Metabolic Engineering an ATP-neutral EMP pathway in Corynebacterium glutamicum: 1

adaptive point mutation in NADH dehydrogenase restores growth 2

3

Gajendar Komati Reddy, Steffen N. Lindner* and Volker F. Wendisch# 4

5

Chair of Genetics of Prokaryotes, Faculty of Biology & CeBiTec, Bielefeld University, 6

Bielefeld, Germany 7

8

#Address correspondence to: Volker F. Wendisch, volker.wendisch@uni-bielefeld.de, 9

*Current address: Algenol Biofuels Germany GmbH, Berlin, Germany 10

11

Keywords: Corynebacterium glutamicum, ATP-neutral glycolysis, soluble transhydrogenase, 12

phosphorylating glyceraldehyde 3-phosphate dehydrogenase, GAPDH, NADH: ubiquinone 13

oxidoreductase type II, NDH-II, non-phosphorylating glyceraldehyde 3-phosphate 14

dehydrogenase, GapN, NADPH oxidase 15

16

AEM Accepted Manuscript Posted Online 9 January 2015Appl. Environ. Microbiol. doi:10.1128/AEM.03116-14Copyright © 2015, American Society for Microbiology. All Rights Reserved.

ABSTRACT 17

Corynebacterium glutamicum uses the Embden-Meyerhof-Parnas pathway of glycolysis and 18

gains two moles of adenosine tri-phosphate (ATP) per mole glucose by substrate level 19

phosphorylation (SLP). To engineer glycolysis without net ATP formation by SLP, 20

endogenous phosphorylating NAD-dependent glyceraldehyde-3-phosphate dehydrogenase 21

(GAPDH) was replaced by non-phosphorylating NADP-dependent glyceraldehyde-3-22

phosphate dehydrogenase (GapN) from Clostridium acetobutylicum, which irreversibly 23

converts glyceraldehyde-3-phosphate (GAP) to 3-phosphoglycerate (3-PG) without ATP 24

generation. As shown recently (S. Takeno, R. Murata, R. Kobayashi, S. Mitsuhashi, and M. 25

Ikeda, Appl Environ Microbiol 76:7154-7160, 2010, doi: 10.1128/AEM.01464-10), this ATP-26

neutral, NADPH generating glycolytic pathway did not allow for growth of C. glutamicum 27

with glucose as sole carbon source unless hitherto unknown suppressor mutations occurred, 28

however, these mutations were not disclosed. In this study, a suppressor mutation was 29

identified and it was shown that heterologous expression of udhA encoding soluble 30

transhydrogenase from E. coli partly restored growth, which suggested growth inhibition by 31

NADPH accumulation. Moreover, genome sequence analysis of second site suppressor 32

mutants able to grow faster with glucose revealed a single point mutation in the gene of non-33

proton-pumping NADH: ubiquinone oxidoreductase (NDH-II) leading to the amino acid 34

change D213G that was shared by these suppressor mutants. Since related NDH-II enzymes 35

accepting NADPH as substrate possess asparagine or glutamine residues at this position, 36

D213G, D213N and D213Q variants of C. glutamicum NDH-II were constructed and shown 37

to oxidize NADPH in addition to NADH. Taken together, ATP-neutral glycolysis by 38

replacing endogenous NAD-dependent GAPDH by NADP-dependent GapN became possible 39

via oxidation of NADPH formed in this pathway by mutant NADPH-accepting NDH-IID213G 40

and, thus, by coupling to electron transport phosphorylation (ETP). 41

INTRODUCTION 42

ATP generation naturally occurs by substrate-level phosphorylation (SLP), electron 43

transport phosphorylation (ETP), photophosphorylation and decarboxylation phosphorylation. 44

The Embden-Meyerhof-Parnas (EMP) pathway of glycolysis supplies ATP by SLP in the 45

absence of terminal electron acceptors or anaerobic conditions as well as direct precursors for 46

biomass formation (1). Bacteria and archaea possess one or more of multiple biologically 47

feasible routes for glucose catabolism like the EMP, the Entner-Doudoroff (ED) pathway and 48

the phosphoketolase pathway that yield between zero to three ATP molecules per glucose 49

molecule and exist in different variants. In natural habitats, a trade-off between rate and yield 50

of ATP production is observed for heterotrophic organisms; faster, but less efficient ATP 51

production may be advantageous under conditions characterized by low abundance of growth 52

substrates (2, 3). For example, Zymomonas mobilis ferments sugars by the ED pathway with a 53

net production of one ATP per mole of glucose and requires two to five fold less energy to 54

synthesize ED pathway enzymes to accomplish the same glycolytic flux as in the EMP 55

pathway (3). The ED pathway flux in Z. mobilis and the specific ethanol productivity is 56

higher in comparison to yeast. Increasing the glycolytic flux in Saccharomyces cerevisiae by 57

introduction of the ED pathway could not be achieved due to the lack of activity of Fe-S 58

cluster enzyme 6-phosphogluconate dehydratase (4). Overexpression of a plant gene encoding 59

NADP-dependent non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase (GapN) 60

in E. coli ∆gapA, which lacks phosphorylating glyceraldehyde-3-phosphate dehydrogenase 61

(GAPDH), led to a strain with functional glycolysis devoid of substrate-level phosphorylation 62

(SLP) (5). Recently, in E. coli ∆gapA strain overexpression of NADP-dependent GapN from 63

Streptococcus mutans led to increased levels of transhydrogenase (udhA) to generate NADH 64

from NADPH and decreased expression of the pentose phosphate pathway, Krebs cycle genes 65

to sustain energy levels. E. coli with ∆gapA::gapN and plasmid-dependent expression of 66

gapN (pTrcgapN) produced 22% higher levels of acetic acid to increase ATP levels by using 67

ack-pta system (6). Introducing the phosphoketolase pathway into C. glutamicum bypassed 68

the pyruvate dehydrogenase reaction which led to enhanced L-glutamate production and 69

reduced CO2 emission (7). 70

Corynebacterium glutamicum is a workhorse of industrial biotechnology with a 71

GRAS status (‘Generally regarded as safe’) and has been used for the production of L-72

glutamine and L-lysine in the last decades. The product spectrum of C. glutamicum has been 73

widened for overproduction of different amino acids (8-10) and e.g. carotenoids (11, 12), 74

alcohols (13), organic acids (14), glycolic acid (15) and diamines (16). C. glutamicum grows 75

aerobically on wide variety of carbon sources including the sugars glucose, fructose and 76

sucrose as well as organic acids such as citrate, acetate, pyruvate, D-lactate and L-lactate. 77

Significant efforts have been focused to engineer C. glutamicum to utilize starch (17), glucans 78

(18), crude glycerol (19), amino sugars (20, 21), pentose sugars from cellulosic hydrolysates 79

(22) and cellobiose (23). However, glucose, fructose and sucrose present in molasses or 80

derived from starch hydrolysis are mainly used in industrial fermentations (24). 81

In C. glutamicum, glucose, fructose and sucrose are imported and phosphorylated by 82

the phosphoenolpyruvate-dependent carbohydrate: phosphotransferase system (PTS) and 83

enter the EMP pathway as glucose 6-phosphate or fructose 1,6–bisphosphate, respectively 84

(25, 26). As typical, the EMP pathway yields two moles of ATP per mole of glucose in C. 85

glutamicum. In addition, C. glutamicum can synthesize ATP by SLP in the tricarboxylic acid 86

(TCA) cycle and by the conversion of acetyl CoA to acetate by acetate kinase (27). Since 87

oxygen (and nitrate) serve as terminal electron acceptors in its respiratory energy metabolism 88

