L

RD

a

ARRAA

KLMEEB

1

aiflpsFc(

cmdcSdjtvflTt

1d

The International Journal of Biochemistry & Cell Biology 43 (2011) 1782– 1791

Contents lists available at SciVerse ScienceDirect

The International Journal of Biochemistry& Cell Biology

journa l h o me page: www.elsev ier .com/ locate /b ioce l

inoleic acid induces an EMT-like process in mammary epithelial cells MCF10A

oberto Espinosa-Neira, Janini Mejia-Rangel, Pedro Cortes-Reynosa, Eduardo Perez Salazar ∗

epartamento de Biologia Celular, Cinvestav-IPN, Av. IPN # 2508, San Pedro Zacatenco, Mexico, DF 07360, Mexico

r t i c l e i n f o

rticle history:eceived 19 April 2011eceived in revised form 1 August 2011ccepted 26 August 2011vailable online 16 September 2011

a b s t r a c t

Epidemiological studies and animal models suggest an association between high levels of dietary fatintake and an increased risk of developing breast cancer. Epithelial–mesenchymal-transition (EMT) is aprocess, by which epithelial cells are transdifferentiated to a mesenchymal state, and it has been impli-cated in cancer progression, including invasion and metastasis. Linoleic acid (LA) induces proliferationand invasion in breast cancer cells. However, the role of LA on the EMT process in human mammary

eywords:inoleic acidCF10A

MT-cadherin

epithelial cells remains to be studied. In the present study, we demonstrate that LA induces a transientdown-regulation of E-cadherin expression, accompanied with an increase of Snail1, Snail2, Twist1, Twist2and Sip1 expressions. Furthermore, LA induces FAK and NF�B activation, MMP-2 and -9 secretions, migra-tion and invasion. In summary, our findings demonstrate, for the first time, that LA promotes an EMT-likeprocess in MCF10A human mammary epithelial cells.

reast cancer

. Introduction

Epidemiological studies and animal models strongly suggestn association between high levels of dietary fat intake and anncreased risk of developing breast cancer. In the mammary gland,ree fatty acids (FFAs) are used as source of energy and for milkipid synthesis, however FFAs also bind to nuclear peroxisomeroliferator-activated receptors (PPARs), and mediate gen expres-ions involved in glucose and lipid metabolism (Louet et al., 2001;erre, 2004). In breast cancer cells, FFAs induce biological pro-esses independent of PPARs including proliferation and migrationYonezawa et al., 2004; Thiery, 2002).

Epithelial–mesenchymal-transition (EMT) is a biological pro-ess by which epithelial cells are transdifferentiated to aesenchymal state, and is a normal process during embryonic

evelopment and wound healing. However, EMT has been impli-ated in cancer metastasis and invasion (Hay, 2005; Thiery andleeman, 2006). EMT begins with loss of apico-basal polarity,egradation of basement membranes and dismantling of adherens

unctions and desmosomes. It is accompanied by the acquisi-ion of mesenchymal characteristics including the expression ofimentin, �-smooth muscle actin, N-cadherin, specific myosin iso-orms, fibronectin, metalloproteinases (MMPs), �-catenin nuclear

ocalization and one increased production of Snail1, Snail2, Twist1,wist2, ZEB1 and Sip1/ZEB2. In addition, cells undergo changes inheir cytoskeleton, such as stress fibers formation, that enable cells

∗ Corresponding author. Tel.: +52 55 5747 3991; fax: +52 55 5747 3393.E-mail address: jperez@cell.cinvestav.mx (E.P. Salazar).

357-2725/$ – see front matter © 2011 Elsevier Ltd. All rights reserved.oi:10.1016/j.biocel.2011.08.017

© 2011 Elsevier Ltd. All rights reserved.

acquire the ability to invade and migrate (Huber et al., 2005; Leeet al., 2006; Micalizzi et al., 2010).

Linoleic acid (LA) is an essential and the major poly-unsaturatedfatty acid (PUFA) in most diets, and is required for the biosynthe-sis of eicosanoids. LA is able to induce inappropriate inflammatoryresponses, contributing to various chronic diseases (Fritsche, 2008;Calder, 2001). In breast cancer cells, LA induces expression ofplasminogen activator inhibitor-1, proliferation, migration andinvasion, while in bovine mammary epithelial cells, LA promotesan increase in intracellular Ca2+ concentrations and proliferation(Yonezawa et al., 2008; Reyes et al., 2004; Byon et al., 2009).

In the present study we demonstrate that LA promotes atransient decrease of E-cadherin expression, accompanied withan increase of Snail1, Snail2, Twist1, Twist2, Sip1, vimentin andN-cadherin expressions. Furthermore, LA induces focal adhesionkinase (FAK) and NF�B activation, an increase of MMP-2 and -9secretions, cell migration and invasion in MCF10A cells. In sum-mary, these findings demonstrate, for the first time that LA inducesan EMT-like process in human mammary epithelial cells MCF10A.

2. Materials and methods

2.1. Materials

LA sodium salt (99% purity, Lot 079K5203), phorbol 12,13-dibutyrate (PDB) and recombinant epidermal growth fac-

tor (EGF) were obtained from Sigma (St. Louis, MO). Basementmembrane matrix (BD Matrigel) was obtained from BD Bio-sciences (Bedford, MA, USA). SC-26196, Western blotting luminolreagent and antibodies (Abs) against E-cadherin 67A4, vimentin

l of Biochemistry & Cell Biology 43 (2011) 1782– 1791 1783

VwP(AITo

2

csEama

DM

2

sSeRsp1

2

(

2

(127Nw

2

5s3NwoeHabapbg

Table 1Sequences used for real-time quantitative polymerase chain reaction.

