Katanin p80 Regulates Human Cortical Development by Limiting Centriole and Cilia Number

Neuron

Article

Katanin p80 Regulates Human Cortical Developmentby Limiting Centriole and Cilia NumberWen F. Hu,1,2,3,5,6 Oz Pomp,19 Tawfeg Ben-Omran,12 Andrew Kodani,18 Katrin Henke,4,9 Ganeshwaran H. Mochida,1,2,7,10

Timothy W. Yu,1,7,11 Mollie B. Woodworth,1,2,3,7 Carine Bonnard,19 Grace Selva Raj,19 Thong Teck Tan,19

Hanan Hamamy,21 Amira Masri,23 Mohammad Shboul,19 Muna Al Saffar,1,2,13 Jennifer N. Partlow,1,2,3

Mohammed Al-Dosari,17 Anas Alazami,14 Mohammed Alowain,15,16 Fowzan S. Alkuraya,14,16 Jeremy F. Reiter,18

Matthew P. Harris,4,9,24,* Bruno Reversade,19,20,22,24,* and Christopher A. Walsh1,2,3,5,6,7,8,24,*1Division of Genetics and Genomics, Department of Medicine2Manton Center for Orphan Disease Research3Howard Hughes Medical Institute4Department of Orthopedic Research

Boston Children’s Hospital, Boston, MA 02115, USA5Program in Neuroscience6Harvard MD-PhD MSTP Program7Department of Pediatrics8Department of Neurology9Department of GeneticsHarvard Medical School, Boston, MA 02115, USA10Pediatric Neurology Unit, Department of Neurology, Massachusetts General Hospital, Boston, MA 02114, USA11Program in Medical and Population Genetics, Broad Institute of MIT and Harvard University, Cambridge, MA 02142, USA12Clinical and Metabolic Genetics Division, Department of Pediatrics, Hamad Medical Corporation, Doha, 3050, Qatar13Department of Pediatrics, Faculty of Medicine and Health Sciences, United Arab Emirates University, Al-Ain, United Arab Emirates14Department of Genetics15Department of Medical Genetics

King Faisal Specialist Hospital and Research Centre, Riyadh 11211, Saudi Arabia16Department of Anatomy and Cell Biology, College of Medicine, Alfaisal University, Riyadh 11533, Saudi Arabia17Department of Pharmacognosy, College of Pharmacy, King Saud University, Riyadh 11451, Saudi Arabia18Department of Biochemistry and Biophysics, Cardiovascular Research Institute, University of California, San Francisco, San Francisco,

CA 94158, USA19Institute of Medical Biology, Human Genetics and Embryology Laboratory20Institute of Molecular and Cellular Biology

A*STAR, Singapore 138648, Singapore21Department of Genetic Medicine and Development, Geneva University, Geneva 1211, Switzerland22Department of Paediatrics, National University of Singapore, Singapore 119260, Singapore23Department of Paediatrics, Faculty of Medicine, University of Jordan, Amman, 11942, Jordan24Co-senior author*Correspondence: [email protected] (M.P.H.), [email protected] (B.R.),

[email protected] (C.A.W.)

http://dx.doi.org/10.1016/j.neuron.2014.12.017

SUMMARY

Katanin is a microtubule-severing complex whosecatalytic activities are well characterized, but whosein vivo functions are incompletely understood.Human mutations in KATNB1, which encodes thenoncatalytic regulatory p80 subunit of katanin,cause severe microlissencephaly. Loss of Katnb1in mice confirms essential roles in neurogenesisand cell survival, while loss of zebrafish katnb1reveals specific roles for katnin p80 in early andlate developmental stages. Surprisingly, Katnb1null mutant mouse embryos display hallmarks ofaberrant Sonic hedgehog signaling, including holo-prosencephaly. KATNB1-deficient human cellsshow defective proliferation and spindle structure,

1240 Neuron 84, 1240–1257, December 17, 2014 ª2014 Elsevier Inc

while Katnb1 null fibroblasts also demonstrate aremarkable excess of centrioles, with supernumer-ary cilia but deficient Hedgehog signaling. Ourresults reveal unexpected functions for KATNB1in regulating overall centriole, mother centriole,and cilia number, and as an essential gene fornormal Hedgehog signaling during neocorticaldevelopment.

INTRODUCTION

Although human genetics has identified essential roles for many

centriole- and cilia-related proteins during human develop-

ment, the functional relationships between these two crucial or-

ganelles are less well understood. Mutations in genes encoding

centrosomal proteins cause a wide range of syndromes, notably

.

mailto:[email protected]




http://crossmark.crossref.org/dialog/?doi=10.1016/j.neuron.2014.12.017&domain=pdf

Neuron

Katanin p80 Limits Centriole and Cilia Number

microcephaly, which is characterized by reduced brain size with

or without other features, such as reduced somatic size. Micro-

cephaly-associated mutations in genes encoding centrosomal

and pericentriolar proteins, including MCPH1, CDK5RAP2,

ASPM, CENPJ, WDR62, CEP152, CASC5, STIL, CEP135,

CEP63, NIN, PCNT, and POC1A, implicate a centrosomal

pathway important during human neurogenesis (Hu et al.,

2014; Mahmood et al., 2011; Thornton and Woods, 2009). How-

ever, cellular mechanisms by which centrioles control neurogen-

esis are still unclear.

A second class of diseases, broadly termed ‘‘ciliopathies,’’

manifest with a range of features, but common themes include

retinal disease, left-right asymmetry defects, polydactyly, hepa-

tobiliary disease, renal cysts, and obesity (Hildebrandt et al.,

2011). These diseases reflect functions of cilia in a wide range

of cellular processes, including mechanosensation, chemosen-

sation, and developmental responses to patterning signals and

growth factors (Nigg and Raff, 2009; Novarino et al., 2011; Oh

and Katsanis, 2012).

Although cilia and centrosomes both function centrally in

neocortical development, their interrelationships in the context

of neurogenesis are not well understood. The neocortex is

formed from a layer of neuroepithelial cells that divide

and expand to form radial glial progenitors, which subse-

quently give rise to intermediate progenitors and, ultimately,

neurons (Greig et al., 2013; Lui et al., 2011). Neuronal progen-

itors lining the lateral ventricle protrude apical primary cilia to

receive critical cues from the cerebrospinal fluid, such as

IGF2 and Sonic hedgehog (Shh), in order to maintain prolifera-

tive cell divisions (Lehtinen et al., 2011; Saade et al., 2013;

Tong et al., 2014). Mutations that impair the function of

the cilium disrupt progenitor polarity and neurogenesis (Higgin-

botham et al., 2013; Lee and Gleeson, 2011; Willaredt et al.,

2008). Recently, the ciliary membrane and a ciliary remnant

have been shown to remain tightly associated with the

mother, or older, more mature centriole in dividing apical neu-

roepithelial cells. The asymmetrical inheritance of both the

mother centriole and this apical ciliary membrane allows asym-

metrical cilium outgrowth and maintenance of apical stem cells

(Paridaen et al., 2013; Wang et al., 2009). These data suggest

that relationships between mother centrioles and cilia are

crucial to neurogenesis and the maintenance of stem cell

character.

Here, we describe recessive mutations in KATNB1, encoding

the p80 subunit of the microtubule-severing enzyme katanin,

that cause severe microcephaly with simplification of cortical

gyri and sulci, or microlissencephaly. By modeling the condition

in mice and zebrafish, we find that katanin p80 is a crucial regu-

lator of early embryonic development. Remarkably, KATNB1-

deficient cells show abnormalities of both the centriole and

primary cilium. In mouse embryonic fibroblasts (MEFs), loss

of katanin p80 leads to the formation of supernumerary centri-

oles capable of forming multipolar spindles and nucleating

ectopic cilia. Evidence of perturbed Shh signaling further sup-

ports disruption of ciliary function. Our data provide a new

mechanism of microcephaly that involves katanin p80-medi-

ated regulation of interactions between centriole and ciliary

signaling.

Ne

RESULTS

Mutations in KATNB1 Cause MicrolissencephalyThree unrelated Middle Eastern families presented with individ-

uals affected with severe microcephaly, global developmental

delay, and seizures. MRI of the affected individuals revealed

dramatically reduced brain size and cortical volume with simpli-

fied gyri, shallow sulci, and enlarged lateral ventricles posteriorly

(Figure 1A), with relative sparing of the midbrain, basal ganglia,

and cerebellum. Affected individuals also displayed mild facial

dysmorphisms and sloping foreheads, consistent with reduced

cranial volume (see Figure S1A available online).

Family 1 is a large Jordanian family with five affected individ-

uals from related, consanguineous nuclear families; siblings of

the affected individuals are all reported to be healthy (Figure 1B).

Family 2 originates fromSaudi Arabia, and the affectedmale pro-

band is the third child of healthy, first-cousin parents (Figure 1B0),with two healthy older siblings. Family 3 is of Palestinian origin,

and the affected individual is the fourth child of two healthy par-

ents with no reported consanguinity (Figure 1B0 0). A sibling of

Proband 3 died from a viral illness at age 2, while other siblings

are healthy. Several paternal first cousins were reported to

display a similar microcephaly and seizure phenotype, although

medical records and DNA samples were unavailable.

Medical genetic and neurological evaluation of the affected

individuals at birth and throughout life revealed dramatically

reduced head circumference, disproportionate to height and

weight (Figures S1B–S1D). Detailed clinical information on all

affected individuals is available in Table S1. The severely

reduced brain size, simplified gyri and enlarged ventricles,

especially posteriorly, and relative sparing of the brain stem

and cerebellum seen on MRI in affected individuals from

all three families bear a striking resemblance to the micro-

lissencephaly caused by mutations in NDE1 (Alkuraya et al.,

2011; Bakircio�glu et al., 2011), and so we use the same term

henceforth.

The consanguineous pedigrees implicated recessive inheri-

tance of rare, pathogenic variants. To identify the causative

mutations in these families, we undertook a combination of ho-

mozygosity mapping, whole-exome sequencing, and targeted

next-generation sequencing (see Experimental Procedures for

further details). In Family 1, mapping of shared regions that are

homozygous and identical-by-descent (IBD) in the affected indi-

viduals, and exclusion of common homozygous segments

shared by unaffected family members, identified a single shared

IBD candidate locus totaling 9 Mb on Chromosome 16 (Fig-

ure S1E). Subsequent whole-exome sequencing of Proband 1

revealed a single, unique homozygous variant present in the

region of IBD. Whole-exome sequencing in Proband 2 identified

3 homozygous, rare, protein-altering variants, and targeted

sequencing of coding exons within blocks of homozygosity

greater than 2 cM in Proband 3 identified seven homozygous,

rare, protein-altering variants. Crossreferencing all three families

identified homozygous deleterious mutations in a single, over-

lapping gene, KATNB1. Sanger sequencing confirmed precise

familial segregation of disease-associated variants (Figures

S1F–S1F0 0), and all three variants were absent from European

or ethnically matched control populations.

uron 84, 1240–1257, December 17, 2014 ª2014 Elsevier Inc. 1241

Figure 1. Mutations in KATNB1 Cause Microlissencephaly

(A) MRI images of affected individuals show reduced cortical size (ctx), simplification of gyral folding pattern, enlarged lateral ventricles (lv) posteriorly and thinning

of the corpus callosum (cc), with relative sparing of the cerebellum (cb), basal ganglia (bg), thalamus (th), and brainstem (br). Scale bar, 50 mm.

(legend continued on next page)

Neuron


1242 Neuron 84, 1240–1257, December 17, 2014 ª2014 Elsevier Inc.

Neuron


KATNB1 encodes the p80 subunit of katanin, a microtubule-

severing enzyme comprised of a p60 catalytic subunit and a

p80 regulatory subunit (McNally and Vale, 1993). Family 1 carries

amutation that abolishes the initiator ATGcodon (Figure 1C), pre-

dicted to result either in complete loss of protein, or potential pro-

duction of an N-terminally truncated protein from a downstream

conserved in-frame methionine at position 57. Family 2 carries a

missense mutation that converts a highly conserved glycine to a

tryptophan (Figure 1C0). Family 3 carries a splice site mutation at

the exon-intron boundary of exon 6 that is predicted to abolish all

splice donor activity (Figure 1C0 0), as the first base pair of the

splice donor site is 100% conserved in eukaryotes (Mount,

1982; Senapathy et al., 1990). Katanin p80 contains sixWD40 re-

peats in the N terminus of the protein, and the mutations in

Families 2 and 3 are located within the first and third WD40

repeats, respectively (Figure 1D). The predicted N-terminal trun-

cated product in Family 1 also disrupts the WD40 domains.

KATNB1 DNA and protein sequences are highly evolutionarily

conserved. Using several different methods of model averaging

(Zhang et al., 2006), we calculated nonsynonymous to synony-

mous substitution ratios (Ka/Ks) between 0.03 and 0.08, indi-

cating extremely strong negative selection of nonsynonymous

variation. The specific proband nucleotide mutation sites are

also highly conserved, with GERP scores of 4.97, 4.28, and

5.01 and for the start codon, missense, and splice site mutation

sites, respectively (Cooper et al., 2005; Davydov et al., 2010).

Additionally, for the missense mutation, comparing the MultiZ

alignment across 100 vertebrate species, all but one species

contain glycine at that residue (Blanchette et al., 2004; Karolchik

et al., 2014). Together, these data indicate that theKATNB1 gene

and the proband mutation sites are extremely well conserved,

and that mutation of these sites is most likely pathogenic.

Mutations in KATNB1 Alter mRNA Splicing and ProteinQuantityThe high conservation of KATNB1 and the highly conserved pro-

tein structure of WD40 repeats (Neer et al., 1994) suggest that

the identified mutations would severely disrupt katanin p80 pro-

tein stability and function. Expression studies in primary fibro-

blasts and induced pluripotent stem cells (iPSCs) derived from

Proband 1 identified reductions in both katanin p80 and p60 in

human cells. The start codonmutation causes the loss of the first

methionine, and translation is predicted to initiate at the next in-

frame methionine 56 amino acids downstream (Figure S2B).

KATNB1 and KATNA1 mRNA are detectable at comparable

levels in Proband 1-derived iPSCs compared to control cell lines

by quantitative RT-PCR (Figure 2A). However, full-length katanin

p80 is not detectable in Proband 1-derived primary fibroblasts or

iPSCs, and in iPSCs we find a new, smaller katanin p80 protein

product consistent with the predicted N-terminal truncated

(B–B0 0) Pedigrees of families with microlissencephaly. Square, male; circle, fema

shading, reported affected individual, medical records unavailable; double lines

collected.

(C–C0 0) Mutation in Family 1 abolishes start ATG codon. Mutation in Family 3 is at a

tryptophan.

(D) Predicted protein structure of katanin p80. Mutations lie at first amino acid an

See also Figure S1, Table S1, and Movie S1.

