. Med. Mycol. 40(6):565–571. PMID:12521120.

Hsu, M.C., Chen, K.W., Lo, H.J., Chen, Y.C., Liao, M.H., Lin,Y.H., and Li, S.Y. 2003. Species identification of medically im-portant fungi by use of real-time LightCycler PCR. J. Med. Mi-crobiol. 52(12): 1071–1076. doi:10.1099/jmm.0.05302-0. PMID:14614065.

Hu, G., Liu, I., Sham, A., Stajich, J.E., Dietrich, F.S., andKronstad, J.W. 2008. Comparative hybridization reveals exten-sive genome variation in the AIDS-associated pathogen Crypto-coccus neoformans. Genome Biol. 9(2): R41. doi:10.1186/gb-2008-9-2-r41. PMID:18294377.

Huffnagle, K.E., and Gander, R.M. 1993. Evaluation of Gen-Probe’s Histoplasma capsulatum and Cryptococcus neoformansAccuProbes. J. Clin. Microbiol. 31(2): 419–421. PMID:8432829.

Huston, S.M., and Mody, C.H. 2009. Cryptococcosis: an emergingrespiratory mycosis. Clin. Chest Med. 30(2): 253–264, vi.doi:10.1016/j.ccm.2009.02.006. PMID:19375632.

Iqbal, N., DeBess, E.E., Wohrle, R., Sun, B., Nett, R.J., Ahlquist,A.M., et al. 2010. Correlation of genotype and in vitro suscept-ibilities of Cryptococcus gattii strains from the Pacific North-west of the United States. J. Clin. Microbiol. 48(2): 539–544.doi:10.1128/JCM.01505-09. PMID:20007380.

Ito-Kuwa, S., Nakamura, K., Aoki, S., and Vidotto, V. 2007. Sero-type identification of Cryptococcus neoformans by multiplexPCR. Mycoses, 50(4): 277–281. doi:10.1111/j.1439-0507.2007.01357.x. PMID:17576319.

Jain, N., Li, L., Hsueh, Y.P., Guerrero, A., Heitman, J., Goldman,D.L., and Fries, B.C. 2009. Loss of allergen 1 confers a hyper-virulent phenotype that resembles mucoid switch variants ofCryptococcus neoformans. Infect. Immun. 77(1): 128–140.doi:10.1128/IAI.01079-08. PMID:18955480.

Jeffreys, A.J. 1987. Highly variable minisatellites and DNA finger-prints. Biochem. Soc. Trans. 15(3): 309–317. PMID:2887471.

Kang, Y., Tanaka, H., Moretti, M.L., and Mikami, Y. 2009. NewITS genotype of Cryptococcus gattii isolated from an AIDS pa-tient in Brazil. Microbiol. Immunol. 53(2): 112–116. doi:10.1111/j.1348-0421.2008.00101.x. PMID:19291095.

Kano, R., Fujino, Y., Takamoto, N., Tsujimoto, H., and Hasegawa,A. 2001. PCR detection of the Cryptococcus neoformans CAPS9gene from a biopsy specimen from a case of feline cryptococco-sis. J. Vet. Diagn. Invest. 13(5): 439–442. PMID:11580071.

Kano, R., Hosaka, S., and Hasegawa, A. 2004. First isolation ofCryptococcus magnus from a cat. Mycopathologia, 157(3):263–264. doi:10.1023/B:MYCO.0000024179.05582.1e. PMID:15180152.

Katsu, M., Kidd, S., Ando, A., Moretti-Branchini, M.L., Mikami,Y., Nishimura, K., and Meyer, W. 2004. The internal transcribedspacers and 5.8S rRNA gene show extensive diversity amongisolates of the Cryptococcus neoformans species complex.FEMS Yeast Res. 4(4–5): 377–388. doi:10.1016/S1567-1356(03)00176-4. PMID:14734018.

