Plant Cell Physiol. 46(1): 233–244 (2005)

doi:10.1093/pcp/pci021, available online at www.pcp.oupjournals.org

JSPP © 2005

at The Japanese S

ociety of Plant P

hysiologists on Novem

ber 5, 2010pcp.oxfordjournals.org

Dow

nloaded from

Molecular Characterization of a Novel Quinolizidine Alkaloid O-Tigloyltransferase: cDNA Cloning, Catalytic Activity of Recombinant Protein and Expression Analysis in Lupinus Plants

Taketo Okada 1, 3, Masami Yokota Hirai 1, 2, 3, Hideyuki Suzuki 1, 4, Mami Yamazaki 1 and Kazuki Saito 1, 2, 5

1 Department of Molecular Biology and Biotechnology, Graduate School of Pharmaceutical Sciences, Chiba University, Chiba, Japan 2 CREST of Japan Science and Technology Agency (JST), Yayoi-cho 1-33, Inage-ku, Chiba, 263-8522 Japan

;

A novel acyltransferase committed to the final step of

quinolizidine alkaloid biosynthesis, tigloyl-CoA:(–)-13α-

hydroxymultiflorine/(+)-13α-hydroxylupanine O-tigloyl-

transferase, has been purified from Lupinus albus. The

internal amino acid sequences were determined with pro-

tease-digested fragments of 25 and 30 kDa bands, allowing

design of primers for amplification of cDNA fragments by

polymerase chain reaction. Using an amplified fragment as

the probe, a full-length cDNA clone was isolated. Sequence

analysis revealed that the cDNA encodes a protein of 453

amino acids with a molecular mass of 51.2 kDa. Phyloge-

netic analysis of the deduced amino acid sequences indi-

cated that this alkaloid acyltransferase belongs to a unique

subfamily of a plant acyl-CoA-dependent acyltransferase

gene family. The cDNA was expressed in bacterial cells as a

recombinant protein fused to glutathione S-transferase.

The fusion protein was affinity purified and cleaved to yield

the recombinant enzyme for the study of catalytic proper-

ties. The recombinant enzyme catalyzed the acyltransfer

reaction from tigloyl-CoA to (–)-13α-hydroxymultiflorine

and (+)-13α-hydroxylupanine. Benzoyl-CoA could also

serve efficiently as an acyl donor for these hydroxylated

alkaloids. RNA blot analysis suggested that the gene was

expressed in roots and hypocotyls but not in cotyledons and

leaves. These results indicated that this specialized acyl-

transferase, isolated for the first time as tigloyltransferase

from nature, is committed to control the quinolizidine alka-

loid patterns in a tissue-specific manner.

Keywords: Acyltransferase — Alkaloid — HMT/HLT —

Lupinus albus — Tigloyltransferase.

Abbreviations: DEPC, diethylpyrocarbonate; GST, glutathione S-

transferase; HMT/HLT, tigloyl-CoA:(–)-13α-hydroxymultiflorine/ (+)-

13α-hydroxylupanine O-tigloyltransferase; LC-PDA-ESI/MS, liquid

chromatography-photodiode array detection-electrospray ionization-

mass spectrometry; ORF, open reading frame; RACE, rapid amplifica-

tion of cDNA end; RT–PCR, reverse transcription–polymerase chain

reaction.

The nucleotide sequence reported in this paper has been sub-

mitted to GenBank, EMBL, DDBJ under the accession number

AB181292 [tigloyl-CoA:(–)-13α-hydroxymultiflorine/ (+)-13α-

hydroxylupanine O-tigloyltransferase from Lupinus albus].

Introduction

The quinolizidine alkaloids are plant secondary products

which are distributed mainly in the family Leguminosae, espe-

cially in the subfamily Papilionaceae (Ohmiya et al. 1995).

More than 200 structurally related compounds belonging to this

alkaloid group are found naturally. These alkaloids are assumed

to play indispensable roles for the survival of plants producing

these metabolites as defense compounds against pathogenic

organisms or predators and allelopathic metabolites for com-

peting with other plant species (Roberts and Wink 1998). Some

alkaloids are beneficial for mankind as potential sources of

medicines because of their pharmacological activities in ani-

mals. In fact, some plants containing the quinolizidine alka-

loids have been used as traditional herbal medicines, and the

quinolizidine alkaloids have been proven to be the principal

components responsible for the pharmacological activities of

these herbal medicines (Tang and Eisenbrand 1992).

The quinolizidine alkaloids are biosynthesized from L-

lysine via its decarboxylated metabolite cadaverine (Fig. 1).

Three units of cadaverine are subjected to oxidative cycliza-

tion to form tetracyclic alkaloids such as (–)-multiflorine and

(+)-lupanine. These de novo synthesized alkaloids are modi-

fied further by hydroxylation and by subsequent esterification

to yield the ester-type alkaloids, e.g. 13α-tigloyloxymultiflor-

ine. The ester-type quinolizidine alkaloids are widely distrib-

uted in the genera Lupinus, Cytisus, Perasonia, Calpurnia,

Genista and Rothia, as the esters of acetic acid, tiglic acid, p-

coumaric acid, ferulic acid and benzoic acid (Ohmiya et al.

1995). The tigloyl esters of quinolizidine alkaloids are the

major forms found in Lupinus plants (Saito and Murakoshi

1995). These ester-type alkaloids are assumed to be the end-

products of biosynthesis and thus the forms for transport and

storage.

A superfamily of acyl-CoA-dependent acyltransferases

exhibiting a conserved sequence motif has been documented in

3 These authors contributed equally to this work.4 Present address: Kazusa DNA Research Institute, Kisarazu, Japan.5 Corresponding author: E-mail, ksaito@faculty.chiba-u.jp; Fax, +81-43-290-2905.

233

Alkaloid acyltransferase234

at The Japanese S

ociety of Plant P

hysiologists on Novem

ber 5, 2010pcp.oxfordjournals.org

Dow

nloaded from

plants (St-Pierre et al. 1998). This versatile gene family is

assumed to evolve the catalytic ability of transfer of a variety

of acyl groups to a number of different substrates having

diverse functions in plants (St-Pierre and De Luca 2000). How-

ever, no gene and its protein that catalyzes tigloyl transfer have

been characterized in this superfamily up to now. Also, no

report is available on the presence of tigloyl esters and tigloyl-

transferase from other organisms, animals and microorgan-

isms. Therefore, it is intriguing to isolate genes encoding

tigloyltransferase responsible for the biosynthesis of ester-type

quinolizidine alkaloids.

The acyltransferases responsible for the conversion of

hydroxylated alkaloids to their esters have been detected in

several Lupinus species (Wink and Hartmann 1982a, Strack et

al. 1991, Saito et al. 1993). From L. albus (=L. termis), we pre-

viously have purified and characterized tigloyl-CoA:(–)-13α-

hydroxymultiflorine/(+)-13α-hydroxylupanine O-tigloyltrans-

ferase (HMT/HLT) that catalyzes the formation of (–)-13α-

tigloyloxymultiflorine or (+)-13α-tigloyloxylupanine from (–)-

13α-hydroxymultiflorine or (+)-13α-hydroxylupanine in the

presence of tigloyl-CoA (Suzuki et al. 1994). In the continuing

study on the enzymology of this biosynthetic pathway, we

report here the isolation of a HMT/HLT cDNA from L. albus

by improved purification of the enzyme proteins and determi-

nation of amino acid sequences of digested peptide fragments.

The cloned HMT/HLT belongs to a large plant-specific acyl-

transferase superfamily. The recombinant protein produced in

Escherichia coli efficiently catalyzes the acyltransfer reaction

from several acyl-CoAs to the hydroxylated alkaloids 13α-

hydroxymultiflorine and 13α-hydroxylupanine. HMT/HLT is

the key enzyme that determines the alkaloid pattern in a plant,

and it is also the first enzyme whose cDNA is isolated in the

biosynthetic pathway of quinolizidine alkaloids.