C. glutamicum generates ATP by electron transport phosphorylation (ETP) (28). By SLP and 89

ETP with bc1-aa3 branch, complete aerobic oxidation of glucose and acetate yields 26.7 ATP 90

and 7.3 ATP, respectively (29, 30). ETP has been shown to be essential for growth with 91

substrates that do not allow ATP generation by SLP (e.g. acetate), however mutants of C. 92

glutamicum devoid of ETP grew with substrates allowing SLP such as glucose (31). Glucose 93

catabolism by the C. glutamiucm ∆F1FO was slow and biphasic under oxygen-limiting 94

conditions. In the first growth phase, ATP generated via SLP in glycolysis while the second 95

phase was characterized by formation of organic acids such as acetate and ATP was 96

apparently generated by SLP via acetate kinase reaction (31). 97

In EMP pathway SLP commenced by GAPDH catalyzing reaction which oxidizes 98

glyceraldehyde-3-phosphate to 1,3-bisphosphoglycerate with simultaneous reduction of NAD 99

to NADH. C. glutamicum possesses two GAPDH homologues encoded by gapA and gapB, 100

respectively. 3-Phosphoglycerate kinase (3-PGK) uses a special “energy-rich” intermediate 101

1,3-bisphosphoglycerate (1,3-bPG) to produce an additional ATP to have a net balance of 2 102

mol of ATP per mol of glucose (32). Homodimeric 3-PGK in C. glutamicum is tightly 103

regulated by ADP concentration (Ki ≈ 100 µM) and plays a critical role in gluconeogenesis as 104

well as essential for glycolysis (33). To study the role of SLP absence in glycolysis of C. 105

glutamicum, SLP via 3-PGK was bypassed by replacing endogenous GAPDH by GapN. 106

GapN catalyzes the irreversible oxidation of glyceraldehyde-3-phosphate (GAP) to 3-107

phosphoglycerate (3-PG) bypassing SLP via 3-PGK in glycolysis (34). The described ATP-108

neutral, NADPH generating glycolysis only allowed for growth with glucose if second site 109

suppressor mutations occurred (35). Unfortunately, the nature of the compensatory 110

mutation(s) was not reported (35). This study identifies a single point mutation in the gene of 111

non-proton-pumping NADH: ubiquinone oxidoreductase (NDH-II) enabling C. glutamicum 112

strains with ATP-neutral glycolysis (no net ATP formation from glucose by SLP) to grow 113

with glucose as sole carbon source. 114

MATERIALS AND METHODS 115

Bacterial strains, plasmids, media, and growth conditions 116

The strains and plasmids used in this study are listed in Table 1. C. glutamicum strains were 117

pre-cultured in lysogeny broth (LB) medium (36) with antibiotics added when appropriate. E. 118

coli strains DH5α (37) was used as hosts for cloning and heterologous expression, 119

respectively. For growth experiments, exponentially growing cells of BHI (Brain-heart 120

infusion) precultures (50 ml) were harvested by centrifugation (3200 xg, 10 min), and washed 121

in CgXII medium (38) without carbon source. Cultures of 50 ml CgXII media containing 4% 122

(w/v) glucose, 100 µg/ml spectinomycin or 25 µg/ml kanamycin, and 1 mM IPTG were 123

inoculated to a final optical density (OD600) of 1 and incubated in 500 ml baffled shake flasks 124

at 30 °C. The OD600 was measured in dilutions resulting in an OD600 between 0.05 and 0.25 125

using a Shimadzu UV-1202 spectrophotometer (Duisburg, Germany). For enzymatic activity 126

determination in cell-free extracts, cells were grown in LB medium to mid-exponential phase 127

(OD600 of 3.5 to 4), harvested by centrifugation (10 min at 3200 xg, 4 °C) and washed in 128

100 mM triethanolamine hydrochloride (TEA-Cl) buffer pH 7.4 or potassium phosphate 129

(KPB) buffer (pH 7.5). Cells were stored at −20 °C until usage. Cultivations were always 130

performed in triplicates. Growth was monitored measuring the OD at 600 nm using a 131

spectrophotometer (V-1200, VWR, Radnor, PA, USA). For the screening of growth 132

conditions cells were grown in 48-well flower plates using the Biolector micro fermentation 133

system (m2plabs GmbH, Aachen, Germany). 1 mL medium was used per well with a shaking 134

frequency of 1100 rpm. Biomass formation was measured as backscattered light intensity sent 135

at 620 nm with a signal gain factor of 20. 136

137

DNA preparation, manipulation, and transformation 138

Standard protocols were used for plasmid isolation, molecular cloning and transformation of 139

E. coli, as well as for electrophoresis (39). Chromosomal DNA and plasmids isolation from 140

C. glutamicum was carried out as described previously (40). Electroporation for plasmid 141

transformation into C. glutamicum was performed as described (41). PCR amplifications were 142

performed in a Flex cycler (Analytik Jena) with Taq DNA polymerase (MBI Fermentas) or 143

KOD DNA polymerase (Novagen) with oligonucleotides listed in Table 2. All restriction 144

enzymes and shrimp alkaline phosphatase were obtained from New England Bio Labs, T4 145

DNA ligase obtained from Roche diagnostics GmbH and used according to the 146

manufacturer’s instructions. 147

148

Construction of C. glutamicum mutant strains 149

For disruption of gapAB, an internal 0.47 kb fragment of the gene was deleted by ligating the 150

1.6-kb SmaI fragment was cloned into pK19mobsacB (42), which is not replicable in C. 151

glutamicum. The resulting vectors, pK19mobsacB-ΔgapA/gapB were used to delete an 152

internal fragment of chromosomal gapA/gapB. Deletion of the chromosomal gapA/gapB locus 153

was verified by PCR amplification using the verifications primers. The gapA and gapB 154

mutant were designated as C. glutamicum ΔgapA (43), ∆gapB and ∆gapAB (GSM0). Other 155

strains used for this study listed in Table 1. 156

157

Construction of expression vectors 158

For IPTG-inducible overexpression, vector pEKEx3 and pVWEx1 were used, Genes gapN 159

and udhA (b3962) were amplified via PCR from genomic DNA of wild-type (WT) 160

Clostridium acetobutylicum or E. coli MG1655 using the oligonucleotide primers listed in 161

Table 2. For overexpression of gapA, gapB and ndh the genes were amplified via PCR from 162

genomic DNA of WT C. glutamicum using oligonucleotide primers listed in Table 2. The 163

PCR products of gapA and gapB were cloned into SmaI restricted blunt-end vector pEKEx3, 164

resulting pEKEx3-gapA and pEKEx3-gapB respectively. ndh and its mutants were cloned 165

into XbaI restricted vector pVWEx1 and resulting plasmids listed in Table 1. The integrity of 166

the construct was confirmed by sequencing. 167

168

Genome Sequence analysis 169

Genomic DNA was isolated and libraries were prepared as previously described (44). 170

Libraries were sequenced on a Genome Analyze IIx platform (Illumina, San Diego, CA, 171

USA) using a single read cluster generation kit v4 according to the manufacturer’s 172

instructions. The program SARUMAN (45) was used for mapping of 32 bp sequence reads to 173

the genome sequence of C. glutamicum (46). The coverage was obtained by multiplying the 174

respective read start by the read length. Perl programming language script implemented for 175

Parsing of the read start information and calculation of read start numbers and coverage. 176

177

Amino acid, glucose and organic acids determination 178

Extracellular amino acids, carbohydrates and organic acids were quantified by means of high-179

pressure liquid chromatography (1200 series, Agilent Technologies Deutschland GmbH, 180

Böblingen, Germany). Cell culture extracts were centrifuged (13,000 xg, 10 min) and the 181

supernatant was used for analysis. For the detection of amino acids, samples were derivatised 182

with ortho-phthaldialdehyde (OPA), separated on a system consisting of a pre-column 183

