Modulation of DNA glycosylase activities in mesenchymal stem cells

E X P E R I M E N T A L C E L L R E S E A R C H X X ( 2 0 0 9 ) X X X – X X X

YEXCR-08153; No. of pages: 10; 4C: 4

ava i l ab l e a t www.sc i enced i r ec t . com

www.e l sev i e r. com/ loca te /yexc r

ARTICLE IN PRESS

Research Article

Modulation of DNA glycosylase activities in mesenchymalstem cells

Gunn A. Hildrestranda,1, Shivali Duggalb,1, Magnar Bjøråsa, Luisa Lunaa,⁎, Jan E. Brinchmannb,⁎

aCentre for Molecular Biology and Neuroscience and Institute of Medical Microbiology, Rikshospitalet University Hospital, 0027 Oslo, NorwaybInstitute of Immunology, Rikshospitalet University Hospital, 0027 Oslo, Norway

A R T I C L E I N F O R M A T I O N

⁎ Corresponding authors. J.E. Brinchmann is toE-mail addresses: [email protected]

1 These authors contributed equally.

0014-4827/$ – see front matter © 2009 Elseviedoi:10.1016/j.yexcr.2009.05.017

Please cite this article as: G.A. Hildrestrand(2009), doi:10.1016/j.yexcr.2009.05.017

A B S T R A C T

Article Chronology:

Received 2 February 2009Revised version received 28 April 2009Accepted 19 May 2009

Adipose-tissue derived mesenchymal stem cells (AT-MSCs) are a promising tool for use in cell-based therapies. However, in vitro expansion is required to obtain clinically relevant cell numbers,and thismight increase the chance of genomic instability. DNA repair is crucial formaintaining DNAintegrity. Herewe have compared the initial step of base excision repair in uncultured and culturedAT-MSCs by analysis of base removal activities and expression levels of relevant DNA glycosylases.Uracil, 5-hydroxyuracil and ethenoadenine removal activities were upregulated in cultured cellscompared to uncultured cells. In contrast, both the 8-oxo-7,8-dihydroguanine (8-oxoG) removalactivity and the concentration of 8-oxoG bases in the DNAwere reduced in the cultured cells. Geneexpression analysis showed no substantial changes in mRNA expression. The glycosylase activities

remained stable through at least 12 passages, suggesting that DNA repair is proficient through theperiod required for in vitro expansion of AT-MSCs to clinically relevant numbers.

© 2009 Elsevier Inc. All rights reserved.

Keywords:

Mesenchymal stem cellsBase excision repairDNA glycosylases8-oxoG

Introduction

During the last few years, multipotent cells with the ability toproliferate in culture without losing their potential to differentiatetowards several mesodermal lineages have been isolated fromadipose tissue (AT) and extensively characterized [1–4]. The cellsare easily obtained in high numbers, and AT is therefore considereda promising cell source for use in regenerative medicine [5–7].Furthermore, the immunorejection problem may be avoidedbecause in vitro expansion can be performed without allogeneicor xenogeneic additives [8]. Numerous terms have been used todescribe the cells. In this paper we will refer to them as adiposetissue-derived mesenchymal stem cells (AT-MSCs), consistentwith suggestions by The International Society for Cellular Therapy(ISCT) [9].

be contacted at Fax: +47 2(L. Luna), jan.brinchmann@

r Inc. All rights reserved.

, et al., Modulation of DNA

In order to obtain the number of cells required for most clinicalprotocols, the AT-MSCs need to be expanded in vitro throughseveral passages. In vitro culture dramatically alters cell shape,cytoskeletal polarization, cell metabolism and the concentration ofoxygen to which the cells are exposed [3,10,11]. This increases theprobability of genomic instability and transformation. Genomicinstability is normally a result of the accumulation of DNA damage;therefore DNA repair is essential for maintaining genome integrityand cell performance. Impaired DNA repair and accumulation ofDNA damage have been causally implicated in stem cell aging[12–15], spontaneous transformation [16–18], and loss of differ-entiation potential (Alves, 6th ISSCR annual meeting 2008,Philadelphia, USA). Thus, in order to be able to safely use in vitroexpanded AT-MSCs in therapeutic protocols, it is important toshow that DNA repair activities are efficient in cultured AT-MSCs.

3 07 35 10; L. Luna, Fax: +47 23 07 40 61.rr-research.no (J.E. Brinchmann).

glycosylase activities in mesenchymal stem cells, Exp. Cell. Res.

mailto:[email protected]

mailto:[email protected]

http://dx.doi.org/10.1016/j.yexcr.2009.05.017


2 E X P E R I M E N T A L C E L L R E S E A R C H X X ( 2 0 0 9 ) X X X – X X X

ARTICLE IN PRESS

Base excision repair is one of several DNA repair mechanismsthat have evolved to protect the genome [19,20]. This repairpathway deals with the most ubiquitous lesions in DNA: oxidized,alkylated and deaminated bases, AP-sites and single-strand breaks[21,22]. Oxidative damage in particular has been associated withcancer and neurodegenerative diseases such as Alzheimer's andParkinson's diseases and to processes of normal aging [23–25]. BERis initiated by a DNA glycosylase that cleaves the N-glycosylic bondbetween the damaged base and the sugar. The baseless sugar isremoved and replaced with a new nucleotide by downstreamenzymes including AP endonucleases, DNA polymerases andligases [26,27]. Mammalian DNA glycosylases that remove oxi-dized bases include OGG1, NTH1, NEIL1 and NEIL2. OGG1 is themajor enzyme for repair of the highly premutagenic lesion 8-oxo-7,8-dihydroguanine (8-oxoG), which is generated in DNAmainly as aresult of oxidation of guanine, or by misincorporation duringreplication [28–34]. If not removed before the next round ofreplication, it may give rise to a GC to TA transversion [35–38].NTH1 initiates repair of C-5, C-6 ring saturated pyrimidines such asthymine glycol (Tg) and 5-hydroxyuracil (5-ohU), [39–42]. NEIL1and NEIL2 have overlapping substrate specificities with OGG1 andNTH1. They both recognize 5-ohU in ssDNA and bubble structures,but only NEIL1 shows affinity for this lesion in dsDNA [43].Furthermore, NEIL1 shows some affinity towards 8-oxoG in ssDNAand duplex DNA, whereas NEIL2 removes this lesion mainly inbubble structures [43–46]. Uracil may occur in DNA by sponta-neous deamination of cytosine leading to mutagenic UG mispairs,or by misincorporation of deoxyuridine monophosphate (dUMP)instead of thymine during DNA replication, generating less harmfulUA pairs. Four DNA glycosylases remove uracil: UNG, SMUG, TDGand MBD4 [47]. Mammalian cells have several enzymes for repairof alkylating damage [48], but alkyladenine DNA glycosylase(AAG/MPG/ANPG) is the only DNA glycosylase [49,50]. Thisenzyme is primarily responsible for removing N7-alkylpurines,N3-methyladenine, and ethenobase DNA lesions. Single anddouble knockout models of various DNA glycosylases haveshown an increase in the incidence of cancer in both unexposedanimals and in animals exposed to different insults revealing theimportance of BER in tumor development [51–58].

Even though no studies have so far been published usingAT-MSCs in clinical trials, several human studies are known to beunder way (see http://clinicaltrials.gov). The number of cells usedin these studies is not given, but by analogy with bone marrowderived MSCs (BM-MSCs), 1–2×106 AT-MSCs per kg body weightis likely to be given when an immunosuppressive effect is sought[59], while more than 109 AT-MSCs may be required in some trialsof tissue regenerative therapy [60]. Such cell numbers may beobtained by culturing AT-MSCs through 12 passages or less. Severalstudies have characterized AT-MSCs with respect to surfacemarkers, gene expression, differentiation potential and geneticstability [1,3,61–66], but to our knowledge, there are no reports onDNA repair activity in these cells. Thus, in the present study, wehave examined the initial step of DNA repair of endogenous baselesions by quantification of DNA glycosylase activities and mRNAlevels of the responsible DNA glycosylases during the first 12passages of in vitro expansion of AT-MSCs and in primary,uncultured AT-MSCs from the same donors. We have alsodetermined the concentration of 8-oxoG lesions in the DNA ofthese cells. Our results show that BER is proficient in in vitroexpanded AT-MSCs.