Gene Forward primer 5′ → 3′ Reverse primer 5′ → 3′

Snail1 GCGAGCTGCAGGACTCTAAT CCTCTGTCCTCATCTGACASnail2 TTCGGACCCACACATTACCT TTGGAGCAGTTTTTGCACTGTwist1 GGAGTCCGCAGTCTTACGAG TGGAGGACCTGGTAGAGGAATwist2 AGCAAGAAGTCGAGCTAAGA CAGCTTGAGCGTCTGGATCTSip1 AATGGCAACAGCAACAAGTG CCCCGTCAGCACATAACTTT

R. Espinosa-Neira et al. / The International Journa

9, N-cadherin 13A9, FAK C-20, MMP-2H-76 and MMP-9H-129ere obtained from Santa Cruz Biotechnology (Santa Cruz, CA).

hosphospecific polyclonal Ab to tyrosine-397 (Tyr-397) of FAKanti-FAK-Tyr(P)397) was obtained from Invitrogen (Caramillo, CA).ctin Ab was kindly provided by Dr. Manuel Hernandez (Cinvestav-

PN). [�-32P] ATP was obtained from Perkin-Elmer (Boston, MA).aq DNA polymerase and SuperScript III reverse transcriptase werebtained from Invitrogen (Caramillo, CA).

.2. Cell culture

The non-tumorigenic mammary epithelial cells MCF10A wereultured in DMEM/F12 medium supplemented with 5% fetal bovineerum (FBS), 10 �g/ml insulin, 0.5 �g/ml hydrocortisone, 20 ng/mlGF and antibiotics in a humidified atmosphere containing 5% CO2nd 95% air at 37 ◦C. MCF7 cells were cultured in DMEM supple-ented with 3.7 g/l sodium bicarbonate, 5% FBS and antibiotics in

humidified atmosphere containing 5% CO2 and 95% air at 37 ◦C.For experimental purposes, MCF10A cells were starved for 4 h in

MEM/F12 without FBS, EGF, insulin and hydrocortisone, whereasCF7 cells were serum-starved for 12 h before treatment.

.3. Cell stimulation

Confluent cultures were washed twice and equilibrated in theame medium at 37 ◦C for at least 30 min, and treated with LA.timulation was terminated by aspirating the medium and nuclearxtracts were obtained or cells were solubilized in 0.5 ml of ice-coldIPA buffer (50 mM HEPES pH 7.4, 150 mM NaCl, 1 mM EGTA, 1 mModium orthovanadate, 100 mM NaF, 10 mM sodium pyrophos-hate, 10% glycerol, 1% Triton X-100, 1% sodium deoxycholate,.5 mM MgCl2, 0.1% SDS and 1 mM phenylmethylsulfonyl fluoride).

.4. Western blotting

Western blotting was performed as described previouslyNavarro-Tito et al., 2008).

.5. Preparation of nuclear extracts

Cells (1.5 × 106) were lysed with 0.1% Nonidet P40 in buffer A10 mM Tris–HCl, pH 7.4, 10 mM NaCl, 6 mM MgCl2, 10 mM NaF,

mM Na3VO4, 1 mM DTT, 1 mM PMSF). Lysates were pelleted at600 rpm for 15 min and resuspended in buffer B (20 mM HEPES, pH.9, 420 mM NaCl, 20% glycerol 1.5 mM MgCl2, 0.2 mM EDTA, 1 mMa3VO4, 10 mM NaF, 1 mM DTT, 0.2 mM PMSF). Nuclear extractsere recovered by centrifugation at 12,000 rpm for 15 min at 4 ◦C.

.6. Electrophoretic mobility shift assay (EMSA)

Double-stranded oligonucleotides containing E-box sequences′-GTGATGACACCTGCCTGTAGCATTCCA-3′, and specific bindingites for NF�B, 5′-AGCTAAGGGACTTTCCGCTGGGGACTTTCCAGG-′ were used as probe (Hodgson et al., 2003; Lopez-Novoa andieto, 2009). Next, 20 pmol of annealed oligonucleotide was labeledith [�-32P] ATP using T4 polynucleotide kinase. The 32P-labeled

ligonucleotide probe (∼1 ng) was incubated with 5 �g of nuclearxtract in a reaction mixture containing 3 �g of poly (dI-dC), 0.25 MEPES, pH 7.5, 0.6 M KCl, 50 mM MgCl2, 1 mM EDTA, 7.5 mM DTT,nd 9% glycerol for 20 min at 4 ◦C. One hundred-fold excess of unla-eled specific (E-boxes or NF�B) or non-specific probes were used

s specific and non-specific competitors, respectively. The sam-les were fractionated on a 6% polyacrylamide gel in 0.5× Trisorate–EDTA buffer. Gels were dried and analyzed by autoradio-raphy.

E-cadherin CGACCAACCCAAGAATCTA AGGCTGTGCCTTCCTACAGA�-Actin TCCCTGGAGAAGAGCTACGA AGCACTGTGTTGGCGTACAG

2.7. Quantitative real-time PCR (RT-qPCR)

Total RNA was obtained by using TriZol reagent (Invitrogen).cDNA was synthesized using SuperScript III reverse transcriptionsystem and 1 �g of total RNA as template. For real-time PCR, relativegene expression was determinated using SYBR Green PCR Mas-ter Mix Kit (Applied Biosystems, Foster City, CA), and the AppliedBiosystems 7300 Real-Time PCR system. Primers are shown inTable 1, and conditions used were described previously (Huanget al., 2008). Amplification was performed for 40 cycles of 3 minat 95 ◦C, 60 s at 60 ◦C, and 3 min at 72 ◦C. Results were analyzedby using the 2−��CT method (Livak and Schmittgen, 2001), andnormalized to �-actin data.

2.8. Scratch-wound assay

Cells were grown to confluence on 35-mm culture dishes, andstarved for 4 h in DMEM without FBS. Cells were treated for 2 h withmitomycin C (12 �M) to inhibit proliferation, and were scratch-wounded using a sterile 200-�l pipette tip, washed twice with PBSand re-fed with DMEM/F12 in the absence or presence of LA. Theprogress of cell migration into the wound was photographed usingan inverted microscope coupled to a camera. Cell migration wasevaluated indirectly by quantification of open wound area by usingthe T-Scratch image analysis software (Geback et al., 2009).

2.9. Zymography

Confluent cultures were treated with 60 �M LA, PDB or ethanol(EtOH), and conditioned medium was collected and concentratedusing centricon filters (Millipore). Equal volume of nonheated con-ditioned medium samples were mixed with sample buffer (2.5%SDS, 1% sucrose and 4 �g/ml phenol red) without reducing agent,and loaded to 8% acrylamide gels copolymerized with gelatin at1 mg/ml. Gels were rinsed twice in 2.5% Triton X-100, and thenincubated in assay buffer (50 mM Tris–HCl pH 7.4, 5 mM CaCl2) at37 ◦C for 48 h. Gels were fixed and stained with 0.25% CoomassieBrilliant Blue G-250 in 10% acetic acid and 30% methanol. Prote-olytic activity was detected as clear bands against the backgroundstain of undigested substrate.