Sidrim et al. 455

Published by NRC Research Press

Kidd, S.E., Hagen, F., Tscharke, R.L., Huynh, M., Bartlett, K.H.,Fyfe, M., et al. 2004. A rare genotype of Cryptococcus gattiicaused the cryptococcosis outbreak on Vancouver Island (BritishColumbia, Canada). Proc. Natl. Acad. Sci. U.S.A. 101(49):17258–17263. doi:10.1073/pnas.0402981101. PMID:15572442.

Kidd, S.E., Guo, H., Bartlett, K.H., Xu, J., and Kronstad, J.W. 2005.Comparative gene genealogies indicate that two clonal lineagesof Cryptococcus gattii in British Columbia resemble strains fromother geographical areas. Eukaryot. Cell, 4(10): 1629–1638.doi:10.1128/EC.4.10.1629-1638.2005. PMID:16215170.

Landlinger, C.S., Preuner, S., Willinger, B., Haberpursch, B., Racil,Z., Mayer, J., and Lion, T. 2009. Species-specific identificationof a wide range of clinically relevant fungal pathogens by use ofLuminex xMAP technology. J. Clin. Microbiol. 47(4): 1063–1073. doi:10.1128/JCM.01558-08. PMID:19244466.

Latouche, G.N., Huynh, M., Sorrell, T.C., and Meyer, W. 2003.PCR – restriction fragment length polymorphism analysis of thephospholipase B (PLB1) gene for subtyping of Cryptococcusneoformans isolates. Appl. Environ. Microbiol. 69(4): 2080–2086. doi:10.1128/AEM.69.4.2080-2086.2003. PMID:12676686.

Leal, A.L., Faganello, J., Bassanesi, M.C., and Vainstein, M.H.2008. Cryptococcus species identification by multiplex PCR.Med. Mycol. 46(4): 377–383. doi:10.1080/13693780701824429.PMID:18415847.

Leaw, S.N., Chang, H.C., Sun, H.F., Barton, R., Bouchara, J.P.,and Chang, T.C. 2006. Identification of medically importantyeast species by sequence analysis of the internal transcribedspacer regions. J. Clin. Microbiol. 44(3): 693–699. doi:10.1128/JCM.44.3.693-699.2006. PMID:16517841.

Levy, P.Y., Habib, G., Reynaud-Gaubert, M., Raoult, D., andRolain, J.M. 2008. Pericardial effusion due to Cryptococcus neo-formans in a patient with cystic fibrosis following lung trans-plantation. Int. J. Infect. Dis. 12(4): 452. doi:10.1016/j.ijid.2007.12.001. PMID:18207443.

Lin, X., and Heitman, J. 2006. The biology of the Cryptococcusneoformans species complex. Annu. Rev. Microbiol. 60(1): 69–105. doi:10.1146/annurev.micro.60.080805.142102.

Litvintseva, A.P., and Mitchell, T.G. 2009. Most environmentalisolates of Cryptococcus neoformans var. grubii (serotype A)are not lethal for mice. Infect. Immun. 77(8): 3188–3195.doi:10.1128/IAI.00296-09. PMID:19487475.

Litvintseva, A.P., Kestenbaum, L., Vilgalys, R., and Mitchell, T.G.2005. Comparative analysis of environmental and clinical popu-lations of Cryptococcus neoformans. J. Clin. Microbiol. 43(2):556–564. doi:10.1128/JCM.43.2.556-564.2005. PMID:15695645.

Litvintseva, A.P., Thakur, R., Vilgalys, R., and Mitchell, T.G.2006. Multilocus sequence typing reveals three genetic subpopu-lations of Cryptococcus neoformans var. grubii (serotype A), in-cluding a unique population in Botswana. Genetics, 172(4):2223–2238. doi:10.1534/genetics.105.046672. PMID:16322524.

Luo, G., and Mitchell, T.G. 2002. Rapid identification of patho-genic fungi directly from cultures by using multiplex PCR. J.Clin. Microbiol. 40(8): 2860–2865. doi:10.1128/JCM.40.8.2860-2865.2002. PMID:12149343.