Please cite this article as: G.A. Hildrestrand, et al., Modulation of DNA(2009), doi:10.1016/j.yexcr.2009.05.017

Materials and methods

Isolation and culture of AT-MSCs from human adipose tissue

AT was obtained by liposuction of healthy donors aged 18–39. Thedonors provided written, informed consent, and the collection andstorage of AT and AT-MSCs were approved by the regionalcommittee for ethics in medical research. The stromal vascularfraction (SVF) was separated from AT as described previously [3].Briefly, lipoaspirate (300–1000 ml) was washed repeatedly anddigested for 45 min on a shaker at 37 °C using 0.1% collagenaseA type 1 (Sigma Aldrich, St. Louis, USA). After centrifugationat 400 ×g for 10 min, floating adipocytes were removed. Theremaining SVF cells were resuspended in Hanks' balanced saltsolution (Gibco, Paisley, UK) containing 2% fetal bovine serum(FBS) (BioWhittaker, Verviers, Belgium). Tissue clumps wereallowed to settle for 1 min. Suspended cells were filtered through100 μmand then 40 μmcell sieves (Becton Dickinson, San Jose, CA).SVF cells were obtained from the interface after Lymphoprepgradient separation at 400 ×g for 30 min (Axis Shield, Oslo,Norway) washed and resuspended in Dulbecco's modified Eagle'smedium (DMEM)/F12 (Gibco, Paisley, UK) containing 10% FBS andantibiotics. Cell counts and viability assessment were performedusing acridine orange/ethidium bromide staining and a NikonEclipse E600 fluorescence microscope (Nikon Corporation, Kana-gawa, Japan).

Immediately after separation, AT-MSCs were isolated from theremaining cells bymagnetic cell sorting. Endothelial cells (CD31+)and leukocytes (CD45+) were removed using magnetic beadsdirectly coupled tomouse anti-human CD31 and CD45monoclonalantibodies (MAb) and LS columns (Miltenyi Biotech, BergishGladbach, Germany), which may be used for depletion of up to1×108 magnetically labeled cells, as described by the producer.Flow cytometric analyses showed that no more than 5% of CD31+and CD45+ cells were left in the suspension (data not shown).Data on the homogeneity, phenotype, functional capabilities andgene expression of CD31−CD45− AT-MSCs have been publishedpreviously [3]. Some of the cells were washed, pelleted and storedas uncultured cells while the rest of them were resuspended inDMEM/F12 containing 20% FBS and antibiotics and established inin vitro culture in incubators containing 5% CO2 mixed with roomair at 37 °C. After 4 to 7 days of culture the medium containingnonadherent cells was discarded, the cultures were washed withDPBS (Gibco, Paisley, UK), and fresh culture medium was added.When the cells reached 50% confluence, adherence was inter-rupted with trypsin-EDTA (Sigma Aldrich, St. Louis, USA), andthe cells were inoculated into new flasks at 5000 cells per cm2.After the first passage 10% FBS was used in stead of 20% for theduration of the cultures. Viable cells (normally >95% of all cells)were counted at each passage. The medium was replaced every2–3 days. Cultured cells were harvested at passages 2–4 and 12–13and snap frozen in liquid nitrogen.

In vitro differentiation of AT-MSCs

Differentiation of AT-MSCs to adipogenic or osteogenic lineageswas performed by using cells from 3 donors at passages 3, 6 and 12,respectively. The culture medium was replaced with specificdifferentiation inductive medium that was changed every third


http://clinicaltrials.gov


Table 1 – DNA oligonucleotides used as substrates in activityassays.

Lesion Oligo

8-oxo-7, 8-dihydroguanine(8-oxoG)

5′ggcggcatgaccc[8-oxoG]gaggcccatc3′

1,N6-ethenoadenine (ɛA) 5′cgagtacggcgg[ɛA]gggcgcatgagc3′5-hydroxyuracil (5-ohU) 5′gcatgcctgcacgg[5-ohU]

catggccagatccccgggtaccgag3′Uracil (U) 5′gcatgcctgcacgg[U]

catggccagatccccgggtaccgag3′

3E X P E R I M E N T A L C E L L R E S E A R C H X X ( 2 0 0 9 ) X X X – X X X

ARTICLE IN PRESS

day. For adipogenic differentiation confluent cultures wereincubated in DMEM/F12 containing 10% FBS, 0.5 mM 1-methyl-3isobutylxanthine, 1 μM dexamethasone, 10 μg/ml insulin (NovoNordisk, Copenhagen, Denmark), and 100 μM indomethacin(Dumex-Alpharma, Copenhagen, Denmark). After 3 weeks, differ-entiated cells were fixed with 1% paraformaldehyde, washed in50% isopropanol, and subsequently incubated for 10 min with Oil-Red O to visualize lipid droplets. Cells were then washed inisopropanol and subjected to nuclear staining with hematoxylin.For osteogenic differentiation, cells were incubated at 3000 cellsper cm2 in DMEM/F12 containing 10% FBS, 100 nM dexametha-sone, 10 mM β-glycerophosphate, and 0.05 mM L-ascorbic acid-2-phosphate. After 3 weeks, differentiated cells were fixed for 1 hwith 1% paraformaldehyde and rinsed with DPBS. Mineralizationof the extracellular matrix was visualized by staining with 40 mMAlizarin Red S, pH 4.2, for 5 min.

Immunophenotypic analysis

AT-MSCs from 3 donors at passages 3, 6 and 13, respectively, werelabeled with the following anti-human antibodies: CD105-APC,CD45-PE, CD14-FITC, CD19 APC (Diatec, Oslo, Norway), CD90-PE,CD73-PE, CD34-FITC, HLA-DR (BD Biosciences, San Diego, CA).Irrelevant control monoclonal antibodies were included for allfluorochromes. In vitro expanded cells were incubated withmonoclonal antibodies for 15 min in the dark, washed and ana-lyzed using a FACS Calibur flow cytometer (BD Biosciences, SanDiego, CA).

RNA extraction and microarray gene chip hybridization

Data on the expression of DNA repair genes were selected from arecently published data set [67]. The three donors used for thisdata set are different from the donors used in the present project.Briefly, uncultured AT-MSCs and monolayer cultured cells werepelleted and snap frozen in liquid nitrogen. Total RNA wasextracted from cells using Ambion RNaqueous (Miro, Austin, TX).Due to small amounts of RNA in uncultured cells, cDNA wasprepared from 100 ng of total RNA using the Two-Cycle cDNASynthesis Kit (Affymetrix, Santa Clara, CA). For all samples, 10 μg ofcRNA was hybridized to the HG-U133A_2 array (Affymetrix, SantaClara, CA). Arrays were scannedwith Affymetrix GeneChip Scanner3000 7G. The data are published in ArrayExpress, accessionnumber E-MEXP-1273.

Microarray analysis

The open-source programming language and environment R(http://cran.r-project.org/doc/FAQ/R-FAQ.html#Citing-R) wereused for pre-processing and statistical analysis of the AffymetrixGeneChip microarrays. The Bioconductor [68] community buildsand maintains numerous packages for microarray analysis writtenin R, and several were used in this analysis. First, the array datawere normalized using the gcRMA package [69]. Probes withabsent calls in all arrays were discarded from the analysis. Afterpre-processing and normalization, a linear model of the experi-ment was made using Limma (bioinf.wehi.edu.au/limma/). Thisprogram was also used for statistical testing and ranking ofsignificantly differentially expressed probes [70]. Affy was used fordiagnostic plots and filtering [71]. To adjust for multiple testing,


the results for individual probes were ranked by Benjamini–Hochberg adjusted p-values, where p<0.01 and p<0.05 wereconsidered significant [72]. Detection of probes was done byGenespring GX 7.3.1 (Agilent Technologies, Palo Alto, CA).

