REVIEW

Ligand-binding assays for cyanobacterial neurotoxinstargeting cholinergic receptors

Rómulo Aráoz & Natalia Vilariño & Luis M. Botana &

Jordi Molgó

Received: 25 November 2009 /Revised: 28 January 2010 /Accepted: 30 January 2010 /Published online: 19 March 2010# Springer-Verlag 2010

Abstract Toxic cyanobacterial blooms are a threat topublic health because of the capacity of some cyanobacte-rial species to produce potent hepatotoxins and neurotoxins.Cyanobacterial neurotoxins are involved in the rapid deathof wild and domestic animals by targeting voltage gatedsodium channels and cholinergic synapses, including theneuromuscular junction. Anatoxin-a and its methylenehomologue homoanatoxin-a are potent agonists of nicotinicacetylcholine receptors. Since the structural determinationof anatoxin-a, several mass spectrometry-based methodshave been developed for detection of anatoxin-a and, later,homoanatoxin-a. Mass spectrometry-based techniques pro-vide accuracy, precision, selectivity, sensitivity, reproduc-ibility, adequate limit of detection, and structural andquantitative information for analyses of cyanobacterialanatoxins from cultured and environmental cyanobacterialsamples. However, these physicochemical techniques willonly detect known toxins for which toxin standards arecommercially available, and they require highly specializedlaboratory personnel and expensive equipment. Receptor-based assays are functional methods that are based on themechanism of action of a class of toxins and are thus,suitable tools for survey of freshwater reservoirs forcyanobacterial anatoxins. The competition between cyano-

bacterial anatoxins and a labelled ligand for binding tonicotinic acetylcholine receptors is measured radioactivelyor non-radioactively providing high-throughput screeningformats for routine detection of this class of neurotoxins.The mouse bioassay is the method of choice for marinetoxin monitoring, but has to be replaced by fully validatedfunctional methods. In this paper we review the ligand-binding assays developed for detection of cyanobacterialand algal neurotoxins targeting the nicotinic acetylcholinereceptors and for high-throughput screening of novelnicotinic agents.

Keywords Receptor binding assay . Cyanobacterialneurotoxins . Anatoxin-a . Nicotinic acetylcholine receptors

Introduction

Worldwide proliferation of harmful cyanobacterial bloomsin continental and coastal waters is of serious environmen-tal and economic concern, because it menaces wildlife andhuman health given the capacity of some cyanobacterialstrains to synthesize potent hepatotoxic and neurotoxicmolecules [1].

Not unlike snake toxins, cyanobacterial neurotoxins alsotarget vital components of neurotransmission, for examplevoltage-gated Na+ channels (VGSC) and cholinergic syn-apses [2, 3]. Saxitoxins, which are among the most toxiccompounds known (i.p. mouse LD50: 5–10 !g kg!1) [4],block sodium permeability through VGSC by reversiblebinding to specific amino acid residues located in the outerpore loops of the channel protein [5], and by this means,inhibit the generation of a proper action potential in nervesand muscle fibres leading to neuromuscular paralysis anddeath by respiratory arrest. Saxitoxins are a group of "20

R. Aráoz (*) : J. MolgóCentre de recherche CNRS de Gif-sur-Yvette,Institut Fédératif de Neurobiologie Alfred Fessard - FRC2118,Laboratoire de Neurobiologie Cellulaire et Moléculaire,FRE 3295, 1 Avenue de la Terrasse,91198 Gif sur Yvette, Francee-mail: araoz@nbcm.cnrs-gif.fr

N. Vilariño : L. M. BotanaDepartamento de Farmacología, Facultad de Veterinaria,Campus Universitario, Universidad de Santiago de Compostela,27002 Lugo, Spain

Anal Bioanal Chem (2010) 397:1695–1704DOI 10.1007/s00216-010-3533-y

structurally related molecules with two guanidinium moie-ties, and are produced both by some dinoflagellate strainsof the genera Alexandrium, Pyrodinium, and Gymnodinium,and by some freshwater cyanobacterial species of thegenera Anabaena, Aphanizomenon, Cylindrospermopsis,and Lyngbya (reviewed elsewhere [2]). The neurotoxinlipopeptides, purified from the marine cyanobacteriumLyngbya majuscula, jamaicamide and kalkitoxin are alsocapable of blocking VGSC [6, 7], and antillatoxin, one ofthe most ichthyotoxic compounds, exceeded only bybrevetoxins, is as an activator of the VGSC [8, 9].

Anatoxin-a and its methylene homologue homoanatoxin-a(Fig. 1), are bicyclic secondary amines that are potent agonistsof the muscular"12#$% and neuronal "4#2 and "7 nicotinicacetylcholine receptors (nAChRs) [10–12]. Anatoxin-a killsmice 2 to 5 min after intraperitoneal injection; death ispreceded by twitching, muscle spasm, paralysis and respira-tory arrest (i.p. mouse LD50: 200 !g kg!1 [13]). Repetitivestimulation of the muscle-type "12#$% nAChR by anatoxin-a causes desensitization of the cholinergic receptor thatultimately leads to the blockade of neuromuscular transmis-sion of the depolarizing type [10, 11]. Cyanobacterialanatoxins are produced by worldwide distributed species ofthe genera Anabaena, Aphanizomenon, Cylindrospermum,Microcystis, Oscillatoria, Phormidium, Planktothrix, andRaphidiopsis [3]. Simultaneous synthesis of anatoxin-a andhomoanatoxin-a was shown in Raphidiopsis mediterraneaSkuja and Oscillatoria PCC 9029 [14, 15]. The structurallyunrelated organophosphate alkaloid anatoxin-a(s) is a potentacetylcholinesterase inhibitor (i.p. mouse LD50: 20 !g kg!1

[16]), that is produced by Anabaena flos-aquae isolate NRC525-17 [17] and A. lemmermannii [18]. Intraperitonealadministration of anatoxin-a(s) to rats causes signs of severecholinergic overstimulation characterized by salivation,lacrimation, urinary incontinence, defecation, convulsion,skeletal muscle fasciculation, and respiratory arrest [16–18].Harmful cyanobacterial blooms containing anatoxin-a [19–22], anatoxin-a(s) [23], or saxitoxin [24] producing cyano-bacteria are associated with the demise of wildlife anddomestic animals.

It was recently revealed that the polyketide synthase genecluster responsible for synthesis of cyanobacterial anatoxins

provided potential molecular tools for detection of bothneurotoxins [25, 26]. Indeed, the primers CGCAAATCGATGCTCACTTA and CCACTGGCTCCATCTTGATTwere proposed for detection, by PCR, of the presence oftoxic Oscillatoria strains producing anatoxin-a and/orhomoanatoxin-a in environmental samples [26].