Results

Improved purification of HMT/HLT and determination of inter-

nal peptide sequences

An improved method requiring fewer chromatographic

steps than previously described (Suzuki et al. 1994) was used

to purify HMT/HLT from roots and hypocotyls of L. albus. The

purification procedure included a novel butyl FF hydrophobic

Fig. 1 Biosynthetic pathway of the ester-type quinolizidine alka-

loids, (–)-13α-tigloyloxymultiflorine and (+)-13α-tigloyloxylupanine,

found in Lupinus plants. The tetracyclic skeleton of quinolizidine alka-

loids is derived from L-lysine via cadaverine. HMT/HLT is committed

in the final step of the biosynthesis of ester-type alkaloids, and thus

this enzyme is responsible for determination of alkaloid accumulation

patterns of the plants.

Fig. 2 SDS–PAGE analysis and determined internal amino acid

sequences of purified HMT/HLT from L. albus. The proteins from the

final purification step were separated by 12.5% SDS–PAGE. Three

bands of 25, 30 and 60 kDa polypeptides were detected by silver

staining and subjected to determination of the internal amino acid

sequences after in-gel trypsin digestion. The amino acid sequences

determined are indicated in the boxes. The DFGWG in the 25 kDa

band indicates the motif sequence highly conserved among the plant

acyl-CoA-dependent acyltransferase family (St-Pierre and De Luca

2000).

Alkaloid acyltransferase 235

at The Japanese S

ociety of Plant P

hysiologists on Novem

ber 5, 2010pcp.oxfordjournals.org

Dow

nloaded from

Table 1 Summary of purification of HMT/HLT from L. albus

a The numbers in parentheses indicates the data of the 0.125 aliquot of the purified protein solution from SP

Sepharose XL.

Purification stepActivity (pkat)

Protein (mg)

Specific activity (pkat mg–1)

Yield (%)Purification factor (-fold)

30–80% (NH4)2SO

464,700 6,080 10.6 100 1

Butyl FF 23,780 103 231 36 22

Superdex 200 pg 12,870 19 677 20 64

SP Sepharose XL 10,740 3.2 3,356 16 317

Superdex 200 HR 5,201 (655) a 0.79 (0.1) 6,550 8.0 618

RESOURCE S 2,088 (263) 0.29 (0.036) 7,305 3.2 689

Fig. 3 Nucleotide and deduced

amino acid sequences of HMT/

HLT cDNA. The amino acid se-

quences in blue and green indi-

cate the partially determined

amino acid sequences of the 25

and 30 kDa peptides, respec-

tively. The blue and green arrow-

heads indicate the N-terminal sites

of the 25 and 30 kDa polypep-

tides, respectively. The under-

lined amino acid sequence in red

indicates a signature motif se-

quence highly conserved among

the plant acyl-CoA-dependent

acyltransferase family. The nucle-

otide sequence in blue indicates

the 242 bp fragment specifically

amplified by RT–PCR. Dotted ar-

rows show the positions of prim-

ers designed for RT–PCR, P25K-

3F-1, P25K-1R and P25K-2R.

Alkaloid acyltransferase236

at The Japanese S

ociety of Plant P

hysiologists on Novem

ber 5, 2010pcp.oxfordjournals.org

Dow

nloaded from

column step, together with RESOURCE S cation exchange

chromatography and it omitted a few of the chromatographic

separation steps described in Suzuki et al. (1994) to yield a

high recovery of active pure HMT/HLT (Table 1). The specific

activity of the 689-fold purified HMT/HLT was 7,305 pkat mg–1

protein and sufficient amounts of protein were produced to

determine several internal HMT/HLT amino acid sequences.

Analysis of the purified protein by SDS–PAGE and silver

staining revealed three polypeptide bands with Mrs of 25, 30

and 60 kDa (Fig. 2). The N-terminal amino acid sequencing of

trypsin-digested peptide fragments from these three polypep-

tides produced the six sequences shown in Fig. 2. In the

digested peptides of the 25 kDa band, a motif sequence

DFGWG that is highly conserved among the plant acyl-CoA-

dependent acyltransferase family (St-Pierre et al. 1998, St-

Pierre and De Luca 2000) was found, suggesting the authentic-

ity of the 25 kDa polypeptide, at least as a part of functional

HMT/HLT. The remaining four peptide sequences found in the

25 and 30 kDa bands showed no significant homology with the

sequences registered in the protein data banks. The sequence

found in the 60 kDa band exhibited a similarity to pectin este-

rase, implying other contaminating protein still in this fraction.

Fig. 4 Phylogenetic tree of the plant acyl-CoA-dependent acyltransferases. The tree was constructed by neighbor-joining distance analysis. Line

lengths indicate the relative distances between nodes. The deduced amino acid sequence of HMT/HLT (DDBJ/GenBank/EMBL accession number

AB181292) was phylogenetically compared with benzoyl coenzyme A:benzyl alcohol benzoyl transferase (BEBT) from Nicotiana tabacum

(AF500202) (D’Auria et al. 2002), BEBT from Clarkia breweri (AF500200) (D’Auria et al. 2002), acetyl-CoA:cis-3-hexen-1-ol acetyl transferase

(CHAT) from Arabidopsis thaliana (AF500201) (D’Auria et al. 2002), taxadien-5α-ol O-acetyltransferase (TAT) from Taxus cuspidata

(AF190130) (Walker et al. 2000c), taxoid C-13 O-phenylpropanoyltransferase (baccatin III:3-amino-3-phenylpropanoyltransferase, BAPT) from

T. canadensis (AY082804) (Walker et al. 2002a), 3′-N-debenzoyl-2′-deoxytaxol N-benzoyltransferase (DBTNBT) from T. canadensis

(AF466397) (Walker et al. 2002b), 2α-hydroxytaxane 2-O-benzoyltransferase (TBT) (2-debenzoyl-7,13-diacetylbaccatin III-2-O-benzoyl trans-

ferase, DBBT) from T. cuspidata (AF297618) (Walker and Croteau 2000a), 10-deacetylbaccatin III-10-O-acetyltransferase (DBAT) from T. cuspi-

data (AF193765) (Walker and Croteau 2000b), hydroxycinnamoyl-CoA quinate:hydroxycynnamoyl transferase (HQT) from Lycopersicon

esculentum (AJ582652) (Niggeweg et al. 2004), hydroxycinnamoyl-CoA:hydroxyanthranilate N-hydroxycinnamoyltransferase 2 from Avena

sativa (AsHHT2) (AB076981) (Yang et al. 2004), hydroxycinnamoyl-CoA:shikimate/quinate hydroxycinnamoyltransferase (HCT) from N. taba-

cum (AJ507825) (Hoffmann et al. 2003), hydroxycinnamoyl/benzoyl-CoA:anthranilate N-hydroxycinnamoyl/benzoyltransferase 1 (HCBT1) from

Dianthus caryophyllus (Z84383) (Yang et al. 1997), vinorine synthase (VS) from Rauvolfia serpentina (AJ556780) (Bayer et al. 2004), acetyl-

CoA:deacetylvindoline-4-O-acetyltransferase (DAT) from Catharanthus roseus (AF053307) (St-Pierre et al. 1998), salutaridinol 7-O-acetyltrans-

ferase (SALAT) from Papaver somniferum (AF339913) (Grothe et al. 2001), malonyl-CoA:anthocyanin 5-glucoside 4′′′-O-malonyltransferase

from Salvia splendens (Ss5MaT2) (AY383734) (Suzuki et al. 2004), agmatine coumaroyltransferase (ACT) from Hordeum vulgare (AY228552)

(Burhenne et al. 2003), malonyl-CoA:anthocyanidin 3-O-glucoside-6′′-O-malonyltransferase from Dahlia variabilis (Dv3MaT) (AF489108)

(Suzuki et al. 2002) and minovincinine 19-hydroxy-O-acetyltransferase (MAT) from C. roseus (AF253415) (Laflamme et al. 2001).

