Molecular typing and in vitro antifungal susceptibility of Cryptococcus spp from patients in Midwest...

Original Article

Molecular typing and in vitro antifungal susceptibility of Cryptococcus spp from patients in Midwest Brazil Olivia Cometti Favalessa1, Daphine Ariadne Jesus de Paula3, Valéria Dutra3, Luciano Nakazato3, Tomoko Tadano2, Márcia dos Santos Lazera4, Bodo Wanke4, Luciana Trilles4, Maria Walderez Szeszs5, Dayane Silva5, Rosane Christine Hahn1,2

1 Laboratório de Micologia, Faculdade de Medicina, Universidade Federal de Mato Grosso, Cuiabá, MT, Brazil

2 Hospital Universitário Júlio Müller, Universidade Federal de Mato Grosso, Cuiabá, MT, Brazil

3 Laboratório de Microbiologia e Biologia Molecular Veterinária, Universidade Federal de Mato Grosso, Cuiabá, MT,

Brazil 4 IPEC – Laboratório de Micologia - FIOCRUZ, Rio de Janeiro, RJ, Brazil

5 IAL - Instituto Adolfo Lutz – Seção de Micologia São Paulo, SP, Brazil.

Abstract Introduction: Cryptococcosis is a systemic fungal infection that affects humans and animals, mainly due to Cryptococcus neoformans and

Cryptococcus gattii. Following the epidemic of acquired immunodeficiency syndrome (AIDS), fungal infections by C. neoformans have

become more common among immunocompromised patients. Cryptococcus gattii has primarily been isolated as a primary pathogen in

healthy hosts and occurs endemically in northern and northeastern Brazil. We to perform genotypic characterization and determine the in

vitro susceptibility profile to antifungal drugs of the Cryptococcus species complex isolated from HIV-positive and HIV-negative patients

attended at university hospitals in Cuiabá, MT, in the Midwestern region of Brazil.

Methodology: Micromorphological features, chemotyping with canavanine-glycine-bromothymol blue (CGB) agar and genotyping by

URA5-RFLP were used to identify the species. The antifungal drugs tested were amphotericin B, fluconazole, flucytosine, itraconazole and

voriconazole. Minimum inhibitory concentrations (MICs) were determined according to the CLSI methodology M27-A3.

Results: Analysis of samples yelded C. neoformans AFLP1/VNI (17/27, 63.0%) and C. gattii AFLP6/VGII (10/27, 37.0%). The MICs ranges

for the antifungal drugs were: amphotericin B (0.5-1 mg/L), fluconazole (1-16 mg/L), flucytosine (1-16 mg/L), itraconazole (0.25-0.12 mg/L)

and voriconazole (0.06-0.5 mg/L). Isolates of C. neoformans AFLP1/VNI were predominant in patients with HIV/AIDS, and C. gattii VGII

in HIV-negative patients. The genotypes identified were susceptible to the antifungal drugs tested.

Conclusion: It is worth emphasizing that AFLP6/VGII is a predominant genotype affecting HIV-negative individuals in Cuiabá. These

findings serve as a guide concerning the molecular epidemiology of C. neoformans and C. gattii in the State of Mato Grosso.

Key words: Cryptococosis; Cryptococcus complex; antifungal drugs. J Infect Dev Ctries 2014; 8(8):1037-1043. doi:10.3855/jidc.4446

(Received 22 November 2013 – Accepted 15 February 2014)

Copyright © 2014 Favalessa et al. This is an open-access article distributed under the Creative Commons Attribution License, which permits unrestricted use,

distribution, and reproduction in any medium, provided the original work is properly cited.

Introduction Cryptococcosis is a severe systemic fungal

infection affecting humans and a variety of animals. It

is mainly caused by two species of yeasts of the genus

Cryptococcus: Cryptococcus neoformans (serotypes

A, D and AD) and Cryptococcus gattii (serotype B and

C) [1]. Regarding molecular types, C. neoformans has

been grouped into AFLP1/VNI and AFLP1A/VNII

(serotype A), AFLP3/VNIII (serotype AD) and

AFLP2/VNIV (serotype D), whereas C. gattii has been

grouped into types AFLP1/VGI, AFLP6/VGII,

AFLP5/VGIII and AFLP7/AFLP10/VGIV (serotypes

B and C) [2]. Immunocompromised patients are more

frequently affected by C. neoformans serotypes A and

D. [3-5]

This species is distributed worldwide and is

considered an important cause of morbidity and

mortality in immunocompromised individuals and

particularly among HIV-infected patients [3-5]. C.

neoformans is associated with organic matter in the

habitats of pigeons, birds in captivity and domestic

environments, in domestic dust and decomposing

wood and in different species of hollow trees [6-8].

Until recently, it was believed that the species C.

gattii was confined to regions with tropical and

subtropical climates, like Australia and New Zealand,

where it is associated with species of Eucalyptus spp.