Ne

form (Figure 2B). Remarkably, p60 protein was also undetect-

able in primary fibroblasts and greatly reduced in iPSCs despite

unchanged transcript levels (Figures 2A and 2B), most likely re-

sulting from a posttranscriptional event. A lymphoblastoid cell

line derived from Proband 2 showed an 84% reduction in katanin

p80 protein compared with a control line, with protein minimally

detectable after long exposure (Figure 2C), suggesting that the

missense allele is either null, due to defective function of the

mutant protein, or hypomorphic, with some residual protein

and residual activity. Interestingly, we also find a concomitant

64% decrease of the katanin p80 binding partner katanin p60

in Proband 2-derived lymphoblasts, compared with control (Fig-

ure 2C), suggesting that the loss of katanin p80 impairs katanin

p60 stability.

For Family 3, we analyzed mRNA splicing using a minigene

comprised of full-length cDNA, including the introns immediately

upstreamanddownstreamof the splicemutation site (Figure 2D).

We transfected tagged wild-type and mutated Proband 3 mini-

gene constructs into HEK293T cells, followed by RT-PCR, and

found that, compared with wild-type, the mutant minigene cre-

ates a smaller RNA product corresponding to skipping of exon

6 (dele6, Figure 2E). Sanger sequencing of the RT-PCR product

identified the presence of the exon 5–exon 7 boundary (Fig-

ure 2F). Expression studies showed that the splicingmutation re-

sults in stable, albeit functionally defective, protein. Transfection

of taggedwild-type and Proband 3minigenes, andwild-type and

exon 6-deleted (dele6) cDNAs, into HEK293T cells with quantita-

tive western blot revealed a 51%–77% reduction in katanin p80

from the mutant minigene and cDNAs compared with their wild-

type counterparts (Figure 2G). Because exon 6 is an in-frame

exon, and mutant protein is present at lower quantities than

wild-type, this mutant form may be hypomorphic. Whereas

tagged, wild-type katanin p80 localizes to the centrosome of

interphase cells (Figure 2H), most tagged dele6 protein accumu-

lates in the nucleus during interphase, with minimal localization

to the centrosome (Figure 2H), indicating that themisspliced pro-

tein is functionally perturbed. In summary, all three mutations

disrupt the N-terminal WD40 repeats of KATNB1, result in lower

levels of katanin p80 aswell as p60 protein, yet have the potential

to produce defective proteins with some partial function.

Katanin p80 Is Required for Embryonic SurvivalTo study functions of katanin p80 in vivo, we generated a Katnb1

gene-trap (gt) mouse line, with the gene-trap vector inserted

between coding exons 2 and 3 (Figure 3A). We confirmed by

RT-PCR that Katnb1 coding exon 2 splices fully to the

Engrailed-2 splice acceptor of the gene-trap vector, with no

detectable wild-type Katnb1 mRNA in homozygous gene-trap

mutants (Figures 3B and 3C). Katanin p80 protein is reduced

by 51% in heterozygous embryos and is undetectable in

le; red arrowhead, affected proband; black shading, affected individual; gray

, consanguineous marriages; diagonal line, deceased; asterisk, DNA sample

50 splice site. Missense mutation in Family 2 converts a conserved glycine to a

d in WD40 domains.


Figure 2. Mutant KATNB1 Alleles Produce Less Protein Than Wild-Type Alleles, and dele6 Mutant Protein Is Mislocalized

(A) qRT-PCR of Proband 1-derived fibroblast and iPSC lines shows presence of KATNB1 and KATNA1mRNA at levels comparable to control cell lines. Unpaired

t test, p < 0.05; ns, not statistically significant.

(B) Western blot of Proband 1-derived fibroblast and iPSC lines shows absence of full-length katanin p80 and presence of smaller protein product compared to

control (top). Katanin p60 levels are also reduced (bottom).

(C) Western blot of Proband 2-derived lymphoblastoid cell lines shows near absence of katanin p80, detectable only at high exposure (top), and reduction of

katanin p60 (bottom). Quantification using LI-COR imaging system.


Neuron



Neuron


homozygous mutant embryos (Figure 3D), indicating that the

gene-trap allele is almost certainly null. Similar to our primary hu-

man cell line data (Figures 2B and 2C), katanin p60 protein levels

are reduced by 39% and 72% in the heterozygous and homozy-

gous Katnb1 gene-trap embryos, respectively (Figure 3E).

Homozygous null Katnb1 gene-trap embryos die embryoni-

cally, with dramatically reduced body size by embryonic day

15.5 (E15.5) (Figures 3F and 3G). Embryos are found along a

spectrum of phenotypic severity, and some very severely

affected embryos die as early as E12.5. All homozygous mutant

embryos are grossly morphologically abnormal, with features

including pallor of the liver, microophthalmia to anophthalmia,

and reduced limb bud outgrowth (Figure 3H). In addition, homo-

zygous mutant embryos show forebrain abnormalities ranging

frommicrocephaly to holoprosencephaly, in which the two hemi-

spheres of the brain fail to separate, resulting in a single ventricle

(Figures 3H–3J). Histopathological analysis of the embryos re-

vealed a lack of red blood cells in the liver, suggesting failed

definitive erythropoiesis, which is a potential cause of embryonic

death (data not shown) (Baron, 2013). Underdeveloped limb

buds, anophthalmia, and holoprosencephaly are commonly

seen in mouse mutants with defective Shh signaling (Chiang

et al., 1996; Hayhurst and McConnell, 2003; Litingtung et al.,

2002) and are associated with human mutations in SHH (Belloni

et al., 1996; Roessler et al., 1996), while Indian hedgehog,

another hedgehog family protein, has been implicated in defini-

tive erythropoiesis (Cridland et al., 2009). The overlap of pheno-

types between homozygous Katnb1 gene-trap mice and Shh

pathway mutants raises the unexpected possibility that katanin

p80 might be involved in modulating Shh signaling. These data

indicate that katanin p80 is required for embryonic development

and survival, and confirm the association of the human muta-

tions with the severe brain malformations.

Katanin p80 Is Required for Early Embryogenesis andFormation of Anterior Structures in ZebrafishAs a second, independent model of katanin loss of function dur-

ing development, we utilized the high conservation of the katanin

p80 protein sequence and gene structure in zebrafish (Figures

4A and S3A) and targeted the exon 6-intron 6 boundary near

the Proband 3 mutation site with TALEN endonucleases (Fig-

ure 4B; Table S2). We generated a series of mutant alleles

harboring different frameshift as well as in-frame deletions and

insertions at the target site (Figures 4B and S3B). Most of the

alleles are frameshift mutations and are predicted to lead to early

termination and, consequently, truncated proteins (Figure 4C

and S3B).

Mutant progeny from F1 carriers of truncated alleles are viable.

However, progeny of females deficient for katnb1, although able

(D) Schematic of the splice site minigene cDNA construct. Primer arrows show l

(E) RT-PCR results of minigene assay. Smaller product in splice mutant minigen

(F) Sanger sequencing of smaller spliced product (asterisk in E) confirms skippin

(G) Western blot of transfected minigenes and cDNAs shows reduced protein lev

imaging system.

(H) Wild-type EGFP-tagged katanin p80 localizes to the centrosome (left; Pericen

with minimal centrosomal localization (right). Scale bar, 10 um.

See also Figure S2.

Ne

to develop through 70% epiboly, show a wide spectrum of phe-

notypes stemming from defects in gastrulation and formation of

anterior structures, ranging from milder microcephaly to more

severe anencephaly and early embryonic death (Figures 4D,

4E, and S3C). The similar phenotypic results observed in mice

and zebrafish deficient for Katnb1 demonstrate that katanin

plays a major role during early embryogenesis and patterning

of anterior structures. Since the humans we identified with

KATNB1mutations survive beyond birth into childhood, the em-

bryonic lethality of Katnb1 deficiencies suggests that the three

identified human alleles may retain partial function. Interestingly,

the maternal rescue observed in the zebrafish (Figure 4E) indi-

cates that normal maternal katnb1 mRNA is sufficient to permit

generally normal growth and patterning during postembryonic

development in the absence of zygotic katnb1, suggesting that

variation in developmental timing of katanin p80 function also

affects phenotypic severity.

Katnb1 Is Ubiquitously Expressed in the Brain andCritical for Neocortical DevelopmentGiven the striking brain morphological phenotypes in the pro-

bands and homozygous gene-trap mouse embryos, we investi-

gated functions of katanin p80 during cortical development.

Katanin p80 is expressed in the mouse cerebral cortex

throughout development (Figure 5A). To evaluate cell-type-spe-

cific expression, we took advantage of the presence of a LacZ

cassette in the gene-trap vector and stained for LacZ protein

in the neocortex of heterozygous embryos. We found ubiquitous

staining throughout the proliferative ventricular zones and in the

cortical plate (Figure 5B), in agreement with available mouse

transcriptome data (Ayoub et al., 2011).

The dramatic reduction in brain size seen in homozygous

mutant mice reflects abnormal proliferation as well as cell death.

Following a pulse of bromodeoxyuridine (BrdU) to pregnant

dams at E12.5, a stage corresponding to early neurogenesis,

we find a 35% reduction in number of actively proliferating cells

in homozygous mutant embryos compared with wild-type,

confirming that fewer cycling progenitors are indeed present

(Figures 5C and 5D). Furthermore, we find that overall cortical

thickness is reduced by 54% at E13.5, a stage corresponding

to peak neurogenesis (Figures 5E–5H), with preserved cell polar-

ity (Figure S5A). To more specifically characterize cortical

defects, we performed immunohistochemistry for specific pro-

genitor subtypes and neurons. Sox2 immunoreactivity, which

identifies radial neuroepithelial progenitors, is reduced 32% in

Katnb1 null embryos. Tbr2 immunoreactivity, which identifies in-

termediate progenitors formed by asymmetric divisions of radial

neuroepithelial cells, is reduced more severely, with 72% deple-

tion. Neurons, labeled with DCX immunoreactivity and derived

ocation of PCR primers for (E).

e (asterisk) corresponds in size to deletion of exon 6 (dele6).

g of exon 6.

els in splice mutant allele relative to wild-type. Quantification using the LI-COR

trin), but EGFP-tagged dele6 mutant protein diffuses throughout the nucleus,


(legend on next page)

Neuron



Figure 4. Maternal Contribution of katnb1 Is Essential for Zebrafish Gastrulation

(A) Katanin p80 protein and gene structure is highly conserved between humans and zebrafish.

(B) TALENs targeting the genomic region surrounding the zebrafish katnb1 exon 6-intron 6 boundary create a series of mutant alleles. Reference sequence (top).

Blue box, TALEN recognition sites; dash, deleted base pairs; red letters, inserted base pairs.

(C) Mutant alleles are predicted to alter protein structure by deletion of amino acids or early truncation of katanin p80 protein.

(D) Progeny of mutant females show a wide spectrum of phenotypes, ranging from early embryonic lethality and anencephaly to microcephaly.

(E) Maternal effect of katnb1 is observed in crosses of mutant females, compared with progeny arising from heterozygous carriers. Embryos developed normally

until 70% epiboly.

See also Table S2 and Figure S3.

Neuron


from asymmetrical divisions of radial neuroepithelial cells or from

the Tbr2-positive progenitors, are the most severely affected,

with an 83% reduction compared to wild-type (Figures 5E–5H).

These results reveal a striking reduction in cycling ventricular

zone progenitors in Katnb1 null cortex, but an even more pro-

found loss of cells that depend upon asymmetrical cell divisions,

Figure 3. Katnb1 Gene-Trap Mutants Die by E14.5, with Brain Phenoty

(A) Location of gene-trap insertion. Gene-trap insertion leads to early truncation

(B and C) RT-PCR confirms absence of wild-type allele in homozygous gene-trap

exon 2 into gene-trap cassette (C).

(D and E) Katanin p80 protein is absent in gt/gt mice (D), and less katanin p60 prot

the LI-COR imaging system.

(F) Homozygous gt/gt mice are present in expectedMendelian ratios before E14.5

embryonically lethal. Chi-square test, p < 0.0001.

(G) Compared with wild-type, homozygous gt/gt embryos are dramatically reduc

p < 0.001.

(H) Homozygous gt/gt embryos vary in size, with brain phenotypes ranging from

zygous gt/gt embryos are micropthalmic (embryo 2), while others have no eye dev

pallor of the liver. All pictured embryos are littermates. Scale bar, 5 mm (top) and

(I) Coronal sections through embryonic brains show reduced cortical size, thickne

of brain. Scale bar, 200 um.

(J) Distribution of homozygous gt/gt phenotypes recovered between E12.5 and E

Ne

including intermediate progenitors and neurons. These data

parallel the results of katanin p80 loss in the Drosophila brain

presented in an accompanying paper, in this issue of Neuron

(Mishra-Gorur et al., 2014). We hypothesized that cell death

might also be a factor in neuronal depletion, and indeed we

find apoptotic cells, marked by activated cleaved caspase 3, in

pes Ranging from Microcephaly to Holoprosencephaly

of Katnb1 mRNA, to mimic a null allele.

mice (B). Sanger sequencing of gene-trap RT-PCR product confirms splicing of

ein is produced in gt/gt mice, compared with wild-type (E). Quantification using

but are almost never found after E15.5, indicating thatKatnb1 loss of function is

ed in body size at E14.5. Error bars indicate mean ± SEM. One-way ANOVA,

microcephaly (embryos 2–4) to holoprosencephaly (embryo 5). Some homo-

elopment (embryos 3–5), and all have underdevelopment of the limb buds and

1 mm (bottom).

ss, and holoprosencephaly in homozygous gt/gt embryos. Dashed line, outline

15.5.


Figure 5. Loss of Katanin p80 Impairs Proliferation of Cortical Progenitors at E12.5, with Fewer Progenitors and Postmitotic Neurons Present

in Cortex

(A) Katanin p80 protein is present in the cerebral cortex throughout embryonic and postnatal development.

(B) Katanin p80 protein is present throughout the developing cortex at high levels in postmitotic neurons in the cortical plate, and lower levels in progenitors of the

ventricular and subventricular zones at E14.5. VZ, ventricular zone; SVZ, subventricular zone; CP, cortical plate. Scale bar, 50 um (left) and 20 um (inset, right).


Neuron



Neuron


homozygous mutant brains. Even in the most mildly affected

homozygous gene-trap embryos, apoptosis is abundant

throughout the brain, particularly in the proliferative ventricular

zones of the cortex, whereas apoptotic cells are absent from

wild-type brains (Figure 5I). We obtained similar results using

neural stem cells (NSCs) differentiated from human iPSCs.

Proband 1-derived neurospheres fail to grow and exhibit wide-

spread apoptosis (Figures S5B–S5D). Together, these data

indicate that katanin p80 is required for neuronal progenitor pro-

liferation and survival during cortical development.