(LiChrospher100 RP18 EC-5 μ (40 × 4 mm), CS-Chromatographie Service GmbH, 184

Langerwehe, Germany) and a main column (LiChrospher 100 RP18 EC-5 μ (125 × 4 mm), 185

CS Chromatographie), and detected with a fluorescence detector (FLD G1321A, 1200 series, 186

Agilent Technologies). L-Asparagine was used as an internal standard. For the detection of 187

carbohydrates and organic acids the separation of the analyte was achieved with a column for 188

organic acids (300 × 8 mm, 10 μm particle size, 25 Å pore diameter, CSChromatographie) 189

and a refractive index detector (RID G1362A, 1200 series, Agilent Technologies) was used. 190

Derivatisation and quantification was carried out as described (47). 191

192

Measurement of Enzyme activities 193

For the determination of the specific activity of glyceraldehyde 3-phosphate dehydrogenase, 194

cells were harvested by centrifugation (3,220 ×g, 4 °C, 10 min) and washed in the appropriate 195

buffer and stored at −20 °C until use. Cells were resuspended in 1 ml of the buffer and cell-196

free extracts were prepared by sonication as described previously (48). All enzyme activity 197

measurements were carried out at 30 °C. Protein concentrations were determined with bovine 198

serum albumin as standard using Bradford (49) reagents (Sigma, Taufkirchen, Germany). 199

Glyceraldehyde 3-phosphate dehydrogenase (GapA) activity was measured according to 200

Omumasaba et al. (50) and modified as follows: The assay contained 1 mM NAD, 50 mM 201

Na2HPO

4, 0.2 mM EDTA, and 2.5 mM glyceraldehyde 3-phosphate in 50 mM TEA-Cl buffer 202

pH 8.5. One unit of enzyme activity corresponds to 1 μmol NADH formed per minute. GapN 203

activity was measured by adding the enzyme to the assay mixture containing 50 mM tricine 204

buffer (pH 8.5), 1 mM NADP, and 1 mM glyceraldehyde 3-phosphate (GAP) at 30 °C. The 205

absorbance variation at 340 nm was followed (51). Transhydrogenase activity (UdhA) was 206

measured at 375 nm at 30 °C in a mixture containing 50 mM Tris·HCl (pH 7.6), 2 207

mM MgCl2, 500 μM NADPH, 1 mM 3-acetyl pyridine adenine dinucleotide, and 10–100 μl 208

crude cell extract. The specific activity was then obtained by dividing the measured slope by 209

the protein concentration (52). 210

211

NADH: ubiquinone oxidoreductase, NAD(P)H oxidase activity was measured at 30°C in a 212

reaction mixture consisting of appropriate amounts of enzyme (10 µl), 50 mM KPB and 50 213

µM Q1 dissolved in dimethyl sulfoxide and 0.2 mM NADH/NADPH. Activity was measured 214

spectrophotometrically at 340 nm by following the decrease of NADH/NADPH concentration 215

at 30 °C. The reaction was started by the addition of 50 µM of coenzyme Q1 solution. The 216

amount of enzyme oxidizing 1 mmol of NADH or NAD(P)H per min was defined as 1 unit, 217

where a millimolar extinction coefficient of 6.2 was used for the calculation (53). Enzymatic 218

kinetics analyzed by fitting to the Michaelis–Menten equation using a nonlinear regression 219

equation Vi = (Vmax*S) ∕ Km+S. 220

Results 221

Design of a C. glutamicum strain with ATP-neutral glycolysis 222

Gene deletion mutants devoid of GAPDH activity (GapA and/or GapB) were 223

constructed to avoid SLP in the subsequent reaction catalysed by 3-PGK. The deletion was 224

confirmed by enzyme activity measurements and WT GapA has specific activity of 0.09 ± 225

0.01 U/mg and GSM0 strain did not show any detectable activity (Table 3). Growth of C. 226

glutamicum WT, ∆gapA, ∆gapB and ∆gapAB was compared in minimal medium with 227

different carbon sources. In the absence of GapA no growth in glucose minimal medium and 228

impaired growth in pyruvate minimal medium was observed while ∆gapB grew as WT. The 229

double deletion mutant showed neither growth with glucose nor pyruvate as sole carbon 230

source. Ectopic expression of gapA complemented the mutants lacking GapA (Table 4). 231

The Clostridium acetobutylicum gene gapN was expressed from IPTG-inducible 232

plasmid pEKEx3 in C. glutamicum ∆gapAB and the resulting strain was designated GSM0. In 233

GSM0, oxidation of glucose to pyruvate in the ATP-neutral variant of glycolysis, thus, should 234

yield two mole of NADPH per mole of glucose, but neither NADH nor ATP, while C. 235

glutamicum WT gains 2 mole of NADH and two mole of ATP per mole of glucose in 236

glycolysis. Activity of GapN (30 ± 0.15 mU/mg) was observed in crude extracts of GSM0, 237

while it was absent from the empty vector carrying control (Table 3). Crude extracts of both, 238

∆gapAB (pEKEx3) and GSM0, lacked detectable activity (< 0.05 mU/mg) of GAPDH (Table 239

3). C. glutamicum GSM0 grew like WT in BHI, but did not grow in glucose minimal medium 240

(Figure 1). 241

242

Influence of heterologous transhydrogenase on growth of GSM0 in glucose minimal 243

medium 244

Since ATP-neutral glycolysis in strain GSM0 yields NADPH instead of NADH, it 245

was tested whether equilibrating NADPH and NADH by heterologous transhydrogenase 246

enabled growth with glucose as sole carbon source. Therefore, the gene udhA for soluble 247

transhydrogenase from E. coli (52) was expressed from expression vector pVWEx1. Crude 248

extracts of C. glutamicum GSM0 (pVWEx1-udhA) contained 17 ± 1 nmol/ min-1 mg-1 specific 249

activity of transhydrogenase, while the empty vector carrying control showed no detectable 250

transhydrogenase activity (<5 nmol min-1 mg-1). C. glutamicum GSM0 (pVWEx1-udhA) could 251

grow in glucose minimal medium strain (Figure 1). However, growth of GSM0 (pVWEx1-252

udhA) was much slower than that of WT (0.06 ± 0.00 h-1 as compared to 0.35 ± 0.01 h-1) and 253

a two-fold lower final OD was reached (Figure 1). No organic acids were detected in 254

supernatants suggesting that the metabolic perturbations did not lead to carbon overflow. 255

Taken together, these results indicate that NADPH formation in the engineered ATP-neutral 256

glycolytic pathway prevented growth with glucose as sole carbon source. Partial restoration of 257

growth was possible when NADPH and NADH were equilibrated by heterologous 258

transhydrogenase. 259

260

Adaptive Evolution of the C. glutamicum GSM0 strain 261

To test if adaptive evolution can overcome the growth impairment of GSM0 in 262

glucose minimal medium, incubation was prolonged for 5-6 days and finally overgrowth of 263

the culture was observed. After plating on CgXII agar plate with 2% glucose four colonies 264

were selected for further experiments. When incubated in glucose minimal medium all four 265

grew (μ = 0.14 ± 0.02 h−1, Figure 2) and, thus, were designated as suppressor mutants GSM1 266

to GSM4. Sequencing of gapN in the suppressor mutants revealed that gapN did not carry any 267

mutation, which was supported by enzyme activity measurements (Table 4). Accordingly, re-268

transformation of plasmid pEKEx3-gapN from GSM1 into C. glutamicum ∆gapAB did not 269

entail growth with glucose. Thus, one or more mutations present in the suppressor mutants 270

may restore growth in glucose minimal medium. 271

Growth and biomass formation of suppressor mutant GSM1 with various carbon 272

sources was compared to WT. With glucose, growth rate and final biomass concentrations 273

observed with GSM1 were almost two times lower than WT (Figure 1 and Figure 2). The 274

specific glucose consumption rates (mmol· g (CDW)-1. h-1) for WT and GSM strain are 0.78 and 275