Favalessa et al. – Molecular typing of Cryptococcus spp in Brazil J Infect Dev Ctries 2014; 8(8):1037-1043.

1038

However, it was described in a recent outbreak on

Vancouver Island, Canada, a temperate region,

suggesting that the species C. gattii has adapted to

different environmental conditions [9]. It has also been

isolated from clinical specimens in several other areas

of the world, including Mexico, parts of Latin

America, Europe, Southern California, Hawaii, India

and Africa [10-15].

In Brazil, cryptococcosis caused by C. neoformans

occurs in all regions of the country [5,16-20].

However, C. gattii has emerged as a primary pathogen

infecting immunocompetent individuals, particularly

children, adolescents and young adults in northeastern

Brazil, where cryptococcosis is characterized by high

mortality rates [18,20-22].

Infection is caused by the inhalation of viable

propagules of these yeasts directly from the

environment. After invading the lung tissue,

hematogenous dissemination occurs with a

predisposition for the central nervous system [23].

Meningitis and meningoencephalitis are the most

common clinical manifestations in cases of

cryptococcal meningitis caused by Cryptococcus spp,

while C. gattii shows a propensity to cause

cryptococcomas, focal CNS lesions and important

neurological sequelae [14,15,23,24].

The purpose of this study was to characterize the

Cryptococcus species complex and its molecular types

derived from clinical isolates obtained from patients

diagnosed with cryptococcosis admitted to the

university hospitals of Cuiabá, MT, using

chemotyping in canavanine-glycine-bromothymol blue

medium, genotypic characterization by PCR and

URA5-RFLP. The in vitro susceptibility profiles of C.

neoformans and C. gattii to amphotericin B,

fluconazole, flucytosine, itraconazole and

voriconazole. were also determined.

Methodology Cryptococcus identification

Between August 2010 and July 2013, clinical

isolates of Cryptococcus spp from patients admitted to

the university hospitals of Cuiabá (General University

Hospital, HGU; Julio Muller University Hospital,

HUJM), were identified in the Mycology Research

Laboratory of the Federal University of Mato Grosso

(UFMT). Identification was achieved by: visualizing

micromorphological features in direct examination

with India ink; biochemical tests, phenol oxidase

positive on Niger seed agar and urease positive; and

phenotypic characterization by chemotyping on

canavanine-glycine-bromothymol blue (CGB)

medium.

Genotypic characterization

Genotypic identification was performed by

polymerase chain reaction (PCR) using paired primers

CNB49A (5'ATTGCGTCCATCCAACCGTTATC-3 ')

and CNB49S (5'ATTGCGTCCAAGTGTTGTTG-3'),

specific for C. gattii and CNA70S: (5 'ATT GCG

GAG CTC TCCACCAAG 3') and CNA70A (5 'ATT

GCG TCC ATG TTA CGTGGC 3') specific for C.

neoformans [25,26].

DNA extraction

For DNA extraction, the protocol described by Del

Poeta et al (1999) [27] was used with modifications.

Lysis buffer (0.5 mM EDTA pH 8.0, 100 mM NaCl,

10 mM Tris pH 8.00, and 0.5% SDS) was used, with

0.05 g of glass beads. The tubes were initially agitated

in a vortex for 5 minutes, then boiled at 100°C for 5

minutes and finally, centrifuged at 16,000 g for 5

minutes. The aqueous phase was extracted with 0.5

volume of buffered phenol and chloroform, shaken

gently for 5 minutes. This was then centrifuged (6,000

g for 10 minutes) and the nucleic acid content present

in the upper phase was collected and precipitated in

the presence of 0.2 M NaCl, pH 5.2, and 1 mL

isopropanol for 16 hours at -20°C, and then

centrifuged (10,000 g for 10 minutes), washed with1

mL of 70% ethanol and dried. Incubation was

performed overnight at -20°C to achieve precipitation.

The DNA was collected by centrifugation at 16,000 g

for 5 minutes, after which the supernatant was

discarded. The pellet was washed with 1 mL of cold

70% ethanol and resuspended in 0,05 mL of MilliQ

water. Subsequently, the DNA was treated with

RNAse A for 1 hour at 37°C. The quality and integrity

of the DNA was analyzed by electrophoresis in 1.0%

agarose gel at 100 V per cm with the aid of a

transilluminator (Loccus, São Paulo, Brazil).