Loss of Katanin p80 Disrupts Spindle Structure andMitosisTo better understand the cellular functions of katanin p80 during

human development, we studied proband-derived cell lines.

Katanin p80 and p60 localize to the spindle poles of mitotic cells

and to the pericentriolar matrix of interphase cells (Figures S5A–

S5C). In immortalized human lymphoblasts and human iPSCs

expressing mutant KATNB1 alleles, we find defects in centroso-

mal structure and function. Approximately 49% of S phase

Proband 2-derived lymphoblasts contain more than two centro-

somes, compared with 11% in control lymphoblasts (Figures 6A

and 6B). Instead of localizing perinuclearly, these centrosomes

cluster in the center of the cell, with the DNA arranged around

the centrosomes (Figure 6A). iPSCs derived from Proband 1 dis-

played mitotic abnormalities in 51% of cells, compared to only

4% of control iPSCs: 10% of cells displayed multipolar spindles,

with supernumerary chromosomes and excess kinetochores,

22% of cells displayed abnormal monoastral spindles, and an

additional 19% contain misaligned chromosomes (Figures 6C

and 6D). Flow cytometry analysis for DNA content on lympho-

blasts from Proband 2 revealed an increased proportion of cells

in S and G2 phase, compared with control lymphoblasts (Figures

6E and 6F), indicative of cell cycle perturbation and aneuploidy.

Katanin p80 Limits Centriole NumberWe further investigated centriole biogenesis in MEFs isolated

from gene-trap embryos. Katnb1 null MEFs are more severely

affected than proband-derived mutant cell lines, with 76% of

gene-trap MEFs containing multipolar mitotic spindles, com-

pared with 12% in wild-type MEFs (Figures 7A and 7D). We

also found binucleate homozygous gene-trapMEFs, likely result-

ing from aneuploid divisions (Shi and King, 2005), while we

almost never found binucleate wild-type MEFs (data not shown).

MEFs isolated from homozygous gene-trap embryos often failed

to proliferate (Figure S6C), and those homozygous gene-trap

MEFs that did grow well in vitro divided significantly more slowly

than wild-type MEFs (Figure 7F), consistent with the widespread

defects in proliferation observed in the mutant embryos.

(C) Fewer actively proliferating cortical progenitors are labeled by acute BrdU

sections in gt/gt cortex compared with wild-type. Scale bar, 20 um.

(D) Quantification of BrdU-positive cells per length of ventricular surface. Error b

(E–G) Homozygous gt/gt mutant cortex is reduced in thickness at E12.5 com

(F, Tbr2+) and neurons (G, DCX+) over radial glia (E, Sox2+). Scale bar, 20 um.

(H) Quantification of radial thickness of cortex, with percent composition of mark

(I) Apoptotic cells labeled by activated cleaved caspase 3 are abundant in homozy

See also Figure S4.

Ne

Defects in cytoskeletal structure in homozygous gene-trap

MEFs, with increased acetylated tubulin immunoreactivity

around the centrosome (Figure S6D), suggest increased overall

microtubule stability. Furthermore, we find more prominent

staining for CAMSAP2, a microtubule minus-end protein that

protects against depolymerization, as well as more linear,

streak-like staining for EB1, a microtubule plus-end protein (Fig-

ures S6E and S6F). Together, these data suggest that microtu-

bule dynamics are altered and that loss of katanin p80 results

in a more stabilized cytoskeleton.

Surprisingly, we found a high proportion of overduplicated

centrioles in homozygous gene-trap MEFs (Figure 7B), with

76% of cells displaying supernumerary centrioles (Figure 7E),

consistent with our multipolar spindle data. Transmission elec-

tron microscopy of centrosomes reveals that these ectopic cen-

trioles have normal 9-fold symmetry but are unpaired, unlike

wild-type, paired centrioles (Figures 7C, S6A, and S6B). These

supernumerary centrioles associate with multiple centrosomal

proteins, including g-tubulin, Stil, and Cep63 (Figure 7B), sug-

gesting they form functional centrosomes and may explain the

origin of the mitotic spindle defects we observe (Figures 7A

and 7D).

Loss of Katanin p80 Causes Supernumerary Cilia andAbrogates Sonic Hedgehog SignalingThe mother centriole is the older centriole in a cell, and normal

cells contain only one mother centriole. Examining the localiza-

tion of two mother centriolar proteins, Ninein and Cep164, re-

vealed the surprising presence of multiple mother centrioles in

Katnb1 homozygous gene-trap MEFs (Figure 8A), suggesting

defects in not just centriole number, but also centriolematuration

and identity.

Since the mother centriole nucleates the primary cilium, the

presence of multiple mother centrioles suggested that Katnb1

mutant cells may be capable of nucleating multiple cilia. Indeed,

after serum starvation to induce cilia growth, we identified many

cells with multiple Ift88- or Arl13b-positive cilia (Figure 8B). Over

35% of Katnb1 homozygous gene-trap MEFs possess supernu-

merary cilia (Figure 8D), nearly four times as many as wild-type

MEFs, confirming an excess of functional mother centrioles in

Katnb1 mutant cells. Some cells contain only a second, shorter

cilium, but other cells grow two or even three full-length cilia (Fig-

ures 8B and 8D). As with wild-type cells,Katnb1mutant MEFs do

not produce cilia without serum starvation (data not shown), sug-

gesting that the multiple cilia arise from supernumerary centri-

oles upon initiation of ciliogenesis, rather than from defective

ciliary resorption.

The overproduction of cilia in the absence of katanin p80

raised the question of whether homozygous gene-trap MEFs

injection at rostral (left), middle (middle), and caudal (right) matched coronal

ars indicate mean ± SEM. Unpaired t test, p < 0.001.

pared with wild-type, with preferential reduction in intermediate progenitors

ers in (E)–(G). Error bars indicate mean ± SEM. One-way ANOVA, p < 0.01.

gous gt/gt ventricular zones, even inmildly affected embryos. Scale bar, 20 um.


Figure 6. Loss of Katanin p80 Causes Centrosome and Centriole Overduplication in Proband-Derived Cell Lines and MEFs

(A) Lymphoblasts derived from Proband 2 undergo centrosomal overduplication, with DNA surrounding centrally located centrosomes. Scale bar, 10 um.

(B) Quantification of proportion of lymphoblasts with overduplicated centrosomes. Unpaired t test, p < 0.01.

(C) Mitotic iPSCs derived from Proband 1 contain monoastral spindles, multipolar spindles, and lagging chromosomes (arrowhead). Scale bar, 10 um.

(D) Quantification of proportion of mitotic iPSCs with abnormal mitoses. Unpaired t test, p < 0.0001.

(E and F) A greater percentage of Proband 2-derived lymphoblasts are aneuploid and have skewed DNA content compared with control lymphoblasts by FACS

(E), indicating that the cell cycle is disrupted in proband-derived lymphoblasts (F).

See also Figure S5.

Neuron


also show alterations in ciliary signaling. The holoprosencephaly

seen in homozygous gene-trap embryos suggested a defect in

Shh signaling, which, in vertebrates, is dependent on cilia

(Huangfu and Anderson, 2005; Huangfu et al., 2003; Mahjoub

and Stearns, 2012). We triggered Shh signaling in MEFs using

Smoothened agonist (SAG) stimulation. SAG normally causes

Gli3 and Smoothened (Smo) to accumulate at the tips of primary

cilia. In contrast, Gli3 failed to accumulate in cilia in SAG-

stimulated MEFs lacking katanin p80 (Figure 8C), with a 77%

reduction in Gli3 localization to the ciliary tip in homozygous


gene-trap MEFs (Figure 8E). Smoothened accumulation in cilia

in SAG-stimulated MEFs is also decreased in homozygous

gene-trapMEFs, even in cells containing only a single cilium (Fig-

ure S7A). qRT-PCR analysis of downstream targets Gli1 and

Patched1, which are normally upregulated in response to Shh

signaling, showed a 5-fold increase in Gli1 induction and 11.8-

fold increase in Patched1 induction upon SAG stimulation in

wild-type MEFs, but no response in homozygous gene-trap

MEFs (Figures 8F and 8G). Together, these data demonstrate

that the loss of katanin p80 leads to overduplication of centrioles

.

Neuron


and excessive maternal centrioles, leading to supernumerary

cilia, and that the resulting multiple cilia fail to properly transduce

Shh signals.

DISCUSSION

Here, we identify katanin p80 as a critical regulator of human

brain development, and extend its functions beyond regulation

of microtubule severing and the mitotic spindle. Three indepen-

dent mutations in KATNB1, affecting protein levels and subcellu-

lar localization, result in severe microlissencephaly in humans,

and complete genetic ablation of Katnb1 leads to embryonic

lethality in mice and zebrafish. On a cellular level, loss of katanin

p80 causes the formation of supernumerary centrioles, including

extra mother centrioles. These centrioles result in multipolar

spindles and also nucleate supernumerary cilia, leading to

reduced Shh signaling. Together, these data implicate katanin

as a regulator of mother and daughter centriole number, and of

the ciliary number and function that follow, thus greatly expand-

ing our view of katanin function.

Despite the severe microlissencephaly seen in humans with

KATNB1 mutations, the human mutations we identified are

most likely hypomorphic. Katanin p80 is essential during early

embryogenesis in both mice and zebrafish. Humans do not

display phenotypes as extreme as those as seen in the loss-of-

functionmouse or zebrafishmutants, nor do they show evidence

of defects classic for ciliary or Shh dysfunction, such as polycy-

stic kidney disease, laterality defects, midline patterning defects

(including holoprosencephaly), or digit anomalies (Dubourg

et al., 2007; Hildebrandt et al., 2011; Novarino et al., 2011). Addi-

tionally, NSCs derived from human iPSCs do not develop excess

cilia or decreased Shh signaling seen in loss-of-function MEFs,

further supporting the hypomorphic nature of the human alleles.

This may reflect the specific mutations we have identified, all of

which disrupt the N-terminal WD40 repeats, and result in

reduced, but not completely abolished, protein levels; thus, the

mutated proteins may retain enough residual activity to rescue

the severe, complete loss-of-function phenotypes. Finally, a

previously published mouse carrying a missense mutation in

Katnb1 is viable, with defects observed only in spermatogenesis

(O’Donnell et al., 2012), suggesting that alleles of KATNB1 can

give rise to varied phenotypes of altered severity (see also

Mishra-Gorur et al., 2014).

Our results also indicate that there are distinct temporal roles

for katanin. Loss of maternal katnb1 results in severe defects of

gastrulation, whereas loss of zygotic zebrafish katnb1 is compat-

ible with survival and growth to viable, fertile adults, indicating

that katnb1 is necessary for tissue patterning during early devel-

opment, with additional roles during later development. There-

fore, the more severe phenotype seen in mice may represent

early loss of mammalian katanin p80 function, and the milder hu-

man disease phenotypic spectrummay arise from loss of katanin

p80 function later during development, possibly in a nervous-

system-specific manner.

The identification of mutations in KATNB1 suggests that

mutations in KATNA1, encoding the catalytic katanin p60 sub-

unit, might also cause microlissencephaly, given their strong

biochemical and functional interactions. In our cohort of micro-

Ne

cephalic and lissencephalic pedigrees, we have not yet identified

any individuals with KATNA1 mutations. Complete loss of

KATNA1 function may be incompatible with embryonic survival,

as is the case with Drosophila katanin p60 (Mao et al., 2014), or

mutations in KATNA1 may cause an entirely different human

phenotype. Further characterization and sequencing in individ-

uals will be necessary to more fully explore the human genetics

of katanin mutations.

The essential roles of KATNB1 in humans, mice, and zebrafish

are somewhat surprising, given our knowledge of the role of the

katanin complex from previous work, and illustrate the unique

insight hypomorphic humanmutations offers in uncovering novel

regulators of early embryonic development. Katanin is amicrotu-

bule-severing enzyme necessary for meiotic spindle assembly

(Mains et al., 1990; Srayko et al., 2006), determination of mitotic

spindle length (Loughlin et al., 2011; McNally et al., 2006),

severing at microtubule crossovers (Lindeboom et al., 2013;

Zhang et al., 2013), axon outgrowth (Ahmad et al., 1999; Karabay

et al., 2004; Yu et al., 2005), and cell motility (Zhang et al., 2011).

Furthermore, katanin has been shown to be required for

axonemal structure (Casanova et al., 2009; Dymek and Smith,

2012) and basal body release (Rasi et al., 2009). However, these

functions all relate to katanin’s microtubule-severing activity.

Our data point to roles for the katanin complex that have not pre-

viously been described or even suspected based on its microtu-

bule-severing function. The supernumerary cilia we observe are

not remnants from previous cell cycles that have not been disas-

sembled, but, rather, are formed de novo with each cell cycle.

Furthermore, our data implicate katanin p80 in functions inde-

pendent of targeting katanin p60 to the centrosome or regulating

katanin p60 catalytic activity (Hartman et al., 1998;McNally et al.,

2000).

Katanin p80, Centrioles, and CiliaWepresent evidence showing katanin’s involvement in control of

centriolar number and centriolar type, as well as in ciliogenesis

and Shh signaling, and in vivo evidence linking all three pro-

cesses. Katnb1-deficient cells show a striking excess of centri-

oles, including multiple mother centrioles. In asymmetrical

divisions of cortical progenitor cells, the mother centriole is pref-

erentially inherited by the stem cell that continues dividing,

whereas the daughter centriole is associated with the more

differentiated cell. Moreover, the mother centriole is associated

with a piece of ciliary membrane that serves to initiate a new

cilium in the cell inheriting the more mature, mother centriole,

allowing it to respond more quickly to extracellular growth sig-

nals, including Shh and IGF2 (Anderson and Stearns, 2009; Leh-

tinen et al., 2011; Paridaen et al., 2013; Piotrowska-Nitsche and

Caspary, 2012; Saade et al., 2013). Although overduplication of

centrioles has been produced by overexpression of genes such

as PLK4, SAS-6, STIL, CPAP, and CEP120 (Arquint and Nigg,

2014; Habedanck et al., 2005; Kleylein-Sohn et al., 2007; Lin

et al., 2013; Peel et al., 2007; Strnad et al., 2007; Tang et al.,

2011), or by loss of CCDC14, CEP76, Lin-23, and Sel-10 (Firat-

Karalar et al., 2014; Peel et al., 2012; Tsang et al., 2009), centriole

overduplication does not always cause excessmother centrioles

or cilia to form (Mahjoub and Stearns, 2012; Marthiens et al.,

2013), as overexpression of Plk4 in the mouse brain leads to



Neuron



Neuron


centrosomal overduplication and microcephaly, but without de-

fects in cilia number or Shh signaling (Marthiens et al., 2013). Our

findings of multiple mother centrioles in Katnb1mutant cells, and

multiple cilia but with defective ciliary Shh signaling, suggest that

katanin p80 may serve an essential role in the link between

centriole and cilium to cell fate in the cortical ventricular zone.