Preparation of total cell extracts

Frozen pellets of uncultured and cultured AT-MSCs were resus-pended in 2 packed cell volumes (PCV) of buffer A (10 mM HepesKOH pH 7.7, 0.5 mMMgCl2, 10 mM KCl, 1 mM DTT, 1×protease and1×phosphatase inhibitor cocktails (Sigma, P8340 and P2850,respectively) and left on ice for 30 min. After 3 freeze/thaw cyclesin an ethanol/dry ice bath and awater bath of 30 °C, the cell debriswas pelleted by centrifugation at 13,000 rpm for 15 min in aHeraeus Biofuge fresco microcentrifuge (Kendro, Osterode, Ger-many). Total cell extracts were transferred to clean tubes andprotein concentrations measured by using the Bio-Rad ProteinMicroassay (Bio-Rad Laboratories, Hercules, CA, cat. no. 500-0006). Aliquots were stored at −70 °C.

Assay for enzymatic cleavage of DNA oligos containingmodified DNA bases

DNA glycosylase activities were measured using standard assays aspreviously described [30]. In short, oligonucleotides containing anyof the four modified bases, 8-oxoG, uracil, 5-ohU and ɛA (Table 1),were 32P-labeled at the 5′ terminus by using T4 polynucleotidekinase (New England Biolabs, Beverly, MA) and [γ-32P]ATP(3000 Ci/mmol) (Amersham Biosciences, UK), and subsequentlyannealedwith the complementary strand containing a normal baseopposite the lesion. Reaction mixtures of 10 μl containing 5 fmol ofthe duplex substrates, reaction buffer (70 mM MOPS, 1 mM DTT,1 mM EDTA and 5% glycerol) and 500 (uracil, 5-ohU and ɛA assays)or 1500 (8-oxoG assay) ng of total cell extracts were incubated for 2(uracil assay) or 4 (8-oxoG, 5-ohU and ɛA assays) hours at 37 °C. Todetect activity, theDNA strandhas to be cleaved after removal of thedamaged base. The monofunctional glycosylases are incapable ofincising the DNA strand and the endonuclease activity of thebifunctional glycosylases is poor. Thus, for effective incision of theDNA strand, NaOH was added to a final concentration of 0.1 M andthe reaction mixtures incubated for 20 min at 70 °C. 0.1 M HCl wasadded to neutralize the samples. After addition of 15 μl of stopsolution (80% formamide, 10 mM EDTA, bromophenol blue andxylene cyanol), the reaction mixtures were incubated for approxi-mately 3 min at 85 °C followed by 3–5 min at rt. Samples wereseparated on 20% denaturing polyacrylamide gels and resultsanalyzed using the Typhoon 9410 variable mood imager system


http://cran.r-project.org/doc/FAQ/R-FAQ.html#Citing-R



ARTICLE IN PRESS

and the ImageQuant TL software (both from Amersham Bios-ciences, UK). 9 parallels were run for each sample.

Preparation of genomic DNA and analysis of 8-oxoG contentby HPLC

Genomic DNA was isolated from AT-MSCs by using the Wizardgenomic DNA purification kit (Promega, Madison, WI, #A1125).Cell pellets or pellets remaining from total cell extract isolationswere resuspended in 600 μl of Nuclei Lysis Solution and 3 μlof RNase solution added. The samples were incubated at 37 °Cfor 30 min. After cooling for 5 min to room temperature, 200 μlof Protein Precipitation Solution was added and the solutionswere incubated on ice for 5 min. The samples were centrifugedat 13,000 rpm for 4 min (Heraeus Biofuge fresco) and the super-natants were transferred to new tubes containing 600 μl ofisopropanol. The solutions were mixed gently until thread-likeDNA appeared and then centrifuged at 13,000 rpm for 1 min. TheDNA pellets were washed in 600 μl of 70% ethanol and centrifugeda second time at 13,000 rpm for 1 min. The DNA pellets were air-dried over night, resuspended in 200 μl of DNA RehydrationSolution, and subjected to nuclease treatment using a protocoladapted fromHofer andMoller [73]. The DNA (7–65 μg) wasmixedwith hydrolysis buffer (50 mM NaAc pH 5.2, 0.2 mM ZnCl2) anddenatured by heating at 95 °C for 5 min, followed by cooling on ice.25 μg of Nuclease P1 (Sigma, Saint Louis, MI, #N8630) was addedand the DNA was incubated at 50 °C for 1 h. After addition of10 mM MgCl2, 50 mM of Tris–HCl pH 8 and 2 U of Calf IntestineAlkaline Phosphatase (Promega, Madison, WI, #M182A), the

Fig. 1 – Proliferation and differentiation of AT-MSCs. (A) Growth ki(B) AT-MSCs morphology after in vitro expansion. Staining of polycadipogenic lineage (Oil-Red O) and (D) osteogenic lineage (Alzarin


samples were incubated at 37 °C for 1.5 h. Samples were analyzedby agarose gel electrophoresis to make sure that the DNA wasproperly digested by the nuclease. 8-hydroxy-2′-deoxyguanosine(8-oxo-dG) and 2′-deoxyguanosine (dG) were separated by high-performance liquid chromatography (HPLC) and analyzed byelectrochemical detection (ECD; +300 mV) and ultraviolet (UV)light (290 nm). Results were expressed as the ratio of 8-oxo-dG/105 dG. 2 parallels were run for each sample.

Results

In vitro cultures of AT-MSCs

Cultures of AT-MSCs isolated from six donors were established andnamed D2, D3, D4, D3.1, DVI and DVII. The cumulative numbers ofAT-MSCs obtained from donors D2, D3 and D4 are shown in Fig. 1A.During log phase of growth, the cells had population doubling(PD) times of 50–60 h. The cells showed typical fibroblast likemorphology (Fig. 1B), expressed the immunophenotypic markersCD105, CD73, and CD90 and failed to express CD45, CD14, CD19,CD34 and HLA class II (data not shown) in accordance with thecriteria for defining MSCs [74]. Senescence was reached after 19–22 passages corresponding to 33–37 PD (Fig. 1A). To confirm theirdifferentiation potential, cells from donors D4, DVI and D3.1 wereinduced with specific differentiation media at passages 3, 6 or 12,respectively, thereby yielding adipocytes (Fig. 1C) and osteocytes(Fig. 1D). Cells at all three time points were capable of differentia-tion to both cell lineages.

netics of AT-MSCs from three donors during long term culture.lonal cultures of AT-MSCs after differentiation towards (C)Red). Images B–D; 100× magnification.



Fig. 2 –DNAglycosylase activities inuncultured (P0) and in early passage (P2 andP4)AT-MSCs from three donors (D3.1, DVI, andDVII).(A) 1500 and (B), (C), (D) 500 ng of total protein extracts were subjected to DNA glycosylase assays using (A) 8-oxoG-, (B) uracil-,(C) 5ohU- and (D) ɛA-containing DNA oligosubstrates (n=9 for each sample). Cleavage products were analyzed by 20% denaturingPAGE and phosphorimaging and results were documented by using the ImageQuant TL software from Amersham Biosciences.

Table 2 – Expression of DNA glycosylase genes in unculturedand cultured AT-MSCs.

Lesion DNAglycosylase genes

UnculturedAT-MSC

CulturedAT-MSC

8-oxoG OGG1 P P/ANEIL1 P/A A ⁎

ɛA MPG P/A P5-ohU NEIL1 P/A A ⁎

NTH1 P/A PUracil UNG P P

SMUG1 P/A P/ATDG P PMBD4 P P ⁎⁎

P: present, A: absent, P/A: borderline present.⁎ Significantly upregulated in uncultured AT-MSC p<0.05.