Alkaloid acyltransferase 237

at The Japanese S

ociety of Plant P

hysiologists on Novem

ber 5, 2010pcp.oxfordjournals.org

Dow

nloaded from

Isolation of cDNA encoding HMT/HLT

Since the 25 kDa polypeptide possessed a sequence motif

common for plant acyltransferases, combinations of degener-

ated primers encoding the determined amino acid sequences

from the 25 kDa band were designed for nested reverse tran-

scription–polymerase chain reaction (RT–PCR) amplification.

The overlapping 242 and 89 bp nucleotide fragments were

amplified specifically with combinations of the forward primer

P25K-3F-1 and the reverse primers P25K-1R or P25K-2R,

respectively (Fig. 3). This 242 bp amplified fragment was used

to isolate 14 cDNA clones by screening of the cDNA library

generated from the roots of 10-day-old L. albus, and sequence

analyses indicated that all clones were identical apart from

their different lengths. The full-length HMT/HLT cDNA

sequence was obtained by 5′-rapid amplification of cDNA end

(RACE) to yield a 1,641 bp poly(A) tail-containing clone with

a putative open reading frame (ORF) of 453 amino acids (Fig.

3). The calculated molecular mass of the encoded protein was

51.2 kDa, which was consistent with that of the purified protein

determined by SDS–PAGE in our previous study (Suzuki et al.

1994).

The ORF of the isolated cDNA contained the two peptide

sequences obtained from the 30 kDa band in the purified HMT/

HLT fraction (Fig. 3), although the cDNA was isolated solely

with the probe encoding the partial 25 kDa band. It seemed that

the 51.2 kDa protein might be cleaved to give 25 and 30 kDa

bands. Then we determined the N-terminal amino acid

sequences of these two 25 and 30 kDa bands isolated from the

gel. The N-terminal sequence (APQTQ) of the 30 kDa band

was identical to one of the peptides isolated upon trypsin diges-

tion, and perfectly matched the sequence from the second to the

sixth amino acid of the deduced sequence from the cDNA as

shown in Fig. 3. The N-terminal sequence (FILQH) of the

25 kDa band was identical to the deduced sequence from the

cDNA. From these results, we confirmed that the 25 and

30 kDa peptides were encoded by the single cDNA.

Phylogenetic analyses of HMT/HLT

Phylogenetic analysis of the deduced protein sequences

revealed that HMT/HLT is separated from the subfamily of

other alkaloid acyltransferases such as deacetylvindorine

acetyltransferase (St-Pierre et al. 1998) and salutaridinol 7-O-

acetyltransferase (Grothe et al. 2001) (Fig. 4). The most closely

related sequence to HMT/HLT is benzoyl-CoA:benzylalcohol

benzoyltransferase from Nicotiana tabacum (D’Auria et al.

2002) with 57% identity on an amino acid sequence level (Fig.

4). The sequence identities of HMT/HLT to other members of

this subfamily are 55% to benzoyl-CoA:benzylalcohol ben-

zoyltransferase from Clarkia brewei and 49% to acetyl-CoA:

cis-3-hexen-1-ol acetyltransferase from Arabidopsis thaliana

(D’Auria et al. 2002).

Catalytic activity of recombinant HMT/HLT produced in

Escherichia coli

To confirm that the isolated cDNA encodes the catalyti-

cally active HMT/HLT, the functional analysis was carried out

with the recombinant protein heterogeneously produced in E.

coli. The recombinant HMT/HLT protein was purified by glu-

tathione S-transferase (GST) tag affinity and subsequent cleav-

age of the tag (Fig. 5). By in vitro enzymatic assay using the

protein extracts of E. coli and the purified recombinant pro-

tein, the single product in the reaction using 13α-hydroxymul-

tiflorine and tigloyl-CoA as substrates was detected on high

performance liquid chromatography (HPLC), while no prod-

ucts were formed in negative control reactions using E. coli

extracts of the empty vector (Fig. 6a). This specific product

was identified as 13α-tigloyloxymultiflorine by liquid chroma-

tography-photodiode array detection-electrospray ionization-

mass spectrometry (LC-PDA-ESI/MS) analysis (Fig. 6b). In a

similar way, the activity for 13α-hydroxylupanine was also

confirmed with tigloyl-CoA as the acyl donor. These results

Fig. 5 Purification and SDS–PAGE analysis of recombinant HMT/

HLT produced in E. coli. The crude extracts from E. coli harboring

pGEX-HMT/HLT expressing the cDNA and the purified recombinant

HMT/HLT were separated by 10% SDS–PAGE. Protein bands were

detected by Coomassie brilliant blue staining. The arrowhead indi-

cates the position of the purified HMT/HLT protein by GST tag and

subsequent tag cleavage on a column.

Alkaloid acyltransferase238

at The Japanese S

ociety of Plant P

hysiologists on Novem

ber 5, 2010pcp.oxfordjournals.org

Dow

nloaded from

Fig. 6 Identification of the product of the reaction cat-

alyzed by the recombinant HMT/HLT by LC-PDA-ESI/

MS. (a) HPLC-PDA analysis of the reaction product of

the recombinant HMT/HLT. The reaction with 13α-

hydroxymultiflorine and tigloyl-CoA was carried out

with the protein extract of E. coli harboring pGEX-

HMT/HLT (upper chromatogram) or pGEX empty vec-

tor (lower chromatogram). HPLC analysis was per-

formed on a Mightysil RP-18 GP 150–4.6 column

(Kanto Chemical) with a mobile phase of 15% ace-

tonitrile and 0.1% trifluoroacetic acid at a flow rate of

0.5 ml min–1. The substrate and the product, 13α-tigloy-

loxymultiflorine, were monitored at 318 nm, the maxi-

mum absorbance of these compounds. The arrow

indicates 13α-tigloyloxymultiflorine specifically pro-

duced by the recombinant HMT/HLT. (b) LC-PDA-

ESI/MS analysis of the specific product, 13α-tigloy-

loxymultiflorine, by the recombinant HMT/HLT. The

product was identified by its quasi-molecular ion mass

at m/z 345 ([M+H]+) (upper spectrum) and its frag-

mented ion at m/z 245 ([M-C5H

7O

2]+) by the MS/MS

technique (lower spectrum).

Alkaloid acyltransferase 239

at The Japanese S

ociety of Plant P

hysiologists on Novem

ber 5, 2010pcp.oxfordjournals.org

Dow

nloaded from

indicated that the isolated cDNA actually encoded the func-

tional HMT/HLT.

Substrate specificity and inhibition of recombinant HMT/HLT

To investigate the substrate specificity of HMT/HLT, the

activity of purified recombinant HMT/HLT protein was

assayed with the five different acyl-CoA derivatives with 13α-

hydroxymultiflorine (Fig. 7a) and 13α-hydroxylupanine (Fig.

7b). Interestingly, the activities with benzoyl-CoA as acyl

donor were ∼1.8-fold higher than those with tigloyl-CoA with

two alkaloid aglycons. The activities with acetyl-CoA, propio-

nyl-CoA and 2-butenoyl-CoA were ∼2–20% of those with

tigloyl-CoA. The Km

values for 13α-hydroxymultiflorine, 13α-

hydroxylupanine, tigloyl-CoA and benzoyl-CoA were deter-

mined (Table 2). Regarding alkaloid aglycon, 13α-hydroxy-

multiflorine is a better substrate than 13α-hydroxylupanine,

judged from the Km

values for each alkaloid and for each acyl

donor with these alkaloids as co-substrate. However, no appar-

ent difference in Km

values was found between tigloyl-CoA and

benzoyl-CoA.