Long-term monitoring of water reservoirs has shown thatthe composition of the cyanobacterial population changeswith time depending on environmental factors [27–29], andno predictions can be made in order to determine whether atoxic species will dominate a given cyanobacterial bloom ornot. Toxin occurrence needs therefore to be assessed. Thecholinergic synapse is a target of choice for neurotoxins,because nicotinic acetylcholine receptors and acetylcholin-esterase play a central role in regulating cholinergicneurotransmission vital to life (autonomous nervous systemand motor function), and to escape from predation (musclecontraction). This review will focus in the ligand-bindingassays developed for the detection of cyanobacterial andalgal neurotoxins and for the discovery of novel ligandstargeting the nicotinic acetylcholine receptors.

The neuromuscular junction

The skeletal neuromuscular junction is a model ofcholinergic synapses and constitutes a primary target for alarge number of neurotoxins [30, 31]. It is made up of threemain cellular components:

1. the motoneuron nerve terminals,2. the peri-synaptic Schwann cells, and3. a specialized region of skeletal muscle fibres in which

"12#$& or "12#$% nAChR are present.

The neuromuscular junction is specialized for rapidtransmission of information from the pre-synaptic nerveterminal to the post-synaptic muscle fibre. This rapidtransmission requires a very close apposition ("50 nmwidth) of plasmatic membranes of pre and post-synapticpartners, and a strict structural and molecular arrangementon both sides of the narrow synaptic cleft separating nerveterminal and muscle membranes. This fast transmission ismediated by the synchronous release through specializedregions of the nerve terminal membrane (active zones) ofacetylcholine (ACh) quanta from synaptic vesicles [32].Released ACh quanta are known to diffuse rapidly acrossthe narrow synaptic cleft and pairs of ACh moleculescooperate to attach to nAChRs, highly concentrated in thepost-synaptic membrane, and to open endplate channels.During their diffusion through the cleft, or after beingreleased from muscle nAChR, most ACh molecules arehydrolyzed by acetylcholinesterase, that is also highlyconcentrated at the neuromuscular junction [33].

N MeOH

Anatoxin-a

NO MeH

Homoanatoxin-a

NO Me

O

H

Pinnamine

Fig. 1 Chemical structures of cyanobacterial neurotoxic alkaloidsanatoxin-a and homoanatoxin-a, and of pinnamine, a homologue ofanatoxin-a purified from the viscera of the marine bivalve Pinnamuricata [84]

1696 R. Aráoz et al.

Nicotinic acetylcholine receptors

Nicotinic acetylcholine receptors are prototypical cation-selective pentameric transmembrane proteins belonging tothe family of ligand gated ion channels that mediate fastneurotransmission at the neuromuscular junction and at theautonomous nervous system (Fig. 2a). In addition, theyparticipate in fundamental aspects of synaptic plasticityinvolved in attention, learning, memory, and developmentat the central nervous system [34–37]. The discovery thatthe electric organ of Torpedo electric ray expresses "12#$&nAChRs at densities that approach a crystalline arrayenabled biochemical and structural characterization of thesereceptors [38–41]. The Torpedo acetylcholine receptor is alarge glycoprotein complex ("290 kDa) composed of fivemembrane-spanning subunits ("12#$&, Fig. 2b). Genomicstudies revealed a family of 16 structurally homologoussubunits in the human genome closely related to TorpedonAChR subunits [42]. The muscle-type nAChRs are of twotypes in vertebrate mammals: embryonic ("12#$&) ormature ("12#$%) receptor-type [43]. In contrast, neuronalnAChRs show more variability in terms of subunitcomposition [34–37].

Binding of acetylcholine to the ligand-binding sitesrapidly (microseconds) shifts the receptor conformationfrom the resting (closed state) to the open state, initiatingthe ion flux through the cation-selective pore for 2 ms, afterwhich the receptor channel closes (desensitized state).Prolonged exposure to competitive agonist neurotoxins

such as anatoxin-a (Fig. 2c), induces significant desensiti-zation, which stabilizes the nAChR in the closed state thatis unresponsive to agonist [34]. Conversely, the binding ofa competitive antagonist such as methyllycaconitine to theligand-binding site, stabilizes the resting closed state.Further, nAChRs are allosteric proteins with other sitesdifferent from the acetylcholine binding site for interactionwith non-competitive antagonists, activators, and regula-tors, compounds that can induce changes in the quaternarystructure of nAChR provoking the aperture/closure of thechannel pore (Fig. 2a) [41].

Detection methods for anatoxin-a

Physicochemical methods

Since the structural determination of anatoxin-a by Devlinin 1977 [13], a series of physicochemical methods havebeen developed for anatoxin-a detection, and later forhomoanatoxin-a; these include thin-layer chromatography(TLC) [44], high-performance liquid chromatography(HPLC) with UV and fluorescence detection [45], gaschromatography (GC) (Fig. 3a), and liquid chromatography(LC) coupled to mass spectrometry (MS) [46–48], or evencapillary electrophoresis [49]. These methods have beenreviewed elsewhere [50]. LC–MS and capillary electropho-resis methods for simultaneous detection of anatoxin-atogether with other cyanobacterial and algal toxins, which

Fig. 2 Basic structure of nicotinic acetylcholine receptors. (a) Schematicdiagram of the nAChR (axial section). The ion channel permeable toNa+, K+, and Ca2+ is located along the pseudo symmetric axis of themolecule. A, acetylcholine-binding site; B, interaction site for positiveeffectors, Ca2+, and peptides; C, non-competitive blockers binding site;D, interaction with channel blockers; P, regulatory sites for ATP,substance P, and physostigmine. Adapted from Neuron, 21, ChangeuxJP, Edelstein SJ, Allosteric receptors after 30 years, 959–980, Copyright(1998) by Cell Press, with permission from Elsevier. (b) Schematicdiagram of nAChRs (top view) illustrating the pentameric organization

of the muscle-type nAChR. Adapted from Neuron, 21, Changeux JP,Edelstein SJ, Allosteric receptors after 30 years, 959–980, Copyright(1998) by Cell Press, with permission of Elsevier. (c) Structural modelof binding between nAChRs and anatoxin-a. Anatoxin-a is in red, the"-subunit is in dark blue, and the structural #-subunit is in light blue.The yellow Cys–Cys pair usually wraps the toxin at the ligand-bindingsite, as proposed by Albuquerque et al. From Albuquerque et al.(Physiol Rev, 2009, 89:73-120, doi:10.1152/physrev.00015.2008) andused with permission of The American Physiological Society

Ligand-binding assays for cyanobacterial neurotoxins targeting cholinergic receptors 1697

are suitable for the analysis of complex environmentalsamples, have also been developed [49, 51–53]. Thesensitivity of detection ranges from microgram to picogramlevels according to the technique employed, and theprocedures for toxin extraction prior to mass analysis arevariable, which in part reflect the differential resistance ofcyanobacteria to homogenization (Table 1 and Ref. [50]).High-resolution liquid chromatography-tandem mass spec-trometry (LC–MS–MS), and nano-electrospray hybridquadrupole time-of-flight mass spectrometry (QqTOF-MS)provide reliability, sensitivity, selectivity, and structural andquantitative information for analysis of anatoxin-a fromenvironmental samples [51, 54, 55].