⁎⁎ Significantly upregulated in cultured AT-MSC p<0.01.


ARTICLE IN PRESS

Enhanced 8-oxoG and decreased uracil, 5-ohU andethenoadenine removal activities in uncultured comparedto cultured AT-MSCs

DNA glycosylase activities for removal of four different DNA baselesions, 8-oxoG, uracil, 5-ohU, and ɛA, were compared inuncultured (P0) and cultured (P2 and P4) AT-MSCs from donorsD3.1, DVI, and DVII. The results are shown in Fig. 2. For removal ofuracil, 5-ohU and ɛA, the over-all trend was increased activities inP2 cells compared to P0 cells. An exception was donor D3.1, whichshowed 10- to 35-fold higher 5-ohU removal activity at P0 than thetwo other donors (Fig. 2C). Interestingly, the 8-oxoG removalactivity was reduced 2- to 3-fold as a result of in vitro culture. Nosubstantial changes were detected from P2 to P4 in any of the fourassays (Fig. 2A).

Expression of DNA repair genes in uncultured and culturedAT-MSC

The activity assay results presented above indicated a difference inrepair capacity between uncultivated and cultivated cells. Oneplausible explanation could be that the expression of relevantenzymes varies between uncultivated and cultivated cells. There-fore the expression profile of DNA glycosylases with the exceptionof NEIL2, which was not present on the array, was examined inuncultivated and cultivated cells (Table 2). The expression of thegenes was either low present, borderline or absent. Consistentwith the enhanced 8-oxoG removal activity in uncultured AT-MSCs, the expression of OGG1 and NEIL1 was higher in these cellsthan in the cultured AT-MSCs. For the other repair activities, whichwere all higher in the cultured cells, the responsible genes were


either upregulated or unchanged in the cultured cells with theexception of NEIL1, which was not expressed in the cultured cells.

Higher 8-oxoG content in genomic DNA from unculturedcompared to cultured AT-MSCs

The activity assays revealed a higher 8-oxoG activity in P0 cellsthan in the cultured P2 and P4 cells. To determine if the reducedrepair activity was associated with accumulation of oxidizedguanines (8-oxoG) in the genomic DNA, we compared theprevalence of this lesion in uncultured P0 cells and in vitrocultured P2 and P4 cells from donors DVI and DVII. The resultsrevealed that, even though the repair assays showed reduced



Fig. 3 – 8-oxoG content in genomic DNA of AT-MSCs. GenomicDNA isolated from uncultured (P0) and initial passage (P2 andP4) cells from two individual donors (DVI and DVII) was treatedwith Nuclease P1 and subjected to HPLC analysis (n=2 for eachsample). The number of 8-oxo-dG per 105 dG was calculated byusing standard curves.


ARTICLE IN PRESS

activity, the prevalence of 8-oxoG also decreased between P0 andP2 cells (Fig. 3). No changes were noted between P2 and P4.

DNA repair capacity is maintained through many passages

We next compared activities in early passage cells to cellscultivated through P12. As can be seen from Fig. 1A, more than1010 AT-MSCs can normally be obtained at P12, a number likely tobe sufficient for most therapeutic applications. At this time, and forseveral more passages, the cells were still in log phase of growth(Fig. 1A). As the cultures used in the first part of the study (D3.1,DVI and DVII) were terminated at P4, cultures from three newdonors (D2, D3 and D4) were established for the next part of thestudy. As shown in Figs. 2 and 4, activities in cells from these

Fig. 4 – DNA glycosylase activities in early and late passage (P3 and(B), (C), (D) 500 ng of total protein extracts were subjected to DNA glɛA-containing DNA oligosubstrates. Cleavage products were analyzwere documented by using the ImageQuant TL software from Ame


donors at P3 corresponded well with the results obtained for P2and P4 cells from the first donors. Furthermore, no significantchanges in glycosylase activities from P2/P3/P4 to P12 wereobserved in any of the four assays. This shows that high DNA repairactivity is maintained through all passages at which AT-MSCs maybe harvested for therapeutic use. Using 8-oxoG and uracil removalassays we also determined DNA repair activities at replicativesenescence (P27–30). The results showed that repair of these DNAlesions was maintained at very late passages, although a slightdecrease in 8-oxoG removal activity was observed at senescence(Supplementary Figs. S1 and S2).

Discussion

AT-MSCs are a potential source for use in cell therapy andregenerative medicine. To obtain clinically relevant cell numbers,in vitro expansion is needed. This may compromise the genomicstability of the cells. Efficient DNA repair is essential formaintaininggenome integrity, and BER is the mechanism by which some of themost ubiquitous DNA lesions are removed. In the present study wecompared BER in primary, uncultured AT-MSCs and in vitroexpanded cells to determine whether in vitro culture affects therepair of small DNA base lesions in these cells.We also looked at theeffect of keeping the cells in culture for the time taken to obtainclinically relevant numbers of AT-MSC (through P12). We foundthat cell culture induced higher levels of uracil, 5-ohU, and ɛAactivity. The mRNA levels of the genes encoding the responsibleDNA glycosylases were found to be either unchanged or increasedin cultured cells. In contrast, we found that the 8-oxoG removalactivitywas reducedwhenunculturedAT-MSCswere established inculture. The mRNA levels of OGG1 and NEIL1 were also found to be

P12) AT-MSCs from three donors (D2, D3, and D4). (A) 1500 andycosylase assays using (A) 8-oxoG-, (B) uracil-, (C) 5ohU- and (D)ed by 20% denaturing PAGE and phosphorimaging and resultsrsham Biosciences.




ARTICLE IN PRESS

reduced in the cultured cells. Interestingly, this was not associatedwith an accumulation, but rather with a drop in the prevalence of8-oxoG lesions in cultured cells. We conclude that, during theperiod of in vitro cell culture required to obtain clinically relevantnumbers of AT-MSC, DNA repair activity appears to be adequate.

Dramatic changes occur when AT-MSCs are removed from theirquiescent, three-dimensional niche in vivo to be placed in in vitroculture. Upon adherence to the cell culture surface the cytoskeletonis polarized, and the shape changes to the typical fibroblastoid,flattened shape. Soona level of cell proliferation is establishedwhichthese cells may not have experienced since embryogenesis. All ofthis occurs in an atmosphere where the oxygen concentration isseveral kPa higher than the concentration towhich the AT-MSCs areaccustomed in vivo. Logically, this should be associated with anincreased level of DNA damage. In order to maintain genomeintegrity, in vitro cell culture should consequently be associatedwithenhanced DNA repair activity. Indeed, for three of the four types ofrepairactivityexaminedhere, this iswhatweobserved. The capacityto repair uracil, 5-ohU and ɛAwas many fold increased between P0and P2 for all donors and all assays, except for 5-ohU repair in donorD3.1, where the repair activity was already extraordinarily high inthe uncultured cells, and remained high after establishment in cellculture. Such interindividual variations of DNA repair activities havebeen shown to occur in population studies [75–78]. The transcriptsencoding the DNA glycosylases responsible for removal of theselesions, UNG, SMUG1, TDG, MBD4, NEIL1, NTH1 and MPG, wereeither unchanged or slightly upregulated in in vitro cultured cells,suggesting that the upregulation of glycosylase activities is notexecuted primarily through transcriptional regulation. In accor-dance with our observations, previous studies have reported anupregulation of UNG in proliferating cells compared to quiescentcells [79,80]. Moreover, UNG was recently shown to be up- anddownregulated through the cell cycle by stepwise phosphorylation[81]. Cell cycle dependent expression has also been demonstratedfor NTH1, MPG, NEIL1 and OGG1 [44,82–84] and several DNAglycosylases have been shown to be activated by posttranslationalmodifications [85]. Thus, the upregulation of DNA glycosylaseactivities in cultured cells could be a result predominantly ofposttranslational modifications of the DNA glycosylases as the cellsenter the cell cycle and start to proliferate.