Phylogenetic analysis indicated that the sequence of

HMT/HLT was close to that of benzoyl-CoA:benzylalcohol

benzoyltransferase. Thus, to confirm whether HMT/HLT pos-

sesses the activity of benzoyl-CoA:benzylalcohol benzoyltrans-

ferase, we performed the assay for the reaction using benzoyl-

CoA and benzyl alcohol as the substrates with the recombinant

HMT/HLT. Determination of the possible reaction product,

benzylbenzoate, was carried out with gas chromatography–

mass spectrometry. However, no benzylbenzoate formation was

detected with the recombinant HMT/HLT (data not shown),

suggesting that HMT/HLT does not catalyze this reaction,

despite its close sequence similarity to that of benzoyl-CoA:

benzylalcohol benzoyltransferase.

The HMT/HLT activity was inhibited by the pre-treat-

ment of the enzyme protein with p-chloromercuribenzoic acid,

a sulfhydryl blocker, and diethylpyrocarbonate (DEPC), a histi-

dine blocker (Table 3). These results suggested that cysteine

and histidine residues are essential for the catalytic function of

HMT/HLT.

mRNA expression of the HMT/HLT gene

Southern blot analysis indicated that a small number (1–2

copies) of homologous genes are present in the genome of L.

albus (data not shown). Northern blot analysis was also carried

out as shown in Fig. 8. The mRNA expression of the HMT/

HLT gene was the highest in roots followed by that in hypocot-

yls. In contrast, HMT/HLT gene expression in leaves and coty-

ledons was at a low level. No expression was detected in young

developing leaves (data not shown).

Fig. 7 Substrate specificity of recombinant HMT/HLT. The acyl-

transfer reaction was carried out with recombinant HMT/HLT using

13α-hydroxymultiflorine or 13α-hydroxylupanine as acyl acceptors

and various acyl-CoAs as acyl donors. The identification of the reac-

tion products was made by LC-PDA-ESI/MS. The relative activities

were determined by intensities of the [M+H]+ ions of the respective

products. The data are expressed as the values relative to (a) 13α-

tigloyloxymultiflorine or (b) 13α-tigloyloxylupanine. The bar indi-

cates the data of duplicate assays.

Table 2 Summary of Km

values of HMT/HLT

Substrate for Km

Km

Co-substrate

13α-Hydroxymultiflorine 94 µM Tigloyl-CoA (0.3 mM)

13α-Hydroxylupanine 112 µM Tigloyl-CoA (0.3 mM)

Tigloyl-CoA 98 µM 13α-Hydroxymultiflorine (0.3 mM)

359 µM 13α-Hydroxylupanine (0.3 mM)

Benzoyl-CoA 93 µM 13α-Hydroxymultiflorine (0.3 mM)

405 µM 13α-Hydroxylupanine (0.3 mM)

Alkaloid acyltransferase240

at The Japanese S

ociety of Plant P

hysiologists on Novem

ber 5, 2010pcp.oxfordjournals.org

Dow

nloaded from

Discussion

Although the quinolizidine alkaloids form a large family

of plant secondary products, no genes encoding enzymes

involved in their biosynthesis have been cloned, presumably

because of the weak enzymatic activities found in plants. Only

a limited number of reports are available for detection of the

enzymatic activities in the cell-free protein extracts for quino-

lizidine alkaloid biosynthesis (Ohmiya et al. 1995). In the

present study, we have cloned, for the first time, the cDNA

encoding a biosynthetic enzyme for quinolizidine alkaloids.

This study could lead to the molecular investigation of metabo-

lism of this large family of plant secondary products.

The present study is also the first example of the molecu-

lar cloning of a tigloyl transferase from any biological source

including plants. Tigloyl esters are widely distributed in plants

as minor components of secondary products, e.g. alkaloids

(Lounasmaa 1988, Ohmiya et al. 1995, Saito and Murakoshi

1995). However, no tigloyl esters and tigloyl transferase have

been found in microorganisms and animals. The tigloyl moiety

is derived from isoleucine through several steps, as suggested

for tigloyl esters of tropane alkaloids in Datura plants (Leete

1973, McGaw and Woolley 1977). Tigloyl-CoA formed by this

pathway is assumed to be used for the esterification of a vari-

ety of aglycons including hydroxylated alkaloids by specific

transferases such as HMT/HLT.

The evolutionarily related plant acyl-CoA-dependent acyl-

transferases (EC 2.3.1.x) are referred to as the BAHD family

based on the names of the first genes isolated (BEAT AHCT

HCBT1 DAT) exhibiting characteristic sequence motifs (St-

Pierre and De Luca 2000). This family consists of a large

number of members; for example, there are approximately 60

BAHD gene family members in A. thaliana. However, only a

limited numbers of genes have been characterized with their

biochemical functions. Phylogenetically, the deduced amino

acid sequence of HMT/HLT is closely related to benzoyl-CoA:

benzyl alcohol benzoyltransferase (BEBT) from C. breweri and

N. tabacum, which is presumed to be involved in the forma-

tion of volatile esters in flowers (D’Auria et al. 2002). Indeed,

HMT/HLT accepted benzoyl-CoA instead of tigloyl-CoA for

acyltransfer to 13α-hydroxymultiflorine and 13α-hydroxylupa-

nine. However, HMT/HLT could not catalyze the benzoyl-

CoA:benzyl alcohol benzoyltransferase reaction, indicating a

relatively strict specificity of HMT/HLT regarding hydroxy-

Fig. 8 Organ-specific expression of the HMT/HLT gene by northern

blot analysis. Total RNA (40 µg) isolated from roots, hypocotyls, coty-

ledons and leaves of 10-day-old L. albus was electrophoresed on an

agarose gel (1.2%), transferred to a positively charged nylon mem-

brane and then hybridized with a 32P-labeled probe of the ORF region

of HMT/HLT cDNA. The final wash of the membrane was performed

in 0.5×SSPE and 0.1% SDS at 65°C. rRNA bands are shown as the

control of equal amounts of RNA loaded.

Table 3 Inhibition of HMT/HLT by sulfhydryl and histidine blockers

The enzyme protein was pre-treated with the inhibitor for 15 min prior to the standard acyltransferase reac-

tion as described in Materials and Methods. For the p-chloromercuribenzoic acid experiment, DTT was omit-

ted from the standard reaction mixture. For the DEPC experiment, after pre-treatment by DEPC, imidazole

(20 mM) was added to quench the reaction with DEPC.

InhibitorConcentration for 50% inhibition

Substrate

p-Chloromercuribenzoic acid 212 µM 13α-Hydroxymultiflorine and tigloyl-CoA

218 µM 13α-Hydroxylupanine and tigloyl-CoA

DEPC 23 mM 13α-Hydroxymultiflorine and tigloyl-CoA

37 mM 13α-Hydroxylupanine and tigloyl-CoA

Fig. 9 Multiple alignment of conserved motifs in the family of plant

acyltransferases. Arrowheads indicate possible functional residues of

cysteine and histidine that presumably are modified by p-chloromer-

curibenzoic acid and DEPC, respectively. The residues with a black

and gray background indicate those of perfect conservation and >50%

identity, respectively, in the 10 proteins. Abbreviations for the pro-

teins are described in the legend to Fig. 4.