The precise mechanism by which loss of katanin p80 causes

centriole overduplication remains unexplored. Duplication of

centrioles is normally limited to once per cell cycle, and presence

of a daughter centriole inhibits centriole duplication (La Terra

et al., 2005; Loncarek et al., 2008; Wong and Stearns, 2003).

However, certain cell lines are capable of excess duplication

when artificially arrested in S phase (Balczon et al., 1995), and

overexpression of various centriolar and pericentriolar matrix

proteins causes overduplication (Loncarek et al., 2008;Mahjoub,

2013).

Centriole duplication can occur from a template mother

centriole or by de novo synthesis, which require similar factors

(Khodjakov et al., 2002; La Terra et al., 2005). In the absence

of katanin p80, both excessive templating of themother centriole

and unbridled de novo centriole synthesis are possibilities.

Immunostaining and electron microscopy show centrioles

clustered together, rather than scattered throughout the cell,

suggesting that some templating may occur. However, the

centrioles we observe are not paired in the classic orthogonal

orientation of templated, duplicating centrioles and suggest

the de novo pathway may nonetheless be active. Furthermore,

centriole duplication has been proposed to be regulated by con-

trolling the localization of duplication factors (Firat-Karalar et al.,

2014). The increased microtubule stability with loss of katanin

may prevent trafficking of positive and negative regulators of

centriole duplication to and away from the centrosome, resulting

in unbridled duplication.

There is emerging evidence in neurodevelopment for genes

linking centrosome, spindle, and cilia biology. Ciliopathy syn-

dromes are associated with rare brain malformations, though

the mechanism by which they occur and their significance is still

unclear (Lee and Gleeson, 2011; Nigg and Raff, 2009; Oh and

Katsanis, 2012). Our results suggest that defects in cilia may

cause isolated nervous system disease, potentially related to

its roles in later development. Loss of two other centrosomal

microcephaly genes,CDK5RAP2 andNDE1, are known to cause

excess centrosomes and multipolar spindles and have recently

been shown to affect cilia length and number as well (Alkuraya

et al., 2011; Bakircio�glu et al., 2011; Barrera et al., 2010; Bond

et al., 2005; Kim et al., 2011; Lizarraga et al., 2010). Mutations

in NDE1 were the first identified cause of microlissencephaly

Figure 7. Loss of Katanin p80 Causes Centriole Overduplication

(A) Homozygous gt/gt MEFs have multipolar mitotic spindles and misaligned chr

(B) Centrioles, labeled by Centrin, are overduplicated in homozygous gt/gt ME

(middle), and Cep63 (bottom) associate with supernumerary centrioles with norm

(C) Serial transmission electron micrograph sections through centrosomes sho

contain only one pair of centrioles. Arrowhead, centriole. Scale bar, 200 nm.

(D) Quantification of mitotic spindle abnormalities in (A). Unpaired t test, p < 0.00

(E) Quantification of centriolar overduplication in (B). Unpaired t test, p < 0.0001.

(F) Homozygous gt/gt MEFs grow more slowly than wild-type or gt/+ MEFs. Two

See also Figure S6.

Ne

(Alkuraya et al., 2011; Bakircio�glu et al., 2011), with a phenotype

very similar to that of KATNB1mutations, and katanin p80 phys-

ically interacts with Ndel1, a close paralog of Nde1 (Toyo-Oka

et al., 2005).Nde1 andCdk5Rap2 also encode centrosomal pro-

teins essential for neurogenesis, though loss of neither Nde1 nor

Cdk5Rap2 is as severe as Katnb1 loss in mice (Barrera et al.,

2010; Feng and Walsh, 2004; Lizarraga et al., 2010). An

appealing model, therefore, is that CDK5RAP2, NDE1, and

KATNB1 may control the pathway limiting centriole duplication,

and that the presence of excessive centrioles, particularly

mother centrioles, in dividing neuroepithelial cells results in per-

turbed ciliary growth factor signaling, defective proliferation, and

excessive cell death.

EXPERIMENTAL PROCEDURES

Human Subjects

A combination of homozygosity mapping, whole-exome sequencing, and tar-

geted sequencing of coding exons within areas of homozygosity was per-

formedandfilteredasdescribed in theSupplementalExperimentalProcedures.

All studies were reviewed and approved by the Institutional Review Board of

Boston Children’s Hospital, Harvard Medical School, and local institutions.

Animals

Targeted gene-trap ESCs (EUCOMM) were injected into C57BL/6 blastocysts

to generate chimeric mice. Male chimeras were bred to WT C57BL/6 females

(Charles River) to transmit the gene-trap allele. The mice were maintained on a

C57/BL6 background. For pulse-labeling experiments, E12.5 timed pregnant

mice were injected with 75 mg/kg BrdU intraperitoneally and euthanized

30 min later.

TALENs targeting the exon 6-intron 6 boundary of zebrafish katnb1

(ENSDARG00000005456) were obtained from ZGENEBIO Biotech Co. Ltd

(Table S2). To generate katnb1 mutants, 150–200 pg of RNA was injected

into one-cell-stage eggs (albino/slc45a2).

Culture Systems

Epstein-Barr virus-immortalized lymphoblastoid cell lines established from

Proband 2 were maintained in RPMI-1640 (GIBCO) with 10% fetal bovine

serum (FBS, GIBCO), and 1 mM penicillin and streptomycin (P/S). Primary

fibroblasts were established from Proband 3 and were maintained in RPMI-

1640 (GIBCO) with 10% FBS, and 1 mM P/S. Human iPSCs (Figure S2A)

were generated using retroviral vectors encoding human KLF4, SOX2,

OCT4, and C-MYC cDNA (Addgene) and grown in knockout DMEM with

20% knockout serum replacement, 2 mM L-glutamine, 1% NEAA, 0.1 mM

b-mercaptoethanol, 0.1% P/S, and 4 ng/ml bFGF on irradiated fibroblast

feeders. iPSCs were dissociated to form embryoid bodies (EBs) and induced

in neural induction medium (DMEM/F12 supplemented with 20%KOSR, 2mM

L-glutamine, 0.2 mM NEAA, 0.1 mM 2-mercaptoethanol, and 1 mM sodium

pyruvate) for 7 days. EBs were then adhered onto laminin-coated plates in

neural precursor medium (neurobasal with 2 mM L-glutamine, 1% B27, 1%

N2, and 20 ng/ml bFGF) for 7–14 days to form rosettes, which were manually

isolated and expanded as NSCs in neural induction medium.

omosomes (arrowhead). PHH3, phosphorylated histone H3. Scale bar, 10 um.

Fs compared with wild-type MEFs. Centrosomal proteins g-tubulin (top), Stil

al stoichiometry. Scale bar, 10 um.

w multiple unpaired centrioles in gene-trap MEFs, whereas wild-type MEFs

01.

-way ANOVA, p < 0.001.



Neuron



Neuron


Trypsin-dissociated MEFs isolated from E13.5 mouse embryos were grown

in DMEM, High Glucose (HyClone) with 15% FBS, and 1 mM P/S and L-gluta-

mine. Cilia were induced by serum starvation for 48 hr in Optimem (GIBCO)

media, then treated with DMSO or 100 nM SAG for an additional 24 hr.

Additional details are available in Supplemental Experimental Procedures.

Quantitative RT-PCR

See Supplemental Experimental Procedures.

Western Blotting


Immunostaining


SUPPLEMENTAL INFORMATION

Supplemental Information includes seven figures, two tables, one movie, and

Supplemental Experimental Procedures and can be found with this article at

http://dx.doi.org/10.1016/j.neuron.2014.12.017.

AUTHOR CONTRIBUTIONS

W.F.H. designed, performed, and analyzed experiments to characterize the

mutations in Families 2 and 3; generated the gene-trap mouse line and zebra-

fish mutant lines; designed, performed, and analyzed all mouse and zebrafish

experiments; helped analyze the centriolar and ciliary phenotypes; designed,

performed, and analyzed EM experiments, and wrote the manuscript. O.P. de-

signed, performed, and analyzed experiments relating to Family 1. T.B.-O.

identified Family 3. A.K. and J.F.R. designed and performed immunostaining

experiments in mouse cell lines, and identified and analyzed centriolar and

ciliary phenotypes. K.H. generated the zebrafish mutant lines and designed,

performed, and analyzed all zebrafish experiments. G.H.M. designed and per-

formed initial genome-wide linkage studies, and G.H.M. and T.W.Y. designed

and performed targeted capture sequencing on Family 3. M.B.W. performed

and analyzed mouse BrdU labeling experiments and helped analyze centriolar

duplication phenotypes in Family 2 andmouse cell lines. C.B. analyzed the IBD

mapping and exome sequencing of Family 1. G.S.R. and T.T.T. reprogrammed

fibroblasts into iPSCs and performed immunostaining for Family 1. H.H. iden-

tified and A.M. and M.S. provided clinical information for Family 1. M.A.S. and

J.N.P. organized clinical information and subject samples for Families 2 and 3.

M.A-.D., A.A., M.A., and F.S.A. identified, provided clinical information for, and

performed genetic analyses for Family 2. M.P.H. directed the zebrafish

research. B.R. directed the research for Family 1. C.A.W. directed the overall

research and wrote the manuscript.

ACKNOWLEDGMENTS

We thank the individuals and their families for their participation. We thank

Boston Children’s Hospital (BCH) Transgenic Core Laboratory, Dana-Farber/

Harvard Cancer Center Rodent Histopathology Core, Dana-Farber Cancer

Figure 8. In the Absence of Katanin p80, Fibroblasts Produce Supernu

(A) Homozygous gt/gt MEFs contain multiple mother centrioles that label with N

(B) Homozygous gt/gt MEFs grow multiple cilia marked by IFT88 and Arl13b (rig

numerary cilia not shown in inset. Scale bar, 10 um.

(C) After stimulation by Smoothened agonist (SAG), gt/gt MEFs fail to relocate Gli3

MEFs robustly relocate Gli3 to the cilium after SAG stimulation (left). Scale bar, 1

(E) Quantification of proportion of ciliated MEFs with supernumerary cilia from (B

(E) Quantification of cilial tip Gli3 intensity in SAG-stimulated cells from (C). Unpa

(F and G) DownstreamSonic hedgehog targetsGli1 (F) and Patched1 (G) are induc

type MEFs. Error bars represent mean ± SEM. Unpaired t test, p < 0.05.

(H) NSCs derived from Proband 1 do not grow supernumerary cilia. Scale bar, 1

(I) After stimulation by Smoothened agonist (SAG), control and mutant NSCs sho

See also Figure S7.

Ne

Institute Neoplasia Flow Cytometry Core, Beth Israel Deaconess Medical

Center (BIDMC) Histology Core Laboratory, Harvard Medical School

Electron Microscopy Facility, and Genome Institute of Singapore for use of fa-

cilities. We thank Tamara Caspary, Erich Nigg, Suzie Scales, and James Silli-

bourne for kind gifts of reagents. This research was supported by NIH NINDS

F31NS083111 and NIGMS T32GM007753 (W.F.H.); NIH NHLBI T32HL007731

(A.K.); Manton Center for Orphan Disease Research and F. Hoffman-La Roche

Ltd. (G.H.M.); Clinical Investigator Training Program at Harvard-MIT Health

Sciences and Technology and BIDMC in collaboration with Pfizer, Inc. and

Merck & Company, Inc, and the Nancy Lurie Marks Junior Faculty MeRIT

Fellowship (T.W.Y.); Leonard and Isabelle Goldenson Research Fellowship

(M.B.W.); KACST grant 09-MED941-20 (F.S.A.); NIH NIAMS R01AR054396,

NIGMS R01GM095941, Burroughs Wellcome Fund, Packard Foundation,

and Sandler Family Supporting Foundation (J.F.R.); Strategic Positioning

Fund for Genetic Orphan Diseases, A*STAR Investigatorship from the Agency

for Science, Technology and Research in Singapore, Branco Weiss Founda-

tion fellow, and A*STAR and EMBO Young Investigator (B.R.); NIH NIDCR

1U01DE024434-01 and BCH Orthopedic Surgical Foundation (K.H. and

M.P.H.); and NIH NINDS R01NS035129 and NIMH RC2MH089952, the Qatar

National Research Fund National Priorities Research Program, and the Man-

ton Center for Orphan Disease Research (C.A.W.). C.A.W. is an Investigator

of the Howard Hughes Medical Institute.

Accepted: December 3, 2014

Published: December 17, 2014

REFERENCES

Ahmad, F.J., Yu, W., McNally, F.J., and Baas, P.W. (1999). An essential role for

katanin in severing microtubules in the neuron. J. Cell Biol. 145, 305–315.

Alkuraya, F.S., Cai, X., Emery, C., Mochida, G.H., Al-Dosari, M.S., Felie, J.M.,

Hill, R.S., Barry, B.J., Partlow, J.N., Gascon, G.G., et al. (2011). Human muta-

tions in NDE1 cause extrememicrocephaly with lissencephaly [corrected]. Am.

J. Hum. Genet. 88, 536–547.

Anderson, C.T., and Stearns, T. (2009). Centriole age underlies asynchronous

primary cilium growth in mammalian cells. Curr. Biol. 19, 1498–1502.

Arquint, C., and Nigg, E.A. (2014). STIL microcephaly mutations interfere with

APC/C-mediated degradation and cause centriole amplification. Curr. Biol. 24,

351–360.

Ayoub, A.E., Oh, S., Xie, Y., Leng, J., Cotney, J., Dominguez, M.H., Noonan,

J.P., and Rakic, P. (2011). Transcriptional programs in transient embryonic

zones of the cerebral cortex defined by high-resolution mRNA sequencing.

Proc. Natl. Acad. Sci. USA 108, 14950–14955.

Bakircio�glu, M., Carvalho, O.P., Khurshid, M., Cox, J.J., Tuysuz, B., Barak, T.,

Yilmaz, S., Caglayan, O., Dincer, A., Nicholas, A.K., et al. (2011). The essential

role of centrosomal NDE1 in human cerebral cortex neurogenesis. Am. J. Hum.

Genet. 88, 523–535.

Balczon, R., Bao, L., Zimmer, W.E., Brown, K., Zinkowski, R.P., and Brinkley,

B.R. (1995). Dissociation of centrosome replication events from cycles of DNA

merary Cilia with Abrogated Shh Signaling

inein (top) and Cep164 (bottom). Scale bar, 10 um.

ht), while wild-type MEFs grow only a single cilium (left). Arrowheads, super-

to the cilium, indicating a deficit in Sonic hedgehog signaling (right). Wild-type

0 um.