Matrix-assisted laser desorption/ionization time of flightmass spectrometry (MALDI-TOF-MS) requires solid sam-ples which are emulsified and mixed with an ultraviolet-absorbing organic matrix. The resulting crystallized mix isbombarded with a laser beam generating gas phase ionswhich are pulsed through the flight tube into the massanalyzer [56]. The application of MALDI-TOF-MS to lowmolecular mass compounds seemed unlikely, because ofsaturation by matrix-ion signals below m/z 500 Da [57].The use of the delayed extraction mode (time lag focusing)and the lowest possible laser intensity providing a signal-to-noise ratio of high quality, together with an appropriatematrix, and matrix–analyte mixing ratio are necessary toinduce a MALDI matrix suppression effect for smallmolecules analysis [57–59]. By carefully tuning MALDI-TOF experimental conditions, anatoxin-a (m/z at 166,Fig. 3b) and homoanatoxin-a (m/z at 180) were detecteddirectly on cyanobacterial filaments in culture, and withminimal sample handling (filament emulsification andmatrix mixing) [60], extending the use of this techniquethat has previously been applied to cyanobacterial typing[61] and to the detection of microcystin (m/z 900 to 1100)and secondary metabolites from cyanobacteria [62, 63].Recently, MALDI-TOF-MS was also applied to thedetection of apratoxin A (m/z at 840) from Lyngbyabouillonii [64].

A further improvement of MALDI-TOF-MS technol-ogy is MALDI imaging mass spectrometry (IMS), apowerful imaging tool that enables the visualization ofthe distribution of a target compound (small drugs orlarge proteins) together with hundreds of other molecularspecies, simultaneously [65, 66]. IMS uses the basicmatrix-assisted laser desorption/ionization process forgeneration of gas-phase ions directly from discrete thintissue sections that have been coated with a MALDIenergy-absorbing matrix. IMS plots the ion intensity as afunction of x and y coordinates on the section to produce

a100 165

136122

75 6894108

15082

50

15082

Mass (m/z)

25

0Rel

ativ

e ab

unda

nce

(%)

00 300 600 900 1200

Scan number

b100 4 4E+4137.0335

b

80

4.4E 4

131 126960

131.1269

138.0392 273.0388155 0344

40

% In

tens

ity

155.0344

20 166.1231274.0393

113 1334

0

113.1334 195.0918177.0163 204.0829 284.2955

150 190 230 270 310Mass (m/z)

110

cECL VISUAL

ANTX 10-10M Ctrl 100%

ANTX 10-10M Ctrl 100%

Ctrl Filter BgTx 10-6 M

Ctr 100% Ctrl FilterCtr 100%

PCC 7515 ANTX 10-5 MPCC 7515

PCC 9240

ANTX 10 M

ANTX 10 6 MPCC 9240 ANTX 10-6 M

PCC 10111 PCC 9240

!Fig. 3 Detection of anatoxin-a. (a) GC chromatogram of a low-molecular-weight extract of the axenic Oscillatoria sp. strain PCC9240. Inset: Electron impact ionization MS of anatoxin-a showing itscharacteristic fragmentation pattern. (b) Detection of anatoxin-a froma low-molecular-weight extract of the axenic Oscillatoria sp. strainPCC 9240 by MALDI-TOF-MS. ([M+H]+ at m/z 166.1231). Matrixions are labelled in grey characters. (c) Non-radioactive ligand-binding assay for detection of anatoxin-a and homoanatoxin-a. Leftpanel: chemiluminescence detection using streptavidin conjugated tohorseradish peroxidase. Right panel: colour detection using streptavi-din conjugated to alkaline phosphatase. Ctrl 100%, slots whereTorpedo membranes were incubated without toxin. Ctrl filter, slotswhere Torpedo membranes were omitted. ANTX, anatoxin-a. BgTx: "-bungarotoxin. PCC 7515, Oscillatoria sancta axenic strain, whichdoes not produce cyanobacterial anatoxins. PCC 1011, OscillatoriaFormosa strain known to produce homoanatoxin-a. A decrease or lackof ECL signals/colour signals compared with Ctrl 100% blotsindicates the presence of cyanobacterial anatoxins

1698 R. Aráoz et al.

an ordered array of mass spectra, each containing nominalm/z values covering a range of over 50,000 Da [66]. IMSis a powerful technique for visualizing the spatialdistribution of cyanotoxins in cultured cyanobacterialfilaments, environmental samples, or forensic samples inorder to confirm the cyanobacterial origin of an analyte.IMS has been applied to differentiation of Lyngbyamajuscula filaments of strains “3 L” and JHB producingcuracin A (m/z at 374) and jamaicamide A (m/z at 511),respectively [64], to visualization of the spatial distribu-tion of secondary metabolites produced by marine cyano-bacteria and sponges [67], and to cyanotoxin discoveryresearch [68].

Competitive ligand-binding methods

Competitive ligand-binding assays are based on thecompetition between an analyte and a labelled ligand forbinding to a receptor [69]. The analyte will displace acertain amount of labelled ligand, which is dependent onthe concentration and the affinity of the analyte towards thereceptor. By keeping constant the concentration of both the

receptor and the labelled ligand, and varying the analyteconcentration, inhibition curves can be constructed. Fromthese curves, the IC50, which represents the analyteconcentration that displaces 50% of the bound labelledligand, can be determined. The IC50 is related to the affinityconstant Ki of the analyte and can be calculated from theCheng–Prusoff equation Ki = IC50/(1 + [ligand]/Kd) [70],where the competition between labelled ligand and analyteis assumed to concern one population of sites, and liganddepletion does not occur because of excess of receptor;[ligand] is the concentration of labelled ligand and Kd is thedissociation constant of the labelled ligand.

Radioactive competitive ligand-binding assays

The unprecedented source of nAChR of muscle-typeprovided by Torpedo electric organ (nAChR="40% oftotal protein) and the discovery of "-bungarotoxin from theBungarus snake venom that binds muscle-type nAChRswith near covalent affinity enabled the development ofcompetitive radioligand-binding assays for the pharmacol-ogy and discovery of novel ligands for nAChR, using

Table 1 Physicochemical and bioanalytical methods developed for anatoxin-a detection

Method Sample LOD Assumed procedure Ref.

