Ras1 controls pheromone expression and response during mating in Cryptococcus neoformans

Ras1 controls pheromone expression and response during mating inCryptococcus neoformans

Michael S. Waugh,a,b Marcelo A. Vallim,a Joseph Heitman,a,b,c,d

and J. Andrew Alspaugha,b,*

a Department of Medicine, Duke University Medical Center, 1543 Busse Building, DUMC 3355, Durham, NC 27710, USAb Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, NC 27710, USAc Department of Pharmacology and Cancer Biology, Duke University Medical Center, Durham, NC 27710, USA

d The Howard Hughes Medical Institute, Duke University Medical Center, Durham, NC 27710, USA

Received 3 July 2002; accepted 12 August 2002

Abstract

The Cryptococcus neoformans Ras1 signal transduction pathway controls mating, hyphal differentiation, and the ability of this

opportunistic human fungal pathogen to grow at elevated temperatures. To further elucidate how Ras1 signals in this organism, the

RAS1 gene was disrupted in the congenic serotype D strain background. Genetic epistasis experiments indicated that Ras1 regulates

the mating response through the MAP kinase/pheromone response pathway. In fact, Ras1 is required for the transcriptional in-

duction of elements of the pheromone response pathway. However, the ability of C. neoformans Ras1 to allow growth at 37 �C is

mediated by a separate signaling pathway. Therefore a single Ras protein may differentially activate distinct downstream targets in

response to different signals within the same organism. This conserved signaling motif has been coopted in C. neoformans to regulate

mating and morphogenesis in addition to being required for its pathogenic potential.

� 2002 Elsevier Science (USA). All rights reserved.

Keywords: MAP kinase; Signal transduction; Fungi

1. Introduction

Ras proteins are highly conserved, monomeric

G-proteins that mediate a variety of signaling events.These proteins contain GTP-binding motifs and fre-

quently display C-terminal consensus sequences, pro-

viding a site for post-translational modification and

targeting of the protein to the plasma membrane (Choy

et al., 1999). These features, as well as the ability to

hydrolyze GTP, allow Ras proteins to serve as mo-

lecular switches in cell signaling processes (reviewed in

Campbell et al., 1998), especially those occurring at thecell surface.

Fungal Ras proteins are involved in cellular re-

sponses to nutrients and stress, cell cycle progression,

and cAMP production (Engelberg et al., 1994; Jiang

et al., 1998; Thevelein, 1994). In Saccharomyces cere-

visiae and the closely related yeast Candida albicans,

Ras plays a dual role to activate a MAP kinase cascade

and to regulate cAMP production (Lorenz and Heit-man, 1997; M€oosch et al., 1996, 1999). These distinct

pathways coordinately control the yeast-to-hyphal

morphological transition in these organisms, demon-

strating a conserved role for Ras proteins to regulate

cellular differentiation. The ability to form hyphae is

correlated with pathogenesis of C. albicans, and Ras

plays a major role in virulence of this organism (Le-

berer et al., 2001).S. cerevisiae Ras2 is a primary regulator of adenylyl

cyclase (Kataoka et al., 1984; Toda et al., 1985), whereas

Ras proteins in the fission yeast Schizosaccharomyces

pombe do not play a major role in controlling cAMP

concentrations (Hughes, 1995). Instead, the S. pombe

Ras1 protein activates the MAP kinase cascade that

functions during pheromone response and mating

(Nielsen et al., 1992). These seemingly conflicting

Fungal Genetics and Biology 38 (2003) 110–121

www.elsevier.com/locate/yfgbi

* Corresponding author. Fax: 1-919-684-8902.

E-mail address: [email protected] (J. AndrewAlspaugh).

1087-1845/02/$ - see front matter � 2002 Elsevier Science (USA). All rights reserved.

PII: S1087-1845 (02 )00518-2

mail to: [email protected]

observations can be accommodated in models in whichRas proteins regulate both MAP kinase and cAMP

signaling, but play more predominant roles in regulating

one or the other pathway in different organisms.

Cryptococcus neoformans is a basidiomycetous fungus

and a significant human pathogen with worldwide dis-

tribution (Mitchell and Perfect, 1995). This organism

offers a powerful genetic model system to study the

molecular mechanisms of differentiation and pathoge-nicity in a divergent lower eukaryote. Initial experiments

defining the Ras pathway in a serotype A strain of

C. neoformans indicated that Ras1 mediates MAP ki-

nase, cAMP, and Ras-specific signal transduction

pathways (Alspaugh et al., 2000). Although, C. neofor-

mans ras1 mutant strains were viable, they were unable

to grow at 37 �C and were thus avirulent in rabbit and

murine models of cryptococcosis (Alspaugh et al., 2000;Waugh et al., 2002). The high temperature growth defect

of C. neoformans ras1 mutant strains was associated

with a failure of actin polarization at elevated temper-

ature (Waugh et al., 2002), a phenotype shared by

S. cerevisiae ras2 mutants (Ho and Bretscher, 2001).

Additionally, C. neoformans Ras1 controls morpho-

logical differentiation. Introduction of a dominant active

RAS1 allele induces hyphal growth, and ras1 mutantsare unable to undergo a hyphal transition during mat-

ing. Interestingly, the ras1 mutant mating defect can be

suppressed by overexpressing MAP kinase signaling el-

ements that regulate the pheromone response pathway

(Alspaugh et al., 2000).

Here we apply a genetic approach to elucidate the

Ras1 signaling pathways in C. neoformans. ras1 mutants

previously studied were isolated only in a serotype AMATa C. neoformans strain background for which there

is no congenic (MATa) mating partner. While C. neo-

formans can mate across serotypes, such mating reac-

tions are not as efficient as mating between congenicstrains and do not allow true genetic analyses. There-

fore, we disrupted the RAS1 gene in the congenic sero-

type D strains. These experiments established that ras1

mutant phenotypes first observed in the serotype A

strains, including alterations in growth at 37 �C and in

mating, are conserved in serotype D strains. This ap-

proach also allowed us to explore a more detailed and

mechanistic analysis of the role of Ras1 in C. neofor-

mans pheromone response, mating, and haploid fruiting

that underscores a direct link between Ras1 signaling

and the MAP kinase pathway.

2. Materials and methods

2.1. Strains and media

The strains used in this study are listed in Table 1.

Standard yeast media were used for most experiments

as described (Sherman, 1991). V8 mating medium was

prepared, as previously described (Kwon-Chung and

Bennett, 1992). Melanin production was assessed on

Niger seed agar (Kwon-Chung and Bennett, 1992).