). Error bars represent mean ± SEM. Unpaired t test, p < 0.01.

ired t test, p < 0.0001.

ed at lower levels following SAG stimulation in gt/gt MEFs compared with wild-

0 um.

w similar Smoothened (Smo) localization to the cilium. Scale bar, 10 um.



Neuron


synthesis and mitotic division in hydroxyurea-arrested Chinese hamster ovary

cells. J. Cell Biol. 130, 105–115.

Baron, M.H. (2013). Concise Review: early embryonic erythropoiesis: not so

primitive after all. Stem Cells 31, 849–856.

Barrera, J.A., Kao, L.-R., Hammer, R.E., Seemann, J., Fuchs, J.L., and

Megraw, T.L. (2010). CDK5RAP2 regulates centriole engagement and cohe-

sion in mice. Dev. Cell 18, 913–926.

Belloni, E., Muenke, M., Roessler, E., Traverso, G., Siegel-Bartelt, J., Frumkin,

A., Mitchell, H.F., Donis-Keller, H., Helms, C., Hing, A.V., et al. (1996).

Identification of Sonic hedgehog as a candidate gene responsible for holopro-

sencephaly. Nat. Genet. 14, 353–356.

Blanchette, M., Kent, W.J., Riemer, C., Elnitski, L., Smit, A.F.A., Roskin, K.M.,

Baertsch, R., Rosenbloom, K., Clawson, H., Green, E.D., et al. (2004). Aligning

multiple genomic sequences with the threaded blockset aligner. Genome Res.

14, 708–715.

Bond, J., Roberts, E., Springell, K., Lizarraga, S.B., Scott, S., Higgins, J.,

Hampshire, D.J., Morrison, E.E., Leal, G.F., Silva, E.O., et al. (2005). A centro-

somal mechanism involving CDK5RAP2 and CENPJ controls brain size. Nat.

Genet. 37, 353–355.

Casanova, M., Crobu, L., Blaineau, C., Bourgeois, N., Bastien, P., and Pages,

M. (2009). Microtubule-severing proteins are involved in flagellar length control

and mitosis in Trypanosomatids. Mol. Microbiol. 71, 1353–1370.

Chiang, C., Litingtung, Y., Lee, E., Young, K.E., Corden, J.L., Westphal, H., and

Beachy, P.A. (1996). Cyclopia and defective axial patterning in mice lacking

Sonic hedgehog gene function. Nature 383, 407–413.

Cooper, G.M., Stone, E.A., Asimenos, G., Green, E.D., Batzoglou, S., and

Sidow, A.; NISC Comparative Sequencing Program (2005). Distribution and in-

tensity of constraint in mammalian genomic sequence. Genome Res. 15,

901–913.

Cridland, S.O., Keys, J.R., Papathanasiou, P., and Perkins, A.C. (2009). Indian

hedgehog supports definitive erythropoiesis. Blood Cells Mol. Dis. 43,

149–155.

Davydov, E.V., Goode, D.L., Sirota, M., Cooper, G.M., Sidow, A., and

Batzoglou, S. (2010). Identifying a high fraction of the human genome to be

under selective constraint using GERP++. PLoS Comput. Biol. 6, e1001025.

Dubourg, C., Bendavid, C., Pasquier, L., Henry, C., Odent, S., and David, V.

(2007). Holoprosencephaly. Orphanet J. Rare Dis. 2, 8.

Dymek, E.E., and Smith, E.F. (2012). PF19 encodes the catalytic subunit of

katanin, p60, and is required for assembly of the flagellar central apparatus

in Chlamydomonas. J. Cell Sci. 125, 3357–3366.

Feng, Y., and Walsh, C.A. (2004). Mitotic spindle regulation by Nde1 controls

cerebral cortical size. Neuron 44, 279–293.

Firat-Karalar, E.N., Rauniyar, N., Yates, J.R., 3rd, and Stearns, T. (2014).

Proximity interactions among centrosome components identify regulators of

centriole duplication. Curr. Biol. 24, 664–670.

Greig, L.C., Woodworth, M.B., Galazo, M.J., Padmanabhan, H., and Macklis,

J.D. (2013). Molecular logic of neocortical projection neuron specification,

development and diversity. Nat. Rev. Neurosci. 14, 755–769.

Habedanck, R., Stierhof, Y.-D., Wilkinson, C.J., and Nigg, E.A. (2005). The Polo

kinase Plk4 functions in centriole duplication. Nat. Cell Biol. 7, 1140–1146.

Hartman, J.J., Mahr, J., McNally, K., Okawa, K., Iwamatsu, A., Thomas, S.,

Cheesman, S., Heuser, J., Vale, R.D., and McNally, F.J. (1998). Katanin, a

microtubule-severing protein, is a novel AAAATPase that targets to the centro-

some using a WD40-containing subunit. Cell 93, 277–287.

Hayhurst, M., and McConnell, S.K. (2003). Mouse models of holoprosence-

phaly. Curr. Opin. Neurol. 16, 135–141.

Higginbotham, H., Guo, J., Yokota, Y., Umberger, N.L., Su, C.-Y., Li, J., Verma,

N., Hirt, J., Ghukasyan, V., Caspary, T., and Anton, E.S. (2013). Arl13b-regu-

lated cilia activities are essential for polarized radial glial scaffold formation.

Nat. Neurosci. 16, 1000–1007.

Hildebrandt, F., Benzing, T., and Katsanis, N. (2011). Ciliopathies. N. Engl. J.

Med. 364, 1533–1543.


Hu, W.F., Chahrour, M.H., and Walsh, C.A. (2014). The diverse genetic land-

scape of neurodevelopmental disorders. Annu. Rev. Genomics Hum. Genet.

15, 195–213.

Huangfu, D., and Anderson, K.V. (2005). Cilia and Hedgehog responsiveness

in the mouse. Proc. Natl. Acad. Sci. USA 102, 11325–11330.

Huangfu, D., Liu, A., Rakeman, A.S., Murcia, N.S., Niswander, L., and

Anderson, K.V. (2003). Hedgehog signalling in themouse requires intraflagellar

transport proteins. Nature 426, 83–87.

Karabay, A., Yu, W., Solowska, J.M., Baird, D.H., and Baas, P.W. (2004).

Axonal growth is sensitive to the levels of katanin, a protein that severs micro-

tubules. J. Neurosci. 24, 5778–5788.

Karolchik, D., Barber, G.P., Casper, J., Clawson, H., Cline, M.S., Diekhans, M.,

Dreszer, T.R., Fujita, P.A., Guruvadoo, L., Haeussler, M., et al. (2014). The

UCSC Genome Browser database: 2014 update. Nucleic Acids Res. 42

(Database issue), D764–D770.

Khodjakov, A., Rieder, C.L., Sluder, G., Cassels, G., Sibon, O., and Wang,

C.-L. (2002). De novo formation of centrosomes in vertebrate cells arrested

during S phase. J. Cell Biol. 158, 1171–1181.

Kim, S., Zaghloul, N.A., Bubenshchikova, E., Oh, E.C., Rankin, S., Katsanis, N.,

Obara, T., and Tsiokas, L. (2011). Nde1-mediated inhibition of ciliogenesis

affects cell cycle re-entry. Nat. Cell Biol. 13, 351–360.

Kleylein-Sohn, J., Westendorf, J., Le Clech, M., Habedanck, R., Stierhof,

Y.-D., and Nigg, E.A. (2007). Plk4-induced centriole biogenesis in human cells.

Dev. Cell 13, 190–202.

La Terra, S., English, C.N., Hergert, P., McEwen, B.F., Sluder, G., and

Khodjakov, A. (2005). The de novo centriole assembly pathway in HeLa cells:

cell cycle progression and centriole assembly/maturation. J. Cell Biol. 168,

713–722.

Lee, J.E., and Gleeson, J.G. (2011). Cilia in the nervous system: linking cilia

function and neurodevelopmental disorders. Curr. Opin. Neurol. 24, 98–105.

Lehtinen, M.K., Zappaterra, M.W., Chen, X., Yang, Y.J., Hill, A.D., Lun, M.,

Maynard, T., Gonzalez, D., Kim, S., Ye, P., et al. (2011). The cerebrospinal fluid

provides a proliferative niche for neural progenitor cells. Neuron 69, 893–905.

Lin, Y.-N., Wu, C.-T., Lin, Y.-C., Hsu, W.-B., Tang, C.-J.C., Chang, C.-W., and

Tang, T.K. (2013). CEP120 interacts with CPAP and positively regulates

centriole elongation. J. Cell Biol. 202, 211–219.

Lindeboom, J.J., Nakamura, M., Hibbel, A., Shundyak, K., Gutierrez, R.,

Ketelaar, T., Emons, A.M.C., Mulder, B.M., Kirik, V., and Ehrhardt, D.W.

(2013). A mechanism for reorientation of cortical microtubule arrays driven

by microtubule severing. Science 342, 1245533.

Litingtung, Y., Dahn, R.D., Li, Y., Fallon, J.F., and Chiang, C. (2002). Shh and

Gli3 are dispensable for limb skeleton formation but regulate digit number

and identity. Nature 418, 979–983.

Lizarraga, S.B., Margossian, S.P., Harris, M.H., Campagna, D.R., Han, A.-P.,

Blevins, S., Mudbhary, R., Barker, J.E., Walsh, C.A., and Fleming, M.D.

(2010). Cdk5rap2 regulates centrosome function and chromosome segrega-

tion in neuronal progenitors. Development 137, 1907–1917.

Loncarek, J., Hergert, P., Magidson, V., and Khodjakov, A. (2008). Control of

daughter centriole formation by the pericentriolar material. Nat. Cell Biol. 10,

322–328.

Loughlin, R., Wilbur, J.D., McNally, F.J., Nedelec, F.J., and Heald, R. (2011).

Katanin contributes to interspecies spindle length scaling in Xenopus. Cell

147, 1397–1407.

Lui, J.H., Hansen, D.V., and Kriegstein, A.R. (2011). Development and evolu-

tion of the human neocortex. Cell 146, 18–36.

Mahjoub, M.R. (2013). The importance of a single primary cilium.

Organogenesis 9, 61–69.

Mahjoub, M.R., and Stearns, T. (2012). Supernumerary centrosomes nucleate

extra cilia and compromise primary cilium signaling. Curr. Biol. 22, 1628–1634.

Mahmood, S., Ahmad, W., and Hassan, M.J. (2011). Autosomal Recessive

Primary Microcephaly (MCPH): clinical manifestations, genetic heterogeneity

and mutation continuum. Orphanet J. Rare Dis. 6, 39.

.

Neuron


Mains, P.E., Kemphues, K.J., Sprunger, S.A., Sulston, I.A., and Wood, W.B.

(1990). Mutations affecting the meiotic and mitotic divisions of the early

Caenorhabditis elegans embryo. Genetics 126, 593–605.

Mao, C.-X., Xiong, Y., Xiong, Z., Wang, Q., Zhang, Y.Q., and Jin, S. (2014).

Microtubule-severing protein Katanin regulates neuromuscular junction devel-

opment and dendritic elaboration in Drosophila. Development 141, 1064–

1074.

Marthiens, V., Rujano, M.A., Pennetier, C., Tessier, S., Paul-Gilloteaux, P., and

Basto, R. (2013). Centrosome amplification causes microcephaly. Nat. Cell

Biol. 15, 731–740.

McNally, F.J., and Vale, R.D. (1993). Identification of katanin, an ATPase that

severs and disassembles stable microtubules. Cell 75, 419–429.

McNally, K.P., Bazirgan, O.A., and McNally, F.J. (2000). Two domains of p80

katanin regulate microtubule severing and spindle pole targeting by p60 kata-

nin. J. Cell Sci. 113, 1623–1633.

McNally, K., Audhya, A., Oegema, K., and McNally, F.J. (2006). Katanin con-

trols mitotic and meiotic spindle length. J. Cell Biol. 175, 881–891.

Mishra-Gorur, K., Ca�glayan, A.O., Schaffer, A.E., Chabu, C., Henegariu, O.,

Vonhoff, F., Akgumusx, G.T., Nishimura, S., Han, W., Tu, S., et al. (2014).

Mutations in KATNB1 cause complex cerebral malformations by disrupting

asymmetrically dividing neural progenitors. Neuron 84, this issue, 1226–1239.

Mount, S.M. (1982). A catalogue of splice junction sequences. Nucleic Acids

Res. 10, 459–472.

Neer, E.J., Schmidt, C.J., Nambudripad, R., and Smith, T.F. (1994). The

ancient regulatory-protein family of WD-repeat proteins. Nature 371, 297–300.

Nigg, E.A., and Raff, J.W. (2009). Centrioles, centrosomes, and cilia in health

and disease. Cell 139, 663–678.

Novarino, G., Akizu, N., and Gleeson, J.G. (2011). Modeling human disease in

humans: the ciliopathies. Cell 147, 70–79.

O’Donnell, L., Rhodes, D., Smith, S.J., Merriner, D.J., Clark, B.J., Borg, C.,

Whittle, B., O’Connor, A.E., Smith, L.B., McNally, F.J., et al. (2012). An essen-

tial role for katanin p80 and microtubule severing in male gamete production.

PLoS Genet. 8, e1002698.

Oh, E.C., and Katsanis, N. (2012). Cilia in vertebrate development and disease.

Development 139, 443–448.

Paridaen, J.T.M.L., Wilsch-Brauninger, M., and Huttner, W.B. (2013).

Asymmetric inheritance of centrosome-associated primary cilium membrane

directs ciliogenesis after cell division. Cell 155, 333–344.

Peel, N., Stevens, N.R., Basto, R., and Raff, J.W. (2007). Overexpressing

centriole-replication proteins in vivo induces centriole overduplication and

de novo formation. Curr. Biol. 17, 834–843.

Peel, N., Dougherty, M., Goeres, J., Liu, Y., and O’Connell, K.F. (2012). The C.

elegans F-box proteins LIN-23 and SEL-10 antagonize centrosome duplica-

tion by regulating ZYG-1 levels. J. Cell Sci. 125, 3535–3544.

Piotrowska-Nitsche, K., and Caspary, T. (2012). Live imaging of individual cell

divisions in mouse neuroepithelium shows asymmetry in cilium formation and

Sonic hedgehog response. Cilia 1, 6.

Rasi, M.Q., Parker, J.D.K., Feldman, J.L., Marshall, W.F., and Quarmby, L.M.

(2009). Katanin knockdown supports a role for microtubule severing in release

of basal bodies before mitosis in Chlamydomonas. Mol. Biol. Cell 20, 379–388.

Roessler, E., Belloni, E., Gaudenz, K., Jay, P., Berta, P., Scherer, S.W., Tsui,

L.C., and Muenke, M. (1996). Mutations in the human Sonic Hedgehog gene

cause holoprosencephaly. Nat. Genet. 14, 357–360.