1.1 respectively. Similarly, growth in minimal medium with fructose or sucrose of GSM1 was 276

slower than that of WT (Figure 2 and 3). GSM1, GSM2, GSM3 and GSM4 showed no growth 277

on acetate, which was expected since the GapN reaction is irreversibly operating in the 278

glycolytic direction but not in the gluconeogenetic direction (51). 279

280

Genome sequencing of suppressor mutants 281

Since growth of the suppressor mutants in glucose minimal medium was not due to 282

mutation of heterologous gapN, the genomes of the suppressor mutants GSM1 to GSM4 were 283

sequenced and compared to the genome of WT (listed in Table S1). Single point mutations 284

(SNPs) and insertions or deletions (Indels) were found which are different from the WT 285

genome are listed in Table S2. The relatively large numbers of SNPs and small deletions and 286

insertions (about 200) are not unprecedented and have e.g. been found in a recently 287

constructed prophage-free variant of C. glutamicum WT (54). To identify the mutation(s) 288

responsible for restoring growth in glucose minimal medium, all SNPs and Indels were 289

compared between the suppressor mutants and as control a strain derived from the same wild 290

type stock. Only the following mutations affected genes and were common to all isolated 291

suppressor mutants: a SNP in the ndh gene and the deletions ∆gapA and ∆gapB (Table S2). 292

The SNP in ndh (cg1656) encoding the non-proton pumping NADH: ubiquinone 293

oxidoreductase NDH-II led to replacement of aspartic acid at position 213 by glycine 294

(ndhD213G). PCR amplification of this region from WT and all four suppressor mutants and 295

subsequent sequence analysis confirmed the observed point mutation in the suppressor 296

mutants and its absence from WT. It was also observed that GSM1 and GSM4 carried 9 base 297

deletions in the gene for 30S ribosomal protein S1 (cg1531; rpsA) near C-terminus. 298

299

Consequences of the amino acid exchange D213G present in NDH-II of the suppressor 300

mutants 301

Two types of NDHs are known in nature, but C. glutamicum only possesses NADH: 302

ubiquinone oxidoreducatse (NDH-II), but lacks a proton pumping NADH: ubiquinone 303

oxidoreducatse (NDH-I). NDH-II is a 55 kDa flavoprotein that couples the transfer of two 304

electrons from NADH to ubiquinone without translocation of protons (29). NDH-II has two 305

conserved FAD binding domains with glycine rich consensus sequence (GXGXXG) along 306

with an NADH binding domain containing a negative charge residue (D or E) at the end of 307

the second β-sheet, which determines the nucleotide specificity (55). Previous studies 308

revealed that NDH-II was solely responsible for NADH oxidation (NADH: ubiquinone 309

oxidoreductase) with maximal activity at pH 6.5 whereas NADPH: ubiquinone 310

oxidoreductase activity was detectable in vitro at pH 4.5 but negligible at pH 6.5 (53). 311

Since the mutation D213G may affect the nucleotide specificity of NDH-II enzymes, protein 312

sequences of biochemically characterized NADH-dependent and NADPH-dependent NDH-II 313

enzymes were aligned (Figure 3). NADPH-dependent NDH-II enzymes possess a neutral 314

amino acid residue at position 213 (numbering according to NDH-II of C. glutamicum), e.g. 315

the glutamine in the Solanum tuberosum and Neurospora crassa enzymes (Figure 3). NDH-II 316

enzymes specific for NADH as cofactor possess charged aspartic acid (as in the wild-type 317

NDH-II of C. glutamicum) or glutamic acid (as in the NDH-II enzymes of S. cerevisiae and E. 318

coli) residues in position 213 (Figure 3). Since NDH-II of the evolved strains GSM1 to GSM4 319

possessed the neutral glycine at position 213, the encoded NDH-II variant may accept 320

NADPH rather than NADH. 321

In order to test NDH-II specific activities with NADH and NADPH as cofactors, 322

crude extracts of C. glutamicum WT, ∆ndh, GSM1 were prepared and ubiquinone 323

oxidoreductase activities with either NADH or NADPH were determined at pH 7.5 (Figure 324

4). Previous studies with purified NDH-II have shown different activity at different pHs (56). 325

Also at a lower pH, namely pH 5.5, NDH-II activities with NADPH as cofactor were 326

increased in crude extracts of GSM1 (0.06 ± 0.01 U/mg) as compared to crude extract of WT 327

(0.01 ± 0.00 U/mg). Similar results were obtained with crude extracts of strains GSM2, GSM 328

3 and GSM4 (data not shown). In addition, D213N and D213Q variants of C. glutamicum 329

NDH-II were constructed and crude extracts of C. glutamicum ∆ndh (pVWEx1-ndhD213N and 330

ndhD213Q) were prepared and analyzed. As previously reported (53), the crude extracts of the 331

wild type showed no detectable ubiquinone oxidoreductase activity with NADPH, but with 332

NADH (kcat of 88 s−1; Km of 50 μM; Table 5). In contrast, crude extracts of GSM1 with 333

NDH-II*D213G showed high ubiquinone oxidoreductase activity with NADPH (kcat of 34 334

s−1; Km of 100 μM corresponding a catalytic efficiency of 0.33 s-1µM-1; Table 5) and NADH 335

(kcat of 32 s−1; Km of 78 μM; Table 5). For crude extracts with NDH-II*D213N and NDH-336

II*D213Q, respectively, NADH: ubiquinone oxidoreductase activities (kcat of 80 s−1 and 63 337

s−1, respectively) and NADPH: ubiquinone oxidoreductase activities (kcat of 32 s−1 and 56 s−1, 338

respectively) were estimated (Table 5). Taken together, neutral amino acid residues (G, N, or 339

Q) at position 213 of NDH-II of C. glutamicum resulted in comparable or higher activities 340

with NADPH as compared to NADH. 341

Discussion 342

GAPDH is important in glycolysis for generation of the reduction equivalent NADH 343

and for ATP generation by SLP in the subsequent reaction of 3-PGK, thus, important for 344

growth and amino acid production by C. glutamicum. NAD-dependent GAPDH could only be 345

replaced by NADP-dependent GapN when secondary mutations occurred. This was reported 346

previously, however, the nature of the(se) mutation(s) remained elusive (35). Here, we report 347

on the identification of such a suppressor mutation, namely, an amino acid exchange in non-348

proton-pumping NDH-II that changed its activity to accept NADPH as substrate implying that 349

excess NADPH inhibited growth. 350

Recently, a different modification of glycolysis in C. glutamicum was followed when 351

endogenous NAD-dependent GAPDH was engineered to accept NADP as substrate in 352

addition to NAD (57). Homology modeling studies predicted a highly conserved Asp35 in the 353

NAD binding site as part of a network of hydrogen bonds interacting with the 2’ and 3’-354

hydroxyl groups of the adenosine ribose ring of NAD. Combination of changing Asp35 to 355

glycine with changes of Leu36 and Thr37 that determine the flexibility of the loop between 356

the second β strand and the subsequent α helix, and of Pro192 to improve NAD/NADP-357

binding resulted in a variant (D35G/L36T/T37K/P192S) with high catalytic efficiency for 358

both NAD (1640 ± 108 mM−1 min−1) and NADP (5868 ± 352 mM−1 min−1) as cofactors (57). 359