MacDougall, L., Kidd, S.E., Galanis, E., Mak, S., Leslie, M.J.,Cieslak, P.R., et al. 2007. Spread of Cryptococcus gattii in Brit-ish Columbia, Canada, and detection in the Pacific Northwest,USA. Emerg. Infect. Dis. 13(1): 42–50. doi:10.3201/eid1301.060827. PMID:17370514.

Magee, P.T., Gale, C., Berman, J., and Davis, D. 2003. Moleculargenetic and genomic approaches to the study of medically im-portant fungi. Infect. Immun. 71(5): 2299–2309. doi:10.1128/IAI.71.5.2299-2309.2003. PMID:12704098.

Maiden, M.C.J., Bygraves, J.A., Feil, E., Morelli, G., Russell, J.E.,

Urwin, R., et al. 1998. Multilocus sequence typing: a portableapproach to the identification of clones within populations ofpathogenic microorganisms. Proc. Natl. Acad. Sci. U.S.A.95(6): 3140–3145. doi:10.1073/pnas.95.6.3140. PMID:9501229.

Martinez, L.R., Garcia-Rivera, J., and Casadevall, A. 2001. Crypto-coccus neoformans var. neoformans (serotype D) strains aremore susceptible to heat than C. neoformans var. grubii (sero-type A) strains. J. Clin. Microbiol. 39(9): 3365–3367. doi:10.1128/JCM.39.9.3365-3367.2001. PMID:11526180.

Martins, M.A., Pappalardo, M.C.S.M., Melhem, M.S.C., and Pereira-Chioccola, V.L. 2007. Molecular diversity of serial Cryptococcusneoformans isolates from AIDS patients in the city of SaoPaulo, Brazil. Mem. Inst. Oswaldo Cruz, 102(7): 777–784.doi:10.1590/S0074-02762007000700001. PMID:18094886.

Massonet, C., Van Eldere, J., Vaneechoutte, M., De Baere, T.,Verhaegen, J., and Lagrou, K. 2004. Comparison of VITEK 2with ITS2-fragment length polymorphism analysis for identifica-tion of yeast species. J. Clin. Microbiol. 42(5): 2209–2211.doi:10.1128/JCM.42.5.2209-2211.2004. PMID:15131191.

Meyer, W., Mitchell, T.G., Freedman, E.Z., and Vilgalys, R. 1993.Hybridization probes for conventional DNA fingerprinting usedas single primers in the polymerase chain reaction to distinguishstrains of Cryptococcus neoformans. J. Clin. Microbiol. 31(9):2274–2280. PMID:8408543.

Meyer, W., Marszewska, K., Amirmostofian, M., Igreja, R.P.,Hardtke, C., Methling, K., et al. 1999. Molecular typing of glo-bal isolates of Cryptococcus neoformans var. neoformans bypolymerase chain reaction fingerprinting and randomly ampli-fied polymorphic DNA — a pilot study to standardize techni-ques on which to base a detailed epidemiological survey.Electrophoresis, 20(8): 1790–1799. doi:10.1002/(SICI)1522-2683(19990101)20:8<1790::AID-ELPS1790>3.0.CO;2-2. PMID:10435451.

Meyer, W., Castaneda, A., Jackson, S., Huynh, M., and Castaneda,E.; IberoAmerican Cryptococcal Study Group. 2003. Moleculartyping of IberoAmerican Cryptococcus neoformans isolates.Emerg. Infect. Dis. 9(2): 189–195. PMID:12603989.

Meyer, W., Aanensen, D.M., Boekhout, T., Cogliati, M., Diaz,M.R., Esposto, M.C., et al. 2009. Consensus multi-locus se-quence typing scheme for Cryptococcus neoformans and Crypto-coccus gattii. Med. Mycol. 47(6): 561–570. doi:10.1080/13693780902953886. PMID:19462334.

Mueller, U.G., and Wolfenbarger, L.L. 1999. AFLP genotyping andfingerprinting. Trends Ecol. Evol. 14(10): 389–394. doi:10.1016/S0169-5347(99)01659-6. PMID:10481200.