Molecular typing

Twenty-seven Brazilian clinical isolates were

typed by URA5-RFLP and PCR-fingerprinting using

the minisatellite-specific core sequence of the wild-

type phage M13. PCR of the gene URA5was

performed in a final volume of 50 μL. Each reaction

contained 50 ng of DNA, 1x PCR buffer [160 mM

(NH4)2SO4, 670 mM Tris-HCI (pH8.8 at 25°C), 0.1%

Tween-20 – (Bioline Inc., Taunton, USA), 0.2 mM

each of dATP, dCTP, dGTP, and dTTP (Roche

Diagnostics GmbH, Mannheim, Germany), 3 mM


1039

magnesium chloride, 1.5 U BioTaq DNA polymerase

(Bioline Inc., Taunton, USA), and 50 ng of each URA5

primer (5’ ATGTCCTCCCAAGCCCTCGACTCCG

3’) and SJ01 (5’

TTAAGACCTCTGAACACCGTACTC 3’) [28]. PCR

was performed for 35 cycles in a Perkin-Elmer thermal

cycler (model 480) at 94°C with 2 minutes initial

denaturation, 45 s denaturation at 94°C, 1 minute

annealing at 61°C, 2 minutes extension at 72°C, and

final extension cycle for 10 minutes at 72°C. A total of

30 μl of PCR products were double digested with

Sau96I (10 U/μL) and HhaI (20 U/μL) for 3 hours, and

the fragments were separated by 3% agarose gel

electrophoresis at 100 V. RFLP patterns were assigned

visually by comparison with patterns obtained from

standard strains provided by the Mycology laboratory

of the Institute of Clinical Research Evandro Chagas –

Oswaldo Cruz Foundation and included WM 148

(VNI), WM 626 (VNII), WM 628 (VNII), 629

(VNIV), WM 179 (VGI), WM 178 (VGII), WM 161

(VGIII) and WM 779 (VGIV).

Antifungal susceptibility testing

The in vitro susceptibility profiles of C.

neoformans and C. gattii against antifungal agents

were determined by using the reference method of

broth microdilution, in accordance with document

M27-A3 of the CLSI. Cutoff points for C. neoformans

and C. gattii have not been established by the CLSI, so

those described by CLSI document M27-A3 for

Candida spp were used, as previously reported [30-

33]. The antifungal drugs tested were amphotericin B,

fluconazole, flucytosine, itraconazole and

voriconazole.

Results Among the 27 patients diagnosed with

cryptococcosis during the study period, 27 strains of

Cryptococcus spp were isolated. Fourteen patients

were HIV-positive, with 13 presenting isolates of C.

neoformans VNI and one of C. gattii VGII. Thirteen

patients showed HIV negative serology, of which 10

presented isolates of C. gattii and three of C.

neoformans. Fifteen of the 27 infected individuals

were male, with ages ranging from 6 to 73 years

(mean age, 37.9 years).

Cryptococcus neoformans was the most prevalent

isolate among HIV-infected individuals and C. gattii

was the most prevalent among HIV-negative

individuals. The antifungal drug susceptibility tests

showed in vitro activity against isolates of

Cryptococcus spp and the MICs ranges to C.

neoformans were: amphotericin B 0.5 - 1 mg/L;

fluconazole 1– 16 mg/L; flucytosine 0.5-8 mg/L;

itraconazole 0.03 – 0.25 mg/L and voriconazole 0.06-

0.5 mg/L MICs ranges against C. gattii were:

amphotericin B 0.5 - 1 mg/L; fluconazole 1 – 16

mg/L; flucytosine 1 - 16 mg/L; itraconazole 0.03 – 0.5

mg/L and voriconazole 0.06-0.5 mg/L. The minimum

inhibitory concentrations (MICs) and MIC50 and

MIC90 values are presented in Table 1.

Table 1. In vitro susceptibility of the genotypes of Cryptococcus spp to fluconazole, itraconazole, voriconazole, flucytosine

and amphotericin B in isolates from HIV-positive and HIV-negative patients.

Genotype and antifungal drug MIC range *MIC50 *MIC90 **GM

(mg/L) (mg/L) (mg/L) (mg/L)

C. neoformans VNI (n = 17)

Amphotericin B 0.5-1 0.5 1 0.67

Fluconazole 1-16 4 8 4.34

Flucytosine 0.5-8 4 4 2.77

Itraconazole 0.03-0.25 0.12 0.25 0.09

Voriconazole 0.06-0.5 0.5 0.5 0.28

C. gattii VGII (n = 10)

Amphotericin B 0.5-1 0.5 1 0.71

Fluconazole 1-16 8 16 7.46

Flucytosine 1-16 8 8 4.92

Itraconazole 0.03-0.5 0.25 0.5 0.22

Voriconazole 0.06-0.5 0.5 0.5 0.28

* MIC50 and MIC90, the concentration capable of inhibiting the growth of isolates by 50% and 90%, respectively. **GM: geometric means.


1040

Discussion

Epidemiological studies addressing the molecular

features of species belonging to the genus

Cryptococcus have been conducted extensively in

numerous parts of the world [2,34-36]. However, in

Brazil, molecular epidemiology studies are still

required to elucidate the distribution of molecular

types in all five Brazilian regions. Despite this, the few

epidemiological studies conducted in Brazil have

demonstrated differences in the distribution of the

genotypes of these species in these regions [17-21,36].