Capsule production was assessed in Dulbecco�s modi-fied Eagle�s medium with 22mM sodium bicarbonate

(Granger et al., 1985). Haploid filamentation was as-

sessed on filament agar (Wickes et al., 1996). When

indicated, galactose was added at a concentration of

3%.

2.2. PCR

Unless otherwise stated, all PCR reactions were per-

formed in a Perkin–Elmer GeneAmp 9600 thermocycler

with 50 ng template DNA, 100 ng of each oligonucleo-

Table 1

Strain Genotype Reference

JEC20a MATa wild-type, congenic with JEC21 Kwon-Chung et al. (1992)

JEC21 MATa wild-type, congenic with JEC20 Kwon-Chung et al. (1992)

JEC43 MATa ura5 Wickes et al. (1997)

JEC155 MATa ura5 ade2 Moore and Edman (1993)

JEC156 MATa ura5 ade2 Moore and Edman (1993)

MWC1a MATa ura5 ade2 ras1::ADE2 This study

MWC2 MATa URA5 ade2 ras1::ADE2 This study

MWC3 MATa ura5 ade2 RAS1 This study

MWC4 MATa URA5 ADE2 RAS1 This study


MWC6 MATa ura5 ade2 ras1::ADE2 This study

MWC7 MATa ura5 ade2 RAS1 This study


MWC9 MATa URA5 ade2 RAS1 This study


MWC11 MATa ura5 ade2 ras1::ADE2 This study

MWC18 MATa ade2 ras1::ADE2 pGPD1-MFa1 This study

a Parental strains in genetic cross.

M.S. Waugh et al. / Fungal Genetics and Biology 38 (2003) 110–121 111

tide primer, and standard reagents from the TaKaRaKit (Takara Shuzo).

2.3. Identification and disruption of the RAS1 gene

The identification of the serotype A C. neoformans

RAS1 gene has been previously described (Alspaugh

et al., 2000). The 1.9 kb serotype D RAS1 locus was

amplified by PCR from JEC21 genomic DNA usingprimers based on the serotype A RAS1 sequence: 2260

(50-TCAGCGGCCGAAGCGTAATT) and 2262 (50-CAAGTATTGTTATGAAATGAT). To determine in-

tron/exon boundaries, the RAS1 cDNA was amplified

from a cDNA library of strain B-3501 (serotype D)

using the following primers: 2934 (50-CATGTCC

CAGGCTCAATTTTTG) and 2935 (50-CCATAGG

CTCTACGCACTCCC).The RAS1 gene was disrupted in the congenic sero-

type D background by biolistic transformation and

homologous recombination, as previously described

(Davidson et al., 2000). Briefly, a ras1::ADE2 disruption

allele was constructed by cloning the ADE2 gene as a

selectable marker into the RAS1 locus by yeast gap

repair (Ma et al., 1987), deleting 279 nucleotides of

RAS1 coding sequence. To increase homologous re-combination at the RAS1 locus, the ends of the ra-

s1::ADE2 linear disruption construct were blocked with

dideoxyadenine and terminal deoxynucleotidyl trans-

ferase (Shah-Mahoney et al., 1997). The linear, dideoxy-

tailed ras1::ADE2 disruption construct was transformed

into a serotype D ade2 ura5 strain (JEC155) by biolistic

DNA delivery (Toffaletti et al., 1993). Transformants

were selected on synthetic medium lacking adenine with1M sorbitol.

Genomic DNAwas isolated from 24 transformants by

themethod of Pitkin et al. (1996) and used as the template

for a PCR with the RAS1 specific primer 5022 (50-GT

GTTGGGAAGTCTGCCTTGACG) and the ADE2

specific primer 1831 (50-CTCGTACGACGGCAATAA

AGGC) to identify strains in which a targeted disruption

of the wild-type RAS1 locus had occurred. The PCRconditions were 94 �C for 5min followed by 35 cycles of

94 �C for 30 s, 50 �C for 30 s, and 72 �C for 90 s. A 1.2 kb

PCR fragment was produced in those strains in which the

RAS1 gene had been replaced by the ras1::ADE2mutant

allele.

Southern hybridization confirming disruption of the

RAS1 gene in strain MWC1 was performed by digesting

20 lg of genomic DNA from strains JEC21 and MWC1with HindIII and with PstI. Electrophoresis, DNA

transfer, prehybridization, hybridization, and autoradi-

ography were performed as described (Sambrook et al.,

1989). The JEC21 RAS1 gene from the start to the stop

codon was used as the probe, using the Random Primed

DNA Labeling Kit (Boehringer–Mannheim) and

[32P]dCTP (Amersham).

2.4. Northern analysis

The RAS1 wild-type strain (JEC21), a ras1 mutant

strain (MWC8), and the ras1+MFa1 strain (MWC18)

were incubated in YPD medium for 24 h at 30 �C. Thestrains were transferred to V8 mating medium and in-

cubated for 24 h at 30 �C. An identical aliquot was

coincubated with an equal number of MATa wild-type

(JEC20) cells on V8 mating medium for 24 h. The cellsfrom each incubation were harvested and immediately

frozen on dry ice. Total RNA was extracted with the

RNeasy Mini Kit (Qiagen) and analyzed by Northern

hybridization by standard methods (Sambrook et al.,

1989). The RAS1, MF a1 pheromone, CPR1a phero-

mone receptor, GPB1 Gb protein, GPA1 Ga protein,

STE20a PAK kinase, and ACT1 (actin) cDNAs were

used as probes.

2.5. PCR amplification of RAS1 from progeny of RAS1

wild-type and ras1 mutant strains

PCRs, using genomic DNA from strains JEC20 and

MWC1-MWC11 as template, amplified either a 1.3 kb

(RAS1) or 3.8 kb (ras1::ADE2) fragment with the fol-

lowing primers: 5022 and 2384 (50-GCGTGAATATAAGCTTGTCG). The PCR conditions were as fol-

lows: 94 �C for 5min followed by 35 cycles of 94 �C for

30 s, 50 �C for 30 s, and 72 �C for 3min.

2.6. Mating assay

All strains were initially grown for 48 h on YPD

medium at 25 �C. Cells for each strain were resuspendedin water at 108 cells/ml. Five ll of the cell suspension for

each strain was mixed with 5 ll of the suspension of the

appropriate mating partner and plated as a drop on V8

mating agar. The mating patches were incubated in the

dark at 25 �C for 14 days and microscopically assessed

daily during this time for the appearance of hyphae and

other mating structures. Quantitative mating experi-

ments were performed, as previously described (Alsp-augh et al., 2000) by harvesting mating patches in water

and quantitatively culturing the supernatant on syn-

thetic medium lacking adenine and containing 5-fluo-

roorotic acid to measure recombinant spore production.