2.10. Invasion assay

Invasion assays were performed by the modified Boyden cham-ber method in 24-well plates containing 12 cell culture inserts with8 �m pore size (Costar, Corning Inc). Briefly, 30 �l BD Matrigelwas added into culture inserts and kept overnight at 37 ◦C. Cellswere plated at 1 × 105 cells per insert in serum-free DMEM/F12 onthe top chamber. The lower chamber contained 600 �l DMEM/F12with 60 �M LA. Cells were incubated for 48 h at 37 ◦C in a 5% CO2atmosphere, and then cells and matrigel on the upper surface of

membrane were removed with cotton swabs, and cells on the lowersurface of membrane were washed and fixed with methanol for5 min. The number of invaded cells was estimated by staining with0.1% crystal violet in PBS. The dye was eluted with 500 �l 10% acetic

1784 R. Espinosa-Neira et al. / The International Journal of Biochemistry & Cell Biology 43 (2011) 1782– 1791

Fig. 1. LA induces a transient down-regulation of E-cadherin levels. (Panel A) MCF10A cells were treated with 60 �M LA for various times and lysed. Lysates were analyzedb rol. Thc or 3 anb < 0.0

av

2

s2T

FtS

y Western blotting with anti-E-cadherin Ab or with anti-actin Ab as loading contontrol (unstimulated) value. (Panel B) MCF10A cells were treated with 60 �M LA fy RT-qPCR. Asterisks denote comparisons made to control. *P < 0.05, **P < 0.01, ***P

cid, and the absorbance at 600 nm was measured. Backgroundalue was obtained from wells without cells.

.11. Immunofluorescence microscopy

Cells were grown on chamber slides (Nalge Nunc), washed witherum free-DMEM and treated with 60 �M LA. Cells were fixed for0 min with 4% paraformaldehyde in PBS, permeabilized with 0.1%riton X-100 and blocked for 20 min with 3% bovine serum albumin

ig. 2. LA induces up-regulation of E-cadherin transcriptional repressors. (Panel A) Nucimes. Binding of nuclear extracts to E-boxes was analyzed by EMSA. (Panel B) MCF10A cnail2, Twist1, Twist2 and Sip1 mRNA levels were quantified by RT-qPCR. Asterisks deno

e graph represents the mean ± S.D. and is expressed as the fold expression aboved 5 h and subsequently total RNA was obtained. E-cadherin mRNA was quantified

01.

(BSA). Cells were incubated overnight at 4 ◦C with vimentin Ab fol-lowed by FITC-labeled anti-mouse secondary Ab for 40 min at roomtemperature. Cells were viewed using a Leica confocal microscope.

2.12. Statistical analysis

Results are expressed as mean ± S.D. Data were statistically ana-lyzed using one-way ANOVA and Dunnett’s multiple comparisontest. Statistical probability of P < 0.05 was considered significant.

lear extracts were obtained from MCF10A cells treated with 60 �M LA for variousells were treated with 60 �M LA for 3 and 5 h and total RNA was obtained. Snail1,

te comparisons made to control (unstimulated). *P < 0.05, **P < 0.01, ***P < 0.001.

R. Espinosa-Neira et al. / The International Journal of Biochemistry & Cell Biology 43 (2011) 1782– 1791 1785

Fig. 3. LA enhaces vimentin and N-cadherin expression. MCF10A cells were treated with 60 �M LA for various times and lysed. Lysates were analyzed by Western blottingwith anti-vimentin Ab (Panel A, upper), anti-N-cadherin Ab (Panel B, upper) or with anti-actin Ab as loading control (Panels A and B, lower). The graphs represent themean ± S.D. and are expressed as the fold expression above control (unstimulated) value. Asterisks denote comparisons made to control. **P < 0.01, ***P < 0.001.

Fig. 4. LA induces FAK and NF�B activation. (Panel A) MCF10A cells were treated with 60 �M LA for various times and lysed. Lysates were analyzed by Western blottingwith anti-FAK-Tyr(P)397 Ab. The membranes were analyzed further by Western blotting with anti-FAK Ab. The graph represents the mean ± S.D. and is expressed as thefold FAK-Tyr(P)397 above control (unstimulated) value. Asterisks denote comparisons made to control. **P < 0.01, ***P < 0.001. (Panel B) Nuclear extracts were obtained fromMCF10A cells treated with 60 �M LA for various times. NF�B DNA binding activity was analyzed by EMSA.

1786 R. Espinosa-Neira et al. / The International Journal of Biochemistry & Cell Biology 43 (2011) 1782– 1791

Fig. 5. LA induces cell migration. (Panel A) MCF10A cells were grown in 35 mm dishes, and pretreated with 12 �M mitomycin C for 2 h. Cell cultures were scratch-wounded,a s of Lq e (ope( ted wi

3

3e

BdMlciEiwaL

c

nd treated for 48 h in serum-free DMEM/F12 containing increasing concentrationuantification of open wound areas and represents the mean ± S.D. of the percentagunstimulated). **P < 0.01, ***P < 0.001. (Panel C) A higher amplification of cells trea

. Results

.1. LA induces a transient down-regulation of E-cadherinxpression levels

EMT involves the loss of E-cadherin expression (Gavert anden-Ze’ev, 2008; Thiery, 2002). We examined whether LA inducesown-regulation of E-cadherin expression. Confluent cultures ofCF10A cells were treated with 60 �M LA for various times and

ysed. Cell lysates were analyzed by Western blotting with anti-E-adherin Ab or with anti-actin Ab as the loading control. As shownn Fig. 1A (upper panel), LA induced a transient down-regulation of-cadherin expression at 3 and 5 h of treatment, following for anncrease a little above of E-cadherin basal levels. Western blotting

ith anti-actin Ab of the same membranes confirmed that similar

mounts of protein were recovered in the absence or presence ofA (Fig. 1A, lower panel).