Ne

Saade, M., Gutierrez-Vallejo, I., Le Dreau, G., Rabadan, M.A., Miguez, D.G.,

Buceta, J., and Martı, E. (2013). Sonic hedgehog signaling switches the

mode of division in the developing nervous system. Cell Rep. 4, 492–503.

Senapathy, P., Shapiro, M.B., and Harris, N.L. (1990). Splice junctions, branch

point sites, and exons: sequence statistics, identification, and applications to

genome project. Methods Enzymol. 183, 252–278.

Shi, Q., and King, R.W. (2005). Chromosome nondisjunction yields tetraploid

rather than aneuploid cells in human cell lines. Nature 437, 1038–1042.

Srayko, M., O’toole, E.T., Hyman, A.A., and Muller-Reichert, T. (2006). Katanin

disrupts the microtubule lattice and increases polymer number in C. elegans

meiosis. Curr. Biol. 16, 1944–1949.

Strnad, P., Leidel, S., Vinogradova, T., Euteneuer, U., Khodjakov, A., and

Gonczy, P. (2007). Regulated HsSAS-6 levels ensure formation of a single pro-

centriole per centriole during the centrosome duplication cycle. Dev. Cell 13,

203–213.

Tang, C.-J.C., Lin, S.-Y., Hsu, W.-B., Lin, Y.-N., Wu, C.-T., Lin, Y.-C., Chang,

C.-W., Wu, K.-S., and Tang, T.K. (2011). The humanmicrocephaly protein STIL

interacts with CPAP and is required for procentriole formation. EMBO J. 30,

4790–4804.

Thornton, G.K., and Woods, C.G. (2009). Primary microcephaly: do all roads

lead to Rome? Trends Genet. 25, 501–510.

Tong, C.K., Han, Y.-G., Shah, J.K., Obernier, K., Guinto, C.D., and Alvarez-

Buylla, A. (2014). Primary cilia are required in a unique subpopulation of neural

progenitors. Proc. Natl. Acad. Sci. USA 111, 12438–12443.

Toyo-Oka, K., Sasaki, S., Yano, Y., Mori, D., Kobayashi, T., Toyoshima, Y.Y.,

Tokuoka, S.M., Ishii, S., Shimizu, T., Muramatsu, M., et al. (2005).

Recruitment of katanin p60 by phosphorylated NDEL1, an LIS1 interacting

protein, is essential for mitotic cell division and neuronal migration. Hum.

Mol. Genet. 14, 3113–3128.

Tsang, W.Y., Spektor, A., Vijayakumar, S., Bista, B.R., Li, J., Sanchez, I.,

Duensing, S., and Dynlacht, B.D. (2009). Cep76, a centrosomal protein that

specifically restrains centriole reduplication. Dev. Cell 16, 649–660.

Wang, X., Tsai, J.-W., Imai, J.H., Lian, W.-N., Vallee, R.B., and Shi, S.-H.

(2009). Asymmetric centrosome inheritance maintains neural progenitors in

the neocortex. Nature 461, 947–955.

Willaredt, M.A., Hasenpusch-Theil, K., Gardner, H.A.R., Kitanovic, I.,

Hirschfeld-Warneken, V.C., Gojak, C.P., Gorgas, K., Bradford, C.L., Spatz,

J., Wolfl, S., et al. (2008). A crucial role for primary cilia in cortical morphogen-

esis. J. Neurosci. 28, 12887–12900.

Wong, C., and Stearns, T. (2003). Centrosome number is controlled by a

centrosome-intrinsic block to reduplication. Nat. Cell Biol. 5, 539–544.

Yu, W., Solowska, J.M., Qiang, L., Karabay, A., Baird, D., and Baas, P.W.

(2005). Regulation of microtubule severing by katanin subunits during neuronal

development. J. Neurosci. 25, 5573–5583.

Zhang, Z., Li, J., Zhao, X.-Q., Wang, J., Wong, G.K.-S., and Yu, J. (2006).

KaKs_Calculator: calculating Ka and Ks through model selection and model

averaging. Genomics Proteomics Bioinformatics 4, 259–263.

Zhang, D., Grode, K.D., Stewman, S.F., Diaz-Valencia, J.D., Liebling, E., Rath,

U., Riera, T., Currie, J.D., Buster, D.W., Asenjo, A.B., et al. (2011). Drosophila

katanin is a microtubule depolymerase that regulates cortical-microtubule

plus-end interactions and cell migration. Nat. Cell Biol. 13, 361–370.

Zhang, Q., Fishel, E., Bertroche, T., and Dixit, R. (2013). Microtubule severing

at crossover sites by katanin generates ordered cortical microtubule arrays in

Arabidopsis. Curr. Biol. 23, 2191–2195.


Neuron, Volume 84

Supplemental Information

Katanin p80 Regulates Human Cortical Development by Limiting Centriole and Cilia Number Wen F. Hu, Oz Pomp, Tawfeg Ben-Omran, Andrew Kodani, Katrin Henke, Ganeshwaran H. Mochida, Timothy W. Yu, Mollie B. Woodworth, Carine Bonnard, Grace Selva Raj, Thong Teck Tan, Hanan Hamamy, Amira Masri, Mohammad Shboul, Muna Al Saffar, Jennifer N. Partlow, Mohammed Al-Dosari, Anas Alazami, Mohammed Alowain, Fowzan S. Alkuraya, Jeremy F. Reiter, Matthew P. Harris, Bruno Reversade, and Christopher A. Walsh

Supplemental Figures and Figure Legends

Supplemental Figure S1, related to Figure 1. KATNB1 affected individuals have

small head circumference relative to height and weight.

(A) Affected KATNB1 individuals show sloping foreheads indicative of reduced cranial

size, and facial dysmorphisms.

(B-D) KATNB1 affected individuals display head circumference well below 0.1st

percentile for ages between birth and five years, disproportionate to height and weight.

Proband data fitted with logarithmic regression line. Proband 1, purple; Proband 1

cousin (female), green; Proband 1 cousin (male), dark blue; Proband 2, red; Proband 3,

orange. Standard growth curves from World Health Organization data(WHO Multicentre

Growth Reference Study Group, 2006)

(E) Homozygosity mapping in Family 1 identifies a single shared identical-by-descent

(IBD) locus on Chromosome 16.

(F-F’’) Sanger sequencing traces showing homozygous mutations in probands and

heterozygous changes in the unaffected parents and siblings.

3

Supplemental Movie S1, related to Figure 1. MRI scans of Proband 2. Full sagittal,

axial and coronal inversion recovery MRI sequences of Proband 2 show reduced brain

size, simplification of gyral folding pattern, enlarged lateral ventricles posteriorly and

thinning of the corpus callosum, with sparing of the cerebellum, basal ganglia, thalamus

and brainstem.

5

Supplemental Figure S2, related to Figure 2. Characterization of iPSC colonies

and Family 1 mutation.

(A) Characterization of representative human iPSC colonies derived from Proband

1. Colonies with ES-like morphology were manually picked 4-5 weeks post-infection.

Several representative clones were characterized. These clones expressed pluripotency

markers, including surface antigens TRA1-60, TRA-1-81 and SSEA4, as well as the

nuclear transcription factors OCT4 and SOX2.

(B) Initiator codon mutation in Family 1 is predicted to result in N-terminal truncation of

56 amino acids. Asterisks, conserved residues.

7

Supplemental Figure S3, related to Figure 4. Sequences and characterization of

zebrafish katnb1 mutant alleles.

(A) Multiple sequence alignment of the human, mouse and zebrafish Katnb1, showing a

high level of conservation of the protein sequence between the species.

(B) Summary of identified TALEN-induced mutations in zebrafish katnb1. Genomic

region surrounding the exon 6 - intron 6 boundary in zebrafish is highlighted. TALEN

recognition sites are marked with blue boxes; exonic sequence (capital letters); intronic

sequence (lowercase). Wild-type sequence is listed above and the sequences of

identified alleles are detailed below; deleted base pairs (red dashes); inserted base

pairs (red letters). The effect on the genomic sequence is summarized to the right of

each sequence: - deletion; + insertion; presence (+) or absence (Δ) of the splice site;

allele names; frequency of the allele in 288 fish analyzed.

(C) Progeny from homozygous female carriers of katnb1 mutations develop normally

through epiboly. Summary of phenotypes appearing at 24 hpf ranging from mild

microcephaly, anencephaly and disrupted embryos.

9

Supplemental Figure S4, related to Figure 5. Katanin p80 in neural progenitor

cells.

(A) Apical complex marker, beta-catenin, localizes to the ventricular surface in both

wild-type and gene-trap developing mouse cortex, indicating intact cellular polarity.

Scale bar, 10 um.

(B) Neurospheres derived from Proband 1 iPSCs fail to grow. Scale bar, 100 um.

(C) Growth curves for neurospheres derived from Proband 1 and control. Two-way

ANOVA, p<0.0001.

(D) Neurospheres derived from Proband 1 show abundant apoptosis compared to

control cells. Scale bar, 100 um.

11

Supplemental Figure S5, related to Figure 6. Endogenous katanin complex

localizes to the centrosome and spindle pole.

(A) Endogenous katanin p80 and p60 localize to the spindle poles of mitotic HEK293T

cells. Scale bar, 10 um.

(B-C) Endogenous katanin p80 and p60 localize to the spindle poles of mitotic iPS cells

(B), and to the centrosome of interphase neural stem cells (NSCs) differentiated from

iPSCs (C). Localization is lost in mutant iPSCs and NSCs derived from Proband 1.

Scale bar, 10 um.

13

Supplemental Figure S6, related to Figure 7. Ultrastructural analysis of centrioles

and cytoskeletal immunohistochemistry.

(A) Gene-trap MEF centrosomes contain multiple unpaired centrioles by transmission

electron microscopy. Arrowhead, centriole. Scale bar, 200 nm.

(B) Cross-section of gene-trap MEF centriole shows normal 9-fold symmetry.

Arrowhead, centriole. Scale bar, 200 nm.

(C) Homozygous gt/gt MEFs fail to proliferate. Fisher’s exact test, p=0.03.

(D) Gene-trap MEF cytoskeleton is comprised of increased acetylated tubulin. Scale

bar, 10 um.

(E) Gene-trap MEFs exhibit increased staining for CAMSAP2, a microtubule minus-end

stabilizing protein. Scale bar, 10 um.

(F) Gene-trap MEFs show increased linear staining for EB1, a microtubule plus-end

protein, compared to the shorter, more puncta-like staining in wild-type MEFs. Scale

bar, 10 um.

15

Supplemental Figure S7, related to Figure 8. Cilia in neural progenitor cells.

(A) After stimulation by Smoothened agonist (SAG), gt/gt MEFs show reduced

Smoothened (Smo) localization to the cilium, indicating a deficit in Sonic hedgehog

signaling (right). Wild-type MEFs robustly relocate Smo to the cilium after SAG

stimulation (left). Scale bar, 10 um.

17

Supplemental Table S1, related to Figure 1. Clinical summary of affected

individuals.

Individual Proband 1 Proband 1 cousin Proband 1 cousin Proband 2 Proband 3Gender Male Female Male, deceased at 5 months Male Male

Parental consanguinity Yes Yes Yes Yes None reported, distant relation suspected based on homozygosity mapping

Prenatal and birth history Full term normal spontaneous vaginal delivery

Born by Caesarian section, no NICU admission

Unknown Unremarkable, full term normal spontaneous vaginal delivery

Microcephaly noted in 2nd trimester, full term normal spontaneous vaginal delivery

Head circumference at birth 30 cm (-‐3.5 SD) 27 cm (-‐5.9 SD) 27 cm (-‐5.9 SD) 29.5 cm (-‐3.9 SD) UnknownWeight at birth 3.7 kg (75th percentile) 3 kg (25th percentile) Unknown 3.3 kg (50th percentile) 3.2 kg (40th percentile)Length at birth Unknown Unknown Unknown 47 cm (-‐1.5 SD) UnknownAge at first evaluation 1 year old 9 months Unknown 3 months 8 monthsHead circumference at first evaluation 38 cm (-‐6.3 SD) 32 cm (-‐10.3 SD) Unknown 34.3 cm (-‐5.3 SD) 34 cm (-‐8.5 SD)Weight at first evaluation Unknown Unknown Unknown 7.2 kg (85th percentile) 6.8 kg (2nd percentile)Length at first evaluation Unknown Unknown Unknown 59.5 cm (-‐0.9 SD) 63 cm (-‐3.5 SD)Age at most recent evaluation 10 years 10 years Not applicable 3 years 4 yearsHead circumference at most recent evaluation

42.5 cm 41 cm Not applicable 39 cm (-‐7.4 SD) 39 cm (-‐7.7 SD)

Weight at most recent evaluation 22 kg 24 kg Not applicable 13 kg (20th percentile) 11.8 kg (0.5th percentile)Length at most recent evaluation 118.5 cm 120 cm Not applicable 90 cm (-‐1.6 SD) Unknown

Neurologic findings Spasticity in achilles tendon bilaterally

Increased tone in achilles tendon bilaterally with exaggerated deep tendon reflexes (+3) in knees and ankles, no clonus, babinski is downwards

Not applicable Spastic quadriplegia Mild hypertonia, increased deep tendon reflexes

Developmental history 10 years old: sitting alone, does not walk, no words (global delay )

10 years old: sitting alone, does not walk, no words

Not applicable Severe and global delay, no speech Head control at 1 year, rolled at 1.25 years, unable to sit unsupported at 4 years, no speech

Seizures 9 years old: seizures in the form of uprolling of eyes with decreased tone all over. Repeated after 6 months, treated with valproic acid

Developed seizures only once at the age of 7 years with cyanosis , uprolling of eyes and tonic contraction of upper limbs and lower limbs

Not applicable Yes, generalized tonic-‐clonic, onset 1 year, treated with Keppra

Yes, onset at 21 months, treated with phenobarbital

Hearing Grossly normal Grossly normal Not applicable Grossly normal Mild hearing loss at 45dB

Vision Grossly normal Grossly normal Not applicable Grossly normal (examined in a private clinic, report not available)

Bilateral vision loss with disc pallor and macular lesions

Dysmorphic features Microcephaly with decreased cranio-‐facial ratio and small cranial vault, large ears, synephrous

Microcephaly with decreased cranio-‐facial ratio and small cranial vault, large ears, synephrous, bulbous nose, almond eyes, big mouth

Not applicable Facial features consistent with microcephaly, single palmar creases, secondary craniosynostosis

Sloping forehead, round face, arched eyebrows, small nose with anteverted nares, thin upper lip, widely spaced teeth, increased internipplary distance, tapered fingers, small testes