Interestingly, the engineered GapA increased L-lysine productivity. However, this came at the 360

cost of perturbed growth and was suggested to be due to excess NADPH which may even be 361

higher in strains not producing L-lysine, an NADPH sink (57). In line with the strict NADP-362

dependence of GapN, growth perturbation was more pronounced as shown here (Figure 1) 363

and previously (35) as compared to growth perturbation observed with the engineered NAD 364

and NADP accepting GapA (57). The concept that NADPH excess inhibited growth was 365

tested directly by heterologous expression of udhA encoding soluble transhydrogenase from 366

E. coli (52) that catalyzes reversible transfer of reducing equivalents between NAD and 367

NADP pools. Indeed, heterologous expression of udhA improved growth with GapN 368

dramatically although wild-type growth rates were not reached (Figure 1). Similarly, udhA 369

overexpression in C. glutamicum and E. coli ∆pgi strains improved the growth by oxidizing 370

NADPH with NAD during excess NADPH conditions occurred due to the redirection of flux 371

through the PPP pathway (58-60). By contrast, membrane-bound transhydrogenase PntAB 372

from E. coli that uses the proton-motive force to drive the reduction of NADP to NADPH by 373

oxidation of NADH to NAD (61) was employed to improve NADPH provision in various C. 374

glutamicum strains thought to exhibit NADPH limitation, e.g. to improve production of L-375

lysine, L-valine, L-ornithine and isobutanol by C. glutamicum (13, 62-64). 376

The finding that suppressor mutation D213G in non-proton-pumping NADH: 377

ubiquinone oxidoreductase changed its activity to accept NADPH as substrate and relieved 378

the growth inhibition due to NADP-dependent GapN (Figure 4) supports the notion that 379

excess NADPH inhibits growth. In E. coli, NADPH stress by restructuring the metabolic 380

network (MG1655ΔudhAΔpgiΔqorΔedd) was overcome by a suppressor mutation in proton-381

pumping NADH: ubiquinone oxidoreductase (NDH-I) subunit nuoF (E183A) fragment that 382

can oxidize NADPH for catabolism (65). C. glutamicum lacks NDH-I and relies on non-383

proton-pumping NDH-II. In C. glutamicum, proton motive force generation occurs largely via 384

cytochrome bc1–aa3 supercomplex and/or less efficiently by cytochrome bd oxidase (66). 385

NDH-II defective strains have been described and they oxidize NADH oxidation via coupling 386

of NAD-dependent lactate dehydrogenase with quinone-dependent lactate dehydrogenases 387

LldD (48) or Dld (67) and/or by coupling NAD-dependent malate dehydrogenase and 388

quinone-dependent malate oxidoreductase (68) to compensate for the lack of NDH-II in C. 389

glutamicum (66). It is conceivable that suppressor mutations leading to NADP-dependent 390

lactate dehydrogenase or NADP-dependent malate dehydrogenase activities might have 391

relieved growth inhibition by excess NADPH, however, these have not been observed in this 392

study. These mutations would have coupled oxidation of excess NADPH indirectly to ATP 393

generation since ubiquinol oxidation generates ATP by ETP as found for the suppressor 394

mutation of non-proton-pumping NADH: ubiquinone oxidoreductase II identified here. 395

Acknowledgements 396

We thank the German Federal Ministry of Education and Research through project 397

“SysEnCor” (0315598E) for providing financial support. We also thank Abigail Koch-398

Koerfges and Michael Bott for providing C. glutamicum strain ∆ndh. 399

400

Table 1. Plasmids and strains list 401

Strain, plasmid Function and relevant characteristics References

E. coli

DH5α General cloning host (F- thi-1 endA1 hsdR17(r- m-)

supE44 ΔlacU169 (-80lacZΔM15) recA1 gyrA96

relA1)

(35)

C. glutamicum

ATCC13032 WT strain, auxotrophic for biotin This work

ΔgapA In-frame deletion of the gapA gene of WT This work

ΔgapAΔgapB In-frame deletion of the gapA and gapB genes of

WT

This work

∆ndh In-frame deletion of the ndh gene of WT This work

GSM0 In-frame deletion of the gapA and gapB genes of

WT with pEKEx3-gapNCac overexpression

This work

GSM1/2/3/4 GSM0 strain with evolved ndh (D213G) This work

Plasmids

pEKEx3 SpecR; C. glutamicum / E. coli shuttle vector (Ptac,

lacIq; pBL1, OriVC.g., OriVE.c.)

(48)

pEKEx3-gapACg Derived from pEKEx3, for regulated expression

of gapA of C. glutamicum

(43)

pEKEx3-gapBCg Derived from pEKEx3, for regulated expression

of gapB of C. glutamicum

This work

pEKEx3-gapNCac Derived from pEKEx3, for regulated expression

of gapN of Clostridium acetobutylicum

This work

pVWEx1 Kanr, PlacIq This work

pVWEx1-udhAEc Derived from pVWEx1, for regulated expression

of udhA of E. coli

This work

pVWEx1-ndhCg Derived from pVWEx1, for regulated expression

of ndh of C. glutamicum

This work

pVWEx1-ndhD213G Derived from pVWEx1, for regulated expression

of ndh of C. glutamicum

This work

pVWEx1-ndhD213N Derived from pVWEx1, for regulated expression

of ndh of C. glutamicum

This work

pVWEx1-ndhD213Q Derived from pVWEx1, for regulated expression

of ndh of C. glutamicum

This work

pK19mobsacB KmR; E. coli/C. glutamicum shuttle vector for

construction of insertion and deletion mutants in

C. glutamicum (pK18 oriVEc sacB lacZα)

This work

pK19mobsacBΔgapA pK19mobsacB with a gapA deletion construct This work

pK19mobsacB∆gapB pK19mobsacB with a gapB deletion construct This work

402

Table 2. Sequences of oligonucleotide primers 403

Name Sequence (5'-3') Function and

relevant

characteristics

gapA_Del_A GGCTGATCCTCAAATGACCAAG Del of gapA

gapA_Del_B CCCATCCACTAAACTTAAACAACCAACACGAAT

GGTCATGTTG

Del of gapA

gapA_Del_C TGTTTAAGTTTAGTGGATGGGCTGCGTCTGACC

GAGCTCGTAG

Del of gapA

gapA_Del_D CACCGAAGCCGTCAGAAACGAATG Del of gapA

gapA_Del_Seq GTTCGTTCCCTGCAAAAACTATTTAG Del of gapA

gapA_Del_Ver_fw CCAACTTCGACGATGCCAATC Verification of

gapB deletion

gapA_Del_Ver_rv CTCTGGTGATTCTGCGATCTTTTC Verification of

gapB deletion

gapB_Del_A GACGGTGACCAATCCGGAG Del of gapB

gapB_Del_B CCCATCCACTAAACTTAAACACTTGTGGTTGTG

CGTCATAAAAAGT

Del of gapB

gapB_Del_C TGTTTAAGTTTAGTGGATGGGGTGTACCCGGAG

CGCAGGCAG

Del of gapB

gapB_Del_D GCCACAATATTGGCTTTGAGGTTG Del of gapB

gapB_Del_Seq CTCACTTAACCGCGAGATCTTGGAC Del of gapB

gapB_Del_Ver_fw GATTTGAGCAATGGGTGGGAG Verification of

gapB deletion

gapB_Del_Ver_rv GATGACAGTGCACGATCATCATG Verification of

gapB deletion

gap_Cacet_fw

GATCTAGAGAAAGGAGGCCCTTCAGATGTTTG

AAAATATATCATCAAATGGAGTTTATAAAAATC

OE of Cac

gapN,

start RBS

gap_Cacet_rv GATCTAGATTATAGGTTTAAAACTATTGATTTA

TGCCTTGTC

OE of Cac

gapN

ndh-fw CTGCAGGTCGACTCTAGAGGAAAGGAGGCCCT

TCAGATGTCAGTTAACCCAACCCG

OE of ndh

ndh-rev CGGTACCCGGGGATCTTACTTTCCGCTGAAACG

CTG

OE of ndh

udhA_fw GCTCTAGAGAAAGGAGGCCCTTCAGATGCCAC

ATTCCTACGATTACG

OE of udhA

udhA_rev GCTCTAGATTAAAACAGGCGGTTTAAACCG OE of udhA

Restriction sites are highlighted in bold, linker sequences for crossover PCR and ribosomal binding sites are shown in italics, 404

stop and start codons are underlined. Abbreviations: OE: overexpression; Del: deletion; RBS: ribosomal binding site; Cgl: C. 405

glutamicum; 406

Table 3. Specific activities of GAPDH and GapN in various strains. 407

Strain Specific activity (nmol/min/mg protein)