2.7. Confrontation assay

All strains were initially grown for 48 h on YPDmedium at 25 �C. Using a sterile toothpick, cells were

selected from a single colony and streaked to a filament

agar plate. Cells from the opposite mating type were

then selected from a single colony, using a new sterile

toothpick, and streaked as close to the first streak of

cells as possible without touching. The patches were

incubated at room temperature in the dark for 4 days

112 M.S. Waugh et al. / Fungal Genetics and Biology 38 (2003) 110–121

and microscopically assessed daily during this time forthe appearance of hyphae or other morphological

changes.

2.8. Haploid fruiting assays

All strains were initially grown for 48 h on YPD

medium at 25 �C. Cells for each strain were resuspended

in water at 108 cells/ml. Five ll of the cell suspension foreach strain was plated as a drop on filament agar. The

patches were incubated in the dark at room temperature

for 21 days and microscopically assessed during this

time for the appearance of hyphae or other morpho-

logical changes.

2.9. Transformation with MAP kinase signaling elements

Plasmids overexpressing various components of the

MAP kinase/pheromone response pathway (Gpb1,

MFa1, Ste12a) were biolistically transformed into the

ura5 ras1 mutant strain MWC1 and into the ura5

RAS1 strain JEC43. Transformants were selected on

synthetic medium lacking uracil with 1M sorbitol

(Toffaletti et al., 1993). Sixteen Uraþ transformants for

each transformed vector were colony purified on syn-thetic medium lacking uracil. Each transformant was

incubated in a mating reaction with strain JEC20 on

V8 mating medium (pGPD1-MFa1 transformants) or

V8-galactose medium (pGAL7-GPB1 and pGAL7-

STE12a transformants) and incubated at 25 �C for 14

days in the dark. These strains were also incubated on

filament agar (or galactose-filament agar) for 21 days

at 25 �C in the dark to assess haploid fruiting. TheGAL7-GPB1 and GPD1-MFa1 plasmids were previ-

ously described (Wang et al., 2000). The GAL7-STE12

a plasmid (pCGS-1) was also previously described

(Wickes et al., 1997).

3. Results

3.1. Identification and disruption of the RAS1 gene in a

serotype D C. neoformans strain

Oligonucleotide primers based on the serotype A

RAS1 sequence (Alspaugh et al., 2000) were used to

amplify a 1.9 kb PCR fragment encompassing the entire

RAS1 locus from genomic DNA of the serotype D

strain JEC21. Analysis of cDNA sequence revealed thatinitiation and termination codons as well as intron–exon

junctions were conserved with the serotype A RAS1

gene. There are 169 single nucleotide polymorphisms

between the serotype A and serotype D RAS1 coding

sequences. Of these, 140 are in introns, 24 are silent

changes, and five result in amino acid substitutions. The

nucleotide sequence of the RAS1 locus from C. neofor-

mans strain JEC21 has been submitted to the GenBankdatabase under Accession No. AF294647.

The RAS1 gene was disrupted by biolistic transfor-

mation and homologous recombination using the

C. neoformans ADE2 gene as the selectable marker

(Perfect et al., 1993; Sudarshan et al., 1999) and a se-

rotype DMATa ade2 ura5 strain (JEC155) as the re-

cipient strain. Southern hybridization confirmed that

the RAS1 gene had been precisely replaced by theras1::ADE2 disruption allele in 1 of the 24 Adeþ

transformants, and no ectopic copies of the disruption

allele were present.

To follow the effects of the ras1 mutation in a genetic

cross, the MATa ras1 ura5 mutant strain (MWC1) was

mated with a wild-type MATa strain (JEC20). After

prolonged incubation (28 days), sufficient mating oc-

curred to allow dissection of 15 basidiospores, of whichten germinated. Among these 10 first generation (F1)

progeny, mating type segregated approximately 1:1

(Table 1, strains MWC2–MWC11). PCR using RAS1-

specific primers and genomic DNA from each strain

revealed that 6 of the 10 progeny strains were

ras1::ADE2 mutants and four were RAS1 wild-type

(Fig. 1A).

The ras1 mutant strains displayed a significantgrowth defect at 37 �C (Fig. 1B). The RAS1 wild-type

and ras1 mutant strains grew equally well at 25 �C on

YPD and minimal media. However, the ability to grow

at 37 �C cosegregated with a wild-type RAS1 gene.

Compared to wild-type strains, the ras1 mutants dis-

played no alterations of the inducible virulence deter-

minants melanin or capsule.

3.2. Ras1 controls early steps in mating

When C. neoformans strains of opposite mating type

are coincubated under conditions of nutrient depriva-

tion and desiccation, mating occurs and results in the

formation of hyphae with terminal basidia and long

chains of basidiospores (Kwon-Chung, 1976). This fil-

amentous response provides a qualitative assessment ofmating efficiency. Both MATa ras1 and MATa ras1

strains were cocultured on V8 mating medium with a

wild-type strain of the opposite mating type. Only rare

mating filaments were present in mating reactions in

which one of the mating strains was a ras1 mutant,

even after 14 days of incubation. In contrast, abundant

mating filaments, basidia, and basidiospores were ob-

served in mating assays between RAS1 wild-typestrains over the same time period (Fig. 2A). Rare

mating filaments were observed in crosses of ras1

mutant strains with wild-type strains after a prolonged

incubation (>21 days), but the extent of mating never

approached wild-type levels. No mating filaments were

observed when MATa ras1 and MATa ras1 mutants

were crossed.


http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=nucleotide&cmd=search&term=AF294647

3.3. Suppression of the ras1 mutant mating defect by

conserved signaling elements

Previous epistasis experiments suggested that Ras1might function upstream of a pheromone response/MAP

kinase pathway to activate C. neoformans mating (Alsp-

augh et al., 2000). To address the interaction of Ras1 and

MAP kinase signaling components, the MATa RAS1

wild-type and ras1mutant strains were transformed with

plasmids overexpressing components of the pheromone-

response pathway in C. neoformans, including the MFa1pheromone, the Gb protein Gpb1, and the transcriptionfactor Ste12a. Overexpression of either the MF a1 or the

GPB1 gene partially suppressed the mating defect of the

ras1 mutant, as demonstrated qualitatively by partial

restoration of a filamentous mating response (Fig. 2B).