Next, we determined whether LA induces down-regulation of E-adherin transcripts. MCF10A cells were stimulated with 60 �M LA

A. Pictures were taken at 48 h after wounding. (Panel B) The graph represents then wound area) of total area. Asterisks denote comparisons made to control culturesth increasing concentrations of LA at the edge of the wound.

for 3 and 5 h, and E-cadherin transcripts were analyzed by RT-qPCR.As illustrated in Fig. 1B, LA induced a transient down-regulation ofE-cadherin transcripts at 3 h of treatment, following for an increasea little bit above of basal levels of E-cadherin transcripts.

3.2. LA promotes up-regulation of E-cadherin transcriptionalrepressors

Snail1, Snail2, Sip1, Twist1 and Twist2 are E-cadherin tran-scriptional repressors that bind to E-cadherin promoter at E-boxes(Hajra et al., 2002; Eger et al., 2005; Cowin et al., 2005). Wedetermined whether LA induces DNA–protein complex formationbetween MCF10A cell nuclear extracts and E-boxes. EMSAs wereperformed using nuclear extracts from MCF10A cells stimulatedwith 60 �M LA and a radiolabeled oligonucleotide probe containing

canonical E-boxes. Our results showed that LA treatment induceda marked increase in DNA–protein complex formation betweenthe nuclear extracts and E-boxes in a time-dependent manner(Fig. 2A). The specificity of these complexes was demonstrated by

R. Espinosa-Neira et al. / The International Journal of Biochemistry & Cell Biology 43 (2011) 1782– 1791 1787

F mm dw M LA.I ells tr

ia

cwStTi

3e

cwefvAo

3

t2aLo(wbpFN

3

ii

ig. 6. LA induces vimentin expression. (Panel A) MCF10A cells were grown in 35ounded, and treated for various times in serum-free DMEM/F12 containing 60 �

mages were obtained by confocal microscopy. (Panel B) A higher amplification of c

nhibition of binding in the presence of a cold competitor, whereasn irrelevant competitor did not affect the binding.

Next, we determined whether LA induces up-regulation of E-adherin transcriptional repressors. MCF10A cells were treatedith 60 �M LA for 3 and 5 h, and Snail1, Snail2, Twist1, Twist2 and

ip1 transcripts were analyzed by RT-qPCR. Our results showedhat treatment with LA for 3 and 5 h induced an increase of Snail1,wist2 and Sip1 transcripts, whereas treatment for 5 h induced anncrease of Snail2 and Twist1 transcripts (Fig. 2B).

.3. LA induces an increase of vimentin and N-cadherinxpression

An increased expression of vimentin and N-cadherin are asso-iated with EMT (Gavert and Ben-Ze’ev, 2008). We determinedhether LA induces an increase of vimentin and N-cadherin

xpression. Cell lysates from MCF10A cells treated with 60 �M LAor various times were analyzed by Western blotting with anti-imentin, anti-N-cadherin Abs and anti-actin Ab as loading control.s shown in Fig. 3A and B, treatment with LA induced an increasef vimentin and N-cadherin expression.

.4. LA promotes FAK and NF�B activation

NF�B contributes to EMT, whereas TGF-� promotes EMThrough a FAK-dependent pathway (Dong et al., 2007; Huber et al.,004; Cicchini et al., 2008). We examined whether LA induces FAKnd NF�B activation. MCF10A cells were stimulated with 60 �MA for various times and cells were lysed or nuclear extracts werebtained. FAK activation, given by the phosphorylation at Tyr-397Parsons, 2003) was analyzed by Western blotting of cell lysatesith anti-FAK-Tyr(P)397 Ab, whereas NF�B activation was analyzed

y EMSA using nuclear extracts and a radiolabeled oligonucleotiderobe representing a canonical NF�B binding site. As illustrated inig. 4A (upper panel) and B, treatment with LA induced FAK andF�B activation in a time-dependent manner.

.5. LA induces cell migration

EMT is characterized for an increased capacity for migration andnvasion (Lee et al., 2006). We determined whether LA induces anncrease on cell migration. MCF10A cells cultured to confluence

ishes and pretreated with 12 �M mitomycin C for 2 h. Cell cultures were scratch- Cells were fixed and immunofluorescence was performed with anti-vimentin Ab.eated with 60 �M LA at the edge of the wound.

were scratch-wounded, followed by treatment with increasingconcentrations of LA for 48 h. As shown in Fig. 5A, cells treatedwith LA showed a significant increase migration pattern towardthe middle of scratch compared to untreated cells. Quantificationof open wound areas of these assays confirmed that LA inducedcell migration (Fig. 5B). A higher amplification of cells showed thatmotility pattern was mainly cohesive (collective migration) ratherthan individual and those cells at the edges of the scratch assumeda fibroblast-like appearance (Fig. 5C).

To determine whether the morphological changes observed arereverted upon long exposure to LA. We analyzed by using scratch-wound assays and confocal microscopy the vimentin pattern incells stimulated for long periods of time with LA. MCF10A cellsstimulated with 60 �M LA for various times were analyzed by con-focal microscopy using anti-vimentin Ab. As illustrated in Fig. 6Aand B, LA induced an increase in vimentin protein expression incells localized at the edges of scratch. Unstimulated cells showeda few cells stained with vimentin Ab, whereas treatment with LAinduced an increase in the number of cells stained with vimentin Abthat were mainly localized at the edges of the scratch, and vimentinwas localized in all cytosol. Moreover, long exposure to LA (48 h),did not revert vimentin expression and its cell localization.

3.6. LA induces MMPs secretion and invasion

During EMT, the mesenchymal markers including MMP-2 and-9 secretions are acquired, resulting in enhanced ability for cellmigration and invasion (Lee et al., 2006). We examined whetherLA induces MMP-2 and -9 secretions and invasion. MCF10A cellswere stimulated with 60 �M LA for various times and conditionedmedium was obtained and cells were lysed. Medium was subjectedto gelatin zymography and Western blotting with anti-MMP-2 and-9 Abs. As illustrated in Fig. 7A and B (upper panel), treatment ofcells with LA induced a marked increase on MMP-2 and -9 secre-tions in a time-dependent manner. Since, EtOH and PDB stimulateexpression and secretion of MMP-2 and -9, respectively (Ke et al.,2006; Cortes-Reynosa et al., 2008), positive controls of MMP-2 and-9 secretions were included, which were prepared by treatment of

MCF7 cells with 1.6 mg/ml EtOH or 100 ng/ml PDB for 24 h. West-ern blotting with anti-actin Ab of cell lysates confirmed that similarnumber of cells were present in the absence or presence of LA(Fig. 6A and B, lower panel).