Ngamwongsatit, P., Sukroongreung, S., Nilakul, C.,Prachayasittikul, V., and Tantimavanich, S. 2005. Electrophore-tic karyotypes of C. neoformans serotype A recovered from Thaipatients with AIDS. Mycopathologia, 159(2): 189–197. doi:10.1007/s11046-004-6671-y. PMID:15770442.

Nosanchuk, J.D., Shoham, S., Fries, B.C., Shapiro, D.S., Levitz,S.M., and Casadevall, A. 2000. Evidence of zoonotic transmis-sion of Cryptococcus neoformans from a pet cockatoo to an im-munocompromised patient. Ann. Intern. Med. 132(3): 205–208.PMID:10651601.

Okabayashi, K., Hasegawa, A., and Watanabe, T. 2007. Microre-view: capsule-associated genes of Cryptococcus neoformans.Mycopathologia, 163(1): 1–8. doi:10.1007/s11046-006-0083-0.PMID:17216326.

Panneerchelvam, S., and Norazmi, M.N. 2003. Forensic DNA pro-filing and database. Malays. J. Med. Sci. 10: 20–26.

Paschoal, R.C., Hirata, M.H., Hirata, R.C., Melhem, M. de. S.,Dias, A.L.T., and Paula, C.R. 2004. Neurocryptococcosis: diag-

456 Can. J. Microbiol. Vol. 56, 2010

Published by NRC Research Press

nosis by PCR method. Rev. Inst. Med. Trop. Sao Paulo, 46(4):203–207. PMID:15361972.

Perfect, J.R., Magee, B.B., and Magee, P.T. 1989. Separation ofchromosomes of Cryptococcus neoformans by pulsed field gelelectrophoresis. Infect. Immun. 57(9): 2624–2627. PMID:2668180.

Playford, E.G., Kong, F., Sun, Y., Wang, H., Halliday, C., andSorrell, T.C. 2006. Simultaneous detection and identification ofCandida, Aspergillus, and Cryptococcus species by reverse lineblot hybridization. J. Clin. Microbiol. 44(3): 876–880. doi:10.1128/JCM.44.3.876-880.2006. PMID:16517870.

Polacheck, I., and Lebens, G.A. 1989. Electrophoretic karyotype ofthe pathogenic yeast Cryptococcus neoformans. J. Gen. Micro-biol. 135(1): 65–71. PMID:2674325.

Polacheck, I., Lebens, G., and Hicks, J.B. 1992. Development ofDNA probes for early diagnosis and epidemiological study ofcryptococcosis in AIDS patients. J. Clin. Microbiol. 30(4): 925–930. PMID:1572979.

Pryce, T.M., Palladino, S., Price, D.M., Gardam, D.J., Campbell,P.B., Christiansen, K.J., and Murray, R.J. 2006. Rapid identifi-cation of fungal pathogens in BacT/ALERT, BACTEC, andBBL MGIT media using polymerase chain reaction and DNAsequencing of the internal transcribed spacer regions. Diagn. Mi-crobiol. Infect. Dis. 54(4): 289–297. doi:10.1016/j.diagmicrobio.2005.11.002. PMID:16466900.

Putignani, L., Antonucci, G., Paglia, M.G., Vincenzi, L., Festa, A.,De Mori, P., et al. 2008. Cryptococcal lymphadenitis as a mani-festation of immune reconstitution inflammatory syndrome in anHIV-positive patient: a case report and review of the literature.Int. J. Immunopathol. Pharmacol. 21(3): 751–756. PMID:18831914.

Qazzafi, Z., Thiruchunapalli, D., Birkenhead, D., Bell, D., andSandoe, J.A.T. 2007. Invasive Cryptococcus neoformans infec-tion in an asplenic patient. J. Infect. 55(6): 566–568. doi:10.1016/j.jinf.2007.08.005. PMID:17905439.

QIAGEN. 2008. Multiplex PCR handbook. For fast and efficientmultiplex PCR without optimization. QIAGEN, Valencia, Calif.

Ramos, J.R., Telles, M.P.C., Diniz-Filho, J.A.F., Soares, T.N.,Melo, D.B., and Oliveira, G. 2008. Optimizing reproducibilityevaluation for random amplified polymorphic DNA markers.Genet. Mol. Res. 7(4): 1384–1391. doi:10.4238/vol7-4gmr520.PMID:19065774.