In contrast to the other three repair activities, we found that theremoval of 8-oxoG was higher in the uncultured than in thecultured AT-MSCs. This was associated with an enhanced expres-sion of the OGG1 and NEIL1 glycosylases involved in 8-oxoG repairin the uncultured cells. The level of 8-oxoG lesions observed in theuncultivated cells is actually comparable to values found in mostother tissues [86]. Presumably, the rate of repair of 8-oxoG lesionsin uncultured AT-MSCs is within the range of what is required toavoid harmful mutations in these cells. Intriguingly, although the8-oxoG removal activity decreased in cultured cells, the prevalenceof 8-oxoG lesions did not increase, as one might have expected.Instead, the level of 8-oxoG lesions was several fold reducedbetween P0 and P2, and remained equally low at P4. The reducedrepair activity in the cultured cells may be explained by ourobservations that NEIL1 mRNA is present in the uncultured butabsent in the cultured AT-MSCs, and OGG1 mRNA is slightly,although not significantly higher expressed in the uncultured cells.Another explanation could be differential posttranslational mod-ification of OGG1 in quiescent and proliferating cells. Phosphoryla-tion and acetylation of OGG1 have been shown to modulate the


activity of OGG1 [87,88]. However, reduced 8-oxoG removalactivity in the cultured cells should logically lead to a higher andnot lower prevalence of 8-oxoG lesions. This discrepancy could beexplained by the existence of OGG1-independent 8-oxoG repairmechanisms which are active in proliferating, but not in non-proliferating cells. Thus, such OGG1-independent mechanisms,which are not detectable by the 8-oxoG repair assay used here,may be responsible for the low prevalence of 8-oxoG lesionsobserved in these cells. Several OGG1-independent mechanismsfor the repair of 8-oxoG have, in fact, been found in various cellsystems [89–91]. Furthermore, a high rate of synthesis of new DNAstrands induced by cell proliferation may actually reduce theincidence of oxidative damage if the number of 8-oxoG bases isdiluted as the cells replicate their DNA. Finally, a recent studyshowed that the generation of 8-oxoG at estrogen receptor-regulated promoters could be a mechanism for transcriptionactivation [92]. Apparently this is achieved by estrogen-inducedactivation of LSD1 demethylase leading to demethylation ofH3K9me2 and thereby generation of H2O2. Peroxide inducesoxidative damage (8-oxoG) locally, and subsequently OGG1 andtopoisomerase IIβ are recruited to the promoter. Removal ofoxidized bases generates transient nicks that function as entrypoints for topoisomerase IIβ, which relaxes the DNA strands andfavors chromatin bending and transcription. Thus, it is possiblethat enhanced OGG1 activity and a higher 8-oxoG level inuncultured cells compared to cultured cells are a result of OGG1participating in other processes in addition to repair in P0 cells.

Conclusions

In the present study we examined the DNA glycosylase activitiesfor removal of 8-oxoG, uracil, 5-ohU, and ɛA, the expression levelsof DNA glycosylases and the accumulation of 8-oxoG lesions inuncultured and in vitro expanded AT-MSCs. In general, our resultsshowed higher uracil, 5-ohU and ɛA removal activities in culturedcells compared to uncultured cells, while the 8-oxoG removalactivity and the accumulation of 8-oxoG lesions in DNAwere lowerin cultured cells than in uncultured cells. The mRNA expression ofDNA glycosylases in the uncultured and cultured AT-MSCs did notvary significantly and levels of expression were mostly inaccordance with the observed differences in the repair activities.Finally, we showed here that all four DNA glycosylase activitiesinvestigated remained stable from P2 to P12, suggesting that baselesion repair is proficient in AT-MSCs during a period of in vitroexpansion sufficient to produce enough cells for all therapeuticapplications considered to be clinically relevant today.

Acknowledgments

This work was supported by a Storforsk grant from The NorwegianResearch Council, The Norwegian Cancer Society and the EuropeanUnion Program: “DNA Damage Response and Repair Mechanisms”.

Appendix A. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at doi:10.1016/j.yexcr.2009.05.017.





ARTICLE IN PRESS

R E F E R E N C E S

[1] S. Gronthos, D.M. Franklin, H.A. Leddy, P.G. Robey, R.W. Storms,J.M. Gimble, Surface protein characterization of humanadipose tissue-derived stromal cells, J. Cell. Physiol. 189 (2001)54–63.

[2] P.A. Zuk, M. Zhu, P. Ashjian, D.A. De Ugarte, J.I. Huang, H. Mizuno,Z.C. Alfonso, J.K. Fraser, P. Benhaim, M.H. Hedrick, Human adiposetissue is a source of multipotent stem cells, Mol. Biol. Cell 13(2002) 4279–4295.

[3] A.C. Boquest, A. Shahdadfar, K. Fronsdal, O. Sigurjonsson, S.H.Tunheim, P. Collas, J.E. Brinchmann, Isolation and transcriptionprofiling of purified uncultured human stromal stem cells:alteration of gene expression after in vitro cell culture, Mol. Biol.Cell 16 (2005) 1131–1141.

[4] A.J. Katz, A. Tholpady, S.S. Tholpady, H. Shang, R.C. Ogle, Cellsurface and transcriptional characterization of humanadipose-derived adherent stromal (hADAS) cells, Stem Cells 23(2005) 412–423.

[5] J.K. Fraser, I. Wulur, Z. Alfonso, M.H. Hedrick, Fat tissue: anunderappreciated source of stem cells for biotechnology, TrendsBiotechnol. 24 (2006) 150–154.

[6] J.M. Gimble, A.J. Katz, B.A. Bunnell, Adipose-derived stem cells forregenerative medicine, Circ. Res. 100 (2007) 1249–1260.

[7] A. Schaffler, C. Buchler, Concise review: adipose tissue-derivedstromal cells—basic and clinical implications for novel cell-basedtherapies, Stem Cells 25 (2007) 818–827.

[8] A. Shahdadfar, K. Fronsdal, T. Haug, F.P. Reinholt, J.E. Brinchmann,In vitro expansion of human mesenchymal stem cells: choice ofserum is a determinant of cell proliferation, differentiation, geneexpression, and transcriptome stability, Stem Cells 23 (2005)1357–1366.

[9] E.M. Horwitz, B.K. Le, M. Dominici, I. Mueller, I. Slaper-Cortenbach,F.C. Marini, R.J. Deans, D.S. Krause, A. Keating, Clarification of thenomenclature for MSC: The International Society for CellularTherapy position statement, Cytotherapy 7 (2005) 393–395.

[10] R. McBeath, D.M. Pirone, C.M. Nelson, K. Bhadriraju, C.S. Chen,Cell shape, cytoskeletal tension, and RhoA regulate stem celllineage commitment, Dev. Cell 6 (2004) 483–495.

[11] L.K. Hansen, D.J. Mooney, J.P. Vacanti, D.E. Ingber, Integrin bindingand cell spreading on extracellular matrix act at different pointsin the cell cycle to promote hepatocyte growth, Mol. Biol. Cell 5(1994) 967–975.

[12] I. Bellantuono, W.N. Keith, Stem cell ageing: does it happen andcan we intervene? Expert Rev. Mol. Med. 9 (2007) 1–20.

[13] J. Kenyon, S.L. Gerson, The role of DNA damage repair in aging ofadult stem cells, Nucleic Acids Res. 35 (2007) 7557–7565.

[14] N.E. Sharpless, R.A. DePinho, How stem cells age and why thismakes us grow old, Nat. Rev., Mol. Cell Biol. 8 (2007) 703–713.