GAPDH GapN

C. glutamicum WT 90 ± 1 < 5

GSM0 < 5 31 ± 1

GSM1 < 5 31 ± 1

The cell extracts were obtained from the indicated C. glutamicum strains cultivated in BHI medium with 1 mM 408

IPTG and 100 μg ml−1 spectinomycin. Averages and standard deviations of triplicate cultivations are shown. 409

Table 4. Growth of various C. glutamicum strains on CgXII minimal medium agar 410

plates with either glucose or pyruvate as carbon source 411

Growth with glucose Growth with pyruvate

strain carrying vector pEKEx3 with carrying vector pEKEx3 with

- gapA gapB gapNCac

- gapA gapB gapNCac

WT + + + + + + + +

ΔgapA − + − − + + + +

ΔgapB + + + + + + + +

ΔgapAΔgapB − + − − − + + −

+ indicates growth: − indicates no growth 412

Table 5. Kinetic parameters of NADH and NADPH oxidation by wild-type and mutated 413

NDH-II proteins. 414

Kinetic parameters were measured at pH 7.5 for NADH and NADPH, using Q0 (100 µM) as an acceptor, in the 415

reaction medium. 416

Kinetic

parameters

Substrate NDH-II NDH-IID213G

NDH-II D213N

NDH-IID213Q

KM (μM) NADH

NADPH

50 ± 4

< 5

78 ± 4

103 ± 1

150 ± 9

180 ± 1

110 ± 11

172 ± 16

Vmax (U/mg) NADH

NADPH

10 ± 1

< 5

4 ± 1

4 ± 1

9 ± 1

4 ± 1

7 ± 1

7 ± 1

kcat (s-1)

NADH

NADPH

88 ± 2

< 5

32 ± 2

34 ± 2

80 ± 3

32 ± 3

63 ± 3

56 ± 3

417

Figure 1. Growth of C. glutamicum WT (closed triangles), GSM1 (closed squares), 418

∆gapAB(pEKEx3)(pVWEx1) (open circles), GSM0 (∆gapAB(pEKEx3-gapN)) (open 419

triangles), ∆gapAB(pEKEx3-gapN)(pVWEx1-udhA) (closed circles) in glucose minimal 420

medium. All cultivations were carried out in 50 ml of CgXII with 100 mM glucose at 30 °C 421

in 500 ml Erlenmeyer flasks with shaking at 120 rpm. Averages and standard deviations of 422

triplicate cultivations are shown. 423

A424

425

B426

427

Figure 2. Growth analysis of C. glutamicum WT (filled columns) and GSM1 (empty 428

columns) with different carbon sources. A) Growth rates; B) maximal OD600. Strains were 429

cultivated in 50 ml of CgXII with different carbon sources. Average values and error bars of 430

triplicate cultivations are given. 431

432

Figure 3. Sequence alignment of various NAD(P)H: quinone oxidoreductases. Bold 433

sequence is conserved glycine rich sequence; underlined residue is most conserved negative 434

charged residues; bold and underlined residue is adaptive neutral charged residue. 435

Corynebacterium glutamicum (YP_225750.1); Mycobacterium tuberculosis 436

(YP_001283183.1); Synechocystis sp. PCC 6803 (BAA17787.1); Bacillus subtilis 437

(YP_007533169.1); Escherichia coli (YP_489377.1); Saccharomyces cerevisiae 438

(NP_010198.1); Neurospora crassa (CAB41986); Solanum tuberosum (CAB52797). 439

440

Figure 4. Specific activities of NDH-II in crude extracts of various strains. Activity was 441

measured at pH 7.5 for NADH and NADPH, using Q1 (50 µM) as an acceptor, in the reaction 442

medium. Monitoring NADH or NADPH consumption expressed as l mol min-1 mg-1 protein 443

measured enzyme activity. The cell extracts of the indicated C. glutamicum strains cultivated 444

in BHI medium with 1 mM IPTG and 100 μg ml−1 spectinomycin. Average values and error 445

bars were calculated from triplicate cultivations. 446

References: 447

1. Bar-Even A, Flamholz A, Noor E, Milo R. 2012. Rethinking glycolysis: on the 448

biochemical logic of metabolic pathways. Nat Chem Biol 8:509-517. 449

2. Pfeiffer T, Schuster S, Bonhoeffer S. 2001. Cooperation and competition in the 450

evolution of ATP-producing pathways. Science 292:504-507. 451

3. Flamholz A, Noor E, Bar-Even A, Liebermeister W, Milo R. 2013. Glycolytic 452

strategy as a tradeoff between energy yield and protein cost. Proc Natl Acad Sci U S 453

A 110:10039-10044. 454

4. Benisch F, Boles E. 2014. The bacterial Entner-Doudoroff pathway does not replace 455

glycolysis in Saccharomyces cerevisiae due to the lack of activity of iron-sulfur 456

cluster enzyme 6-phosphogluconate dehydratase. J Biotechnol 171:45-55. 457

5. Valverde F, Losada M, Serrano A. 1999. Engineering a central metabolic pathway: 458

glycolysis with no net phosphorylation in an Escherichia coli gap mutant 459

complemented with a plant GapN gene. FEBS letters 449:153-158. 460

6. Centeno-Leija S, Utrilla J, Flores N, Rodriguez A, Gosset G, Martinez A. 2013. 461

Metabolic and transcriptional response of Escherichia coli with a NADP(+)-462

dependent glyceraldehyde 3-phosphate dehydrogenase from Streptococcus mutans. 463

Antonie Van Leeuwenhoek 104:913-924. 464

7. Chinen A, Kozlov YI, Hara Y, Izui H, Yasueda H. 2007. Innovative metabolic 465

pathway design for efficient L-glutamate production by suppressing CO2 emission. J 466

Biosci Bioeng 103:262-269. 467

8. Jensen JV, Wendisch VF. 2013. Ornithine cyclodeaminase-based proline production 468

by Corynebacterium glutamicum. Microb Cell Fact 12:63. 469

9. Sindelar G, Wendisch VF. 2007. Improving lysine production by Corynebacterium 470

glutamicum through DNA microarray-based identification of novel target genes. Appl 471