Randhawa, H.S., Kowshik, T., and Khan, Z.U. 2003. Decayedwood of Syzygium cumini and Ficus religiosa living trees inDelhi/New Delhi metropolitan area as natural habitat of Crypto-coccus neoformans. Med. Mycol. 41: 189–197. doi:10.1080/369378031000137251. PMID:12964710.

Rappelli, P., Are, R., Casu, G., Fiori, P.L., Cappuccinelli, P., andAceti, A. 1998. Development of a nested PCR for detection ofCryptococcus neoformans in cerebrospinal fluid. J. Clin. Micro-biol. 36(11): 3438–3440. PMID:9774618.

Restrepo, B.I., and Barbour, A.G. 1989. Cloning of 18S and 25SrDNAs from the pathogenic fungus Cryptococcus neoformans.J. Bacteriol. 171(10): 5596–5600. PMID:2676980.

Ruma, P., Chen, S.C.A., Sorrell, T.C., and Brownlee, A.G. 1996.Characterization of Cryptococcus neoformans by random DNAamplification. Lett. Appl. Microbiol. 23(5): 312–316. doi:10.1111/j.1472-765X.1996.tb00197.x. PMID:8987712.

Saiki, R.K., Scharf, S., Faloona, F., Mullis, K.B., Horn, G.T.,Erlich, H.A., and Arnheim, N. 1985. Enzymatic amplificationof b-globulin genomic sequences and restriction site analysis fordiagnosis of sickle cell anemia. Science (Washington, D.C.),230(4732): 1350–1354. doi:10.1126/science.2999980.

Sambrook, J., Fritsch, E.F., and Maniatis, T. 1989. Molecular clon-

ing: a laboratory manual. Cold Spring Harbor Laboratory Press,Plainview, N.Y.

Sandhu, G.S., Kline, B.C., Stockman, L., and Roberts, G.D. 1995.Molecular probes for diagnosis of fungal infections. J. Clin. Mi-crobiol. 33(11): 2913–2919. PMID:8576345.

Sansinforiano, M.E., Rabasco, A., Martınez-Trancon, M., Parejo,J.C., Hermoso-de-Mendoza, M., and Padilla, J.A. 2001. [Optimi-zation of the conditions for RAPD–PCR of Candida spp. andCryptococcus spp.] Rev. Iberoam. Micol. 18(2): 65–69. PMID:15487909.[In Spanish.]

Schein, J.E., Tangen, K.L., Chiu, R., Shin, H., Lengeler, K.B.,MacDonald, W.K., et al. 2002. Physical maps for genome analy-sis of serotype A and D strains of the fungal pathogen Crypto-coccus neoformans. Genome Res. 12(9): 1445–1453. doi:10.1101/gr.81002. PMID:12213782.

Schwartz, D.C., and Cantor, C.R. 1984. Separation of yeast chro-mosome-sized DNAs by pulsed field gradient gel electrophor-esis. Cell, 37(1): 67–75. doi:10.1016/0092-8674(84)90301-5.PMID:6373014.

Sorrell, T.C. 2001. Cryptococcus neoformans variety gattii. Med.Mycol. 39(2): 155–168. PMID:11346263.

Sorrell, T.C., Chen, S.C., Ruma, P., Meyer, W., Pfeiffer, T.J., Ellis,D.H., and Brownlee, A.G. 1996. Concordance of clinical andenvironmental isolates of Cryptococcus neoformans var. gattii byrandom amplification of polymorphic DNA analysis and PCR fin-gerprinting. J. Clin. Microbiol. 34(5): 1253–1260. PMID:8727912.

Spitzer, E.D., and Spitzer, S.G. 1992. Use of a dispersed repetitiveDNA element to distinguish clinical isolates of Cryptococcus neo-formans. J. Clin. Microbiol. 30(5): 1094–1097. PMID:1349898.