[15] W.Wagner, P. Horn, M. Castoldi, A. Diehlmann, S. Bork, R. Saffrich,V. Benes, J. Blake, S. Pfister, V. Eckstein, A.D. Ho, Replicativesenescence of mesenchymal stem cells: a continuous andorganized process, PLoS ONE 3 (2008) e2213.

[16] D. Rubio, S. Garcia, M.F. Paz, C.T. De la, L.A. Lopez-Fernandez,A.C. Lloyd, J. Garcia-Castro, A. Bernad, Molecular characterizationof spontaneous mesenchymal stem cell transformation, PLoS ONE3 (2008) e1398.

[17] D. Rubio, J. Garcia-Castro, M.C. Martin, F.R. de la, J.C. Cigudosa,A.C. Lloyd, A. Bernad, Spontaneous human adult stem celltransformation, Cancer Res. 65 (2005) 3035–3039.

[18] Y. Wang, D.L. Huso, J. Harrington, J. Kellner, D.K. Jeong, J. Turney,K. McNiece, Outgrowth of a transformed cell population derivedfrom normal human BM mesenchymal stem cell culture,Cytotherapy 7 (2005) 509–519.

[19] J.H. Hoeijmakers, Genome maintenance mechanisms forpreventing cancer, Nature 411 (2001) 366–374.

[20] R. Hakem, DNA-damage repair; the good, the bad, and the ugly,EMBO J. 27 (2008) 589–605.


[21] T. Lindahl, R.D. Wood, Quality control by DNA repair, Science 286(1999) 1897–1905.

[22] D.E. Barnes, T. Lindahl, Repair and genetic consequences ofendogenous DNA base damage in mammalian cells, Annu. Rev.Genet. 38 (2004) 445–476.

[23] M. Valko, C.J. Rhodes, J. Moncol, M. Izakovic, M. Mazur, Freeradicals, metals and antioxidants in oxidative stress-inducedcancer, Chem. Biol. Interact. 160 (2006) 1–40.

[24] I. Martin, M.S. Grotewiel, Oxidative damage and age-relatedfunctional declines, Mech. Ageing Dev. 127 (2006) 411–423.

[25] L.J. Martin, DNA damage and repair: relevance to mechanisms ofneurodegeneration, J.Neuropathol. Exp.Neurol. 67 (2008)377–387.

[26] J. Baute, A. Depicker, Base excision repair and its role inmaintaining genome stability, Crit. Rev. Biochem. Mol. Biol. 43(2008) 239–276.

[27] D.O. Zharkov, Base excision DNA repair, Cell. Mol. Life Sci. 65(2008) 1544–1565.

[28] H. Aburatani, Y. Hippo, T. Ishida, R. Takashima, C. Matsuba,T. Kodama, M. Takao, A. Yasui, K. Yamamoto, M. Asano, Cloningand characterization of mammalian 8-hydroxyguanine-specificDNA glycosylase/apurinic, apyrimidinic lyase, a functional mutMhomologue, Cancer Res. 57 (1997) 2151–2156.

[29] K. Arai, K. Morishita, K. Shinmura, T. Kohno, S.R. Kim, T. Nohmi,M. Taniwaki, S. Ohwada, J. Yokota, Cloning of a human homolog ofthe yeast OGG1 gene that is involved in the repair of oxidativeDNA damage, Oncogene 14 (1997) 2857–2861.

[30] M. Bjoras, L. Luna, B. Johnsen, E. Hoff, T. Haug, T. Rognes,E. Seeberg, Opposite base-dependent reactions of a humanbase excision repair enzyme on DNA containing7,8-dihydro-8-oxoguanine and abasic sites, EMBO J. 16 (1997)6314–6322.

[31] J.P. Radicella, C. Dherin, C. Desmaze, M.S. Fox, S. Boiteux, Cloningand characterization of hOGG1, a human homolog of the OGG1gene of Saccharomyces cerevisiae, Proc. Natl. Acad. Sci. U.S.A. 94(1997) 8010–8015.

[32] T. Roldan-Arjona, Y.F. Wei, K.C. Carter, A. Klungland, C. Anselmino,R.P. Wang, M. Augustus, T. Lindahl, Molecular cloning andfunctional expression of a human cDNA encoding the antimutatorenzyme 8-hydroxyguanine-DNA glycosylase, Proc. Natl. Acad. Sci.U.S.A. 94 (1997) 8016–8020.

[33] T.A. Rosenquist, D.O. Zharkov, A.P. Grollman, Cloning andcharacterization of a mammalian 8-oxoguanine DNA glycosylase,Proc. Natl. Acad. Sci. U.S.A. 94 (1997) 7429–7434.

[34] R. Lu, H.M. Nash, G.L. Verdine, A mammalianDNA , repair enzymethat excises oxidatively damaged guanines maps to a locusfrequently lost in lung cancer, Curr. Biol. 7 (1997) 397–407.

[35] A. Klungland, I. Rosewell, S. Hollenbach, E. Larsen, G. Daly, B. Epe,E. Seeberg, T. Lindahl, D.E. Barnes, Accumulation of premutagenicDNA lesions in mice defective in removal of oxidative basedamage, Proc. Natl. Acad. Sci. U.S.A. 96 (1999) 13300–13305.

[36] O. Minowa, T. Arai, M. Hirano, Y. Monden, S. Nakai, M. Fukuda,M. Itoh, H. Takano, Y. Hippou, H. Aburatani, K. Masumura,T. Nohmi, S. Nishimura, T. Noda, Mmh/Ogg1 gene inactivationresults in accumulation of 8-hydroxyguanine in mice, Proc. Natl.Acad. Sci. U.S.A. 97 (2000) 4156–4161.

[37] M.L. Michaels, C. Cruz, A.P. Grollman, J.H. Miller, Evidence thatMutY and MutM combine to prevent mutations by an oxidativelydamaged form of guanine in DNA, Proc. Natl. Acad. Sci. U.S.A. 89(1992) 7022–7025.

[38] D. Thomas, A.D. Scot, R. Barbey, M. Padula, S. Boiteux, Inactivationof OGG1 increases the incidence of G . C→T . A transversions inSaccharomyces cerevisiae: evidence for endogenous oxidativedamage to DNA in eukaryotic cells, Mol. Gen. Genet. 254 (1997)171–178.

[39] R. Aspinwall, D.G. Rothwell, T. Roldan-Arjona, C. Anselmino, C.J.Ward, J.P. Cheadle, J.R. Sampson, T. Lindahl, P.C. Harris, D. Hickson,Cloning and characterization of a functional human homolog ofEscherichia coli endonuclease III, Proc. Natl. Acad. Sci. U.S.A. 94(1997) 109–114.




ARTICLE IN PRESS

[40] S. Ikeda, T. Biswas, R. Roy, T. Izumi, I. Boldogh, A. Kurosky,A.H. Sarker, S. Seki, S. Mitra, Purification and characterization ofhuman NTH1, a homolog of Escherichia coli endonuclease III.Direct identification of Lys-212 as the active nucleophilic residue,J. Biol. Chem. 273 (1998) 21585–21593.

[41] M. Dizdaroglu, B. Karahalil, S. Senturker, T.J. Buckley,T. Roldan-Arjona, Excision of products of oxidative DNA basedamage by human NTH1 protein, Biochemistry (Mosc) 38 (1999)243–246.

[42] L. Eide, L. Luna, E.C. Gustad, P.T. Henderson, J.M. Essigmann,B. Demple, E. Seeberg, Human endonuclease III acts preferentiallyon DNA damage opposite guanine residues in DNA, Biochemistry(Mosc) 40 (2001) 6653–6659.

[43] H. Dou, S. Mitra, T.K. Hazra, Repair of oxidized bases in DNAbubble structures by human DNA glycosylases NEIL1 and NEIL2,J. Biol. Chem. 278 (2003) 49679–49684.