Alkaloid acyltransferase 241

at The Japanese S

ociety of Plant P

hysiologists on Novem

ber 5, 2010pcp.oxfordjournals.org

Dow

nloaded from

lated aglycons. We have shown previously that the purified

HMT/HLT only utilized the 13α(axial)-hydroxylated tetracy-

clic alkaloids as acyl acceptors (Suzuki et al. 1994). Although

HMT/HLT, benzoyl-CoA:benzyl alcohol benzoyltransferase

and acety-CoA:cis-3-hexene-1-ol acetyltransferase from A.

thaliana (D’Auria et al. 2002) belong to the same subfamily of

the BAHD acyltransferases, the substrate specificities of these

enzymes are rather diverse. Similarly, the diverse substrate spe-

cificity in a single subfamily was reported for phylogenetically

closely related acyltransferases from Taxus species (Walker and

Croteau 2001). These results suggest that the substrate specifi-

city of the BAHD acyltransferase could evolve relatively easily.

Since Km

values of HMT/HLT for tigloyl-CoA and ben-

zoyl-CoA are nearly the same (Table 2) and the activity with

benzoyl-CoA is higher than that with tigloyl-CoA (Fig. 7), this

enzyme is more properly referred to as tigloyl/benzoyl-CoA:

(–)-13α-hydroxymultiflorine/(+)-13α-hydroxylupanine O-tigloyl/

benzoyltransferase. However, only a trace amount of benzoy-

loxylupanine was detected (Wink and Witte 1984) and no

apparent accumulation of benzoyloxymultiflorine was reported

in L. albus. This presumably is due to the limited supply of

benzoyl-CoA compared with tigloyl-CoA or different compart-

mentation of each acyl-CoA and HMT/HLT in this plant. The

accumulation of benzoyloxylupanine has been reported in other

taxonomically related Lupinus species, e.g. L. polyphyllus

(Wink et al. 1982b) and L. angustifolius (Strack et al. 1991,

Hirai et al. 2000). HMT/HLT presumably is responsible for

biosynthesis of benzoyloxylupanine in these species.

Previously we purified HMT/HLT as a single protein of

50 kDa (Suzuki et al. 1994). However, we noticed that 30 and

25 kDa bands were associated with the activity and could not

be separated. In the present study, we purified these two bands

to obtain sufficient amounts of enzyme protein for peptide

sequencing. The isolated cDNA encoded a single 50 kDa pro-

tein, which contained the partial peptide sequences from the 30

and 25 kDa bands. These results suggest that the cleavage of

the 50 kDa protein into 30 and 25 kDa bands is an artifact of

the purification procedure. Nevertheless, these fragments still

retained the catalytic activity, presumably remaining physi-

cally associated. A similar situation has been reported for

acetyl-CoA:deacetylvindoline 4-O-acetyltransferase from

Catharanthus roseus (periwinkle) (Power et al. 1990, St-Pierre

et al. 1998) and for hydroxycinnamoyl/benzoyl-CoA:anthrani-

late N-hydroxycinnamoyl/benzoyltransferase from Dianthus

caryophyllus (Yang et al. 1997). This could be a common char-

acter of the proteins belonging to this family.

As shown in Fig. 9, the members of the BAHD acyltrans-

ferase family have a few conserved sequence motifs. In addi-

tion to a highly conserved DFGWG motif as the signature of

this family, cysteine and histidine residues indicated in Fig. 9

are also conserved in all sequences. The histidine residue in the

HXXXD(G) motif has been postulated to function as a general

base in catalysis of the acyltransfer reaction (Shaw and Leslie

1991, St-Pierre et al. 1998). Indeed, the activity of HMT/HLT

was inhibited by DEPC, although the inhibition required a

higher concentration of DEPC than previously reported for

acyltransferases (for example, St-Pierre et al. 1998, St-Pierre

and De Luca 2000, Grothe et al. 2001). The requirement for a

higher concentration of DEPC could be due to the different

protein folding pattern that prevents the access of DEPC to the

catalytic histidine. The HMT/HLT activity was also inhibited

by p-chloromercuribenzoic acid, indicating the involvement of

a cysteine residue in the catalytic function. This could be the

conserved cysteine residue indicated in Fig. 9, that may be a

component of a catalytic triad as suggested previously (Grothe

et al. 2001).

The HMT/HLT gene was expressed specifically in roots

and hypocotyls, and only a limited level of expression has been

detected in cotyledons and leaves. This expression pattern is in

good agreement with the enzymatic activity of HMT/HLT, rep-

resenting ∼84% of the total activity found in roots and hypocot-

yls (Suzuki et al. 1994). These results indicate that roots and

hypocotyls are the main organs for the biosynthesis of quinoliz-

idine alkaloids in plant organs. Previously we also reported that

the distribution of several different acyltransferases in different

plant species is well correlated with the accumulation of

acylated quinolizidine alkaloids (Suzuki et al. 1994), suggest-

ing the importance of the terminal acyltransferase for alkaloid

accumulation patterns in diverse plant species.

Previously we detected HMT/HLT activities dominantly

in the particle fractions associated with the mitochondrial

marker enzymes (Suzuki et al. 1996). In fact, by the prediction

of the iPSORT program (http://psort.nibb.ac.jp/), the N-termi-

nal sequence of the deduced HMT/HLT showed the highest

score for translocation to the mitochondria. However, the

sequence of purified HMT/HLT started from the second amino

acid of the deduced sequence derived from cDNA, indicating

that no processing as an ordinary mitochondrial transit peptide

takes place. Since there are some examples of a lack of a cleav-

able mitochondrial pre-sequence (Sjöling and Glaser 1998), the

N-terminal sequence of HMT/HLT may act as a targeting sig-

nal to mitochondria without extensive processing. Otherwise

HMT/HLT may localize in another particle fraction such as the

peroxisomes, since there is a signal peptide-like sequence

(SHI) for peroxisome translocation in the C-terminus of the

HMT/HLT protein. This sequence shows a close similarity to

the characteristic C-terminal peroxisome targeting signal type 1

(Reumann 2004). Thus, it still remains an open question in

which subcellular compartment HMT/HLT localizes.

In some Lupinus species, the alkaloid-rich ‘bitter’ form

and the alkaloid-poor ‘sweet’ form are available. Recently, we

have investigated the alkaloid accumulation patterns, gene

expression profiles by cDNA-amplified fragment length poly-

morphism and the HMT/HLT activities of the ‘bitter’ and

‘sweet’ forms of L. angustifolius (Hirai et al. 2000). Although

striking differences in alkaloid accumulation were observed

between the two forms, no significant difference in the HMT/

HLT activity was seen in the hypocotyl cell-free extracts of

Alkaloid acyltransferase242

at The Japanese S

ociety of Plant P

hysiologists on Novem

ber 5, 2010pcp.oxfordjournals.org

Dow

nloaded from

these forms. These results suggest that HMT/HLT is regulated

independently from the genetic factor that determines the alka-

loid accumulation in ‘bitter’ and ‘sweet’ forms.

In conclusion, we have cloned and characterized the

cDNA encoding HMT/HLT responsible for determination of

alkaloid accumulation patterns in L. albus. The present findings

can serve as the molecular information for a better understand-

ing and a further metabolic engineering of quinolizidine alka-

loid metabolism in plants.

Materials and Methods

Chemicals

(–)-13α-Hydroxymultiflorine and (+)-13α-hydroxylupanine used

in this study were from our laboratory stock. Tigloyl-, acetyl-, propio-

nyl-, 2-butenoyl- and benzoyl-CoA were purchased from Sigma-

Aldrich (St Louis, MO, U.S.A.). The molecular weight markers used

for SDS–PAGE were purchased from Amersham Biosciences (Piscata-

way, NJ, U.S.A.). Bradford protein dye reagent was purchased from

Bio-Rad (Hercules, CA, U.S.A.). Restriction enzymes were purchased

from TaKaRa (Ohtsu, Japan) or Toyobo (Osaka, Japan). T4 DNA

ligase was purchased from Promega (Madison, WI, U.S.A.) or Nova-

gen EMD Biosciences (Madison, WI, U.S.A.). DNA amplification by

PCR using Pyrobest or Ex Taq DNA polymerase (TaKaRa) was car-

ried out in an iCycler thermocycler (Bio-Rad). Other chemicals and

enzymes were of the highest grade available.