Sullivan, C.B., Jefferies, J.M.C., Diggle, M.A., and Clarke, S.C.2006. Automation of MLST using third-generation liquid-hand-ling technology. Mol. Biotechnol. 32(3): 219–226. doi:10.1385/MB:32:3:219. PMID:16632888.

Sun, S., and Xu, J. 2007. Genetic analyses of a hybrid cross be-tween serotypes A and D strains of the human pathogenic fun-gus Cryptococcus neoformans. Genetics, 177(3): 1475–1486.doi:10.1534/genetics.107.078923. PMID:17947421.

Tolkacheva, T., McNamara, P., Piekarz, E., and Courchesne, W.1994. Cloning of a Cryptococcus neoformans gene, GPA1, en-coding a G-protein a-subunit homolog. Infect. Immun. 62(7):2849–2856. PMID:8005675.

Upton, A., Fraser, J.A., Kidd, S.E., Bretz, C., Bartlett, K.H.,Heitman, J., and Marr, K.A. 2007. First contemporary case ofhuman infection with Cryptococcus gattii in Puget Sound: evi-dence for spread of the Vancouver Island outbreak. J. Clin. Mi-crobiol. 45(9): 3086–3088. doi:10.1128/JCM.00593-07. PMID:17596366.

Varma, A., and Kwon-Chung, K.J. 1989. Restriction fragmentpolymorphism in mitochondrial DNA of Cryptococcus neofor-mans. J. Gen. Microbiol. 135(12): 3353–3362. PMID:2576873.

Varma, A., and Kwon-Chung, K.J. 1992. DNA probe for strain typ-ing of Cryptococcus neoformans. J. Clin. Microbiol. 30(11):2960–2967. PMID:1452666.

Varma, A., Swinne, D., Staib, F., Bennett, J.E., and Kwon-Chung,K.J. 1995. Diversity of DNA fingerprints in Cryptococcus neo-formans. J. Clin. Microbiol. 33(7): 1807–1814. PMID:7665650.

Veron, V., Simon, S., Blanchet, D., and Aznar, C. 2009. Real-timepolymerase chain reaction detection of Cryptococcus neofor-mans and Cryptococcus gattii in human samples. Diagn. Micro-biol. Infect. Dis. 65(1): 69–72. doi:10.1016/j.diagmicrobio.2009.05.005. PMID:19679239.

Vollmer, T., Stormer, M., Kleesiek, K., and Dreier, J. 2008. Eva-luation of novel broad-range real-time PCR assay for rapid de-tection of human pathogenic fungi in various clinical

Sidrim et al. 457

Published by NRC Research Press

specimens. J. Clin. Microbiol. 46(6): 1919–1926. doi:10.1128/JCM.02178-07. PMID:18385440.

Wengenack, N.L., and Binnicker, M.J. 2009. Fungal molecular di-agnostics. Clin. Chest Med. 30(2): 391–408, viii. doi:10.1016/j.ccm.2009.02.014. PMID:19375643.

Wilbur, L., and Heyborne, R. 2009. Transient loss of consciousnesscaused by cryptococcal meningitis in an immunocompetent pa-tient: a case report. Cases J. 2(1): 60. doi:10.1186/1757-1626-2-60. PMID:19146689.

Williams, J.G.K., Kubelik, A.R., Livak, K.J., Rafalski, J.A., andTingey, S.V. 1990. DNA polymorphisms amplified by arbitraryprimers are useful as genetic markers. Nucleic Acids Res.18(22): 6531–6535. doi:10.1093/nar/18.22.6531. PMID:1979162.

Zou, C.C., Yu, Z.S., Tang, L.F., Liang, L., and Zhao, Z.Y. 2006.Primary abdominal lymphonodular cryptococcosis in children: 2case reports and a literature review. J. Pediatr. Surg. 41(3): e11–e15. doi:10.1016/j.jpedsurg.2005.11.083. PMID:16516607.

458 Can. J. Microbiol. Vol. 56, 2010

Published by NRC Research Press

Copyright of Canadian Journal of Microbiology is the property of Canadian Science Publishing and its content

may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express

written permission. However, users may print, download, or email articles for individual use.