Brain imaging MRI at 1 year and 11 years MRI at 10 years old Not applicable MRI at 17 months MRI at 11 months

cerebral cortex Simplification of the gyral pattern with thickened cortex (packygyria), broad flat gyri, smooth grey-‐white matter interface, brain atrophy

Simplification of the gyral pattern with thickened cortex (packygyria), broad flat gyri, smooth grey-‐white matter interface, shallow sylvian fissure

Moderately to severely simplified gyral pattern, normal cortical thickness

Severely simplified gyral pattern, normal cortical thickness

basal ganglia and thalami Grossly normal Grossly normal Grossly normal Grossly normal basal ganglia, small thalami

corpus callosum Partial agenesis of body and splenium (genu present)

Agenesis of the body and splenium (genu present), hypomyelination is noted

Partial agenesis (genu and body present)

Partial agenesis (only genu present)

ventricles Prominent ventricles enlarged ventricles (colpocephaly)

Enlarged ventricle (colpocephaly), the 4th ventricle is communicating with an enlarged cisterna magna, through a slit-‐like opening finding representing Dandy-‐Walker variant

Enlarged posteriorly Enlarged posteriorly, periventricular heterotopia

cerebellum and brain stem Atrophy involving the cerebellum and cerebellar vermis

Atrophy involving the cerebellum and cerebellar vermis

Grossly normal, enlarged cisterna magna

Grossly normal, enlarged cisterna magna

Other findings None None Not applicable None Oral pharyngeal dysphagia, elevated liver enzymes

Normal screening tests Blood Not available Not applicable Abdominal ultrasound Karyotype, toxoplasma, rubella, cytomegalovirus, herpes simplex, HIV, complete blood count, serum electrolytes, renal and thyroid function tests, creatine kinase, abdominal ultrasound

19

Supplemental Table S2, related to Figure 4. Plasmid and protein sequences of

TALENs used to generate zebrafish katnb1 mutants.

katnb1-L Plasmid sequence: gctgcttcgcgatgtacgggccagatatacgcgtggctccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattgaaccggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacaatttaggtgacactatagaagctagcgtttaaacttaagctgatccactagtccagtgtggtggaattcgccatggactacaaagaccatgacggtgattataaagatcatgacatcgattacaaggatgacgatgacaagatggcccccaagaagaagaggaaggtgggcatccacggggtacccatggtagatttgagaactttgggatattcacagcagcagcaggaaaagatcaagcccaaagtgaggtcgacagtcgcgcagcatcacgaagcgctggtgggtcatgggtttacacatgcccacatcgtagccttgtcgcagcaccctgcagcccttggcacggtcgccgtcaagtaccaggacatgattgcggcgttgccggaagccacacatgaggcgatcgtcggtgtggggaaacagtggagcggagcccgagcgcttgaggccctgttgacggtcgcgggagagctgagagggcctccccttcagctggacacgggccagttgctgaagatcgcgaagcggggaggagtcacggcggtcgaggcggtgcacgcgtggcgcaatgcgctcacgggagcacccctcaacCTGACCCCAGAGCAGGTCGTGGCCATTGCCTCGAATGGAGGGGGCAAACAGGCGTTGGAAACCGTACAACGATTGCTGCCGGTGCTTTGTCAGGCACACGGCCTCACTCCGGAACAAGTGGTCGCCATTGCCTCGAATGGAGGGGGCAAACAGGCGTTGGAAACCGTACAACGATTGCTGCCGGTGCTGTGCCAAGCGCACGGTTTAACCCCAGAGCAGGTCGTGGCCATTGCCTCGAATGGAGGGGGCAAACAGGCGTTGGAAACCGTACAACGATTGCTGCCGGTGCTTTGTCAGGCACACGGCCTCACTCCGGAACAAGTGGTCGCAATCGCGAGCAATAACGGCGGAAAACAGGCTTTGGAAACGGTGCAGAGGCTCCTTCCAGTGCTGTGCCAAGCGCACGGCCTCACCCCAGAGCAGGTCGTGGCAATCGCCTCCAACATTGGCGGGAAACAGGCACTCGAGACTGTCCAGCGCCTGCTTCCCGTGCTTTGTCAGGCACACGGCCTCACTCCGGAACAAGTGGTCGCGATCGCAAGCCACGACGGAGGAAAGCAAGCCTTGGAAACAGTACAGAGGCTGTTGCCTGTGC TGTGCCAAGCGCACGGATTAACCCCAGAGCAGGTCGTGGCAATCGCCTCCAACATTGGCGGGAAACAGGCACTCGAGACTGTCCAGCGCCTGCTTCCCGTGCTTTGTCAGGCACACGGCCTCACTCCGGAACAAGTGGTCGCAATCGCCTCCAACATTGGCGGGAAACAGGCACTCGAGACTGTCCAGCGCCTGCTTCCCGTGCTGTGCCAAGCGCACGGACTTACCCCAGAGCAGGTCGTGGCCATTGCCTCGAATGGAGGGGGCAAACAGGCGTTGGAAACCGTACAACGATTGCTGCCGGTGCTGTGCCAAGCGCACGGCCTTACCCCAGAGCAGGTCGTGGCGATCGCAAGCCACGACGGAGGAAAGCAAGCCTTGGAAACAGTACAGAGGCTGTTGCCTGTGCTGTGCCAAGCGCACGGACTAACCCCAGAGCAGGTCGTGGCGATCGCAAGCCACGACGGAGGAAAGCAAGCCTTGGAAACAGTACAGAGGCTGTTGCCTGTGCTGTGCCAAGCGCACGGGCTCACCCCAGAGCAGGTCGTGGCAATCGCCTCCAACATTGGCGGGAAACAGGCACTCGAGACTGTCCAGCGCCTGCTTCCCGTGCTTTGTCAGGCACACGGCCTCACTCCGGAACAAGTGGTCGCAATCGCGAGCAATAACGGCGGAAAACAGGCTTTGGAAACGGTGCAGAGGCTCCTTCCAGTGCTGTGCCAAGCGCACGGGCTAACCCCAGAGCAGGTCGTGGCCATTGCCTCGAATGGAGGGGGCAAACAGGCGTTGGAAACCGTACAACGATTGCTGCCGGTGCTTTGTCAGGCACACGGCCTCACTCCGGAACAAGTGGTCGCAATCGCGAGCAATAACGGCGGAAAACAGGCTTTGGAAACGGTGCAGAGGCTCCTTCCAGTGCTGTGCCAAGCGCACGGActcacgcctgagcaggtagtggctattgcatccaatggagggggcagacccgcactggagtcaatcgtggcccagctttcgaggccggaccccgcgctggccgcactcactaatgatcatcttgtagcgctggcctgcctcggcggacgacccgccttggatgcggtgaagaaggggctcccgcacgcgcctgcattgattaagcggaccaacagaaggattcccgagaggacatcacatcgagtggcaggatcccagctggtgaagagcgagctggaggagaagaagtccgagctgcggcacaagctgaagtacgtgccccacgagtacatcgagctgatcgagatcgccaggaacagcacccaggaccgcatcctggagatgaaggtgatggagttcttcatgaaggtgtacggctacaggggaaagcacctgggcggaagcagaaagcctgacggcgccatctatacagtgggcagccccatcgattacggcgtgatcgtggacacaaaggcctacagcggcggctacaatctgcctatcggccaggccgacgagatggagagatacgtggaggagaaccagacccggaataagcacctcaaccccaacgagtggtggaaggtgtaccctagcagcgtgaccgagttcaagttcctgttcgtgagcggccacttcaagggcaactacaaggcccagctgaccaggctgaaccacatcaccaactgcaatggcgccgtgctgagcgtggaggagctgctgatcggcggcgagatgatcaaagccggcaccctgacactggaggaggtgcggcgcaagttcaacaacggcgagatcaacttcagatcttgataactcgagtttaaacccgctgatcagcctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcggtgggctctatgggcggccgccttctactgggcggttttatggacagcaagcgaaccggaattgccagctggggcgccctctggtaaggttgggaagccctgcaaagtaaactggatggctttcttgccgccaaggatctgatggcgcaggggatcaagctctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaagacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcacgggctcgcgccagccgaactgttcgccaggctcaaggcgagcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtgccggctggtgtggcggaccgctatcaggacatagcgttggctaccgtgatattgctgaagagcttgcgcgaatggctgacgcttctcgtgcttacggtatcgccgcctcccgatgcatcagtgcacttttcggggaaatgtgcgcgaccctatttgtttatttttctaatacatcaaatatgtatccgctcatgagacaataacctgataaatgcttcaataatagcacgtgctaaaacttcatttttaaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcctttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgt gcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggag aaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagt cctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcgg cctttttacggttcctggccttttgctggccttttgctcacatgttctt Protein: MDYKDHDGDYKDHDIDYKDDDDKMAPKKKRKVGIHGVPMVDLRTLGYSQQQQEKIKPKVRSTVAQHHEALVGHGFTHAHIVALSQHPAALGTVAVKYQDMIAALPEATHEAIVGVGKQWSGARALEALLTVAGELRGPPLQLDTGQLLKIAKRGGVTAVEAVHAWRNALTGAPLNLTPEQVVAIASNGGGKQALETVQRLLPVLCQAHGLTPEQVVAIASNGGGKQALETVQRLLPVLCQAHGLTPEQVVAIASNGGGKQALETVQRLLPVLCQAHGLTPEQVVAIASNNGGKQALETVQRLLPVLCQAHGLTPEQVVAIASNIGGKQALETVQRLLPVLCQAHGLTPEQVVAIASHDGGKQALETVQRLLPVLCQAHGLTPEQVVAIASNIGGKQALETVQRLLPVLCQAHGLTPEQVVAIASNIGGKQALETVQRLLPVLCQAHGLTPEQVVAIASNGGGKQALETVQRLLPVLCQAHGLTPEQVVAIASHDGGKQALETVQRLLPVLCQAHGLTPEQVVAIASHDGGKQALETVQRLLPVLCQAHGLTPEQVVAIASNIGGKQALETVQRLLPVLCQAHGLTPEQVVAIASNNGGKQALETVQRLLPVLCQAHGLTPEQVVAIASNGGGKQALETVQRLLPVLCQAHGLTPEQVVAIASNNGGKQALETVQRLLPVLCQAHGLTPEQVVAIASNGGGRPALESIVAQLSRPDPALAALTNDHLVALACLGGRPALDAVKKGLPHAPALIKRTNRRIPERTSHRVAGSQLVKSELEEKKSELRHKLKYVPHEYIELIEIARNSTQDRILEMKVMEFFMKVYGYRGKHLGGSRKPDGAIYTVGSPIDYGVIVDTKAYSGGYNLPIGQADEMERYVEENQTRNKHLNPNEWWKVYPSSVTEFKFLFVSGHFKGNYKAQLTRLNHITNCNGAVLSVEELLIGGEMIKAGTLTLEEVRRKFNNGEINFRS*