TLC Lyophilizedcyanobacteria

5 !g g!1 Homogenization (acidified water) > solventextraction > evaporation > derivatization >TLC > detection

[44]

HPLC–fluorescencedetection

Water (10 mL)Lyophilized cyanobacteria(100 mg)

0.2 ng mL!1 SPE extraction > evaporation > derivatizationHomogenization (acidified methanol) > SPEextraction > evaporation > derivatization > HPLC

[45]

GC–MS Lyophilizedcyanobacteria Water

0.1 ng in column Homogenization (acidified methanol) > SPEextraction disk > solvent extraction for watersamples > derivatization > GC–MS

[46]

TSP-LC–MSa Lyophilized cyanobacteria(100 mg)

500 pg Homogenization (acidified water) > SPE extraction >cation exchange > evaporation > LC–MS

[47]

ESI-LC–MSn b Water 0.6 !g L!1 SPE extraction > evaporation > derivatization [48]Lyophilized cyanobacteria(100 mg)

Homogenization (acidified water) > SPEextraction > LC–(LC–MSn)

Capillary zoneelectrophoresis

Spiked cyanobacterialblooms

1.2 !g mL!1 Freeze-thawing twice > filtration [49]

LC–ESI-TOF-MS Spiked environmentalwater samples (100 mL)

0.5 ng in column C18-SD extraction disk > LC–ESI-TOF-MS [51]

MALDI-TOF-MS Lyophilized cyanobacteria(0.5 !g)

Some filaments Emulsification > cocrystallization with matrix >MALDI-TOF-MS

[60]

Radioactiveligand-binding assay

Lyophilized cyanobacteria(20 mg)

1.7 !g L!1 Homogenization (acidified water) > filtrationMWCO 5000 Da > LBAc>scintillation

[15]

Non-radioactive ligand-binding assay

Lyophilized cyanobacteria(20 mg)

6.1 !g LECL!1 Homogenization (acidified water) > filtration [76]

Water samples 1.5 !g Lcolour!1 MWCO 5000 Da > LBA > ECL/ colour

SPE extraction > evaporation > resuspension >LBA > ECLcolour

a TSP-LC–MS: thermospray-liquid chromatography–mass spectrometryb ESI-LC–MSn : electrospray ionisation-liquid chromatography–multiple tandem mass spectrometryc LBA: ligand-binding assay

Ligand-binding assays for cyanobacterial neurotoxins targeting cholinergic receptors 1699

Torpedo membranes as source of receptors and 125I-"-bungarotoxin as radioactive tracer.

There are two assay formats for analysis of nAChR-radioligand interactions: scintillation proximity assay (SPA)and filtration-based assays. The scintillation proximityassay is based on the emission of light as a result of energytransfer from the #-particle of the radioactive ligand to theSPA bead that contains a scintillant. For energy transfer tooccur, the radioactive ligand and the SPA-bead must be inclose proximity ("10 !m), if not, the energy of theradioactive ligand is absorbed by the buffer (Fig. 4a). Inscintillation proximity assays, nAChR are allowed tointeract with SPA-beads (i.e. through wheat germ

agglutinin-coated polyvinyltoluene–SPA beads [71, 72]).The test compound, radioligand, nAChRs and SPA beadsare incubated in a 96-well plate. The proximity between thebound radioligand and the SPA beads enhances scintillationthat is recorded by a microplate scintillation counter. SPAassays do not require separation of free and bound radio-ligand, and therefore are amenable for high-throughputscreening applications [72].

Filtration assay is the most widely used format forradioligand-binding assay. Following incubation of Torpedomembranes with the test compound and radioligand dis-placement, Torpedo membranes and bound radioligand areadsorbed on to a glass fibre membrane by filtration.Unbound radioligand is removed by successive washingsteps. Scintillation counting is performed from dried filters(Fig. 4b). The high affinity of anatoxin-a and homoanatoxin-a for nAChR was exploited to adapt the radioligand-bindingassay for routine detection of this class of neurotoxinsdirectly in low-molecular-mass cell extracts of axeniccyanobacteria in a 100 !L volume reaction mixture [15].By using Torpedo electrocyte membranes and 125I-"-bungarotoxin as tracer, analysis of 76 axenic strains ofcyanobacteria led to the discovery that five Oscillatoriastrains, which were unknown for their toxicity, inhibited 125I-"-bungarotoxin binding. The presence of anatoxin-a andhomoanatoxin-a or the simultaneous production of bothneurotoxins by Oscillatoria strains was confirmed by GC–MS (Fig. 3a) [15].

Another breakthrough in the understanding of nicotinicacetylcholine receptors was the discovery and structuraldetermination of a homologue of the extracellular domainof nAChR, namely the acetylcholine binding protein(AChBP), secreted by glial cells in the molluscs (Aplysiaand Lymnaea) [73]. These proteins form homopentamericstructures homologous to the NH2-terminal domain ofnAChR, that is, the ligand binding domain of Cys-loopreceptors [74]. Because it is known that AChBP most closely

a

Unbound radioligand

[125I]-ligand

Bound radioligand

light

[125I]-ligand

c

Filtration Visual detection

ECL Color

d

Po

lariz

atio

n

Po

lari

ze

d l

igh

t e

xc

ita

tio

n

b

Filtration Gamma counter

!Fig. 4 Ligand-binding assay formats. (a) Scintillation proximity assay.SPA assays do not require separation of free and bound radioligand. Thetest compound, radioligand, receptor, and SPA beads are incubated andscintillation is measured. The proximity of the radioligand and SPAbead excites the scintillant. The # particles emitted by the unboundradioligand are dissipated in the medium. (b) Filter assays requireseparation of free and bound radioligand for radioactive recording. (c)Non-radioactive ligand-binding filter assay: Simultaneous ECL/colourdetection of inhibition of "-bungarotoxin biotin-XX conjugate bindingto Torpedo electrocyte nAChR-membranes by anatoxin-a, "-bungar-otoxin, and extracts of axenic cyanobacteria. See Fig. 3c for details. (d)Fluorescence polarization assay in competitive receptor-binding assay.A fluorophore excited by plane polarized light emits fluorescence in thesame polarized plane as that of the exciting light whenever it remainsstationary throughout the excited state. Small fluorophore dyes tumblerapidly and are randomly oriented during excitation with the polarizedlight, so fluorescence emission is low. Binding of the fluorophore to areceptor slows the fluorophore’s rotation. Emitted light remains highlypolarized

1700 R. Aráoz et al.

resemble the ligand binding domain of "7 nAChR, compe-tition binding assays were performed with His-tagged Aplysiacalifornica-AChBP or Lymnaea stagnalis-AChBP as surro-gates for "7 nAChR, and 125I-"-bungarotoxin or 3H-epibatidine as tracers, for screening and discovery of novelligands of "7 nAChR [75].

Non-radioactive competitive ligand-binding assays

In order to circumvent problems inherent in the use ofradioactivity (safety, radioisotope decay, and cost issues)a non-radioactive method for visual detection ofanatoxin-a and homoanatoxin-a was developed [76].The non-radioactive receptor ligand-binding assay is basedon:

1. the use of Torpedo electrocyte membranes rich in"12#$& nAChR,

2. the high affinity of cyanobacterial anatoxins fornAChRs, and

3. the use of "-bungarotoxin biotin-XX conjugate astracer.