1788 R. Espinosa-Neira et al. / The International Journal of Bi

Fig. 7. LA induces cell invasion. MCF10A cells were treated with 60 �M LA for var-ious times and conditioned medium was obtained and cells were lysed. MMP-2and -9 secretions were analyzed on conditioned medium using gelatin-substrategels (Panel A), and Western blotting using anti-MMP-2 and -9 Abs (Panel B). Posi-tive controls of MMP-2 and -9 secretions were included. Cell lysates were analyzedby Western blotting using anti-actin Ab as loading control. (Panel C) MCF10A cellswere plated on top of matrigel and treated with increasing concentrations of LAfor 48 h and cell invasion was evaluated. The graph represents the mean ± S.D.ac

BMrd

3c

Wamsccww

nd is expressed as the percentage of maximum invaded cells. Asterisks denoteomparisons made to control cultures (unstimulated). *P < 0.05.

Next, we determined whether LA induces invasion using theoyden chamber method. Invasion assays were performed withCF10A cells stimulated with various concentrations of LA. Our

esults showed that LA induces invasion in a concentration-ependent manner (Fig. 7C).

.7. Biological effects mediated by LA do not require itsonversion to arachidonic acid

LA is able to be transformed to arachidonic acid (AA) (Das, 2006).e studied whether the biological effects induced by LA are medi-

ted by its conversion to AA. Since, LA �6-desaturation, which isediated by �6-desaturase, is the rate-limiting step in the conver-

ion of LA to AA (Sprecher et al., 1995; Sprecher, 2000). MCF10A

ells were pretreated for 3 h with 2 �M SC-26196, which is a spe-ific inhibitor of �6-desaturase (Harmon et al., 2003) stimulatedith 60 �M LA and cell migration assays or vimentin expressionere performed. Our results showed that treatment with SC-26196

ochemistry & Cell Biology 43 (2011) 1782– 1791

did not inhibit cell migration (Fig. 8A and B), and the increase onvimentin expression induced by LA (Fig. 8C).

4. Discussion

It has been reported that a dietary pattern characterized byhigh-fat choices, including saturated fatty acids (SFAs), mono-unsaturated fatty acids (MUFAs), n-3 PUFA and n-6 PUFA, isassociated with increased risk of breast cancer (Schulz et al., 2008;Lee and Lin, 2000). In humans, LA is the major PUFA, comprising84–89% of the total PUFA energy in the diet of adult population,and its plasma concentration is around 275 �M (Kris-Etherton et al.,2000; Ferrucci et al., 2006; Anderson et al., 2009). Moreover, con-jugated LA inhibits the proliferation of MCF7 cells, whereas it doesnot have an inhibitor effect in MCF10A cells (Albright et al., 2005).In contrast, the LA PUFA has been linked to the development ofcancer in animals (Fay et al., 1997). LA is an essential fatty acidand induces proliferation, migration, invasion and the activationof transcription factors (Johanning and Lin, 1995; Yonezawa et al.,2008; Reyes et al., 2004). However, the participation of LA on EMTprocess in mammary epithelial cells has not been studied.

Classical cadherins are transmembrane adhesion receptorsrequired to form and maintain adherens junctions. They mediatecell–cell adhesions through their extracellular domains and con-nect to the actin microfilaments indirectly via �- and �-catenin inthe cytoplasm (Halbleib and Nelson, 2006; Wheelock et al., 2008).EMT induces the disassembled of adherens junctions, accompa-nied with the loss or reduction of E-cadherin, as well as the actincytoskeleton reorganizes from an epithelial cortical alignment withcell–cell junctions into actin stress fibers anchored to focal adhesioncomplexes (Gumbiner, 2005; Lee et al., 2006). Cell expression ofE-cadherin is negatively regulated by several transcription factorsincluding Snail1, Snail2, Twist1 and 2, ZEB1 and Sip1, each of whichbind to E-cadherin promoter at E-boxes and repress its transcrip-tion (Baranwal and Alahari, 2009; Cano et al., 2000; Wheelock et al.,2008). We demonstrate here that LA induces a transient down-regulation of E-cadherin expression, as well as nuclear extractsfrom MCF10A cells treated with LA bind to one DNA sequence corre-sponding to canonical E-boxes, and that LA induces an increase ofSnail1, Snail2, Twist1, Twist2 and Sip1 mRNA levels. We proposethat LA stimulates the expression of these transcription factors,and then they bind to E-boxes and mediate the downregulationof E-cadherin expression.

During EMT, the decrease in epithelial traits is accompa-nied by the acquisition of mesenchymal characteristics includingthe expression of vimentin, �-smooth-muscle actin, N-cadherin,fibronectin and MMPs (Gavert and Ben-Ze’ev, 2008; Thiery, 2003).Vimentin is a type III intermediate filament expressed in cellsof mesenchymal origin, and the reduction of E-cadherin levelsand/or release from adherens junctions has been associated withthe novo expression of vimentin and with the metastatic conver-sion of epithelial cells. Moreover, vimentin and N-cadherin areexpressed in mesenchymal cells, however they also are expressedin epithelial cells involved in physiological or pathological pro-cesses that require migration such as tumor invasion (Gilles et al.,2003; Hazan et al., 2000; Gavert and Ben-Ze’ev, 2008). Our Westernblot findings show that LA induces a transient increase of vimentinand N-cadherin expression. In contrast, when vimentin expressionwas analyzed by confocal microscopy of scratch wound assays, wedetermined that LA induces an increase in vimentin expression butit is not down regulated until 48 h of stimulation. We propose that

vimentin expression is not down regulated because the cells aremigrating toward the middle of the scratch until 48 h of stimulation.Supporting our proposal, these findings also show that cells stainedwith vimentin Ab are mainly localized at the edge of the scratch,

l of Bi

wbvanloc2it

leoaWiimlMNc2

F(6Mbv

R. Espinosa-Neira et al. / The International Journa

here the cells are migrating. In line with this notion, Westernlot analysis of vimentin expression shows the down regulation ofimentin expression at 20 h of treatment with LA, because thesessays were performed with confluent cultures, where the cells areot able to migrate. Therefore, we propose that LA induces an EMT-

ike process. In agreement with our proposal, vimentin is expressedn invasive breast cancer cells lines and its expression in MCF10Aells and breast cancer cells enhances migration (Bindels et al.,006; Gilles et al., 1999). Moreover, N-cadherin is over-expressed

n most invasive and metastatic human breast cancer cell lines andumors (Hazan et al., 2000).