In Mato Grosso, this is the first report describing the

molecular types circulating in the state capital of

Cuiabá. This study demonstrated the prevalence of

cryptococcal meningitis by C. neoformans VNI among

HIV-infected patients and C. gattii VGII in patients

presenting negative serology for HIV.

Cryptococcosis has become more frequently

diagnosed among HIV/AIDS patients and is

considered an important cause of morbidity and

mortality. C. neoformans is the species with the largest

number of isolates among species belonging to the

Cryptococcus complex [5,16-18,37]. Currently, an

increasing number of cases of cryptococcosis have

been reported in patients without HIV. Regarding this

finding, we recommend testing for C. gattii as a

primary pathogen, since it affects apparently healthy

individuals, especially in northern and northeastern

Brazil [21,22,36].

In Brazil, C. neoformans predominates in clinical

isolates from HIV/AIDS patients, particularly in the

southern, southeastern and mid-western regions [9,16-

18,20]. Of the C. neoformans species analyzed in this

study, all showed the molecular type VNI, a

prevalence observed by other researchers [8,10,19,20].

In the 1990s, during the outbreak that occurred on

Vancouver Island and nearby areas in Canada and the

USA, the genotype C. gattii VGIIa / VGIIc emerged

as a primary pathogen, illustrating that the species is

not only present in tropical and subtropical regions,

but also in other geographic areas, including those

with temperate climates. This outbreak indicated that

exposure to environmental sources, such as trees and

soil contaminated by this yeast, can lead to

cryptococcosis infection in humans and animals

[38,39,40]. In a study analyzing environmental

samples in Cuiabá, MT, Anzai et al. [41] also isolated

the genotype C. gattii VGII, which is similar to that

detected in the clinical isolates analyzed in this work.

Santos et al. [21] studied 43 cases of meningitis

caused by Cryptococcus spp, in which C. gattii was

the most common isolate among HIV-negative

patients (19/29; 65.5%). The genotype VGII (25/56,

44.6%) was the most frequently isolated, as reported

previously [36-42], and in agreement with this work.

Different results have been observed in southern

Brazil, with Casali et al. [18] reporting 11 isolates of

C. gattii serotype B type VGIII among the clinical

samples they studied. In Goiânia, MS, Souza et al.

[20] identified C. gattii serotype B type VGIII in four

clinical samples.

In vitro susceptibility tests are not routinely

performed in Brazilian laboratories, particularly in the

public health services, even though these tests are

extremely useful for selecting the appropriate therapy.

In this study, clinical isolates of C. neoformans and C.

gattii were susceptible to the antifungal agents tested

(Table 1).

Studies conducted in several parts of the world

have shown low MIC50 and MIC90 values for

fluconazole against C. neoformans VNI [43-45]. In

this study, the MIC50 and MIC90 values for fluconazole

were 4-8 mg/L; however, higher values (2-128 mg/L)

have been reported for isolates of C. neoformans VNI

[46].

High MIC values (≥ 64 mg/L) have been reported

for fluconazole against C. gattii [44,47], in contrast to

this study, which determined values ≤ 16 mg/L. Hagen

et al. [48] analyzed 350 isolates of C. gattii originating

from clinical, environmental and animal sources and

reported that MIC values for flucytosine and

fluconazole were higher, i.e. these antifungal drugs

showed less activity in vitro against C. gattii compared

with isavuconazole, itraconazole, posaconazole, and

voriconazole. Regarding new azoles, voriconazole

demonstrated strong activity against the genotypes,

even against isolates that presented diminished

susceptibility to fluconazole. In this study,

voriconazole also showed low MIC values against C.

gattii and C. neoformans, suggesting that voriconazole

could be an important drug for the treatment of

cryptococcosis in cases of resistance to fluconazole,

and due to the toxic effects related to amphotericin B.

Despite the promising in vitro results obtained for

voriconazole, numerous other studies are required to

determine the correlation between in vitro

susceptibility and therapeutic success in vivo.

Following their analysis of susceptibility profiles

of C. gattii genotypes, Chong et al. [49] reported

higher MIC values for fluconazole (≥ 64 µg/mL)

against C. gattii VGII than against C. gattii VGIII and

VGI [48]. Iqbal et al. [50] reported differences in the

susceptibility profiles of the molecular types of C.

gattii, having determined higher MIC values for the


1041

VGII subtypes than the VGI and VGIII subtypes. In

Brazil, Souza et al. [20] reported low MIC values for

voriconazole and amphotericin B against isolates of C.

gattii. It is worth highlighting that C. gattii VGIII was

identified in this study and that the MIC values

obtained for amphotericin B were low, in agreement

with those in the literature [47,50,51], considering the

cutoffs used by Nguyen and Yu [30] and Lozano-Chui

et al. [31]. For voriconazole, MIC values against C.

gattii (range = 0.06 – 0.5 mg/L were in agreement with

those presented by Espinel-Ingroff et al [53], whereas

against C. neoformans MIC values (range = 0.06–0.5

mg/L), were lower compared with those of the same

study.