[44] T.K. Hazra, T. Izumi, I. Boldogh, B. Imhoff, Y.W. Kow, P. Jaruga,M. Dizdaroglu, S. Mitra, Identification and characterization of ahuman DNA glycosylase for repair of modified bases in oxidativelydamaged DNA, Proc. Natl. Acad. Sci. U.S.A. 99 (2002) 3523–3528.

[45] T.K. Hazra, Y.W. Kow, Z. Hatahet, B. Imhoff, I. Boldogh, S.K.Mokkapati, S. Mitra, T. Izumi, Identification and characterizationof a novel human DNA glycosylase for repair of cytosine-derivedlesions, J. Biol. Chem. 277 (2002) 30417–30420.

[46] I. Morland, V. Rolseth, L. Luna, T. Rognes, M. Bjoras, E. Seeberg,Human DNA glycosylases of the bacterial Fpg/MutM superfamily:an alternative pathway for the repair of 8-oxoguanine and otheroxidation products in DNA, Nucleic Acids Res. 30 (2002)4926–4936.

[47] H.E. Krokan, F. Drablos, G. Slupphaug, Uracil in DNA—occurrence,consequences and repair, Oncogene 21 (2002) 8935–8948.

[48] B. Sedgwick, P.A. Bates, J. Paik, S.C. Jacobs, T. Lindahl, Repair ofalkylated DNA: recent advances, DNA Repair (Amst) 6 (2007)429–442.

[49] T.R. O'connor, F. Laval, Isolation and structure of a cDNAexpressing a mammalian 3-methyladenine-DNA glycosylase,EMBO J. 9 (1990) 3337–3342.

[50] L. Samson, B. Derfler, M. Boosalis, K. Call, Cloning andcharacterization of a 3-methyladenine DNA glycosylase cDNAfrom human cells whose gene maps to chromosome 16,Proc. Natl. Acad. Sci. U.S.A. 88 (1991) 9127–9131.

[51] Y. Xie, H. Yang, C. Cunanan, K. Okamoto, D. Shibata, J. Pan, D.E.Barnes, T. Lindahl, M. McIlhatton, R. Fishel, J.H. Miller, Deficienciesin mouse Myh and Ogg1 result in tumor predisposition and G to Tmutations in codon 12 of the K-ras oncogene in lung tumors,Cancer Res. 64 (2004) 3096–3102.

[52] M.T. Russo, L.G. De, P. Degan, E. Parlanti, E. Dogliotti, D.E. Barnes,T. Lindahl, H. Yang, J.H. Miller, M. Bignami, Accumulation of theoxidative base lesion 8-hydroxyguanine in DNA of tumor-pronemice defective in both the Myh and Ogg1 DNA glycosylases,Cancer Res. 64 (2004) 4411–4414.

[53] M. Kunisada, K. Sakumi, Y. Tominaga, A. Budiyanto, M. Ueda,M. Ichihashi, Y. Nakabeppu, C. Nishigori, 8-Oxoguanine formationinduced by chronic UVB exposure makes Ogg1 knockout micesusceptible to skin carcinogenesis, Cancer Res. 65 (2005)6006–6010.

[54] K. Sakamoto, Y. Tominaga, K. Yamauchi, Y. Nakatsu, K. Sakumi,K. Yoshiyama, A. Egashira, S. Kura, T. Yao, M. Tsuneyoshi, H. Maki,Y. Nakabeppu, T. Tsuzuki, MUTYH-null mice are susceptible tospontaneous and oxidative stress induced intestinaltumorigenesis, Cancer Res. 67 (2007) 6599–6604.

[55] A. Kinoshita, H.Wanibuchi, K. Morimura, M.Wei, D. Nakae, T. Arai,O. Minowa, T. Noda, S. Nishimura, S. Fukushima, Carcinogenicityof dimethylarsinic acid in Ogg1-deficient mice, Cancer Sci. 98(2007) 803–814.

[56] J. Liao, D.N. Seril, G.G. Lu, M. Zhang, S. Toyokuni, A.L. Yang,G.Y. Yang, Increased susceptibility of chronic ulcerativecolitis-induced carcinoma development in DNA repair enzymeOgg1 deficient mice, Mol. Carcinog. 47 (2008) 638–646.


[57] M. Igarashi, M. Watanabe, M. Yoshida, K. Sugaya, Y. Endo,N. Miyajima, M. Abe, S. Sugano, D. Nakae, Enhancement of lungcarcinogenesis initiated with 4-(N-hydroxymethylnitrosamino)-1-(3-pyridyl)-1-butanone by Ogg1 gene deficiency in female,but not male, mice, J. Toxicol. Sci. 34 (2009) 163–174.

[58] M.K. Chan, M.T. Ocampo-Hafalla, V. Vartanian, P. Jaruga, G. Kirkali,K.L. Koenig, S. Brown, R.S. Lloyd, M. Dizdaroglu, G.W. Teebor,Targeted deletion of the genes encoding NTH1 and NEIL1 DNAN-glycosylases reveals the existence of novel carcinogenicoxidative damage to DNA, DNA Repair (Amst) (2009) Epub aheadof print.

[59] B.K. Le, F. Frassoni, L. Ball, F. Locatelli, H. Roelofs, I. Lewis, E. Lanino,B. Sundberg, M.E. Bernardo, M. Remberger, G. Dini, R.M. Egeler,A. Bacigalupo, W. Fibbe, O. Ringden, Mesenchymal stem cells fortreatment of steroid-resistant, severe, acute graft-versus-hostdisease: a phase II study, Lancet 371 (2008) 1579–1586.

[60] A. Giordano, U. Galderisi, I.R. Marino, From the laboratory benchto the patient's bedside: an update on clinical trials withmesenchymal stem cells, J. Cell. Physiol. 211 (2007) 27–35.

[61] P.A. Zuk, M. Zhu, P. Ashjian, D.A. De Ugarte, J.I. Huang, H. Mizuno,Z.C. Alfonso, J.K. Fraser, P. Benhaim, M.H. Hedrick, Human adiposetissue is a source of multipotent stem cells, Mol. Biol. Cell 13(2002) 4279–4295.

[62] A. Noer, L. Lindeman, P. Collas, Histone H3 modificationsassociated with differentiation and long-term culture ofmesenchymal adipose stem cells, Stem Cells Dev. 18 (2008)Electronic publication ahead of print.

[63] L.A. Meza-Zepeda, A. Noer, J.A. Dahl, F. Micci, O. Myklebost,P. Collas, High-resolution analysis of genetic stability of humanadipose tissue stem cells cultured to senescence, J. Cell. Mol. Med.12 (2008) 553–563.

[64] A. Noer, A.L. Sorensen, A.C. Boquest, P. Collas, Stable CpGhypomethylation of adipogenic promoters in freshly isolated,cultured, and differentiated mesenchymal stem cells fromadipose tissue, Mol. Biol. Cell 17 (2006) 3543–3556.

[65] J.B. Mitchell, K. McIntosh, S. Zvonic, S. Garrett, Z.E. Floyd, A.Kloster, H.Y. Di, R.W. Storms, B. Goh, G. Kilroy, X. Wu, J.M. Gimble,Immunophenotype of human adipose-derived cells: temporalchanges in stromal-associated and stem cell-associated markers,Stem Cells 24 (2006) 376–385.

[66] B.R. Grimes, C.M. Steiner, S. Merfeld-Clauss, D.O. Traktuev,D. Smith, A. Reese, A.M. Breman, V.C. Thurston, G.H. Vance,B.H. Johnstone, R.B. Slee, K.L. March, Interphase FISH analysisdemonstrates that human adipose stromal cells maintain a highlevel of genomic stability in long term culture, Stem Cells Dev. 18(2008) Electronic publication ahead of print.

[67] S. Duggal, K.B. Fronsdal, K. Szoke, A. Shahdadfar, J.E. Melvik,J.E. Brinchmann, Phenotype and gene expression of humanmesenchymal stem cells in alginate scaffolds, Tissue Eng. Part A15 (2008) Epub ahead of print.