In contrast, overexpression of the Ste12a transcrip-

tion factor, encoding a putative downstream target of

the pheromone-induced/MAP kinase pathway, did not

suppress the ras1 mutant mating defect. The GAL7-

STE12a plasmid pCGS-1 was biolistically transformed

into the ras1 ura5 strain MWC1. Fifty independenttransformants were isolated and placed in mating reac-

tions with the MATa strain JEC20 on V8 mating me-

dium with and without galactose. No mating filaments

were observed in these crosses, even after four weeks of

incubation. The pCGS-1 plasmid was functional since it

supported galactose-induced haploid filamentation in a

wild-type strain (described below). A RAS1 wild-type

strain transformed with the same plasmid demonstratednormal mating filamentation on V8 mating medium

with or without galactose.

None of the ras1 mutant strains overexpressing MAP

kinase components or the Ste12a transcription factor

was able to grow at 37 �C. This finding supports a model

in which Ras1 signals upstream of the pheromone re-

Fig. 1. Disruption of the RAS1 gene in congenic serotype D strains of C. neoformans. (A) A genetic cross between a RAS1 wild-type (JEC20) and ras1

mutant (MWC1) strain resulted in isolation of 10 F1 progeny (MWC2–MWC11), among which four had a wild-type RAS1 locus and six were ras1

mutants. Genomic DNA from both the parental and F1 strains was used as the template for PCRs using RAS1-specific primers, amplifying either a

1.3 kb (RAS1) or 3.8 kb (ras1::ADE2) product. (B) The ras1 mutation and a growth defect at 37 �C cosegregate in meiotic progeny. RAS1 wild-type

and ras1 mutant strains were incubated on YPD medium for 48 h at 30 and 37 �C.


sponsive MAP kinase pathway during mating but acti-

vates other targets to promote growth at elevated tem-perature and virulence.

3.4. Quantification of mating

The effect of a ras1 mutation on C. neoformans

mating was quantified by determining the number of

recombinant spores from a two-week-old mating mix-

ture. Equal numbers of cells from a MATa RAS1 wild-type strain (JEC21), a MATa ras1 mutant strain

(MWC10), and a MATa ras1 strain overexpressing the

MFa1 pheromone gene (ras1+MFa1, MWC18) were

incubated in mating mixtures with a MATa RAS1 ade2

lys1 strain (JEC156). Cell suspensions from these mating

reactions were plated to synthetic medium lacking ade-

nine and containing 5-fluoroorotic acid to select re-

combinant Adeþura� progeny. Neither the parentalstrains nor the hyphal heterokaryon grow on this me-

dium. After two weeks of incubation, we detected a 300-

fold decrease in mating efficiency of the ras1 mutant

strain compared to wild-type. For every 107 MATa Ras1

cells mated, 1:2� 106 Adeþura� recombinant progeny

colonies were obtained. In contrast, for every 107 MATaras1 cells originally mated, only 4� 103 Adeþura� col-

onies were recovered (p ¼ 0:002). This represents a 300-

fold decrease in mating efficiency due to the ras1

mutation, similar to the level of mating impairment

observed in the mfa1,2,3 triple pheromone gene mutant

strain (Shen et al., 2002). Overexpression of the MFa1pheromone gene in the ras1mutant background resulted

in greater than a 10-fold increase in recombinant spore

recovery compared with the ras1 mutant strain. There-

fore, Ras1 controls other events in the mating response

pathway, in addition to pheromone production.

3.5. Ras1 is required for haploid fruiting in C. neoformans

In response to extreme desiccation and nitrogen

starvation, MATa C. neoformans strains can filament

and sporulate in the absence of a mating partner by a

process termed haploid fruiting (Wickes et al., 1996).

The haploid fruiting filaments are similar to but distinctfrom mating filaments and are uninucleate, have un-

fused clamp connections, and produce numerous blas-

tospores and only MAT a basidiospores. Constitutive

activation of the Ras1 signaling pathway results in ac-

celerated haploid fruiting, even among strains that do

not readily undergo this filamentous differentiation

(Alspaugh et al., 2000). To further examine a role for

Fig. 2. Ras1 is required for C. neoformans mating. (A) TheMATa Ras1 wild-type strain (JEC21),MATa RAS1 wild-type strain (JEC20),MATa ras1

mutant strain (MWC8), and the MATa ras1 mutant strain (MWC2) were coincubated for 7 days in mating reactions on V8 medium with strains of

opposite mating type. (B) The ras1mutant strain was transformed with the pGPD1-MFa1 and pGAL7-GPB1 plasmids. The transformed strains were

coincubated with a MATa RAS1 wild-type strain (JEC20) on V8 mating medium for 7 days. The edges of the mating reactions were assessed for

filamentation as a marker of mating and photographed (100�).


Ras1 in haploid fruiting, prototrophic RAS1 wild-type

(JEC21) and ras1 mutant strains (MWC8 and MWC10)were incubated on filament agar at 25 �C in the dark.

After 14 days, the RAS1 wild-type strain exhibited ro-

bust haploid fruiting. In contrast, no haploid fruiting

occurred in the ras1mutant strains, even after 28 days of

incubation (Fig. 3A).

Since components of the pheromone response path-

way were able to suppress the ras1 mutant mating de-

fect, the effect of overexpression of these proteins onhaploid fruiting was also assessed. In contrast to the

partial effect on mating, overexpression of the phero-

mone response genes MFa1 or GPB1 failed to suppress

the ras1 mutant defect in haploid fruiting (data not

shown). Therefore, Ras1 likely controls haploid fruiting

in a pheromone-independent manner, and in a way

distinct from its role in the mating response.

Overexpression of the STE12a transcription factorgene has been previously demonstrated to induce hap-

loid fruiting in a wild-type strain of C. neoformans

(Wickes et al., 1997). The effect of a ras1 mutation on

Ste12a-induced filamentation was assessed by overex-

pression of this gene under control of the GAL7 pro-

moter. Introduction of the GAL7-STE12a plasmid

(pCGS-1) into a MATa RAS1 wild-type strain resulted

in accelerated haploid filamentation in a galactose-in-ducible manner. In contrast, no hyphae were observed in

50 independent MATa ras1 mutant strains transformed

with the pCGS-1 plasmid on glucose or galactose-con-taining media after two weeks of incubation (Fig. 3B).