NF�B has been implicated in the EMT process, because it regu-ates the transcription of Snail1, Snail2, Twist1/2, and ZEB1 (Hubert al., 2004; Min et al., 2008). NF�B also promotes the expressionf other genes implicated in EMT including vimentin and MMP-9,s well as MT1-MMP expression, which induces MMP-2 activation.e demonstrate that LA induces NF�B activation and an increase

n MMP-2 and -9 secretions in MCF10A cells. We propose that LAnduces the expression of Snail1, Snail2, Twist1, Twist2 and Sip1

RNA through a NF�B-dependent pathway, and that NF�B regu-ates vimentin expression and the secretion and/or expression of

MP-2 and -9. Supporting our proposal, it has been reported thatF�B plays a central role in EMT in a mouse model of breast can-

er progression and that MMPs are implicated in EMT (Huber et al.,004).

ig. 8. Role of �6-desaturase in migration and vimentin expression induced by LA. (Panel−) or presence (+) of 2 �M SC-26196 and with 12 �M mitomycin C for 2 h. Cell cultures0 �M LA. (Panel B) The graph represents the quantification of open wound areas and repCF10A cells were pretreated for 3 h in the absence (−) or presence (+) of 2 �M SC-2619

lotting with anti-vimentin Ab and anti-actin Ab as loading control. The graph represents talue. Asterisks denote comparisons made to control. ***P < 0.001.

ochemistry & Cell Biology 43 (2011) 1782– 1791 1789

A hallmark of EMT is the acquisition of the ability to migrateand invade through ECM and it is mediated by common tar-gets including FAK and Src (Cicchini et al., 2008; Mandal et al.,2008). FAK and Src are key players in the regulation of cellmatrix interactions, formation of focal contacts and mediate a vari-ety of cell functions including migration, survival, invasivenessand EMT (Avizienyte and Frame, 2005; Parsons, 2003). In Metmurine hepatocyte (MMH) lines, TGF-� promotes up-regulationof mesenchymal and invasiveness markers and delocalization ofmembrane-bound-E-cadherin via FAK activation (Cicchini et al.,2008), whereas in human embryonic carcinoma cell line NT2/D1and mouse mammary epithelial cells NMuMG, TGF-� induces EMTthrough a FAK and Src kinase-dependent pathway (Bailey andLiu, 2008). Furthermore, Src-induced deregulation of E-cadherinrequires specific integrin signaling and the Src-dependent tyrosinephosphorylation of FAK at peripheral integrin-dependent protru-sions in KM12C colon cancer cells (Avizienyte et al., 2002). In linewith this notion, we demonstrate that LA induces FAK activation,cell migration and invasion. Particularly, cell migration pattern iscohesive and the cells at the edge of the scratch assume an elon-gated fibroblast-like morphology. Supporting these findings, it hasbeen reported that cancer cells can spread by collective migra-tion of groups of tumor cells (Friedl and Gilmour, 2009), as well

as in a breast cancer xenograft mouse model, lymphatic dissemi-nation is mediated by collective migration (Giampieri et al., 2009),

A) MCF10A cells were grown in 35 mm dishes and pretreated for 3 h in the absence were scratch-wounded, and treated for 48 h in serum-free DMEM/F12 containingresents the mean ± S.D. of the percentage (open wound area) of total area. (Panel C)6, stimulated with 60 �M LA for 15 h and lysed. Lysates were analyzed by Westernhe mean ± S.D. and is expressed as the fold expression above control (unstimulated)

1 l of Bi

wv

AtEtEvbaaGalH

Lleevasta

A

c(C

R

A

A

A

A

B

B

B

B

C

C

C

C

C

C

D

D

790 R. Espinosa-Neira et al. / The International Journa

hereas solitary movement in vivo directs tumor cells to bloodessels (Condeelis and Segall, 2003; Wyckoff et al., 2004).

LA is the precursor of AA and we previously demonstrated thatA promotes EMT-like transition with a cohesive migration pat-

ern in MCF10A cells (Martinez-Orozco et al., 2010). It suggests thatMT-like transition mediated by LA is mediated by LA transforma-ion to AA. However, we demonstrate here that LA promotes anMT-like process through a mechanism independent on LA con-ersion to AA. We propose that LA mediates an EMT-like processy the activation of two G-protein coupled receptors namely FFAR1nd GPR120, because these receptors are expressed in MCF10A cellsnd are activated by medium and long chain FFAs, such as LA (Soto-uzman et al., 2008; Navarro-Tito et al., 2008). Furthermore, oleatend LA induce an increase in cellular Ca2+ concentration and pro-iferation of breast cancer cells via FFAR1 (Yonezawa et al., 2004;ardy et al., 2005).

In conclusion, our findings demonstrate, for the first time, thatA induces an EMT-like process in MCF10A mammary epithe-ial cells, because LA promotes a transient decrease of E-cadherinxpression, accompanied with an increase of mesenchymal mark-rs expression including Snail1, Snail2, Twist1, Twist2, Sip1,imentin and N-cadherin. Furthermore, LA induces FAK and NF�Bctivation, MMP-2 and -9 secretions and cell migration and inva-ion. These findings define a new role for LA in breast cancer andhey suggest that LA may play an important role during the invasionnd metastasis processes.

cknowledgements

We are grateful to Nora Ruiz and Catalina Flores for their techni-al assistance. This work was supported by a grant from CONACYT83802) and UC-Mexus. R. E-N and J. M-R are supported by a CONA-YT Predoctoral Training Grant.

eferences

lbright CD, Klem E, Shah AA, Gallagher P. Breast cancer cell-targeted oxidativestress: enhancement of cancer cell uptake of conjugated linoleic acid, activationof p53, and inhibition of proliferation. Exp Mol Pathol 2005;79:118–25.

nderson SG, Sanders TA, Cruickshank JK. Plasma fatty acid composition as a pre-dictor of arterial stiffness and mortality. Hypertension 2009;53:839–45.