Microbiol Biotechnol 76(3):677-689. 472

10. Peters-Wendisch P, Stolz M, Etterich H, Kennerknecht N, Sahm H, Eggeling L. 473

2005. Metabolic engineering of Corynebacterium glutamicum for L-serine 474

production. Appl Environ Microbiol 71:7139-7144. 475

11. Heider SA, Peters-Wendisch P, Wendisch VF. 2012. Carotenoid biosynthesis and 476

overproduction in Corynebacterium glutamicum. BMC Microbiol 12:198. 477

12. Heider SA, Peters-Wendisch P, Netzer R, Stafnes M, Brautaset T, Wendisch VF. 478

2013. Production and glucosylation of C50 and C40 carotenoids by metabolically 479

engineered Corynebacterium glutamicum. Appl Microbiol Biotechnol 98(3):1223-480

1235. 481

13. Blombach B, Riester T, Wieschalka S, Ziert C, Youn JW, Wendisch VF, 482

Eikmanns BJ. 2011. Corynebacterium glutamicum tailored for efficient isobutanol 483

production. Appl Environ Microbiol 77:3300-3310. 484

14. Wieschalka S, Blombach B, Bott M, Eikmanns BJ. 2013. Bio-based production of 485

organic acids with Corynebacterium glutamicum. Microb Biotechnol 6:87-102. 486

15. Zahoor A, Otten A, Wendisch VF. 2014. Metabolic engineering of 487

Corynebacterium glutamicum for glycolate production. J Biotechnol:doi: 488

10.1016/j.jbiotec.2013.1012.1020. 489

16. Schneider J, Wendisch VF. 2010. Putrescine production by engineered 490

Corynebacterium glutamicum. Applied microbiology and biotechnology 88:859-868. 491

17. Seibold G, Auchter M, Berens S, Kalinowski J, Eikmanns BJ. 2006. Utilization of 492

soluble starch by a recombinant Corynebacterium glutamicum strain: growth and 493

lysine production. J Biotechnol 124:381-391. 494

18. Tsuchidate T, Tateno T, Okai N, Tanaka T, Ogino C, Kondo A. 2011. Glutamate 495

production from beta-glucan using endoglucanase-secreting Corynebacterium 496

glutamicum. Appl Microbiol Biotechnol 90:895-901. 497

19. Meiswinkel TM, Rittmann D, Lindner SN, Wendisch VF. 2013. Crude glycerol-498

based production of amino acids and putrescine by Corynebacterium glutamicum. 499

Bioresour Technol 145:254-258. 500

20. Uhde A, Youn JW, Maeda T, Clermont L, Matano C, Kramer R, Wendisch VF, 501

Seibold GM, Marin K. 2013. Glucosamine as carbon source for amino acid-502

producing Corynebacterium glutamicum. Appl Microbiol Biotechnol 97:1679-1687. 503

21. Matano C, Uhde A, Youn JW, Maeda T, Clermont L, Marin K, Kramer R, 504

Wendisch VF, Seibold GM. 2014. Engineering of Corynebacterium glutamicum for 505

growth and L-lysine and lycopene production from N-acetyl-glucosamine. Appl 506

Microbiol Biotechnol 98:5633-5643. 507

22. Meiswinkel TM, Gopinath V, Lindner SN, Nampoothiri KM, Wendisch VF. 508

2013. Accelerated pentose utilization by Corynebacterium glutamicum for 509

accelerated production of lysine, glutamate, ornithine and putrescine. Microb 510

Biotechnol 6:131-140. 511

23. Adachi N, Takahashi C, Ono-Murota N, Yamaguchi R, Tanaka T, Kondo A. 512

2013. Direct L-lysine production from cellobiose by Corynebacterium glutamicum 513

displaying beta-glucosidase on its cell surface. Appl Microbiol Biotechnol 97:7165-514

7172. 515

24. Kelle R, Hermann T, Bathe B. 2005. L-Lysine production. In Handbook of 516

Corynebacterium glutamicum (Eggeling L., Bott M., eds), CRC Press, Boca Raton, 517

USA, pp. 465-488. 518

25. Mori M, Shiio I. 1987. Phosphoenolpyruvate:sugar phosphotransferase systems and 519

sugar metabolism in Brevibacterium flavum Agric Biol Chem 51:2671-2678. 520

26. Zahoor A, Lindner SN, Wendisch VF. 2012. Metabolic engineering of 521

Corynebacterium glutamicum aimed at alternative carbon sources and new products. 522

Comput Struct Biotechnol J 3:e201210004. 523

27. Reinscheid DJ, Schnicke S, Rittmann D, Zahnow U, Sahm H, Eikmanns BJ. 524

1999. Cloning, sequence analysis, expression and inactivation of the 525

Corynebacterium glutamicum pta-ack operon encoding phosphotransacetylase and 526

acetate kinase. Microbiology 145:503-513. 527

28. Kabus A, Niebisch A, Bott M. 2007. Role of cytochrome bd oxidase from 528

Corynebacterium glutamicum in growth and lysine production. Appl Environ 529

Microbiol 73:861-868. 530

29. Bott M, Niebisch A. 2003. The respiratory chain of Corynebacterium glutamicum. J 531

Biotechnol 104:129-153. 532

30. Niebisch A, Bott M. 2003. Purification of a cytochrome bc1-aa3 supercomplex with 533

quinol oxidase activity from Corynebacterium glutamicum. Identification of a fourth 534

subunity of cytochrome aa3 oxidase and mutational analysis of diheme cytochrome 535

c1. J Biol Chem 278:4339-4346. 536

31. Koch-Koerfges A, Kabus A, Ochrombel I, Marin K, Bott M. 2012. Physiology 537

and global gene expression of a Corynebacterium glutamicum ∆F1FO-ATP synthase 538

mutant devoid of oxidative phosphorylation. Biochim Biophys Acta 1817:370-380. 539

32. Noor E, Eden E, Milo R, Alon U. 2010. Central carbon metabolism as a minimal 540

biochemical walk between precursors for biomass and energy. Mol Cell 39:809-820. 541

33. Reddy GK, Wendisch VF. 2014. Characterization of 3-phosphoglycerate kinase 542

from Corynebacterium glutamicum and its impact on amino acid production. BMC 543

Microbiol 14:54. 544

34. Rosenberg LL, Arnon DI. 1955. The preparation and properties of a new 545

glyceraldehyde-3-phosphate dehydrogenase from photosynthetic tissues. J Biol Chem 546

217:361-371. 547

35. Takeno S, Murata R, Kobayashi R, Mitsuhashi S, Ikeda M. 2010. Engineering of 548

Corynebacterium glutamicum with an NADPH-generating glycolytic pathway for L-549

lysine production. Appl Environ Microbiol 76:7154-7160. 550

36. Sambrook J FE, Maniatis T. 1989. Molecular cloning: a laboratory manual. Cold 551

Spring Harbor Laboratory Press. 552

37. Hanahan D. 1983. Studies on transformation of Escherichia coli with plasmids. J 553

Mol Biol 166:557-580. 554

38. Eggeling L, Bott M. 2005. Handbook of Corynebacterium glutamicum. CRC Press, 555

Boca Raton, USA. 556

39. Sambrook J, Russell D. 2001. Molecular Cloning. A Laboratory Manual, 3rd 557

Edition. Cold Spring Harbor Laboratoy Press. 558

40. Eikmanns BJ, Thum-Schmitz N, Eggeling L, Ludtke KU, Sahm H. 1994. 559

Nucleotide sequence, expression and transcriptional analysis of the Corynebacterium 560

glutamicum gltA gene encoding citrate synthase. Microbiology 140:1817-1828. 561

41. Tauch A, Kirchner O, Loffler B, Gotker S, Puhler A, Kalinowski J. 2002. 562

Efficient electrotransformation of Corynebacterium diphtheriae with a mini-replicon 563

derived from the Corynebacterium glutamicum plasmid pGA1. Curr Microbiol 564

45:362-367. 565

42. Schäfer A, Tauch A, Jäger W, Kalinowski J, Thierbach G, Puhler A. 1994. Small 566

mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids 567

pK18 and pK19: selection of defined deletions in the chromosome of 568

Corynebacterium glutamicum. Gene 145:69-73. 569

43. Siedler S, Lindner SN, Bringer S, Wendisch VF, Bott M. 2013. Reductive whole-570

cell biotransformation with Corynebacterium glutamicum: improvement of NADPH 571

generation from glucose by a cyclized pentose phosphate pathway using pfkA and 572