Plant materials

The seeds of L. albus Forsk were germinated in moistened ver-

miculite in daylight in a greenhouse at ∼25°C as described previously

(Suzuki et al. 1994).

Purification of HMT/HLT

All procedures were performed at 4°C. Crude protein was

extracted from roots, hypocotyls and epicotyls (2.47 kg, fresh weight)

of 13-day-old L. albus seedlings as described (Suzuki et al. 1994). The

precipitate appearing between 30 and 80% (NH4)2SO

4 was collected

and dissolved in buffer A (20 mM sodium phosphate, pH 7.0, contain-

ing 10 mM 2-mercaptoethanol and 1.5 M ammonium sulfate). The

proteins were absorbed on butyl FF (Amersham) equilibrated with

buffer A and were eluted at a flow rate of 0.8 ml min–1 with a linear

gradient of 1.5–1.0 M ammonium sulfate. The fractions with the

enzyme activity were collected and concentrated. The proteins were

then separated on Superdex 200 pg (Amersham) equilibrated with

buffer B (20 mM sodium phosphate, pH 6.3, containing 10 mM 2-mer-

captoethanol) at a flow rate of 1.0 ml min–1. The fractions with the

enzyme activity were collected and then applied to SP Sepharose XL

(Amersham). The proteins were eluted at a flow rate of 2.0 ml min–1

with a linear gradient of 0–0.5 M NaCl, and the fractions with the

enzyme activity were collected and concentrated. The portion (0.125

volume) of the concentrated enzyme solution was then separated on

Superdex 200 HR (Amersham) equilibrated with buffer B at a flow

rate of 0.3 ml min–1. The fractions with the enzyme activity were col-

lected and then applied to RESOURCE S (Amersham) equilibrated

with buffer B. Proteins were eluted at a flow rate of 4.0 ml min–1 with

a linear gradient of 0–0.5 M NaCl.

Determination of internal and N-terminal amino acid sequences

After the final step of protein purification by RESOURCE S, the

fraction with the highest enzymatic activity was subjected to 12.5%

SDS–PAGE. Bands were detected by silver staining. The three

observed bands of 25, 30 and 60 kDa proteins were subjected to deter-

mination of the internal amino acid sequences. The respective bands

were digested in-gel by trypsin and then separated by reverse-phase

HPLC. HPLC separation was performed on a TSKgel ODS-80Ts QA

(2.0×250 mm) column (Tosoh, Tokyo, Japan) with a gradient of 0–

90% acetonitrile in 0.1% trifluoroacetic acid (TFA) at a flow rate of

0.2 ml min–1. Separated peptides were monitored at 210 and 280 nm.

Sequencing of the peptides was performed using a Procise 494 cLC

(Applied Biosystems, Foster City, CA, U.S.A.) or Hewlett-Packard

G1005A (Hewlett Packard, Palo Alto, CA, U.S.A.) protein sequenc-

ing system. To determine the N-terminal amino acid sequence of the

25 and 30 kDa bands, the peptides in the gel of SDS–PAGE were

transferred to a PVDF membrane and then analyzed by protein

sequencer, Procise 494 HT (Applied Biosystems).

Molecular cloning of cDNA

Isolation of partial fragments encoding the 25 kDa peptide by

RT–PCR—Total RNA was extracted from roots of 10-day-old L. albus

with the RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany) or TRI-

zol reagents (Invitrogen, Carlsbad, CA, U.S.A.). mRNA was purified

using an mRNA Purification Kit (Amersham). From total RNA

extracted from roots, first-strand cDNA was synthesized using AMV

reverse transcriptase XL (TaKaRa) with the Oligo dT-3sites Adaptor

Primer (TaKaRa). The degenerate primers were designed from the

amino acid sequence of the 25 kDa peptide. The first PCR was per-

formed using the forward primers P25K-1F, GARYTNGAYGAYYT-

NTTYAA (corresponding to the amino acid sequence of ELDDLFK);

P25K-2F, GAYGTNGAYTTYGGNTGGGGNAA (corresponding to

the amino acid sequence of DVDFGWGK); or P25K-3F-1, CCNWS-

NTAYTTYTAYAAYGA (corresponding to the amino acid sequence of

PSYFYND) and the reverse primer of the 3sites Adaptor Primer

(TaKaRa) which hybridizes to a region synthesized by the Oligo dT-

3sites Adaptor Primer. With the forward primer corresponding to these

templates and the other reverse primers, which have complementary

sequences to those of the forward primers, P25K-1R, P25K-2R and

P25K-3R-1 (corresponding to P25K-1F, P25K-2F and P25K-3F-1,

respectively), the nested PCR was performed with all possible combi-

nations of the forward and reverse primers. The amplified fragments

were cloned into pT7Blue T-vector (Novagen) by TA-cloning, and the

nucleotide sequences of the inserts were determined.

Isolation of the full-length clone by cDNA library screening and

5′-RACE—The cDNA library was constructed with the λZAPII vector

(Stratagene, La Jolla, CA, U.S.A.) from mRNA of L. albus, and

2.0×105 plaques of primary cDNA library were screened by the PCR-

amplified fragment. Plaques were blotted onto positively charged

nylon membranes, Hybond N+ (Amersham). Duplicate filters were

hybridized with the 32P-labeled probe prepared by the Random Primer

DNA Labeling Kit Ver.2 (TaKaRa) using the 242 bp nucleotide frag-

ment, which was amplified specifically by RT–PCR with the combina-

tion of P25K-3F-1 and P25K-1R as a template. The final post-

hybridization wash was performed in 0.2×SSPE (Sambrook et al.

1989) and 0.1% SDS at 65°C. For extension of the 5′-terminus of the

cDNA, 5′-RACE was performed using the 5′-Full RACE Core Set

(TaKaRa).

Expression and purification of recombinant HMT/HLT

BamHI sites were created on both ends of the HMT/HLT coding

region by PCR using the two primers: BamHI F, CGCGGATCCAT-

GGCTCCCCAAACTCAATCTCTA; and BamHI R, CGCGGATCCT-

CAAATGTGTGACCTTAATATTTG. The engineered cDNA fragment

was inserted into the BamHI site of pGEX-6P-2 (Amersham) with the

correct orientation confirmed by sequence analysis as designated

pGEX-HMT/HLT, which gives a recombinant gene product with an N-

Alkaloid acyltransferase 243

at The Japanese S

ociety of Plant P

hysiologists on Novem

ber 5, 2010pcp.oxfordjournals.org

Dow

nloaded from

terminal GST protein tag. E. coli BL21 cells harboring pGEX-HMT/

HLT and empty pGEX were grown at 20°C in 2×YT-ampicillin

(100 µg ml–1) liquid medium to an OD600

= 0.7–1.0. The solution of

0.1 mM isopropyl-β-D-thiogalactoside was added immediately for

inducible production of recombinant protein. The cells were suspended

in 1×phosphate-buffered saline [140 mM NaCl, 2.7 mM KCl, 10 mM

Na2HPO

4 and 1.8 mM KH

2PO

4 (pH 7.3)] and disrupted by sonication.

After the addition of Trition X-100 to 1% concentration and following

centrifugation, the supernatant was used as crude protein extracts. For

purification of the recombinant HMT/HLT, a GSTrap column

(Amersham), whose resin has glutathione as ligand resulting in affin-

ity for GST, was used. GST tags were removed from GST fusion

recombinant proteins by in-column digestion using PreScission Pro-

tease (Amersham).