vizienyte E, Frame MC. Src and FAK signalling controls adhesion fate and theepithelial-to-mesenchymal transition. Curr Opin Cell Biol 2005;17:542–7.

vizienyte E, Wyke AW, Jones RJ, McLean GW, Westhoff MA, Brunton VG, et al.Src-induced de-regulation of E-cadherin in colon cancer cells requires integrinsignalling. Nat Cell Biol 2002;4:632–8.

ailey KM, Liu J. Caveolin-1 up-regulation during epithelial to mesenchymal transi-tion is mediated by focal adhesion kinase. J Biol Chem 2008;283:13714–24.

aranwal S, Alahari SK. Molecular mechanisms controlling E-cadherin expression inbreast cancer. Biochem Biophys Res Commun 2009;384:6–11.

indels S, Mestdagt M, Vandewalle C, Jacobs N, Volders L, Noel A, et al. Regu-lation of vimentin by SIP1 in human epithelial breast tumor cells. Oncogene2006;25:4975–85.

yon CH, Hardy RW, Ren C, Ponnazhagan S, Welch DR, McDonald JM, et al. Freefatty acids enhance breast cancer cell migration through plasminogen activatorinhibitor-1 and SMAD4. Lab Invest 2009;89:1221–8.

alder PC. Polyunsaturated fatty acids, inflammation, and immunity. Lipids2001;36:1007–24.

ano A, Perez-Moreno MA, Rodrigo I, Locascio A, Blanco MJ, del Barrio MG, et al.The transcription factor snail controls epithelial–mesenchymal transitions byrepressing E-cadherin expression. Nat Cell Biol 2000;2:76–83.

icchini C, Laudadio I, Citarella F, Corazzari M, Steindler C, Conigliaro A, et al.TGF�-induced EMT requires focal adhesion kinase (FAK) signaling. Exp Cell Res2008;314:143–52.

ondeelis J, Segall JE. Intravital imaging of cell movement in tumours. Nat Rev Cancer2003;3:921–30.

ortes-Reynosa P, Robledo T, Macias-Silva M, Wu SV, Salazar EP. Src kinase regu-lates metalloproteinase-9 secretion induced by type IV collagen in MCF-7 humanbreast cancer cells. Matrix Biol 2008;27:220–31.

owin P, Rowlands TM, Hatsell SJ. Cadherins and catenins in breast cancer. Curr Opin

Cell Biol 2005;17:499–508.

as UN. Essential fatty acids: biochemistry, physiology and pathology. Biotechnol J2006;1:420–39.

ong R, Wang Q, He XL, Chu YK, Lu JG, Ma QJ. Role of nuclear factor kappaB and reactive oxygen species in the tumor necrosis factor-alpha-induced

ochemistry & Cell Biology 43 (2011) 1782– 1791

epithelial–mesenchymal transition of MCF-7 cells. Braz J Med Biol Res2007;40:1071–8.

Eger A, Aigner K, Sonderegger S, Dampier B, Oehler S, Schreiber M, et al. �EF1 isa transcriptional repressor of E-cadherin and regulates epithelial plasticity inbreast cancer cells. Oncogene 2005;24:2375–85.

Fay MP, Freedman LS, Clifford CK, Midthune DN. Effect of different types andamounts of fat on the development of mammary tumors in rodents: a review.Cancer Res 1997;57:3979–88.

Ferre P. The biology of peroxisome proliferator-activated receptors: relation-ship with lipid metabolism and insulin sensitivity. Diabetes 2004;53(Suppl.1):S43–50.

Ferrucci L, Cherubini A, Bandinelli S, Bartali B, Corsi A, Lauretani F, et al. Relationshipof plasma polyunsaturated fatty acids to circulating inflammatory markers. JClin Endocrinol Metab 2006;91:439–46.

Friedl P, Gilmour D. Collective cell migration in morphogenesis, regeneration andcancer. Nat Rev Mol Cell Biol 2009;10:445–57.

Fritsche KL. Too much linoleic acid promotes inflammation-doesn’t it?Prostaglandins Leukot Essent Fatty Acids 2008;79:173–5.

Gavert N, Ben-Ze’ev A. Epithelial–mesenchymal transition and the invasive potentialof tumors. Trends Mol Med 2008;14:199–209.

Geback T, Schulz MM, Koumoutsakos P, Detmar M. TScratch: a novel and sim-ple software tool for automated analysis of monolayer wound healing assays.Biotechniques 2009;46:265–74.

Giampieri S, Manning C, Hooper S, Jones L, Hill CS, Sahai E. Localized and reversibleTGF� signalling switches breast cancer cells from cohesive to single cell motility.Nat Cell Biol 2009;11:1287–96.

Gilles C, Polette M, Mestdagt M, Nawrocki-Raby B, Ruggeri P, Birembaut P, et al.Transactivation of vimentin by �-catenin in human breast cancer cells. CancerRes 2003;63:2658–64.

Gilles C, Polette M, Zahm JM, Tournier JM, Volders L, Foidart JM, et al.Vimentin contributes to human mammary epithelial cell migration. J Cell Sci1999;112:4615–25 (Pt 24).

Gumbiner BM. Regulation of cadherin-mediated adhesion in morphogenesis. NatRev Mol Cell Biol 2005;6:622–34.

Hajra KM, Chen DY, Fearon ER. The SLUG zinc-finger protein represses E-cadherinin breast cancer. Cancer Res 2002;62:1613–8.

Halbleib JM, Nelson WJ. Cadherins in development: cell adhesion, sorting, and tissuemorphogenesis. Genes Dev 2006;20:3199–214.

Hardy S, St-Onge GG, Joly E, Langelier Y, Prentki M. Oleate promotes the proliferationof breast cancer cells via the G protein-coupled receptor GPR40. J Biol Chem2005;280:13285–91.

Harmon SD, Kaduce TL, Manuel TD, Spector AA. Effect of the �6-desaturase inhibitorSC-26196 on PUFA metabolism in human cells. Lipids 2003;38:469–76.

Hay ED. The mesenchymal cell, its role in the embryo, and the remarkable signalingmechanisms that create it. Dev Dyn 2005;233:706–20.

Hazan RB, Phillips GR, Qiao RF, Norton L, Aaronson SA. Exogenous expression of N-cadherin in breast cancer cells induces cell migration, invasion, and metastasis.J Cell Biol 2000;148:779–90.