3.6. Ras1 is required for pheromone production and

response

To understand the mechanisms by which Ras1 affects

cryptococcal mating and hyphal formation, confronta-

tion assays between MATa and MATa cells were con-ducted. The earliest events in the cryptococcal mating

process involve pheromone production and recognition

and a resulting initiation of hyphal differentiation prior

to cell fusion (Moore and Edman, 1993). The morpho-

logical changes occurring in individual cells can be ob-

served when C. neoformans strains of opposite mating

type are grown on nutrient-poor medium in confronta-

tion. In such an assay, wild-type MATa cells typicallyproduce hyphae within 2 days, the majority of which are

directed toward the opposite mating partner. Similarly,

MATa cells undergo a moderate filamentous response,

but the cells also enlarge and become highly refractile.

These cellular changes are likely a form of cellular dif-

ferentiation along a pheromone gradient. When either

strain in a confrontation assay was a ras1 mutant,

no hyphae were evident even after 72 h of incubation(Fig. 4).

Fig. 3. Ras1 is required for C. neoformans haploid fruiting and Ste12a-induced filamentation. (A) To assess the effect of a ras1 mutation on haploid

fruiting, theMATa ras1 wild-type (JEC21) and ras1mutant (MWC8) strains were incubated on filament agar for 21 days. The edge of each patch was

assessed microscopically for haploid fruiting and photographed (100�). (B) The RAS1 ura5 (JEC43) and ras1 ura5 (MWC1) strains were transformed

with the pGAL7-STE12a plasmid pCGS-1. The transformed strains were incubated on filament agar containing glucose or galactose as the carbon

source for 7 days (40�).


To determine if reduced pheromone activity alone

accounted for the failure of cellular response in con-

frontation assays, we also tested the ras1+MFa1 strain

(MWC18) in confrontation with the wild-type MATa

strain JEC20. Overexpression of the MFa1 pheromone

gene in the ras1 mutant strain resulted in restoration of

the cellular changes that occur at a distance in the

confronting MATa strain but failed to restore the hy-

phal response of the MATa ras1 strain itself (Fig. 4).

Therefore, the ras1 mutant is defective not only in

pheromone production, but also in its response to a

mating partner.

3.7. Ras1 regulates transcription of pheromone response

pathway genes

Northern analysis was performed to determine if

Ras1 controls C. neoformans pheromone activity at the

level of transcription. A MATa RAS1 wild-type strain

(JEC21), ras1 mutant strain (MWC8), and ras1+MFa1strain (MWC18) were incubated for 24 h on V8 medium

alone or in a mating reaction with the MATa strain

JEC20. Total RNA was extracted from recovered cells

and analyzed by Northern hybridization using as probes

the MFa1 pheromone gene, the CPR1a pheromone re-

ceptor gene, the Gb protein gene GPB1, the Ga protein

gene GPA1, the PAK kinase gene STE20a, and the actin

gene ACT1 (Fig. 5). Importantly, the transcriptionalactivity of the a-specific genes STE20a, MFa1, and

CPR1a appears 2-fold diluted in the mating reaction

Fig. 4. Ras1 controls early morphological events in C. neoformans

mating. The MATa Ras1 wild-type (JEC21), MATa RAS1 wild-type

(JEC20), MATa ras1 mutant (MWC8), the MATa ras1 mutant

(MWC2), and the MATa ras1 mutant strain expressing the MFa1 gene

(MWC18) were analyzed for filamentous differentiation in response to

confrontation with a mating partner. MATa and MATa strains were

inoculated on nutrient-poor filament agar in close proximity without

physically contacting each other. The region between the two strains

was assessed for hyphal formation at 72 h and photographed (200�).

Fig. 5. Ras1 regulates transcription of genes in the pheromone re-

sponse pathway. A MATa Ras1 wild-type strain (JEC21), ras1 mutant

strain (MWC8), and ras1+GPD1-MFa1 strain (MWC18) were incu-

bated on V8 mating agar in the presence or absence of a MATamating

partner (JEC20). The cells were harvested, and total RNA was ana-

lyzed by Northern analysis using the a-pheromone gene MFa1, a-pheromone receptor gene CPR1a, Gb protein gene GPB1, Ga protein

gene GPA1, PAK kinase gene STE20a, and the actin ACT1 gene as

probes.


lanes since one-half of the total RNA is contributed bythe MATa mating partner.

In contrast to the RAS1 wild-type strain, the ras1

mutant strain displayed a marked decrease in MFa1transcript at baseline and under the normal inducing

conditions of a mating reaction. Additionally, the

transcription of the CPRa1 and GPB1 genes was also

dramatically decreased in the ras1 mutant compared to

the wild-type strain. Both of these genes encode proteinsthat help compose the pheromone receptor/G-protein

complex. Introduction of the MFa1 gene under control

of the constitutive GPD1 promoter into the ras1 mutant

strain restored a-pheromone message; however, it failed

to restore wild-type levels of CPR1a or GPB1 (Fig. 5).

Therefore, Ras1 plays a central role in controlling the

transcription of three genes encoding pheromone re-

sponse signaling proteins.Mutation of the RAS1 gene had no effect on the ex-

pression of the Ga protein gene GPA1 or the PAK ki-

nase gene STE20a, although MFa1 overexpression did

marginally increase expression of these genes (2� and

1.6�, respectively) (Fig. 5). Although these proteins are

also involved in C. neoformans mating (Alspaugh et al.,

1997; Wang et al., 2002), they are not directly coupled to

the pheromone/pheromone receptor complex. There-fore, the effect of Ras1 on transcription is limited to

certain elements of the pheromone response pathway.

4. Discussion

Ras proteins are highly conserved, small monomeric

G-proteins that regulate an array of intracellular path-ways to allow cellular responses to external stimuli. The

C. neoformans RAS1 gene was previously identified and

demonstrated to regulate mating and filamentation,

agar adherence, and high temperature growth (Alsp-

augh et al., 2000). Subsequently, the high temperature

growth defect of the ras1 mutant strain helped to define

a conserved role of Ras proteins in controlling actin

polarization in vegetative yeast cells in a temperature-dependent manner (Waugh et al., 2002). In contrast to

S. cerevisiae and C. albicans, C. neoformans Ras1 does

not appear to play a significant role in cAMP homeo-

stasis. In this study, we used genetic approaches to

further characterize the role of Ras1 in C. neoformans

mating and hyphal development. By creating a targeted

disruption of the RAS1 gene in the congenic C. neofor-

mans serotype D strains, we isolated F1 progeny from across between the ras1 mutant strain and a wild-type

strain and demonstrated cosegregation of the ras1 mu-

tation with defects in mating, haploid fruiting, and

growth at 37 �C. Genetic epistasis and transcriptional

profiling in these strains elucidated downstream effectors

of Ras1 involved in the mating process and in hyphal

development.