gapA deletion mutants. Appl Microbiol Biotechnol 97:143-152. 573

44. Milse J, Petri K, Ruckert C, Kalinowski J. 2014. Transcriptional response of 574

Corynebacterium glutamicum ATCC 13032 to hydrogen peroxide stress and 575

characterization of the OxyR regulon. J Biotechnol. 576

45. Blom J, Jakobi T, Doppmeier D, Jaenicke S, Kalinowski J, Stoye J, Goesmann 577

A. 2011. Exact and complete short-read alignment to microbial genomes using 578

Graphics Processing Unit programming. Bioinformatics 27:1351-1358. 579

46. Kalinowski J, Bathe B, Bartels D, Bischoff N, Bott M, Burkovski A, Dusch N, 580

Eggeling L, Eikmanns BJ, Gaigalat L, Goesmann A, Hartmann M, Huthmacher 581

K, Kramer R, Linke B, McHardy AC, Meyer F, Mockel B, Pfefferle W, Puhler 582

A, Rey DA, Ruckert C, Rupp O, Sahm H, Wendisch VF, Wiegrabe I, Tauch A. 583

2003. The complete Corynebacterium glutamicum ATCC 13032 genome sequence 584

and its impact on the production of L-aspartate-derived amino acids and vitamins. J 585

Biotechnol 104:5-25. 586

47. Peters-Wendisch P, Gotker S, Heider SAE, Komati Reddy G, Nguyen AQ, 587

Stansen KC, Wendisch VF. 2014. Engineering biotin prototrophic Corynebacterium 588

glutamicum strains for amino acid, diamine and carotenoid production. J Biotechnol 589

in press. 590

48. Stansen C, Uy D, Delaunay S, Eggeling L, Goergen JL, Wendisch VF. 2005. 591

Characterization of a Corynebacterium glutamicum lactate utilization operon induced 592

during temperature-triggered glutamate production. Appl Environ Microbiol 593

71:5920-5928. 594

49. Bradford MM. 1976. A rapid and sensitive method for the quantitation of 595

microgram quantities of protein utilizing the principle of protein-dye binding. Anal 596

Biochem 72:248-254. 597

50. Omumasaba CA, Okai N, Inui M, Yukawa H. 2004. Corynebacterium glutamicum 598

glyceraldehyde-3-phosphate dehydrogenase isoforms with opposite, ATP-dependent 599

regulation. J Mol Microbiol Biotechnol 8:91-103. 600

51. Iddar A, Valverde F, Serrano A, Soukri A. 2002. Expression, purification, and 601

characterization of recombinant nonphosphorylating NADP-dependent 602

glyceraldehyde-3-phosphate dehydrogenase from Clostridium acetobutylicum. 603

Protein Expr Purif 25:519-526. 604

52. Sauer U, Canonaco F, Heri S, Perrenoud A, Fischer E. 2004. The soluble and 605

membrane-bound transhydrogenases UdhA and PntAB have divergent functions in 606

NADPH metabolism of Escherichia coli. J Biol Chem 279:6613-6619. 607

53. Matsushita K, Otofuji A, Iwahashi M, Toyama H, Adachi O. 2001. NADH 608

dehydrogenase of Corynebacterium glutamicum. Purification of an NADH 609

dehydrogenase II homolog able to oxidize NADPH. FEMS Microbiol Lett 204:271-610

276. 611

54. Baumgart M, Unthan S, Ruckert C, Sivalingam J, Grunberger A, Kalinowski J, 612

Bott M, Noack S, Frunzke J. 2013. Construction of a prophage-free variant of 613

Corynebacterium glutamicum ATCC 13032 for use as a platform strain for basic 614

research and industrial biotechnology. Appl Environ Microbiol 79:6006-6015. 615

55. Michalecka AM, Agius SC, Moller IM, Rasmusson AG. 2004. Identification of a 616

mitochondrial external NADPH dehydrogenase by overexpression in transgenic 617

Nicotiana sylvestris. The Plant journal : for cell and molecular biology 37:415-425. 618

56. Nantapong N, Otofuji A, Migita CT, Adachi O, Toyama H, Matsushita K. 2005. 619

Electron transfer ability from NADH to menaquinone and from NADPH to oxygen of 620

type II NADH dehydrogenase of Corynebacterium glutamicum. Biosci Biotechnol 621

Biochem 69:149-159. 622

57. Bommareddy RR, Chen Z, Rappert S, Zeng AP. 2014. A de novo NADPH 623

generation pathway for improving lysine production of Corynebacterium glutamicum 624

by rational design of the coenzyme specificity of glyceraldehyde 3-phosphate 625

dehydrogenase. Metab Eng 25C:30-37. 626

58. Canonaco F, Hess TA, Heri S, Wang T, Szyperski T, Sauer U. 2001. Metabolic 627

flux response to phosphoglucose isomerase knock-out in Escherichia coli and impact 628

of overexpression of the soluble transhydrogenase UdhA. FEMS Microbiol Lett 629

204:247-252. 630

59. Lindner SN, Petrov DP, Hagmann CT, Henrich A, Kramer R, Eikmanns BJ, 631

Wendisch VF, Seibold GM. 2013. Phosphotransferase system-mediated glucose 632

uptake is repressed in phosphoglucoisomerase-deficient Corynebacterium 633

glutamicum strains. Appl Environ Microbiol 79:2588-2595. 634

60. Toya Y, Ishii N, Nakahigashi K, Hirasawa T, Soga T, Tomita M, Shimizu K. 635

2010. 13C-metabolic flux analysis for batch culture of Escherichia coli and its pyk and 636

pgi gene knockout mutants based on mass isotopomer distribution of intracellular 637

metabolites. Biotechnol Prog 26:975-992. 638

61. Jackson JB. 2003. Proton translocation by transhydrogenase. FEBS letters 555:176-639

177. 640

62. Bartek T, Blombach B, Lang S, Eikmanns BJ, Wiechert W, Oldiges M, Noh K, 641

Noack S. 2011. Comparative 13C metabolic flux analysis of pyruvate dehydrogenase 642

complex-deficient, L-valine-producing Corynebacterium glutamicum. Appl Environ 643

Microbiol 77:6644-6652. 644

63. Jiang LY, Zhang YY, Li Z, Liu JZ. 2013. Metabolic engineering of 645

Corynebacterium glutamicum for increasing the production of L-ornithine by 646

increasing NADPH availability. J Ind Microbiol Biotechnol 40:1143-1151. 647

64. Kabus A, Georgi T, Wendisch VF, Bott M. 2007. Expression of the Escherichia 648

coli pntAB genes encoding a membrane-bound transhydrogenase in Corynebacterium 649

glutamicum improves L-lysine formation. Appl Microbiol Biotechnol 75:47-53. 650

65. Auriol C, Bestel-Corre G, Claude JB, Soucaille P, Meynial-Salles I. 2011. Stress-651

induced evolution of Escherichia coli points to original concepts in respiratory 652

cofactor selectivity. Proc Natl Acad Sci U S A 108:1278-1283. 653

66. Bott M, Niebisch A. 2005. Respiratory energy metabolism. In Handbook of 654

Corynebacterium glutamicum (Eggeling L., Bott M., eds), CRC Press, Boca Raton, 655

USA, pp. 305-332. 656

67. Kato O, Youn JW, Stansen KC, Matsui D, Oikawa T, Wendisch VF. 2010. 657

Quinone-dependent D-lactate dehydrogenase Dld (Cg1027) is essential for growth of 658

Corynebacterium glutamicum on D-lactate. BMC Microbiol 10:321. 659

68. Molenaar D, van der Rest ME, Petrovic S. 1998. Biochemical and genetic 660

characterization of the membrane-associated malate dehydrogenase (acceptor) from 661

Corynebacterium glutamicum. Eur J Biochem 254:395-403. 662

663