Following incubation of Torpedo electrocyte membraneswith purified toxins, cyanobacterial cell extracts, fieldcyanobacterial blooms, or aqueous samples, TorpedonAChRs and bound labelled "-bungarotoxin are immobi-lized on a glass fibre membrane using a 48-well Slot-Blotdevice (Figs. 3c and 4c). After washing steps to removefree labelled "-bungarotoxin, the detection of cyanobacte-rial anatoxins is performed either by chemiluminescence(using streptavidin conjugated to horseradish peroxidase),or by colour precipitation (using streptavidin conjugated toalkaline phosphatase, Figs. 3c and 4c). The binding ofcyanobacterial anatoxins to nAChRs prevents furtherbinding of labelled "-bungarotoxin in a concentration-dependent manner. The IC50 values for anatoxin-a inhibi-tion of "-bungarotoxin binding to Torpedo nAChRassessed by radioactive or non-radioactive ligand-bindingassays are fairly similar with overlapping 95% confidenceintervals. These findings indicate that the non-radioactiveligand-binding assay could be used instead of the 125I-"-bungarotoxin-based binding assay for anatoxin-a detectionwithout loss of sensitivity, and with the advantage that noradioactive waste is generated [76].

Fluorescence polarization is a non-radioactive ligand-binding assay that could be applied to detection ofcyanobacterial anatoxins (Fig. 4d). Using Torpedo electro-cyte membranes and "-bungarotoxin Alexa Fluor 488conjugate, a fluorescence polarization assay was developedto detect and quantify gymnodimine-A and 13-desmethyl Cspirolide [77]. These phycotoxins are emergent dinoflagel-late toxins highly toxic to mice that are known for beingpotent antagonists of nAChR (i.p. LD50: 80 !g kg!1

gymnodimine-A; i.p. LD50: 40 !g kg!1 13-desmethyl Cspirolide) [77, 78]. The presence of nanomolar concen-trations of these cyclic imines in solution inhibits thebinding of fluorescent "-bungarotoxin to nAChR in aconcentration-dependent manner. Okadaic acid, yessotoxin,and brevetoxin-2, three lipophilic marine toxins, did notinterfere with this assay [77]. The matrix effect of mussels,clams, cockles, and scallops on the competitive fluores-cence polarization assay was also assessed [79]. Theinterference of these shellfish extracts with the fluorophore,or its binding to nAChRs, was lower than 11%. Conse-quently, this assay format can be used to detect gymnodi-mine and 13-desmethyl C spirolide in shellfish as ascreening assay, and may also be suitable for the surveyof neurotoxic cyanobacteria interacting with nAChRs.

Membrane potential fluorescence is a functional assaythat can detect agonist and antagonist molecules for thenAChR. This method is based on the use of transfected celllines expressing various nAChRs subtypes and a membranepotential-sensitive fluorescent dye. The cells, grown in96-well plates, are incubated with a membrane potentialdye solution after which basal fluorescence is recorded,followed by the sequential addition of a test compound (toassess agonist activity), of a reference agonist such asnicotine (to assess antagonist activity of the test com-pound), and, last, addition of a KCl solution to normalizefor dye load and cell count [80, 81]. Fluorescence ismeasured after each step using a fluorescence plate reader.The response is calculated as the ratio of the fluorescenceincrease produced by the test compound to that producedby a given KCl concentration. Membrane potential fluores-cence should prove a valuable tool for characterizingnicotinic receptor function and for high-throughput screen-ing of novel nicotinic agents.

Concluding remarks

Liquid chromatography coupled with high-resolution massspectrometric techniques, or MALDI-TOF based techni-ques both provide accuracy, precision, selectivity, sensitiv-ity, reproducibility, adequate limit of detection, andstructural and quantitative information for analysis ofanatoxin-a from environmental samples. However, thesemethods will only detect known toxins for which toxinstandards are available. Besides, given the sophistication ofmass spectrometry-based methods, their application forroutine detection of cyanobacterial anatoxins in freshwaterreservoirs may be very expensive.

Ligand-binding assays are rapid and relatively simple toperform, and do not require highly specialized laboratorypersonnel or expensive equipment. However, these methodsfail to distinguish the chemical entity of the tested

Ligand-binding assays for cyanobacterial neurotoxins targeting cholinergic receptors 1701

compound. Nicotinic acetylcholine receptor-based assays,using Torpedo electrocyte membranes or transfected cells,are functional methods that are based on the mechanism ofaction of anatoxin-a/ homoanatoxin-a, providing high-throughput formats for routine detection of this class ofneurotoxins.

The mouse bioassay is still the standard method formarine biotoxin monitoring in Europe (CD 86-609-eec), butmust be replaced because of ethical concerns and forreasons of specificity. It is known that marine molluscs thatfilter-feed on dinoflagellates and marine cyanobacteria areable to bioaccumulate a series of toxic compounds [78, 82,83]. A novel alkaloid compound named pinnamine (Fig. 1)was purified from the viscera of the Okinawan bivalvePinna muricata using mouse bioassay to monitor toxinpurification. Astonishingly, this bicyclic secondary amine ischemically related to anatoxin-a and of similar toxicity (i.p.mouse, LD99=0.5 mg kg!1 [84]). The development ofnovel functional assays for neurotoxin discovery is encour-aged to replace the mouse bioassay (CD 86-609-eec).Receptor-based assays are suitable tools for screening anddiscovering novel compounds.

Cyanobacteria constitute an important source of newbioactive molecules. The discovery of novel compoundsand the elucidation of their molecular mechanisms of actionmay be extremely useful for developing front-line drugs forneurodegenerative diseases related to neuronal nAChRs. Aproper approach for the discovery of cyanobacterial neuro-toxins targeting cholinergic receptors may be a combinationof functional assays which provide fast and inexpensiveinformation about sample toxicity, and a physicochemicalmethod that provides chemical identification of the analyte.

Acknowledgments The research in the authors laboratories has beenfunded by research grants from the Agence Nationale de la Recherche(ANR ARISTOCYA, CESA 01507), the EU VIIth Frame Program,211326-CP (CONffIDENCE, to L.M.B.) and STC-CP2008-1-555612(ATLANTOX to L.M.B. and J.M.), and by the Pasteur Institute (PTR2000/25 to Michael Herdman).