Microscopic analysis of the attenuated mating activ-ity of the ras1 mutant revealed alterations in the earliest

mating events, as haploid yeast cells first initiate fila-

mentous differentiation in response to a pheromone

signal from a mating partner. In contrast to wild-type

strains, ras1 mutants failed both to form hyphae in

confrontation with a mating partner and also failed to

induce hyphal formation in a distant confronting strain.

By Northern blot analysis, Ras1 was demonstrated toplay a major role in the transcriptional regulation of

genes in the pheromone response pathway. Interestingly,

Ras1 is not required for the transcription of STE20a,encoding a PAK kinase homolog that may act down-

stream of the pheromone receptor/G-protein complex

(Wang et al., 2002). Therefore, all genes in the mating

response pathway are not under Ras1 control. Similarly,

Ras1 does not significantly regulate the Ga protein geneGPA1 at the level of transcription. Gpa1 plays an im-

portant role in the C. neoformansmating response, but it

acts in a pathway distinct from the pheromone response

cascade. Instead, Gpa1 functions upstream of adenylyl

cyclase to regulate cAMP levels in response to nutrient

deprivation or other stress signals (Alspaugh et al., 1997;

Alspaugh et al., 2002).

The expression of MFa1 and GPB1 has been previ-ously demonstrated to be induced by nutrient depriva-

tion signals (Shen et al., 2002; Wang et al., 2000).

However, the effect of Ras1 on the expression of these

genes is unlikely to be directly related to nutrient de-

privation signaling since transcription of the GPA1 gene

is also induced by nitrogen deprivation (Tolkacheva

et al., 1994) but unaffected by mutation of RAS1.

In other fungi, Ras proteins also play central roles inthe transcriptional regulation of genes involved in

pheromone response and cellular differentiation. The

human fungal pathogen C. albicans possesses a single

RAS gene, CaRAS1. In a C. albicans ras1/ras1 homo-

zygous mutant strain, transcription of two genes in-

volved in the yeast-to-hyphal transition, SAP4-6 and

HWP1, is dramatically decreased compared to wild-type

strains, and this defect was suppressed by overexpres-sion of the MAP kinase component Hst7 (Leberer et al.,

2001).

Ras proteins in the budding yeast S. cerevisiae also

regulate cellular processes by signaling through phero-

mone response pathways. For example, Ras2-induced

filamentous differentiation in diploid S. cerevisiae strains

is dependent on a conserved MAP kinase pathway, in-

cluding the pheromone signaling molecules Ste20, Ste11,Ste7, and Ste12 (M€oosch et al., 1996, 1999).

Additionally, the Ras1 protein in the fission yeast S.

pombe also controls mating pheromone activity and re-

sponse. S. pombe ras1 mutant strains are sterile, and the

pheromone-regulated gene mat1-Pm is not induced in

the absence of Ras1 activity (Nielsen et al., 1992). An

activated S. pombe ras1val17 allele dramatically induces


the transcription of this pheromone-regulated gene, butit does not bypass the requirement for nitrogen depri-

vation and pheromone to initiate mat1-Pm transcription

(Nielsen et al., 1992).

More recently, a mechanism by which a single Ras

protein may differentially activate distinct downstream

effectors was described in S. pombe. Ras1 in this yeast

activates the Byr2 MEKK homolog, mediating the

pheromone signal and mating. Additionally, Ras1 alsoactivates Scd1, a presumed guanine nucleotide exchange

factor for Cdc42, controlling cell morphology. The ac-

tivation of S. pombe Ras1 by different upstream ex-

change factors determines which downstream target is in

turn activated by Ras1. Efc25 was determined to be the

specific Ras-GEF for the Scd1/cell morphology path-

way, and Ste6 likely serves as the Ras-GEF for acti-

vating the Byr2/pheromone signaling pathway(Papadaki et al., 2002). This model of fungal Ras sig-

naling is strikingly similar to the case of C. neoformans

in which mating and cellular morphology are controlled

by a single Ras protein. Additionally, the molecular

targets regulating these different processes are distinct.

The role of C. neoformans Ras1 in pheromone re-

sponse and cellular differentiation is clearly more com-

plex than simple transcriptional control of one or moresignaling molecules. Such a model must explain the

following observations. First, after prolonged incuba-

tion, ras1 mutants eventually mate and form basi-

diospores, though with strikingly reduced efficiency

compared to wild-type strains. Second, overexpression

of the upstream components of the pheromone-induced

MAP kinase pathway, MF1 and Gpb1, only partially

suppresses the ras1 mutant mating defect and fails tosuppress the haploid fruiting defect of this strain. Third,

overexpression of STE12a, which normally induces

MFa1 expression in a wild-type strain (Wickes et al.,

1997), fails to suppress the mating defect of the ras1

mutant strain.

The low level of mating present in the ras1 mutant

strain my be indicative of a basal, uninduced phero-

mone activity that allows a minimal amount of cellfusion and hyphal differentiation. Alternatively, fusion

of MATa and MAT a cells may not absolutely depend on

a pheromone signal, thus allowing the degree of mating

observed in the ras1 mutant strain. This hypothesis has

recently been confirmed in C. neoformans mutant

strains in which all three a-pheromone genes were dis-

rupted. Even in the complete absence of pheromone

produced in the MATa strain, approximately 1% of cellsstill mated in quantitative mating assays (Shen et al.,

2002). This degree of mating is very similar to that

quantified in mating reactions involving the ras1 mutant

strains.

The observation that overexpression of individual

pheromone response molecules only partially restores

mating in the ras1 mutant background can be explained

by the finding that the transcription of multiple phero-mone-responsive genes is under Ras1 control. There-

fore, overexpression of theMFa1 pheromone gene in the

ras1 mutant strain increases mating activity but cannot

completely compensate for the lower levels of phero-

mone receptor or its associated Gb protein Gpb1.

However, it is also possible that Ras1 is involved in

pheromone-independent signaling processes that regu-

late cellular differentiation. The haploid fruiting defectof the ras1 mutant strain was not suppressed by over-

expression of pheromone-response elements. Other

mechanisms by which C. neoformans Ras1 may regulate

hyphal differentiation in a pheromone-independent

manner include its effect on the actin cytoskeleton. Actin

depolarization is altered in a temperature-dependent

fashion in ras1 mutant strains, preventing normal veg-

etative yeast growth at elevated temperatures (Waughet al., 2002). A related but more subtle cytoskeletal

defect may similarly prevent hyphal growth at lower

temperatures.