The majority of studies addressing in vitro

susceptibility testing for amphotericin B against C.

neoformans and C. gattii have shown that many of

these isolates are susceptible at MIC values ≤ 1 mg/L

[47,48,50-53], similar to the MIC values obtained in

this work. However, the literature reports MIC values

for amphotericin B ≥ 1 µg/mL, such as Lozano-Chui et

al. [31], who reported MIC values of 3-4 mg/L, which

were associated with treatment failure.

Given the severity of infection by Cryptococcus

gattii and the potential neurological sequelae that

affect not only immunocompromised, but also healthy

individuals, the adequation of laboratory facilities to

provide early diagnosis of cryptococcosis in Brazil is

essential. Moreover, the importance of performing

molecular typing of the species of C. gattii should be

emphasized, given literature findings indicating the

existence of differences in the in vitro susceptibility

profiles. Understanding the molecular types circulating

in different Brazilian regions and their correlation with

the minimal inhibitory concentrations values obtained

for the antifungals most frequently used in medical

practice should elucidate aspects of this important

enigmatic puzzle, the Cryptococcus complex.

References 1. Kwon-Chung KJ, Varma SA (2006) Do major species

concepts support one, two or more species within

Cryptococcus neoformans? FEMS Yeast Res 6: 574-587.

2. Meyer W, Aanensen DM, Boekhout T, Cogliati M, Diaz MR,

Esposto MC, Fisher M, Gilgado F, Hagen F, Kaocharoen S,

Litvintseva AP, Mitchell TG, Simwami SP, Trilles L, Viviani

MA, Kwon-Chung J (2009) Consensus multi-locus sequence

typing scheme for Cryptococcus neoformans and

Cryptococcus gattii. Med Mycol 47: 561-570.

3. Perfect JR, Dismukes WE, Dromer F, Goldman DL, Graybill

JR, Hamill RJ, Harrison TS, Larsen RA, Lortholary O,

Nguyen MH, Pappas PG, Powderly WG, Singh N, Sobel JD,

Sorrell TC (2010) Clinical practice guidelines for the

management of cryptococcal disease: 2010 update by the

infectious diseases society of america. Clin Infect Dis 50:

291-322.

4. Sajadi MM, Roddy KM, Chan-Tack KM, and Forrest GN

(2009) Risk factors for mortality from primary cryptococcosis

in patients with HIV. Postgrad Med 121: 107–113.

5. Fernandes OFL, Costa TR, Costa MR, Soares AJ, Pereira

AJSC, Silva MR (2000) Cryptococcus neoformans isolados

de pacientes com AIDS. Rev Soc Bras Med Trop 33: 75-78.

6. Nishikawa MM, Lazera MS, Barbosa GG, Trilles L,

Balassiano BR, Macedo RC, Bezerra CC, Pérez MA,

Cardarelli P, Wanke B (2003) Serotyping of 467

Cryptococcus neoformans isolates from clinical and

environmental sources in Brazil: analysis of host and regional

patterns. J Clin Microbiol 41: 73-77.

7. Lin X, Heitman J (2006) The biology of the Cryptococcus

neoformans species complex. Annu Rev Microbiol 60: 69-

105.

8. Passoni LFC, Wanke B, Nishikawa MM, Lazera MS (1998)

Cryptococcus neoformans isolated from human dwellings in

Rio de Janeiro,Brazil: an analysis of the domestic

environment of AIDS patients with and without

cryptococcosis. Med Mycol 36: 305-311.

9. Kidd SE, Hagen F, Tscharke RL, Huynh M, Bartlett KH, Fyfe

M, MacDougall L, Boekhout T, Kwon-Chung KJ, Meyer W

(2004) A rare genotype of Cryptococcus gattii caused the

cryptococcosis outbreak on Vancouver Island (British

Columbia, Canada). Proc Natl Acad Sci U S A 101:17258-

17263.

10. Murthy JMK (2007) Fungal infections of the central nervous

system: The clinical syndromes. Neurol India 55: 221-225.

11. Chen S, Sorrel Tl, Nimmo G,Speed B, Currie B, Ellis D,

Marriott D, Pfeiffer T, Parr D, and Byth K (2000)

Epidemiology and host- and variety dependent characteristics

of infection due to Cryptococcus neoformans in Australia and

New Zealand. Australasian Cryptococcal Study Group. Clin

Infect Dis 31: 499-508.