Assay of enzymatic activity

The HMT/HLT activity was determined by detection of the ester

alkaloid formed from alkaloid substrates and acyl-CoA derivatives by

enzymatic reaction. The standard reaction mixture consisted of

100 mM potassium phosphate (pH 8.0), 0.5 mM EDTA, 1 mM dithio-

threitol (DTT), 0.15 mM alkaloid substrate, 0.15 mM acyl-CoA deriv-

ative and protein. After incubation for 10–60 min at 30°C, the reaction

was terminated by addition of a 0.67 volume of methanol. The reaction

mixture was analyzed directly by HPLC. HPLC analysis was per-

formed on a Mightysil RP-18 GP 150–4.6 (5 µm) column (Kanto

Chemical, Tokyo, Japan) with a mobile phase of 15% acetonitrile and

20 mM sodium phosphate (pH 5.5) at a flow rate of 0.5–1.0 ml min–1.

The formation of 13α-hydroxymultiflorine and 13α-hydroxylupanine

derivatives was monitored at 327 and 220 nm, respectively, as

described (Saito et al. 1989). The identification of products was con-

firmed further by LC-ESI/MS.

To elucidate the substrate specificity, the reaction with recom-

binant HMT/HLT protein was carried out with the various acyl-CoA

derivatives and the aglycons. The products were identified with LC-

ESI/MS

LC-PDA-ESI/MS analysis

The reaction mixtures were analyzed by an LC-PDA-ESI/MS

system consisting of a Finnigan LCQ DECA mass spectrometer

(Thermo Quest, San Jose, CA, U.S.A.) and an Agilent HPLC 1100

series (Agilent technologies, Palo Alto, CA, U.S.A.). LC separations

were performed on a Mightysil RP-18 GP 150–4.6 (5 µm) column

(Kanto Chemical) with a mobile phase of 15% acetonitrile and 0.1%

TFA at a flow rate of 0.5 ml min–1 using UV photodiode array detec-

tion. Nitrogen was used as sheath gas for positive ion ESI/MS per-

formed at a capillary temperature and voltage of 320°C and 5.0 kV,

respectively. The tube lens offset was set at 10.0 V. Full scan mass

spectra were acquired from 50 to 1,000 m/z at two scans s–1. Tandem

MS analysis was carried out with helium as collision gas. The normal-

ized collision energy was set to 40%. The specific products were iden-

tified from the theoretical unit mass for [M+H]+ in +ESI: 13-

tigloyloxymultiflorine, 345; 13-acetyloxymultiflorine, 305; 13-propio-

nyloxymultiflorine, 319; 13-(2-butenoyl)oxymultiflorine, 331; 13-ben-

zoyloxymultiflorine, 367; 13-tigloyloxylupanine, 347; 13-

acetyloxylupanine, 307; 13-propionyloxylupanine, 321; 13-(2-buten-

oyl)oxylupanine, 333; and 13-benzoyloxylupanine, 369. Fragmented

ions derived from these quasi-molecular ions were also identified by

the MS/MS technique. The relative activities regarding each acyl-CoA

were calculated by relative integration of ion areas of quasi-molecular

ions compared with the products of the tigloyl transferase reaction.

Northern and Southern blot analyses

For northern blot analysis, 40 µg of total RNA isolated from

leaves, developing (folded) leaves, cotyledons, hypocotyls and roots

was denatured and separated in a formaldehyde agarose (1.2%) gel.

For Southern blot analysis, genomic DNA was extracted from L. albus

using the DNeasy Plant Mini Kit (QIAGEN). Aliquots of 20 µg of

genomic DNA were digested with BamHI or EcoRV and separated on

a 0.8% agarose gel. After transfer to a Hybond N+ membrane, hybridi-

zation was carried out with the 32P-labeled probe prepared from the

ORF of HMT/HLT cDNA using the Random Primer DNA Labeling

Kit Ver.2 (TaKaRa). The final washes on post-hybridization were per-

formed in 0.5× SSPE and 0.1% SDS at 65°C. Hybridization signals

were detected with a STORM 860 image analyzer (Amersham).

Miscellaneous techniques

All recombinant DNA technology principally followed the meth-

ods of Sambrook et al. (1989). DNA sequencing was performed by the

dideoxy chain termination method. Phylogenetic analysis was carried

out by CLUSTAL W packaged in DNASpace Ver. 3.5 (Hitachi Soft-

ware, Tokyo, Japan), and the tree was drawn by DNASpace. SDS–

PAGE and subsequent staining of proteins were performed as

described previously (Suzuki et al. 1994). Gas chromatography–mass

spectrometry for detection of benzylbenzoate was carried out as

described previously (Hirai et al. 2000, D’Auria et al. 2002).

Acknowledgments

This work was supported, in part, by Grants-in-Aid for Scien-

tific Research from the Ministry of Education, Culture, Sports, Sci-

ence and Technology, Japan, by CREST of Japan Science and

Technology Agency (JST) and by Research for the Future Program

(00L01605) ‘Molecular mechanisms on regulation of morphogenesis

and metabolism leading to increased plant productivity’. We thank

CREST-Plant Molecular Science Satellite Laboratory in the Life Sci-

ence Research Support Center of Akita Prefectural University for

DNA sequencing.

References

Bayer, A., Ma, X. and Stöckigt, J. (2004) Acetyltransfer in natural product bio-

synthesis—functional cloning and molecular analysis of vinorine synthase.

Bioorg. Med. Chem. 12: 2787–2795.

Burhenne, K., Kristensen, B.K. and Rasmussen, S.K. (2003) A new class of N-

hydroxycinnamoyltransferases. Purification, cloning, and expression of a bar-

ley agmatine coumaroyltransferase (EC 2.3.1.64). J. Biol. Chem. 278: 13919–

13927.

D’Auria, J.C., Chen, F. and Pichersky, E. (2002) Characterization of an acyl-

transferase capable of synthesizing benzylbenzoate and other volatile esters in

flowers and damaged leaves of Clarkia breweri. Plant Physiol. 130: 466–476.

Grothe, T., Lenz, R. and Kutchan, T.M. (2001) Molecular characterization of the

salutaridinol 7-O-acetyltransferase involved in morphine biosynthesis in

opium poppy Papaver somniferum. J. Biol. Chem. 276: 30717–30723.

Hirai, M.Y., Suzuki, H., Yamazaki, M. and Saito, K. (2000) Biochemical and

partial molecular characterization of bitter and sweet forms of Lupinus angus-

tifolius, an experimental model for study of molecular regulation of quinolizi-

dine alkaloid biosynthesis. Chem. Pharm. Bull. 48: 1458–1461.

Hoffmann, L., Maury, S., Martz, F., Geoffroy, P. and Legrand, M. (2003) Purifi-

cation, cloning, and properties of an acyltransferase controlling shikimate and

quinate ester intermediates in phenylpropanoid metabolism. J. Biol. Chem.

278: 95–103.

Laflamme, P., St-Pierre, B. and De Luca, V. (2001) Molecular and biochemical

analysis of a Madagascar periwinkle root-specific minovincinine-19-

hydroxy-O-acetyltransferase. Plant Physiol. 125: 189–198.

Leete, E. (1973) Biosynthetic conversion of α-methylbutyric acid to tiglic acid

in Datura meteloides. Phytochemistry 12: 2203–2205.

Alkaloid acyltransferase244

at The Japanese S

ociety of Plant P

hysiologists on Novem

ber 5, 2010pcp.oxfordjournals.org

Dow

nloaded from

Lounasmaa, M. (1988) The Alkaloids: The Tropane Alkaloids. Edited by Brossi,

A. Vol. 33. Academic Press, Inc., CA.

McGaw, B.A. and Woolley, J.G. (1977) Non-reversibility of the isoleucine-ace-

tate pathway in Datura. Phytochemistry 16: 1711–1713.