Additionally, we hypothesize that Ras1 and the

transcription factor Ste12a play complementary and

non-redundant roles in regulating haploid fruiting in

C. neoformans. The STE12a gene encodes a transcrip-

tion factor homologous to proteins in other fungi thatpredominantly mediate a pheromone signal (Chang et

al., 2000; Wickes et al., 1997), and Ste12a dramatically

induces MFa1 transcription when overexpressed (Wic-

kes et al., 1997). However, ste12a mutant strains are

only modestly reduced for mating competency (Chang et

al., 2000; Wickes et al., 1997). Additionally, both Ste12aand Ras1 proteins induce hyphal formation in the ab-

sence of a mating partner when overexpressed (Alsp-augh et al., 2000; Wickes et al., 1997). Therefore, the

primary role of the Ste12a transcription factor may not

be to mediate the C. neoformans pheromone response in

mating.

Previous reports demonstrated that Ste12a is re-

quired for the hyphal differentiation in response to in-

troduction of a dominant active RAS1Q67L allele (Yue

et al., 1999). Here we demonstrate that Ras1 is requiredfor hyphal induction by Ste12a overexpression. These

results are best supported by a model in which these two

signaling molecules act in separate pathways that are

both required for effective hyphal differentiation in

C. neoformans.

In summary, these investigations into the mechanisms

of Ras signaling in C. neoformans growth and differen-

tiation have elucidated conserved and novel aspects ofsignal transduction in this human fungal pathogen.

Similar to the case in other fungi,C. neoformansRas1 is a

central regulator of the pheromone response/MAP ki-

nase pathway that promotes hyphal differentiation.

C. neoformans Ras1 also controls pheromone-indepen-

dent signaling mechanisms essential for filamentation,

development, and pathogenicity.


Acknowledgments

We thank Cameron DeCesare for technical assistance

and Ping Wang for providing plasmid pGAL7-GPB1,

Brian Wickes for providing plasmid pCGS-1 (GAL7-

STE12a), and Wei-Chiang Shen for providing plasmid

pGPD1-MFa1. This work was supported by NIHGrants

AI01556 (JAA), AI39115, AI41937, and AI42159 (JH).

This work was also supported by a P01 Award AI44975from the NIH to the Duke University Mycology Re-

search Unit. Michael Waugh is a Howard Hughes Med-

ical Institute Medical Student Research Training Fellow.

Joseph Heitman is a Burroughs Wellcome Scholar in

Molecular Pathogenic Mycology and an associate inves-

tigator of the Howard HughesMedical Institute. Andrew

Alspaugh is a Merck Young Investigator in Medical

Mycology (IDSA) and a BurroughsWellcome FundNewInvestigator in Molecular Pathogenic Mycology.

References

Alspaugh, J.A., Perfect, J.R., Heitman, J., 1997. Cryptococcus neofor-

mansmating and virulence are regulated by the G-protein a subunit

Gpa1 and cAMP. Genes Dev. 11, 3206–3217.

Alspaugh, J.A., Cavallo, L.M., Perfect, J.R., Heitman, J., 2000. RAS1

regulates filamentation, mating and growth at high temperature of

Cryptococcus neoformans. Mol. Microbiol. 36, 352–365.

Alspaugh, J.A., Pukkila-Worley, R., Harashima, T., Cavallo, L.M.,

Funnell, D., Cox, G.M., Perfect, J.R., Kronstad, J.W., Heitman, J.,

2002. Adenylyl cyclase functions downstream of the G a protein

Gpa1 and controls mating and pathogenicity of Cryptococcus

neoformans. Eukaryotic Cell 1, 75–84.

Campbell, S.L., Khosravi-Far, R., Rossman, K.L., Clark, G.J., Der,

C.J., 1998. Increasing complexity of Ras signaling. Oncogene 17,

1395–1413.

Chang, Y.C., Wickes, B.L., Miller, G.F., Penoyer, L.A., Kwon-Chung,

K.J., 2000. Cryptococcus neoformans STE12a regulates virulence

but is not essential for mating. J. Exp. Med. 191, 871–882.

Choy, E., Chiu, V.K., Silletti, J., Feoktistov, M., Morimoto, T.,

Michaelson, D., Ivanov, I.E., Philips, M.R., 1999. Endomembrane

trafficking of Ras: the CAAX motif targets proteins to the ER and

Golgi. Cell 98, 69–80.

Davidson, R.C., Cruz, M.C., Sia, R.A.L., Allen, B.M., Alspaugh, J.A.,

Heitman, J., 2000. Gene disruption by biolistic transformation in

serotype D strains of Cryptococcus neoformans. Fungal Genet.

Biol. 29, 38–48.

Engelberg, D., Klein, C., Martinetto, H., Struhl, K., Karin, M., 1994.

The UV response involving the Ras signaling pathway and AP-1

transcription factors is conserved between yeast and mammals. Cell

77, 381–390.

Granger, D.L., Perfect, J.R., Durack, D.T., 1985. Virulence of

Cryptococcus neoformans: regulation of capsule synthesis by carbon

dioxide. J. Clin. Invest. 76, 508–516.

Ho, J., Bretscher, A., 2001. Ras regulates the polarity of the yeast actin

cytoskeleton through the stress response pathway. Mol. Biol. Cell

12, 1541–1555.

Hughes, D.A., 1995. Control of signal transduction and morphogen-

esis by Ras. Cell Biol. 6, 89–94.

Jiang, Y., Davis, C., Broach, J.R., 1998. Efficient transition to

growth on fermentable carbon sources in Saccharomyces cerevi-

siae requires signaling through the Ras pathway. EMBO J. 17,

6942–6951.

Kataoka, T., Powers, S., McGill, C., Fasano, O., Strathern, J., Broach,

J., Wigler, M., 1984. Genetic analysis of yeast RAS1 and RAS2

genes. Cell 37, 437–445.

Kwon-Chung, K.J., 1976. Morphogenesis of Filobasidiella neoformans,

the sexual state of Cryptococcus neoformans. Mycologia 68, 821–

833.

Kwon-Chung, K.J., Bennett, J.E., 1992. Medical Mycology. Lea &

Febiger, Malvern, PA.

Kwon-Chung, K.J., Edman, J.C., Wickes, B.L., 1992. Genetic asso-

ciation of mating types and virulence in Cryptococcus neoformans.