12. Morgan J, McCarthy KM, Gould S, Fan K, Arthington-

Skaggs B, Iqbal N,Stamey K, Hajjeh RA, Brandt ME, and the

Gauteng (2006) Cryptococcal Surveillance Initiative Group.

Cryptococcus gattii infection: characteristics and

epidemiology of cases identified in a South African province

with high HIV seroprevalence, 2002–2004. Clin Infect Dis

43: 1077-1080.

13. Jain NBL, Wickes BL, Keller SM, Fu J, Casadevall A, Jain P,

Ragan MA, Banerjee U, Fries BC (2005) Molecular

epidemiology of clinical Cryptococcus neoformans strains

from India. J Clin Microbiol 43: 5733-5742.

14. Meyer W and Trilles L. Genotyping of the Cryptococcus

neoformans/Cryptococcus gattii Species Complex. Australian

Biochemist 2010 (41); 12-15.

15. Hagen F, Colom MF, Swinne D, Tintelnot K, Iatta R,

Montagna MT, Torres-Rodriguez JM, Cogliati M, Velegraki

A, Burggraaf A, Kamermans A, Sweere JM, Meis JF,

Klaassen CH, Boekhout T (2012) Autochthonous and

dormant Cryptococcus gattii infections in Europe. Emerg

Infect Dis. 18: 1618-16124.

16. Favalessa OC, Ribeiro LC, Tadano T, Fontes CJF, Dias FB,

Coelho BPA, Hahn RC (2009) Primeira descrição da

caracterização fenotípica e susceptibilidade in vitro a drogas

de leveduras do gênero Cryptococcus spp isoladas de

pacientes HIV positivos e negativos, Estado de Mato Grosso.

Rev Soc Bras Med Trop 42: 661-665.


1042

17. Matsumoto MT, Fusco-Almeida AM, Baeza LC, Melhem

MSC, Mendes-Giannini MJS (2007) Genotyping, serotyping

and determination of mating-type of cryptococcus

neoformans clinical isolates from São Paulo State, Brazil. Rev

Inst Med Trop S Paulo 49: 41-47.

18. Casali AK, Goulart L, Rosa e Silva LK, Ribeiro AM, Amaral

AA, Alves SH, Schrank A, Meyer W, Vainstein MH (2003)

Molecular typing of clinical and environmental Cryptococcus

neoformans isolates in the Brazilian state Rio Grande do Sul.

FEMS Yeast Res 3: 405-415.

19. Matos CS, Andrade NS, Oliveira NS, Barros TF (2012)

Microbiological characteristics of clinical isolates of

cryptococcus spp in Bahia, Brazil: Molecular Types and

antifungal susceptibilities. Eur J Clin Microbiol Infect 31:

1647-1652.

20. Souza LKH, Souza-Junior AH, Costa CR, Fagnello J,

Vainstein MH, Chagas ALB, Souza ACM, Silva MRR (2009)

Molecular typing and antifungal susceptibility of clinical and

environmental Cryptococcus neoformans species complex

isolates in Goiania, Brazil. Mycoses 53: 62-67.

21. Santos WRA, Meyer W, Wanke B, Costa SPSE, Trilles L,

Nascimento JLM, Medeiros R, Morales BP, Bezerra Cde C,

Macêdo RC, Ferreira SO, Barbosa GG, Perez MA, Nishikawa

MM, Lazéra Mdos S (2008) Primary endemic Cryptococcosis

gattii by molecular type VGII in the state of Pará, Brazil.

Mem Inst Oswaldo Cruz 103: 813-818.

22. Correa MP, Oliveira EC, Duarte RR, Pardal PP, Oliveira FM,

Severo LC (1999) Cryptococcosis in children in the state of

Pará, Brazil. Rev Soc Bras Med Trop 32: 505-508.

23. Moretti ML, Resende MR, Lazéra MS, Colombo AL,

Shikanai-Yasuda MA (2008) [Guidelines in cryptococcosis-

2008]. Rev Soc Bras Med Trop 41: 524-544.

24. Chen SC, Korman TM, Slavin MA, Marriott D, Byth K, Bak

N, Currie BJ, Hajkowicz K, Heath CH, Kidd S, McBride WJ,

Meyer W, Murray R, Playford EG, Sorrell TC; Australia and

New Zealand Mycoses Interest Group (ANZMIG)

Cryptococcus Study (2013) Antifungal therapy and

management of complications of cryptococcosis due to

Cryptococcus gattii. Clin Infect Dis 57: 543-51.5

25. Aoki FH, Imai T, Tanaka R, Mikami Y, Taguchi H,

Nishimura NF, Nishimura K, Miyaji M, Schreiber AZ,

Branchini ML (1999) New PCR primer pairs specific for

Cryptococcus neoformans serotype A or B prepared on the

basis of random amplified polymorphic DNA fingerprint

pattern analyses. J Clin Microbiol 37: 315-20.