[68] R.C. Gentleman, V.J. Carey, D.M. Bates, B. Bolstad, M. Dettling,S. Dudoit, B. Ellis, L. Gautier, Y. Ge, J. Gentry, K. Hornik, T. Hothorn,W. Huber, S. Iacus, R. Irizarry, F. Leisch, C. Li, M. Maechler,A.J. Rossini, G. Sawitzki, C. Smith, G. Smyth, L. Tierney, J.Y. Yang,J. Zhang, Bioconductor: open software development forcomputational biology and bioinformatics, Genome Biol. 5 (2004)R80.

[69] Z. Wu, R.A. Irizarry, R. Gentleman, F. Martinez-Murillo, F. Spencer,A model-based background adjustment for oligonucleotideexpression arrays, J. Am. Stat. Assoc. 99 (2004) 909–917.

[70] G.K. Smyth, Linear models and empirical Bayes methods forassessing differential expression in microarray experiments,Stat. Appl. Genet. Mol. Biol. 3 (2004) Article3.

[71] L. Gautier, M. Moller, L. Friis-Hansen, S. Knudsen, Alternativemapping of probes to genes for Affymetrix chips, BMCBioinformatics 5 (2004) 111.

[72] Y. Benjamini, Y. Hochberg, Controlling the false discovery rate: apractical and powerful approach to multiple testing, J.R. Stat. Soc.57 (1995).




ARTICLE IN PRESS

[73] T. Hofer, L. Moller, Reduction of oxidation during the preparationof DNA and analysis of 8-hydroxy-2′-deoxyguanosine, Chem. Res.Toxicol. 11 (1998) 882–887.

[74] M. Dominici, B.K. Le, I. Mueller, I. Slaper-Cortenbach, F. Marini,D. Krause, R. Deans, A. Keating, D. Prockop, E. Horwitz, Minimalcriteria for defining multipotent mesenchymal stromal cells.The International Society for Cellular Therapy position statement,Cytotherapy 8 (2006) 315–317.

[75] K. Vahakangas, G.E. Trivers, S. Plummer, R.B. Hayes, H. Krokan, M.Rowe, R.P. Swartz, H. Yeager Jr., C.C. Harris, O(6)-methylguanine-DNA methyltransferase and uracil DNA glycosylase in humanbroncho-alveolar lavage cells and peripheral blood mononuclearcells from tobacco smokers and non-smokers, Carcinogenesis 12(1991) 1389–1394.

[76] K. Janssen, K. Schlink, W. Gotte, B. Hippler, B. Kaina, F. Oesch, DNArepair activity of 8-oxoguanine DNA glycosylase 1 (OGG1) inhuman lymphocytes is not dependent on genetic polymorphismSer326/Cys326, Mutat. Res. 486 (2001) 207–216.

[77] A.R. Collins, M. Dusinska, E. Horvathova, E. Munro, M. Savio,R. Stetina, Inter-individual differences in repair of DNA baseoxidation, measured in vitro with the comet assay, Mutagenesis16 (2001) 297–301.

[78] T. Paz-Elizur, D. Elinger, Y. Leitner-Dagan, S. Blumenstein,M. Krupsky, A. Berrebi, E. Schechtman, Z. Livneh, Development ofan enzymatic DNA repair assay for molecular epidemiologystudies: distribution of OGG activity in healthy individuals, DNARepair (Amst) 6 (2007) 45–60.

[79] B.L. Cool, M.A. Sirover, Immunocytochemical localization of thebase excision repair enzyme uracil DNA glycosylase in quiescentand proliferating normal human cells, Cancer Res. 49 (1989)3029–3036.

[80] T.M. Vollberg, K.M. Siegler, B.L. Cool, M.A. Sirover, Isolation andcharacterization of the human uracil DNA glycosylase gene,Proc. Natl. Acad. Sci. U.S.A. 86 (1989) 8693–8697.

[81] L. Hagen, B. Kavli, M.M. Sousa, K. Torseth, N.B. Liabakk, O.Sundheim, J. Pena-Diaz, M. Otterlei, O. Horning, O.N. Jensen, H.E.Krokan, G. Slupphaug, Cell cycle-specific UNG2 phosphorylationsregulate protein turnover, activity and association with RPA,EMBO J. 27 (2008) 51–61.

[82] L. Luna, M. Bjoras, E. Hoff, T. Rognes, E. Seeberg, Cell-cycleregulation, intracellular sorting and induced overexpression ofthe human NTH1 DNA glycosylase involved in removal offormamidopyrimidine residues fromDNA,Mutat. Res. 460 (2000)95–104.


[83] M. Bouziane, F. Miao, S.E. Bates, L. Somsouk, B.C. Sang,M. Denissenko, T.R. O'connor, Promoter structure and cell cycledependent expression of the human methylpurine-DNAglycosylase gene, Mutat. Res. 461 (2000) 15–29.

[84] L. Luna, V. Rolseth, G.A. Hildrestrand, M. Otterlei, F. Dantzer,M. Bjoras, E. Seeberg, Dynamic relocalization of hOGG1during the cell cycle is disrupted in cells harbouring thehOGG1-Cys326 polymorphic variant, Nucleic Acids Res. 33(2005) 1813–1824.

[85] K.H. Almeida, R.W. Sobol, A unified view of base excisionrepair: lesion-dependent protein complexes regulated bypost-translational modification, DNA Repair (Amst) 6 (2007)695–711.

[86] S. Loft, D.P. Hogh, L. Mikkelsen, L. Risom, L. Forchhammer,P. Moller, Biomarkers of oxidative damage to DNA and repair,Biochem. Soc. Trans. 36 (2008) 1071–1076.

[87] J. Hu, S.Z. Imam, K. Hashiguchi, N.C. de Souza-Pinto, V.A. Bohr,Phosphorylation of human oxoguanine DNA glycosylase(alpha-OGG1) modulates its function, Nucleic Acids Res. 33(2005) 3271–3282.

[88] K.K. Bhakat, S.K. Mokkapati, I. Boldogh, T.K. Hazra, S. Mitra,Acetylation of human 8-oxoguanine-DNA glycosylase by p300and its role in 8-oxoguanine repair in vivo, Mol. Cell Biol. 26(2006) 1654–1665.

[89] P.F. Le, A. Klungland, D.E. Barnes, A. Sarasin, S. Boiteux,Transcription coupled repair of 8-oxoguanine in murine cells: theogg1 protein is required for repair in nontranscribed sequencesbut not in transcribed sequences, Proc. Natl. Acad. Sci. U.S.A. 97(2000) 8397–8402.

[90] M. Osterod, E. Larsen, P.F. Le, J.G. Hengstler, G.T. van der Horst,S. Boiteux, A. Klungland, B. Epe, A global DNA repair mechanisminvolving the Cockayne syndrome B (CSB) gene product canprevent the in vivo accumulation of endogenous oxidative DNAbase damage, Oncogene 21 (2002) 8232–8239.

[91] F. Dantzer, M. Bjoras, L. Luna, A. Klungland, E. Seeberg,Comparative analysis of 8-oxoG:C, 8-oxoG:A, A:C and C:C DNArepair in extracts from wild type or 8-oxoG DNA glycosylasedeficient mammalian and bacterial cells, DNA Repair (Amst) 2(2003) 707–718.

[92] B. Perillo, M.N. Ombra, A. Bertoni, C. Cuozzo, S. Sacchetti, A.Sasso, L. Chiariotti, A. Malorni, C. Abbondanza, E.V. Avvedimento,DNA oxidation as triggered by H3K9me2 demethylation drivesestrogen-induced gene expression, Science 319 (2008)202–206.



Modulation of DNA glycosylase activities in mesenchymal stem cells

Documents

Transcript of Modulation of DNA glycosylase activities in mesenchymal stem cells