References

1. Sivonen K, Jones G (1999) In: Chorus I, Bartram J (eds)Cyanobacterial toxins, 1st edn. F & FN Spon, London

2. Llewellyn LE (2006) Saxitoxin, a toxic marine natural productthat targets a multitude of receptors. Nat Prod Rep 23(2):200–222

3. Aráoz R, Molgó J, Tandeau de Marsac N (2009) Neurotoxiccyanobacterial toxins. Toxicon. doi:10.1016/j.toxicon.2009.07.036

4. Schantz EJ, Ghazarossian VE, Schnoes HK, Strong FM, SpringerJP, Pezzanite JO, Clardy J (1975) Structure of saxitoxin. J AmChem Soc 97:1238–1239

5. Bricelj VM, Connell L, Konoki K, MacQuarrie SP, Scheuer T,Catterall WA, Trainer VL (2005) Sodium channel mutationleading to saxitoxin resistance in clams increases risk of PSP.Nature 434:763–767

6. Edwards DJ, Marquez BL, Nogle LM, McPhail K, Goeger DE,Roberts MA, Gerwick WH (2004) Structure and biosynthesis of thejamaicamides, new mixed polyketide-peptide neurotoxins from themarine cyanobacterium Lyngbya majuscula. Chem Biol 11:817–833

7. Wu M, Okino T, Nogle LM, Marquez BL, Williamson RT,Sitachitta N, Berman FW, Murray TF, McGough K, Jacobs R,Colsen K, Asano T, Yokokawa F, Shioiri T, Gerwick WH (2000)Structure, synthesis, and biological properties of kalkitoxin, anovel neurotoxin from the marine cyanobacterium Lyngbyamajuscula. J Am Chem Soc 122:12041–12042

8. Orjala J, Nagle DG, Hsu VL, Gerwick WH (1995) Antillatoxin- an exceptionally ichthyotoxic cyclic lipopeptide from thetropical cyanobacterium Lyngbya-Majuscula. J Am Chem Soc117:8281–8282

9. Li WI, Berman FW, Okino T, Yokokawa F, Shioiri T, GerwickWH, Murray TF (2001) Antillatoxin is a marine cyanobacterialtoxin that potently activates voltage-gated sodium channels. ProcNatl Acad Sci USA 98:7599–7604

10. Spivak CE, Witkop B, Albuquerque EX (1980) Anatoxin-a - anovel, potent agonist at the nicotinic receptor. Mol Pharmacol18:384–394

11. Thomas P, Stephens M, Wilkie G, Amar M, Lunt GG, Whiting P,Gallagher T, Pereira E, Alkondon M, Albuquerque EX, WonnacottS (1993) (+)-Anatoxin-a is a potent agonist at neuronal nicotinicacetylcholine-receptors. J Neurochem 60:2308–2311

12. Amar M, Thomas P, Johnson C, Lunt GG, Wonnacott S (1993)Agonist pharmacology of the neuronal alpha-7 nicotinic receptorexpressed in Xenopus-oocytes. FEBS Lett 327:284–288

13. Devlin JP, Edwards OE, Gorham PR, Hunter NR, Pike RK,Stavric B (1977) Anatoxin-a, a toxic alkaloid from Anabaena-Flos-Aquae Nrc-44 h. Can J Chem-Rev Can Chim 55:1367–1371

14. Namikoshi M, Murakami T, Watanabe MF, Oda T, Yamada J,Tsujimura S, Nagai H, Oishi S (2003) Simultaneous production ofhomoanatoxin-a, anatoxin-a, and a new non-toxic 4-hydroxyhomoanatoxin-a by the cyanobacterium Raphidiopsismediterranea Skuja. Toxicon 425:33–538

15. Aráoz R, Nghiem HO, Rippka R, Palibroda N, Tandeau de MarsacN, Herdman M (2005) Neurotoxins in axenic oscillatoriancyanobacteria: coexistence of anatoxin-alpha and homoanatoxin-alpha determined by ligand-binding assay and GC/MS.Microbiology-(UK) 151:1263–1273

16. Mahmood NA, Carmichael WW (1986) The Pharmacology ofanatoxin-a(s), a neurotoxin produced by the fresh-water cyanobac-terium Anabaena-Flos-Aquae Nrc 525-17. Toxicon 24:425–434

17. Mahmood NA, Carmichael WW, Pfahler D (1988) Anticholines-terase poisonings in dogs from a cyanobacterial (blue-green-algae)bloom dominated by Anabaena-Flos-Aquae. Am J Vet Res49:500–503

18. Onodera H, Oshima Y, Henriksen P, Yasumoto T (1997)Confirmation of anatoxin-a(s), in the cyanobacterium Anabaenalemmermannii, as the cause of bird kills in Danish lakes. Toxicon35:1645–1648

19. Wood SA, Selwood AI, Rueckert A, Holland PT, Milne JR, SmithKF, Smits B, Watts LF, Cary CS (2007) First report ofhomoanatoxin-a and associated dog neurotoxicosis in NewZealand. Toxicon 50:292–301

20. Gugger M, Lenoir S, Berger C, Ledreux A, Druart JC, Humbert JF,Guette C, Bernard C (2005) First report in a river in France of thebenthic cyanobacterium Phormidium favosum producing anatoxin-aassociated with dog neurotoxicosis. Toxicon 45:919–928

21. Edwards C, Beattie KA, Scrimgeour CM, Codd GA (1992)Identification of anatoxin-a in benthic cyanobacteria (blue-green-algae) and in associated dog poisonings at Loch Insh, Scotland.Toxicon 30:1165–1175

22. Krienitz L, Ballot A, Kotut K, Wiegand C, Putz S, Metcalf JS,Codd GA, Pflugmacher S (2003) Contribution of hot spring

1702 R. Aráoz et al.

cyanobacteria to the mysterious deaths of Lesser Flamingos atLake Bogoria, Kenya. FEMS Microbiol Ecol 43:141–148

23. Henriksen P, Carmichael WW, An JS, Moestrup O (1997)Detection of an anatoxin-a(s)-like anticholinesterase in naturalblooms and cultures of cyanobacteria/blue-green algae fromDanish lakes and in the stomach contents of poisoned birds.Toxicon 35:901–913

24. Negri AP, Jones GJ, Hindmarsh M (1995) Sheep mortalityassociated with paralytic shellfish poisons from the cyanobacte-rium Anabaena-Circinalis. Toxicon 33:1321–1329

25. Méjean A, Mann S, Maldiney T, Vassiliadis G, Lequin O, Ploux O(2009) Evidence that biosynthesis of the neurotoxic alkaloidsanatoxin-a and homoanatoxin-a in the cyanobacterium Oscillato-ria PCC 6506 occurs on a modular polyketide synthase initiatedby L-proline. J Am Chem Soc 131:7512–7513

26. Cadel-Six S, Iteman I, Peyraud-Thomas C, Mann S, Ploux O,Méjean A (2009) Identification of a polyketide synthase codingsequence specific for anatoxin-a-producing Oscillatoria cyano-bacteria. Appl Environ Microbiol 75:4909–4912

27. Baker JA, Entsch B, Neilan BA, McKay DB (2002) Monitoringchanging toxigenicity of a cyanobacterial bloom by molecularmethods. App Environ Microbiol 68:6070–6076