26. Horta JA, Staats CC, Casali AK, RibeiroAM, Schrank

IS,Schrank A, Vainstein MH (2002) Epidemiological aspects

of clinical and environmental Cryptococcus neoformans

isolates in the Brazilian state Rio Grande do Sul. Med Mycol,

40: 565-571.

27. Del Poeta M, Toffaletti DL, Rude TH, Dykstra CC, Heitman

J, Perfect JR (1999) Topoisomerase I is essential in

Cryptococcus neoformans: role In pathobiology and as an

antifungal target Genetics 152: 167-78.

28. Meyer W, Castañeda A, Jackson S, Huynh M, Castañeda E,

Group I.C.S (2003) Molecular typing of IberoAmerican

Cryptococcus neoformans isolates. Emerg Infect Dis 9: 189-

195.

29. Clinical and Laboratory Standards Institute (2008) Reference

method for broth dilution antifungal susceptibility testing of

yeasts, 3rd ed. CLSI document M27-A3. Clinical and

Laboratory Standards Institute, Wayne, PA.

30. Nguyen MH, Yu CY (1998) In vitro comparative efficacy of

voriconazole and itraconazole against fluconazole susceptible

and resistant Cryptococcus neoformans isolates.

Antimicrobial Agents Chemother 42: 471-472.

31. Lozano-Chiu MVL, Paetznick MA, Gannoum, Rex JH (1998)

Detection of resistance to amphotericin B among

Cryptococcus neoformans clinical isolates: performances of

three different media assessed by using E-test and National

Committee for Clinical Laboratory Standards M27-A

methodologycs. J Clin Microbiol 36: 2817-2822.

32. De Bedout C, Ordóñez N, Gómez BL, Rodríguez MC,

Restrepo A, Castañeda E (1999) In vitro antifungal

susceptibility of clinical isolates of Cryptococcus neoformans

var. neoformans and C. neoformans var. gattii. Rev Iberoam

Micol 16: 36-39.

33. Vanden Bossche H, Dromer F, Improvisi I, Lozano-Chiu M,

Rex JH, Sanglard D (1998) Antifungal drug resistance in

pathogenic fungi. Med Mycol 36(1):119-128.

34. Meyer W and Trilles L (2010) Genotyping of the

Cryptococcus neoformans/Cryptococcus gattii Species

Complex. Australian Biochemist 41:12-15.

35. Springer DJ and Chaturvedi V (2010) Projecting Global

Occurrence of Cryptococcus gattii. Emerging Infectious

Diseases 16: 14-20.

36. Trilles L, Lazéra MS, Wanke B, Oliveira RV, Barbosa GG,

Nishikawa MM, Morales BP, Meyer W (2008) Regional

pattern of the molecular types of Cryptococcus neoformans

and Cryptococcus gattii in Brazil. Mem Inst Oswaldo Cruz 3:

455-462.

37. Silva PR, Rabelo RAS, Terra APS, Teixeira DNS (2008)

Suscetibilidade a antifúngicos de variedades de Cryptococcus

neoformans isoladas de pacientes em hospital universitário.

Rev Soc Bras Med Trop 41: 158-162.

38. Kidd SE, Hagen F, Tscharke RL, Huynh M, Bartlett KH, Fyfe

M, MacDougall L, Boekhout T, Kwon-Chung KJ, Meyer W

(2004) A rare genotype of Cryptococcus gattii caused the

cryptococcosis outbreak on Vancouver Island (British

Columbia, Canada). Proc Natl Acad Sci USA 101:17258–

17263.

39. Byrnes EJ, Li W, Lewit Y, Ma H, Voelz K, Ren P, Carter

DA, Chaturvedi V, Bildfell RJ, Bildfell RJ, May RC, Heitman

J (2010) Emergence and pathogenicity of highly virulent

Cryptococcus gattii genotypes in the northwest United States.

PLoS Pathog 6: e1000850.

40. Hagen F, Colom MF, Swinne D, Tintelnot K, Iatta R,

Montagna MT, Torres-Rodriguez JM, Cogliati M, Velegraki

A, Burggraaf A, Kamermans A, Sweere JM, Meis JF,

Klaassen CH, Boekhout T (2012) Autochthonous and

dormant Cryptococcus gattii infections in Europe. Emerg

Infect Dis. 18: 1618-24.

41. Anzai MC,Takarara DT, Simi W B, Wanke B, Lazera M S,

Trillles L, Nakasato L, Dutra V, de Paula DA, Hahn, RC

(2013) Cryptococcus gattii in a Plathymenia reticulate

reticulate hollow in a Cuiabá, Mato Grosso. Brazil. Mycoses.

In press.