Hodgson L, Henderson AJ, Dong C. Melanoma cell migration to type IV collagenrequires activation of NF-�B. Oncogene 2003;22:98–108.

Huang W, Zhang Y, Varambally S, Chinnaiyan AM, Banerjee M, Merajver SD, et al.Inhibition of CCN6 (Wnt-1-induced signaling protein 3) down-regulates E-cadherin in the breast epithelium through induction of snail and ZEB1. Am JPathol 2008;172:893–904.

Huber MA, Azoitei N, Baumann B, Grunert S, Sommer A, Pehamberger H, et al. NF-�Bis essential for epithelial–mesenchymal transition and metastasis in a model ofbreast cancer progression. J Clin Invest 2004;114:569–81.

Huber MA, Kraut N, Beug H. Molecular requirements for epithelial–mesenchymaltransition during tumor progression. Curr Opin Cell Biol 2005;17:548–58.

Johanning GL, Lin TY. Unsaturated fatty acid effects on human breast cancer celladhesion. Nutr Cancer 1995;24:57–66.

Ke Z, Lin H, Fan Z, Cai TQ, Kaplan RA, Ma C, et al. MMP-2 mediates ethanol-induced invasion of mammary epithelial cells over-expressing ErbB2. Int JCancer 2006;119:8–16.

Kris-Etherton PM, Taylor DS, Yu-Poth S, Huth P, Moriarty K, Fishell V, et al. Polyun-saturated fatty acids in the food chain in the United States. Am J Clin Nutr2000;71:179S–88S.

Lee JM, Dedhar S, Kalluri R, Thompson EW. The epithelial–mesenchymal tran-sition: new insights in signaling, development, and disease. J Cell Biol2006;172:973–81.

Lee MM, Lin SS. Dietary fat and breast cancer. Annu Rev Nutr 2000;20:221–48.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time

quantitative PCR and the 2(−��C(T)) method. Methods 2001;25:402–8.Lopez-Novoa JM, Nieto MA. Inflammation and EMT: an alliance towards organ fibro-

sis and cancer progression. EMBO Mol Med 2009;1:303–14.Louet JF, Chatelain F, Decaux JF, Park EA, Kohl C, Pineau T, et al. Long-chain fatty acids

regulate liver carnitine palmitoyltransferase I gene (L-CPT I) expression througha peroxisome-proliferator-activated receptor alpha (PPAR�)-independent path-way. Biochem J 2001;354:189–97.

Mandal M, Myers JN, Lippman SM, Johnson FM, Williams MD, Rayala S, et al.Epithelial to mesenchymal transition in head and neck squamous carcinoma:

association of Src activation with E-cadherin down-regulation, vimentin expres-sion, and aggressive tumor features. Cancer 2008;112:2088–100.

Martinez-Orozco R, Navarro-Tito N, Soto-Guzman A, Castro-Sanchez L, Perez-Salazar E. Arachidonic acid promotes epithelial-to-mesenchymal-like transitionin mammary epithelial cells MCF10A. Eur J Cell Biol 2010;89:476–88.

l of Bi

M

M

N

PR

S

S

S

R. Espinosa-Neira et al. / The International Journa

icalizzi DS, Farabaugh SM, Ford HL. Epithelial–mesenchymal transition in can-cer: parallels between normal development and tumor progression. J MammaryGland Biol Neoplasia 2010;15:117–34.

in C, Eddy SF, Sherr DH, Sonenshein GE. NF-�B and epithelial to mesenchymaltransition of cancer. J Cell Biochem 2008;104:733–44.

avarro-Tito N, Robledo T, Salazar EP. Arachidonic acid promotes FAK activation andmigration in MDA-MB-231 breast cancer cells. Exp Cell Res 2008;314:3340–55.

arsons JT. Focal adhesion kinase: the first ten years. J Cell Sci 2003;116:1409–16.eyes N, Reyes I, Tiwari R, Geliebter J. Effect of linoleic acid on proliferation and gene

expression in the breast cancer cell line T47D. Cancer Lett 2004;209:25–35.chulz M, Hoffmann K, Weikert C, Nothlings U, Schulze MB, Boeing H. Identifica-

tion of a dietary pattern characterized by high-fat food choices associated withincreased risk of breast cancer: the European Prospective Investigation intoCancer and Nutrition (EPIC)-Potsdam Study. Br J Nutr 2008;100:942–6.

oto-Guzman A, Robledo T, Lopez-Perez M, Salazar EP. Oleic acid induces ERK1/2

activation and AP-1 DNA binding activity through a mechanism involving Srckinase and EGFR transactivation in breast cancer cells. Mol Cell Endocrinol2008;294:81–91.

precher H. Metabolism of highly unsaturated n−3 and n−6 fatty acids. BiochimBiophys Acta 2000;1486:219–31.

ochemistry & Cell Biology 43 (2011) 1782– 1791 1791

Sprecher H, Luthria DL, Mohammed BS, Baykousheva SP. Reevaluation of thepathways for the biosynthesis of polyunsaturated fatty acids. J Lipid Res1995;36:2471–7.

Thiery JP. Epithelial–mesenchymal transitions in tumour progression. Nat Rev Can-cer 2002;2:442–54.

Thiery JP. Epithelial–mesenchymal transitions in development and pathologies. CurrOpin Cell Biol 2003;15:740–6.

Thiery JP, Sleeman JP. Complex networks orchestrate epithelial–mesenchymal tran-sitions. Nat Rev Mol Cell Biol 2006;7:131–42.

Wheelock MJ, Shintani Y, Maeda M, Fukumoto Y, Johnson KR. Cadherin switching.J Cell Sci 2008;121:727–35.

Wyckoff J, Wang W, Lin EY, Wang Y, Pixley F, Stanley ER, et al. A paracrine loopbetween tumor cells and macrophages is required for tumor cell migration inmammary tumors. Cancer Res 2004;64:7022–9.

Yonezawa T, Haga S, Kobayashi Y, Katoh K, Obara Y. Unsaturated fatty acids promote

proliferation via ERK1/2 and Akt pathway in bovine mammary epithelial cells.Biochem Biophys Res Commun 2008;367:729–35.

Yonezawa T, Katoh K, Obara Y. Existence of GPR40 functioning in a humanbreast cancer cell line MCF-7. Biochem Biophys Res Commun 2004;314:805–9.