Infect. Immun. 60, 602–605.

Leberer, E., Harcus, D., Dignard, D., Johnson, L., Ushinsky, S.,

Thomas, D.Y., Schr€ooppel, K., 2001. Ras links cellular morpho-

genesis to virulence by regulation of the MAP kinase and cAMP

signalling pathways in the pathogenic fungus Candida albicans.

Mol. Microbiol. 42, 673–687.

Lorenz, M.C., Heitman, J., 1997. Yeast pseudohyphal growth is

regulated by Gpa2, a G protein a homolog. EMBO J. 16, 7008–

7018.

Ma, H., Kunes, S., Schatz, P.J., Botstein, D., 1987. Plasmid construc-

tion by homologous recombination in yeast. Gene 58, 201–216.

Mitchell, T.G., Perfect, J.R., 1995. Cryptococcosis in the era of

AIDS—100 years after the discovery of Cryptococcus neoformans.

Clin. Microbiol. Rev. 8, 515–548.

Moore, T.D.E., Edman, J.C., 1993. The a-mating type locus of

Cryptococcus neoformans contains a peptide pheromone gene. Mol.

Cell. Biol. 13, 1962–1970.

M€oosch, H.U., Roberts, R.L., Fink, G.R., 1996. Ras2 signals via the

Cdc42/Ste20/mitogen-activated protein kinase module to induce

filamentous growth in Saccharomyces cerevisiae. Proc. Natl. Acad.

Sci. USA 93, 5352–5356.

M€oosch, H.-U., Kubler, E., Krappmann, S., Fink, G.R., Braus, G.H.,

1999. Crosstalk between the Ras2p-controlled mitogen-activated

protein kinase and cAMP pathways during invasive growth of

Saccharomyces cerevisiae. Mol. Biol. Cell. 10, 1325–1335.

Nielsen, O., Davey, J., Egel, R., 1992. The ras1 function of Schizo-

saccharomyces pombe mediates pheromone-induced transcription.

EMBO J. 11, 1391–1395.

Papadaki, P., Pizon, V., Onken, B., Chang, E.C., 2002. Two Ras

pathways in fission yeast are differentially regulated by two Ras

guanine nucleotide exchange factors.Mol. Cell. Biol. 22, 4598–4606.

Perfect, J.R., Toffaletti, D.L., Rude, T.H., 1993. The gene encoding

phosphoribosylaminoimidazole carboxylase (ADE2) is essential for

growth of Cryptococcus neoformans in cerebrospinal fluid. Infect.

Immun. 61, 4446–4451.

Pitkin, J.W., Panaccione, D.G., Walton, J.D., 1996. A putative cyclic

peptide efflux pump encoded by the TOXA gene of the plant-

pathogenic fungus Cochliobolus carbonum. Microbiology 142,

1557–1565.

Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A

Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold

Spring Harbor, NY.

Shah-Mahoney, N., Hampton, T., Vidaver, R., Ratner, D., 1997.

Blocking the ends of transforming DNA enhances gene targeting in

Dictyostelium. Gene 203, 33–41.

Shen, W.-C., Davidson, R.C., Cox, G.M., Heitman, J., 2002. Phero-

mones control mating and differentiation via paracrine and

autocrine signaling in Cryptococcus neoformans. Eukaryotic Cell

1, 366–377.

Sherman, F., 1991. Getting started with yeast. In: Guthrie, C., Fink,

G.R. (Eds.), Methods in Enzymology, vol. 194. Academic Press,

San Diego, CA, pp. 3–21.

Sudarshan, S., Davidson, R.C., Heitman, J., Alspaugh, J.A., 1999.

Molecular analysis of the Cryptococcus neoformans ADE2 gene, a

selectable marker for transformation and gene disruption. Fungal

Genet. Biol. 27, 36–48.

Thevelein, J.M., 1994. Signal transduction. Yeast 10, 1753–1790.


Toda, T., Uno, I., Ishikawa, T., Powers, S., Kataoka, T., Broek, D.,

Cameron, S., Broach, J., Matsumoto, K., Wigler, M., 1985. In

yeast, RAS proteins are controlling elements of adenylate cyclase.

Cell 40, 27–36.

Toffaletti, D.L., Rude, T.H., Johnston, S.A., Durack, D.T., Perfect,

J.R., 1993. Gene transfer in Cryptococcus neoformans by use of

biolistic delivery of DNA. J. Bacteriol. 175, 1405–1411.

Tolkacheva, T., McNamara, P., Piekarz, E., Courchesne, W., 1994.

Cloning of a Cryptococcus neoformans gene, GPA1, encoding a G-

protein a-subunit homolog. Infect. Immun. 62, 2849–2856.

Wang, P., Nichols, C.B., Lengeler, K.B., Cardenas, M.E., Cox, G.M.,

Perfect, J.R., Heitman, J., 2002. Mating-type-specific and nonspe-

cific PAK kinases play shared and divergent roles in Cryptococcus

neofromans. Eukaryotic Cell 1, 257–272.

Wang, P., Perfect, J.R., Heitman, J., 2000. The G-protein b subunit

GPB1 is required for mating and haploid fruiting in Cryptococcus

neoformans. Mol. Cell. Biol. 20, 352–362.

Waugh, M.S., Nichols, C.B., DeCesare, C.M., Cox, G.M., Heitman,

J., Alspaugh, J.A., 2002. Ras1 and Ras2 contribute shared and

unique roles in physiology and virulence of Cryptococcus neofor-

mans. Microbiology 148, 191–201.

Wickes, B.L., Mayorga, M.E., Edman, U., Edman, J.C., 1996.

Dimorphism and haploid fruiting in Cryptococcus neoformans:

association with the a-mating type. Proc. Natl. Acad. Sci. USA 93,

7327–7331.

Wickes, B.L., Edman, U., Edman, J.C., 1997. The Cryptococcus

neoformans STE12a gene: a putative Saccharomyces cerevisiae

STE12 homologue that is mating type specific. Mol. Microbiol. 26,

951–960.

Yue, C., Cavallo, L.M., Alspaugh, J.A., Wang, P., Cox, G.M.,

Perfect, J.R., Heitman, J., 1999. The STE12a homolog is

required for haploid filamentation but largely dispensable for

mating and virulence in Cryptococcus neoformans. Genetics 153,

1601–1615.


Ras1 controls pheromone expression and response during mating in Cryptococcus neoformans

Documents

Transcript of Ras1 controls pheromone expression and response during mating in Cryptococcus neoformans