42. Martins LMS, Wanke B, Lazéra MS, Trilles L, Barbosa GG,

Macedo RCL, Cavalcanti MAS, Eulálio KD, Castro JAF,

Silva AS, Nascimento FF, Gouveia VA, Monte SJH (2008)

Genotypes of Cryptococcus neoformans and Cryptococcus

gattii as agents of endemic cryptococcosis in Teresina, Piauí

(northeastern Brazil). Mem Inst Oswaldo Cruz 106: 725-730.

43. Datta K, Jain N, Sethi S, Rattan A, Casadevall A, Banerjee U

(2003) Fluconazole and itraconazole susceptibility of clinical


1043

isolates of Cryptococcus neoformans at a tertiary care centre

in India: a need for care. J Antimicrob Chemother 52: 683-68.

44. Tay ST, Tanty Haryanty T, Ng KP, Rohani MY, Hamimah H

(2006) In vitro susceptibilities of Malaysian clinical isolates

of Cryptococcus neoformans var. grubii and Cryptococcus

gattii to five antifungal drugs. Mycoses 49: 324-30.

45. Lia M, Liaob Y, Chena M, Pana W, Weng L (2012)

Antifungal susceptibilities of Cryptococcus species complex

isolates from AIDS and non-AIDS patients in Southeast

China. Braz J Infect Dis 16: 175-179.

46. Sar B, Monchy D, Vann M, Keo C, Sarthou JL, Buisson Y

(2004) Increasing in vitro resistance to fluconazole in

Cryptococcus neoformans Cambodian isolates: April 2000 to

March 2002. J Antimicrob Chemother 54: 563-565.

47. Soares BM, Santos DA, Kohler LM, César GC, Carvalho IR,

Martins MA, Cisalpin OS (2008) Cerebral infection caused by

Cryptococcus gattii: a case report and antifungal susceptibility

testing. Rev Iberoam Micol 25: 242-245.

48. Hagen F, Illnait-Zaragozi MT, Bartlett KH, Swinne

D,Geertsen E, Klaassen CHW, Boekhout T, Meis JF (2010)

In Vitro Antifungal Susceptibilities and Amplified Fragment

Length Polymorphism Genotyping of a Worldwide Collection

of 350 Clinical, Veterinary, and Environmental Cryptococcus

gattii Isolates. Antimicrob Agents Chemother 54: 5139–

5145.

49. Chong HS, Dagg R, Malik R, Chen S, Carter D (2010) In

Vitro Susceptibility of the Yeast Pathogen Cryptococcus to

Fluconazole and Other Azoles Varies with Molecular

Genotype. J Clin Microbiol 48: 4115–4120.

50. Iqbal N, DeBess EE, Wohrle R, Sun B, Nett RJ, Ahlquist

AM, Chiller T, Lockhart SR for the Cryptococcus gattii

Public Health Working Group (2010) Correlation of

Genotype and In Vitro Susceptibilities of Cryptococcus gattii

Strains from the Pacific Northwest of the United States. J Clin

Microbiol 48: 539–544.

51. Thompson GR, Wiederhold NP, Fothergill AW, Vallor AC,

Wickes BL, Patterson TF (2009) Antifungal Susceptibilities

among Different Serotypes of Cryptococcus gattii and

Cryptococcus neoformans. Antimicrob Agent Chemother 53:

309-311.

52. Espinel-Ingroff A, Aller AI, Canton E, Castañón-Olivares LR,

Chowdhary A, Cordoba S, Cuenca-Estrella M, Fothergill A,

Fuller J, Govender N, Hagen F, Illnait-Zaragozi MT, Johnson

E, Kidd S, Lass-Flörl C, Lockhart SR, Martins MA, Meis JF,

Melhem MS, Ostrosky-Zeichner L, Pelaez T, Pfaller MA,

Schell WA, St-Germain G, Trilles L, Turnidge J (2012)

Cryptococcus neoformans-Cryptococcus gattii species

complex: an international study of wild-type susceptibility

endpoint distributions and epidemiological cutoff values for

fluconazole, itraconazole, posaconazole, and voriconazole.

Antimicrob Agents Chemother. 56: 5898-5906.

53. Souza LKH, Fernandes OFL, Kobayashi CCBA, Passos XS,

Costa CR, Lemos JA, Souza-Júnior AH, Silva MRR (2005)

Antifungal susceptibilities of clinical and environmental

isolates of Cryptococcus neoformans in Goiânia City, Goiás,

Brazil. Rev Inst Med Trop S Paulo 47: 253-256.

Corresponding author Dra. Rosane Christine Hahn

Faculdade de Medicina-UFMT: Av. Fernando Corrêa da Costa

2367, Boa Esperança 78060-900, Cuiabá, MT, Brazil

Phone +55 65 36158809 Email: [email protected]

Conflict of interests: No conflict of interests is declared.

Molecular typing and in vitro antifungal susceptibility of Cryptococcus spp from patients in Midwest...

Documents

Transcript of Molecular typing and in vitro antifungal susceptibility of Cryptococcus spp from patients in Midwest...