28. Havens KE, James RT, East TL, Smith VH (2003) N: P ratios,light limitation, and cyanobacterial dominance in a subtropicallake impacted by non-point source nutrient pollution. EnvironPollut 122:379–390

29. Briand E, Escoffier N, Straub C, Sabart M, Quiblier C, HumbertJF (2009) Spatiotemporal changes in the genetic diversity of abloom-forming Microcystis aeruginosa (cyanobacteria) popula-tion. ISME J 3:419–429

30. Molgó J, Meunier FA, Colasante C, Poulain B (1997) In: Bittar E,Festoff BW, Hantaï D, Citron BA (eds) Marine toxins affectingquantal acetylcholine release and transmission at the vertebrateneuromuscular junction, 1st edn. JAI Press Ltd, London

31. Meunier FA, Schiavo G, Molgó J (2002) Botulinum neurotoxins:from paralysis to recovery of functional neuromuscular transmis-sion. J Physiol-Paris 96:105–113

32. Van der Kloot W, Molgó J (1994) Quantal acetylcholine release atthe vertebrate neuromuscular junction. Physiol Rev 74:899–991

33. Feng G, Krejci E, Molgó J, Cunningham JM, Massoulié J, SanesJR (1999) Genetic analysis of collagen Q: roles in acetylcholin-esterase and butyrylcholinesterase assembly and in synapticstructure and function. J Cell Biol 144:1349–1360

34. Albuquerque EX, Pereira EFR, Alkondon M, Rogers SW (2009)Mammalian nicotinic acetylcholine receptors: from structure tofunction. Physiol Rev 89:73–120

35. Corringer PJ, Le Novere N, Changeux JP (2000) Nicotinic receptorsat the amino acid level. Annu Rev Pharmacol Toxicol 40:431–458

36. Dani JA, Bertrand D (2007) Nicotinic acetylcholine receptors andnicotinic cholinergic mechanisms of the central nervous system.Annu Rev Pharmacol Toxicol 47:699–729

37. Dutertre S, Lewis RJ (2006) Toxin insights into nicotinicacetylcholine receptors. Biochem Pharmacol 72:661–670

38. Miyazawa A, Fujiyoshi Y, Stowell M, Unwin N (1999) Nicotinicacetylcholine receptor at 4.6 angstrom resolution: Transversetunnels in the channel wall. J Mol Biol 288:765–786

39. Unwin N (2005) Refined structure of the nicotinic acetylcholinereceptor at 4 angstrom resolution. J Mol Biol 346:967–989

40. Unwin N (1993) Nicotinic Acetylcholine-Receptor at 9-AngstromResolution. J Mol Biol 229:1101–1124

41. Changeux JP, Edelstein SJ (1998) Allosteric receptors after30 years. Neuron 21:959–980

42. Karlin A (2002) Emerging structure of the nicotinic acetylcholinereceptors. Nat Rev Neurosci 3:102–114

43. Mishina M, Takai T, Imoto K, Noda M, Takahashi T, Numa S,Methfessel C, Sakmann B (1986) Molecular distinction between

fetal and adult forms of muscle acetylcholine-receptor. Nature321:406–411

44. Pelander A, Ojanpera I, Sivonen K, Himberg K, Waris M,Niinivaara K, Vuori E (1996) Screening for cyanobacterial toxinsin bloom and strain samples by thin layer chromatography. WaterRes 30:1464–1470

45. James KJ, Sherlock IR, Stack MA (1997) Anatoxin-a in Irishfreshwater and cyanobacteria, determined using a new fluorimet-ric liquid chromatographic method. Toxicon 35:963–971

46. Himberg K (1989) Determination of anatoxin-a, the neurotoxin ofAnabaena-flos-aquae cyanobacterium, in algae and water by gas-chromatography mass-spectrometry. J Chromatogr A 481:358–362

47. Harada K, Nagai H, Kimura Y, Suzuki M, Park HD, WatanabeMF, Luukkainen R, Sivonen K, Carmichael WW (1993) Liquid-chromatography mass-spectrometric detection of anatoxin-a, aneurotoxin from cyanobacteria. Tetrahedron 49:9251–9260

48. Furey A, Crowley J, Lehane M, James KJ (2003) Liquidchromatography with electrospray ion-trap mass spectrometryfor the determination of anatoxins in cyanobacteria and drinkingwater. Rapid Commun Mass Spectrom 17:583–588

49. Vasas G, Gaspar A, Pager C, Suranyi G, Mathe C, Hamvas MM,Borbely G (2004) Analysis of cyanobacterial toxins (anatoxin-a,cylindrospermopsin, microcystin-LR) by capillary electrophoresis.Electrophoresis 25:108–115

50. Osswald J, Rellan S, Gago A, Vasconcelos V (2007) Toxicologyand detection methods of the alkaloid neurotoxin produced bycyanobacteria, anatoxin-a. Environ Int 33:1070–1089

51. Maizels M, Budde WL (2004) A LC/MS method for the determina-tion of cyanobacteria toxins in water. Anal Chem 76:1342–1351

52. Dahlmann J, Budakowski WR, Luckas B (2003) Liquidchromatography-electrospray ionisation-mass spectrometry basedmethod for the simultaneous determination of algal and cyano-bacterial toxins in phytoplankton from marine waters and lakesfollowed by tentative structural elucidation of microcystins. JChromatogr A 994:45–57

53. Heldman CJ, Krick WR, Perkins DAK, Harrahy EA, SonzogniWC (2008) New measurements of cyanobacterial toxins in naturalwaters using high performance liquid chromatography coupled totandem mass spectrometry. J Environ Qual 37:1817–1824

54. James KJ, Crowley J, Hamilton B, Lehane M, Skulberg O,Furey A (2005) Anatoxins and degradation products, deter-mined using hybrid quadrupole time-of-flight and quadrupoleion-trap mass spectrometry: forensic investigations of cyano-bacterial neurotoxin poisoning. Rapid Commun Mass Spectrom19:1167–1175

55. Furey A, Crowley J, Shuilleabhain AN, Skulberg AM, James KJ(2003) The first identification of the rare cyanobacterial toxin,homoanatoxin-a, in Ireland. Toxicon 41:297–303

56. Hillenkamp F, Karas M, Beavis RC, Chait BT (1991) Matrix-assisted laser desorption ionization mass-spectrometry of biopol-ymers. Anal Chem 63:A1193–A1202

57. Cohen L, Go EP, Siuzdak K (2007) In: Hillenkamp F, Peter-Katalini!J (eds) Small-molecule desorption/ionization mass analysis, 1st edn.Wiley–VCH, Weinheim

58. Lidgard R, Duncan MW (1995) Utility of matrix-assisted laser-desorption ionization time-of-flight mass-spectrometry for theanalysis of low-molecular-weight compounds. Rapid CommunMass Spectrom 9:128–132

59. McCombie G, Knochenmuss R (2004) Small-molecule MALDIusing the matrix suppression effect to reduce or eliminate matrixbackground interferences. Anal Chem 76:4990–4997