Niggeweg, R., Michael, A.J. and Martin, C. (2004) Engineering plants with

increased levels of the antioxidant chlorogenic acid. Nature Biothechnol. 22:

746–754.

Ohmiya, S., Saito, K. and Murakoshi, I. (1995) The Alkaloids: Lupine Alka-

loids. Edited by Cordell, G.A. Vol. 47. Academic Press, Inc., CA.

Power, R., Kurz W.G. and De Luca, V. (1990) Purification and characterization

of acetylcoenzyme A:deacetylvindoline 4-O-acetyltransferase from Catha-

ranthus roseus. Arch. Biochem. Biophys. 279: 370–376.

Reumann, S. (2004) Specification of the peroxisome targeting signals type 1 and

type 2 of plant peroxisomes by bioinformatics analyses. Plant Physiol. 135:

783–800.

Roberts, M.F. and Wink, M. (1998) Alkaloids Biochemistry, Ecology, and

Medicinal Applications. Plenum Press, New York.

Saito, K., Kobayashi, K., Ohmiya, S., Otomasu, H. and Murakoshi, I. (1989)

Analysis of lupine alkaloids in plants by high-performance liquid chromatog-

raphy. J. Chromatogr. A. 462: 333–340.

Saito, K. and Murakoshi, I. (1995) Studies in Natural Chemistry: Chemistry,

Biochemistry and Chemotaxonomy of Lupine Alkaloids in Leguminosae.

Edited by Rahman, A.-U. Vol. 15. Elsevier Science, Oxford.

Saito, K., Suzuki, H., Takamatsu, S. and Murakoshi, I. (1993) Acyltransferases

for lupin alkaloids in Lupinus hirsutus. Phytochemistry. 32: 87–91.

Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Labo-

ratory Manual, 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring

Harbor, NY.

Shaw, W.V. and Leslie, A.G. (1991) Chloramphenicol acetyltransferase. Annu.

Rev. Biophys. Biophys. Chem. 20: 363–386.

Sjöling, S. and Glaser, E. (1998) Mitochondrial targeting peptides in plants.

Trends Plant Sci. 3: 136–140.

St-Pierre, B. and De Luca, V. (2000) Recent Advances in Phytochemistry Evolu-

tion of Metabolic Pathways. Edited by John, R.I., Romeo, T., Varin, L. and

De Luca, V. Vol. 34. Elsevier Science, Oxford.

St-Pierre, B., Laflamme, P., Alarco, A.-M. and De Luca, V. (1998) The terminal

O-acetyltransferase involved in vindoline biosynthesis defines a new class of

proteins responsible for coenzyme A-dependent acyl transfer. Plant J. 14:

703–713.

Strack, D., Becher, A., Brall, S. and Witte, L. (1991) Quinolizidine alkaloids and

the enzymatic syntheses of their cinnamic and hydroxycinnamic acid esters in

Lupinus angustifolius and L. luteus. Phytochemistry 30: 1493–1498.

Suzuki, H., Koike, Y., Murakoshi, I. and Saito, K. (1996) Subcellular localiza-

tion of acyltransferases for quinolizidine alkaloid biosynthesis in Lupinus.

Phytochemistry 42: 1557–1562.

Suzuki, H., Murakoshi I. and Saito, K. (1994) A novel O-tigloyltransferase for

alkaloid biosynthesis in plants. Purification, characterization, and distribution

in Lupinus plants. J. Biol. Chem. 269: 15853–15860.

Suzuki, H., Nakayama, T., Yonekura-Sakakibara, K., Fukui, Y., Nakamura, N.,

Yamaguchi, M.A., Tanaka, Y., Kusumi, T. and Nishino, T. (2002) cDNA

cloning, heterologous expressions, and functional characterization of malo-

nyl-coenzyme A:anthocyanidin 3-O-glucoside-6′′-O-malonyltransferase from

dahlia flowers. Plant Physiol. 130: 2142–2151.

Suzuki, H., Sawada, S., Watanabe, K., Nagae, S., Yamaguchi, M.A., Nakayama,

T. and Nishino, T. (2004) Identification and characterization of a novel

anthocyanin malonyltransferase from scarlet sage (Salvia splendens) flowers:

an enzyme that is phylogenetically separated from other anthocyanin acyl-

transferases. Plant J. 38: 994–1003.

Tang, W. and Eisenbrand, G. (1992) Chinese Drugs of Plant Origin, Chemistry,

Pharmacology, and Use in Traditional and Modern Medicine. Springer-Ver-

lag, Berlin.

Walker, K. and Croteau, R. (2001) Taxol biosynthetic genes. Phytochemistry 58:

1–7.

Walker, K. and Croteau, R. (2000a) Taxol biosynthesis: molecular cloning of a

benzoyl-CoA:taxane 2α-O-benzoyltransferase cDNA from Taxus and func-

tional expression in Escherichia coli. Proc. Natl. Acad. Sci. USA 97: 13591–

13596.

Walker, K. and Croteau, R. (2000b) Molecular cloning of a 10-deacetylbaccatin

III-10-O-acetyl transferase cDNA from Taxus and functional expression in

Escherichia coli. Proc. Natl. Acad. Sci. USA 97: 583–587.

Walker, K., Fujisaki, S., Long, R. and Croteau, R. (2002a) Molecular cloning

and heterologous expression of the C-13 phenylpropanoid side chain-CoA

acyltransferase that functions in taxol biosynthesis. Proc. Natl. Acad. Sci.

USA 99: 12715–12720.

Walker, K., Long, R. and Croteau, R. (2002b) The final acylation step in taxol

biosynthesis: cloning of the taxoid C13-side-chain N-benzoyltransferase from

Taxus. Proc. Natl. Acad. Sci. USA 99: 9166–9171.

Walker, K., Schoendorf, A. and Croteau, R. (2000c) Molecular cloning of a

taxa-4(20), 11(12)-dien-5α-ol-O-acetyl transferase cDNA from Taxus and

functional expression in Escherichia coli. Arch. Biochem. Biophys. 374: 371–

380.

Wink, M. and Hartmann, T. (1982a) Enzymatic synthesis of quinolizidine alka-

loid esters: a tigloyl-CoA:13-hydroxylupanine O-tigloyltransferase from

Lupinus albus L. Planta 156: 560–565.

Wink, M., Schiebel, H.M., Witte, L. and Hartmann, T. (1982b) Quinolizidine

alkaloids from plants and their cell suspension culture. Planta Med. 44: 15–

20.

Wink, M. and Witte, L. (1984) Turnover and transport of quinolizidine alka-

loids: diurnal variation of lupanine in the phloem sap, leaves and fruits of

Lupinus albus L. Planta 161: 519–524.

Yang, Q., Reinhard, K., Schiltz, E. and Matern, U. (1997) Characterization and

heterologous expression of hydroxycinnamoyl/benzoyl-CoA:anthranilate N-

hydroxycinnamoyl/benzoyltransferase from elicited cell cultures of carna-

tion, Dianthus caryophyllus L. Plant Mol. Biol. 35: 777–789.

Yang, Q., Trinh, H.X., Imai, S., Ishihara, A., Zhang, L., Nakayashiki, H., Tosa,

Y. and Mayama, S. (2004) Analysis of the involvement of hydroxyanthrani-

late hydroxycinnamoyltransferase and caffeoyl-CoA 3-O-methyltransferase

in phytoalexin biosynthesis in oat. Mol. Plant Microbe Interact. 17: 81–89.

(Received October 12, 2004; Accepted November 10, 2004)