60. Aráoz R, Guérineau V, Rippka R, Palibroda N, Herdman M,Laprevote O, von Dohren H, Tandeau de Marsac N, Erhard M(2008) MALDI-TOF-MS detection of the low molecular weightneurotoxins anatoxin-a and homoanatoxin-a on lyophilized and freshfilaments of axenic Oscillatoria strains. Toxicon 51:1308–1315

Ligand-binding assays for cyanobacterial neurotoxins targeting cholinergic receptors 1703

61. Erhard M, vonDohren H, Jungblut P (1997) Rapid typing andelucidation of new secondary metabolites of intact cyanobacteriausing MALDI-TOF mass spectrometry. Nat Biotechnol 15:906–909

62. Fastner J, Erhard M, von Dohren H (2001) Determination ofoligopeptide diversity within a natural population of Microcystisspp. (Cyanobacteria) by typing single colonies by matrix-assistedlaser desorption ionization-time of flight mass spectrometry. ApplEnviron Microbiol 67:5069–5076

63. Welker M, Fastner J, Erhard M, von Dohren H (2002)Applications of MALDI-TOF MS analysis in cyanotoxin re-search. Environ Toxicol 17:367–374

64. Simmons TL, Coates RC, Clark BR, Engene N, Gonzalez D,Esquenazi E, Dorrestein PC, Gerwick WH (2008) Biosyntheticorigin of natural products isolated from marine microorganism-invertebrate assemblages. Proc Natl Acad Sci USA 105:4587–4594

65. Cornett DS, Reyzer ML, Chaurand P, Caprioli RM (2007)MALDI imaging mass spectrometry: molecular snapshots ofbiochemical systems. Nat Methods 4:828–833

66. Caprioli RM, Farmer TB, Gile J (1997) Molecular imaging ofbiological samples: Localization of peptides and proteins usingMALDI-TOF MS. Anal Chem 69:4751–4760

67. Esquenazi E, Coates C, Simmons L, Gonzalez D, Gerwick WH,Dorrestein PC (2008) Visualizing the spatial distribution ofsecondary metabolites produced by marine cyanobacteria andsponges via MALDI-TOF imaging. Mol Biosyst 4:562–570

68. Taniguchi M, Nunnery JK, Engene N, Esquenazi E, Byrum T,Dorrestein PC, Gerwick WH (2009) Palmyramide A, a cyclicdepsipeptide from a Palmyra Atoll Collection of the marinecyanobacterium Lyngbya majuscula (dagger). J Nat Prod.doi:10.1021/np900428h

69. De Jong LAA, Uges DRA, Franke JP, Bischoff R (2005)Receptor-ligand binding assays: Technologies and applications. JChromatogr B 829:1–25

70. Cheng Y, Prusoff WH (1973) Relationship between inhibitionconstant (K1) and concentration of inhibitor which causes 50 percent inhibition (I50) of an enzymatic reaction. Biochem Pharmacol22:3099–3108

71. Patel AB, Malpass JR (2008) Potential nicotinic acetylcholinereceptor ligands from 2, 4-methanoproline derivatives. J Med Chem51:7005–7009

72. Hui X, Gao J, Xie X, Suto N, Ogiku T, Wang MW (2005) Arobust homogeneous binding assay for alpha 4 beta 2 nicotinicacetylcholine receptor. Acta Pharmacol Sin 26:1175–1180

73. Smit AB, Syed NI, Schaap D, van Minnen J, Klumperman J, KitsKS, Lodder H, van der Schors RC, van Elk R, Sorgedrager B,Brejc K, Sixma TK, Geraerts WPM (2001) A glia-derived

acetylcholine-binding protein that modulates synaptic transmis-sion. Nature 411:261–268

74. Brejc K, van Dijk WJ, Klaassen RV, Schuurmans M, van der OostJ, Smit AB, Sixma TK (2001) Crystal structure of an ACh-bindingprotein reveals the ligand-binding domain of nicotinic receptors.Nature 411:269–276

75. Ulens C, Akdemir A, Jongejan A, van Elk R, Bertrand S, PerrakisA, Leurs R, Smit AB, Sixma TK, Bertrand D, de Esch IJP (2009)Use of acetylcholine binding protein in the search for novel alpha7 nicotinic receptor ligands. In silico docking, pharmacologicalscreening, and X-ray analysis. J Med Chem 52:2372–2383

76. Aráoz R, Herdman M, Rippka R, Ledreux A, Molgó J, ChangeuxJP, Tandeau de Marsac N, Nghiem HO (2008) A non-radioactiveligand-binding assay for detection of cyanobacterial anatoxinsusing Torpedo electrocyte membranes. Toxicon 52:163–174

77. Vilariño N, Fonfria ES, Molgó J, Aráoz R, Botana LM (2009)Detection of gymnodimine-A and 13-desmethyl C spirolidephycotoxins by fluorescence polarization. Anal Chem 81:2708–2714

78. Kharrat R, Servent D, Girard E, Ouanounou G, Amar M, MarrouchiR, Benoit E, Molgó J (2008) The marine phycotoxin gymnodiminetargets muscular and neuronal nicotinic acetylcholine receptorsubtypes with high affinity. J Neurochem 107:952–963

79. Fonfria ES, Vilariño N, Espiña B, Louzao MC, Álvarez M, MolgóJ, Aráoz R, Botana LM (2009) Feasibility of gymnodimine and13-desmethyl C spirolide detection by fluorescence polarizationusing a receptor-based assay in shellfish matrixes. Anal ChimActa 657:75–82

80. Fitch RW, Xiao YX, Kellar KJ, Daly JW (2003) Membranepotential fluorescence: A rapid and highly sensitive assay fornicotinic receptor channel function. Proc Natl Acad Sci USA100:4909–4914

81. Fitch RW, Garraffo HM, Spande TF, Yeh HJC, Daly JW (2003)Bioassay-guided isolation of epiquinamide, a novel quinolizidinealkaloid and nicotinic agonist from an Ecuadoran poison frog,Epipedobates tricolor. J Nat Prod 66:1345–1350

82. Molgó J, Girard E, Benoit E (2007) In: Botana LM (ed) Cyclicimines: an insight into this emerging group of bioactive marinetoxins, 1st edn. Iowa, Blackwell Publishing Ltd

83. Laurent D, Kerbrat AS, Darius HT, Girard E, Golubic S, Benoit E,Sauviat MP, Chinain M, Molgó J, Pauillac S (2008) Arecyanobacteria involved in ciguatera fish poisoning-like outbreaksin New Caledonia? Harmful Algae 7:827–838

84. Takada N, Iwatsuki M, Suenaga K, Uemura D (2000) Pinnamine,an alkaloidal marine toxin, isolated from Pinna muricata.Tetrahedron Lett 41:6425–6428

1704 R. Aráoz et al.