katnb1-R

Plasmid sequence: gctgcttcgcgatgtacgggccagatatacggctccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattgaaccggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacaatttaggtgacactatagaagctagcgtttaaacttaagctgatccactagtccagtgtggtggaattcgccatggactacaaagaccatgacggtgattataaagatcatgacatcgattacaaggatgacgatgacaagatggcccccaagaagaagaggaaggtgggcatccacggggtacccatggtagatttgagaactttgggatattcacagcagcagcaggaaaagatcaagcccaaagtgaggtcgacagtcgcgcagcatcacgaagcgctggtgggtcatgggtttacacatgcccacatcgtagccttgtcgcagcaccctgcagcccttggcacggtcgccgtcaagtaccaggacatgattgcggcgttgccggaagccacacatgaggcgatcgtcggtgtggggaaacagtggagcggagcccgagcgcttgaggccctgttgacggtcgcgggagagctgagagggcctccccttcagctggacacgggccagttgctgaagatcgcgaagcggggaggagtcacggcggtcgaggcggtgcacgcgtggcgcaatgcgctcacgggagcacccctcaacCTGACCCCAGAGCAGGTCGTGGCGATCGCAAGCCACGACGGAGGAAAGCAAGCCTTGGAAACAGTACAGAGGCTGTTGCCTGTGCTTTGTCAGGCACACGGCCTCACTCCGGAACAAGTGGTCGCAATCGCCTCCAACATTGGCGGGAAACAGGCACTCGAGACTGTCCAGCGCCTGCTTCCCGTGCTGTGCCAAGCGCACGGTTTAACCCCAGAGCAGGTCGTGGCAATCGCGAGCAATAACGGCGGAAAACAGGCTTTGGAAACGGTGCAGAGGCTCCTTCCAGTGCTTTGTCAGGCACACGGCCTCACTCCGGAACAAGTGGTCGCGATCGCAAGCCACGACGGAGGAAAGCAAGCCTTGGAAACAGTACAGAGGCTGTTGCCTGTGCTGTGCCAAGCGCACGGCCTCACCCCAGAGCAGGTCGTGGCCATTGCCTCGAATGGAGGGGGCAAACAGGCGTTGGAAACCGTACAACGATTGCTGCCGGTGCTTTGTCAGGCACACGGCCTCACTCCGGAACAAGTGGTCGCCATTGCCTCGAATGGAGGGGGCAAACAGGCGTTGGAAACCGTACAACGATTGCTGCCGGTGCTGTGCCAAGCGCACGGATTAACCCCAGAGCAGGTCGTGGCAATCGCCTCCAACATTGGCGGGAAACAGGCACTCGAGACTGTCCAGCGCCTGCTTCCCGTGCTTTGTCAGGCACACGGCCTCACTCCGGAACAAGTGGTCGCAATCGCGAGCAATAACGGCGGAAAACAGGCTTTGGAAACGGTGCAGAGGCTCCTTCCAGTGCTGTGCCAAGCGCACGGACTTACCCCAGAGCAGGTCGTGGCCATTGCCTCGAATGGAGGGGGCAAACAGGCGTTGGAAACCGTACAACGATTGCTGCCGGTGCTGTGCCAAGCGCACGGCCTTACCCCAGAGCAGGTCGTGGCAATCGCGAGCAATAACGGCGGAAAACAGGCTTTGGAAACGGTGCAGAGGCTCCTTCCAGTGCTGTGCCAAGCGCACGGACTAACCCCAGAGCAGGTCGTGGCGATCGCAAGCCACGACGGAGGAAAGCAAGCCTTGGAAACAGTACAGAGGCTGTTGCCTGTGCTGTGCCAAGCGCACGGGCTCACCCCAGAGCAGGTCGTGGCCATTGCCTCGAATGGAGGGGGCAAACAGGCGTTGGAAACCGTACAACGATTGCTGCCGGTGCTTTGTCAGGCACACGGCCTCACTCCGGAACAAGTGGTCGCCATTGCCTCGAATGGAGGGGGCAAACAGGCGTTGGAAACCGTACAACGATTGCTGCCGGTGCTGTGCCAAGCGCACGGGCTAACCCCAGAGCAGGTCGTGGCAATCGCCTCCAACATTGGCGGGAAACAGGCACTCGAGACTGTCCAGCGCCTGCTTCCCGTGCTTTGTCAGGCACACGGCCTCACTCCGGAACAAGTGGTCGCGATCGCAAGCCACGACGGAGGAAAGCAAGCCTTGGAAACAGTACAGAGGCTGTTGCCTGTGCTGTGCCAAGCGCACGGActcacgcctgagcaggtagtggctattgcatcccacgacgggggcagacccgcactggagtcaatcgtggcccagctttcgaggccggaccccgcgctggccgcactcactaatgatcatcttgtagcgctggcctgcctcggcggacgacccgccttggatgcggtgaagaaggggctcccgcacgcgcctgcattgattaagcggaccaacagaaggattcccgagaggacatcacatcgagtggcaggatcccagctggtgaagagcgagctggaggagaagaagtccgagctgcggcacaagctgaagtacgtgccccacgagtacatcgagctgatcgagatcgccaggaacagcacccaggaccgcatcctggagatgaaggtgatggagttcttcatgaaggtgtacggctacaggggaaagcacctgggcggaagcagaaagcctgacggcgccatctatacagtgggcagccccatcgattacggcgtgatcgtggacacaaaggcctacagcggcggctacaatctgcctatcggccaggccgacgagatgcagagatacgtgaaggagaaccagacccggaataagcacatcaaccccaacgagtggtggaaggtgtaccctagcagcgtgaccgagttcaagttcctgttcgtgagcggccacttcaagggcaactacaaggcccagctgaccaggctgaaccacaaaaccaactgcaatggcgccgtgctgagcgtggaggagctgctgatcggcggcgagatgatcaaagccggcaccctgacactggaggaggtgcggcgcaagttcaacaacggcgagatcaacttctgataactcgagtctagagggcccgtttaaacccgctgatcagcctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcggtgggctctatgggcggccgccttctactgggcggttttatggacagcaagcgaaccggaattgccagctggggcgccctctggtaaggttgggaagccctgcaaagtaaactggatggctttcttgccgccaaggatctgatggcgcaggggatcaagctctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaagacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcacgggctcgcgccagccgaactgttcgccaggctcaaggcgagcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtgccggctggtgtggcggaccgctatcaggacatagcgttggctaccgtgatattgctgaagagcttgcgcgaatggctgacgcttctcgtgcttacggtatcgccgcctcccgatgcatcagtgcacttttcggggaaatgtgcgcgaccctatttgtttatttttctaatacatcaaatatgtatccgctcatgagacaataacctgataaatgcttcaataatagcacgtgctaaaacttcatttttaaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcctttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctt Protein: MDYKDHDGDYKDHDIDYKDDDDKMAPKKKRKVGIHGVPMVDLRTLGYSQQQQEKIKPKVRSTVAQHHEALVGHGFTHAHIVALSQHPAALGTVAVKYQDMIAALPEATHEAIVGVGKQWSGARALEALLTVAGELRGPPLQLDTGQLLKIAKRGGVTAVEAVHAWRNALTGAPLNLTPEQVVAIASHDGGKQALETVQRLLPVLCQAHGLTPEQVVAIASNIGGKQALETVQRLLPVLCQAHGLTPEQVVAIASNNGGKQALETVQRLLPVLCQAHGLTPEQVVAIASHDGGKQALETVQRLLPVLCQAHGLTPEQVVAIASNGGGKQALETVQRLLPVLCQAHGLTPEQVVAIASNGGGKQALETVQRLLPVLCQAHGLTPEQVVAIASNIGGKQALETVQRLLPVLCQAHGLTPEQVVAIASNNGGKQALETVQRLLPVLCQAHGLTPEQVVAIASNGGGKQALETVQRLLPVLCQAHGLTPEQVVAIASNNGGKQALETVQRLLPVLCQAHGLTPEQVVAIASHDGGKQALETVQRLLPVLCQAHGLTPEQVVAIASNGGGKQALETVQRLLPVLCQAHGLTPEQVVAIASNGGGKQALETVQRLLPVLCQAHGLTPEQVVAIASNIGGKQALETVQRLLPVLCQAHGLTPEQVVAIASHDGGKQALETVQRLLPVLCQAHGLTPEQVVAIASHDGGRPALESIVAQLSRPDPALAALTNDHLVALACLGGRPALDAVKKGLPHAPALIKRTNRRIPERTSHRVAGSQLVKSELEEKKSELRHKLKYVPHEYIELIEIARNSTQDRILEMKVMEFFMKVYGYRGKHLGGSRKPDGAIYTVGSPIDYGVIVDTKAYSGGYNLPIGQADEMQRYVKENQTRNKHINPNEWWKVYPSSVTEFKFLFVSGHFKGNYKAQLTRLNHKTNCNGAVLSVEELLIGGEMIKAGTLTLEEVRRKFNNGEINF*

21

Extended Experimental Procedures

Human Subjects

We collected peripheral blood samples from the affected individuals and one or

both of their parents after obtaining written informed consent according to the protocols

approved by the participating institutions. All human studies were reviewed and

approved by the institutional review board of Boston Children’s Hospital, Harvard

Medical School and all local institutions.

Homozygosity Mapping, Exome Sequencing and Filtering in Family 1

Genomic DNA was extracted from saliva samples using the Oragen Purifier Kit.

Proband 1, the affected cousin, and their unaffected parents and siblings were

genotyped using Illumina Human OmniExpress 12v1 BeadChips following

manufacturer’s instructions. Call rates were above 99%. Gender and relationship were

verified using Illumina BeadStudio software. Mapping was performed by searching for

shared regions that are homozygous and identical-by-descent (IBD) in the 2 affected

individuals using custom programs written in the Mathematica (Wofram Research, Inc.)

data analysis software. Candidate regions were further refined by exclusion of common

homozygous segments with any unaffected family members. The confidence criteria to

identify IBD blocks were a minimum of 3 cM and a SNP density over the 5th percentile.

Centimorgan distances between SNPs were determined from the HapMap Phase II

recombination rate map. We identified a single shared identical-by-descent candidate

locus totaling 9 Mb on Chromosome 16 (hg19; chr16:55,216,971-64,204,977).

Whole exome sequencing of Proband 1 was performed using the Illumina

TruSeq Exome Enrichment Kit for exome capture using 1 ug of genomic DNA. Illumina

22

HiSeq2000 High-output mode was used for sequencing as 100 bp paired-end runs at

the UCLA Clinical Genomics Centre and at the UCLA Broad Stem Cell Research

Centre. 6 samples were pooled before the exome capture and sequenced across 2

flowcell lanes. Sequence reads were aligned to the human reference genome (Human

GRCh37 (hg19) build) using Novoalign (v2.07,

http://www.novocraft.com/main/index.php). PCR duplicates were identified by Picard

(v1.42, http://picard.sourceforge.net/) and Genome Analysis Toolkit (v1.1,

http://www.broadinstitute.org/gatk/)(McKenna et al., 2010) was used to re-align indels,

recalibrate the quality scores, call, filter, recalibrate and evaluate the variants. SNVs

and INDELs across the sequenced protein-coding regions and flanking junctions were

annotated using Variant Annotator X (VAX), a customized Ensembl Variant Effect

Predictor(Yourshaw et al., 2014). Each variant was annotated with information including

gene names and accession numbers, reference variant, variant consequences, protein

positions and amino-acid changes, conservation scores, population minor allele

frequencies, expression pattern, and PolyPhen2(Adzhubei et al., 2010), SIFT(Kumar et

al., 2009), Condel(González-Pérez and López-Bigas, 2011) predictions. An average

coverage of 62X was achieved across the exome with 86.2% of these bases covered at

≥10X. A total of 19,247 variants were identified across the RefSeq protein coding exons

and flanking introns (+/-2bp). Of these, 1515 variants (76 homozygous and 1439

heterozygous variants) were protein-changing variants with population minor allele

frequencies <1%.

A single, unique homozygous start codon mutation in KATNB1 (c.1A>G, hg19

chr16: 57,771,156) was present in the region of IBD. Sanger sequencing confirmed and

23

validated mutation segregation in all tested family members, using forward primer 5’-

TTCTGTCTGCCTGGATGTG and reverse primer 5’-GAAACAAAGCTGTGGGTTCAG.

Exome Sequencing and Filtering in Proband 2

Exome capture was performed using TruSeq Exome Enrichment kit (Illumina,

San Diego, CA, USA) following the manufacturer’s protocol. Samples were prepared as

an Illumina sequencing library, and in the second step, the sequencing libraries were

enriched for the desired target using the Illumina Exome Enrichment protocol. The

captured libraries were sequenced using the Illumina HiSeq 2000 Sequencer. The

reads were mapped against UCSC hg19 (http://genome.ucsc.edu/) by BWA (Burrows-

Wheeler Aligner) (http://bio-bwa.sourceforge.net/). SNPs and Indels were detected by

SAMTOOLS (http://samtools.sourceforge.net/).

Exome-derived data were filtered for variants as follows. A total of 82073 exome

variants were identified, of which 37,114 were homozygous, consistent with inheritance

from consanguineous parents. We excluded all variants that did not reside in a coding

or splice site region, or were present in dbSNP or the 1000Genomes database, leaving

175 variants. Subsequent steps involved removal of all variants which resided outside

the autozygome, or which were present in our Saudi population specific database (167

exomes) at an allele frequency greater than 0.005, or listed within the Exome Variant

Server, leaving only 4 variants. Finally the pathogenicity of all surviving missense

variants was established using Polyphen-2 and SIFT, and any variant predicted benign

by both algorithms was eliminated, with 3 variants remaining.

24

Gene Exonic Function Change Present in control

Saudi database

(167 exomes)

GLYATL3 frameshift deletion

NM_001010904:exon6:c.577_578del:

p.193_193del Yes

GJA10 nonsynonymous SNV NM_032602:exon1:c.669G>T: p.L223F Yes

KATNB1 nonsynonymous SNV NM_005886:exon3:c.97G>T: p.G33W No

KATNB1 was the only gene with variants that intersected with candidate variants in

Family 1 and Proband 3, and only the KATNB1 missense variant was completely absent

from our Saudi population specific database (c.97G>T, hg19 chr16:57,775,655). This

variant was confirmed by Sanger sequencing using the forward primer 5’-

GGTCACCCCTCCTTCACAAG and reverse primer 5’- TCACTCTTCAGCCTCCAACC.

Genome-wide SNP genotyping and homozygosity mapping in Proband 3

Proband 3 and his father were genotyped by the Illumina Human610-Quad

BeadChip array according to manufacturers’ instructions. Though the parents of the

affected individual were not reported to be consanguineous, there were 11 blocks of

homozygosity over 2.0 cM in Proband 3 that were not shared by his father. The largest

block was 13.4 cM in size, suggesting that the parents are likely to be distantly related.

25

Chromosome Interval Size (cM) Size (Mb)

16 rs8046668; rs12373064 13.4 14.1

14 rs11624171; rs4562969 9.5 5.8

16 rs2966097; rs7195057 6 1.7

5 rs1549221; rs2913861 5.5 2.9

5 rs3765045; rs13158449 2.9 1.9

20 rs242435; rs6129021 2.6 0.8

21 p terminus; rs2207843 2.6 4.3

1 rs7541950; rs11205321 2.6 2.4

9 rs10116618; rs28651528 2.4 4.8

9 rs28651528; rs10869153 2.2 26.8

14 rs2401756; rs9323838 2.1 0.9

Array capture and exon sequencing in Proband 3

We performed array capture followed by high-throughput Illumina sequencing of

all coding exons within the blocks of homozygosity over 2.0 cM in Proband 3 that were

not shared by his father. Array capture and sequencing were performed as previously

described(Yu et al., 2010) in Proband 3. Briefly, a custom microarray was designed with

oligonucleotide probes targeting all exons within the candidate interval. DNA bound to

the array was amplified and used to generate sequencing libraries. The average depth

of target coverage was 138X, with 86.6% of bases covered by ≥10 reads. After filtering

for standard quality and mapping confidence, a total of 1297 potential homozygous

sequence variants were identified.

26

Variant analysis and sequencing confirmation in Proband 3

Variants were annotated with respect to predicted molecular effect and presence

in known population datasets using ANNOVAR(Wang et al., 2010) as well as the

genomic mutation consequence calculator(Major, 2007). To identify candidate

pathogenic variants, variants were filtered to exclude those found in known population

datasets with a minor allele frequency (MAF) of 1% or greater in the 1000 Genomes

Project (http://www.1000genomes.org) or the NHLBI Exome Sequencing Project

(http://evs.gs.washington.edu/EVS), and to exclude those predicted to be molecularly

nonimpactful (intergenic, synonymous, or intronic and greater than 2bp from a splice

junction). Of the 1297 homozygous variants identified in the individual, 74 were protein-

altering, and only 7 variants were rare (MAF 0.01 as above) and protein-altering. Of the

7 variants, 3 are present in dbSNP132 and 2 others are present at very low frequency in

EVS; these 5 were all predicted to be tolerated by Polyphen-2 and SIFT, leaving two

remaining candidate variants.

27

Gene Exonic

Function

Change Exome

Variant

Server

6500

allele

frequency

dbSNP132 Polyphen

-2

SIFT

TPTE

nonsynonymous

SNV NM_199260:c.A1042G: p.K348E rs212146 NA Tolerated

LOC100288

966,POTED

nonsynonymous

SNV NM_001257362:c.G337A: p.G113S rs6517869 Benign Tolerated

LOC100288

966,POTED

nonsynonymous

SNV NM_001257362:c.A1603G: p.M535V rs78643169 Benign Tolerated

CDC42BPB

nonsynonymous

SNV NM_006035:c.C2948T: p.A983V 0.000923 Benign Tolerated

PROP1

nonsynonymous

SNV NM_006261:c.C425T: p.A142V 0.00246

Benign Tolerated

NOP16

frameshift

insertion

NM_001256539:c.586_587insAC:

p.R196fs

KATNB1 splicing NM_005886:exon6:c.432+1G>A

Of these 2 variants, whole-exome sequencing of Probands 1 and 2 led to the

elimination the NOP16 variant, leaving a single remaining candidate. This was a

homozygous single base pair change in KATNB1 in the first base of the intron

(c.432+1G>A, hg19 chr16:57,785,215). This variant was verified by Sanger sequencing

with forward primer 5’-TTGTCTCCGTGGGGAGTAAC and reverse primer 5’-

CTAGGGGATTCATGCAGAGC. The primers for Sanger confirmation of this variant

were designed with Primer3 (http://frodo.wi.mit.edu/primer3/)(Rozen and Skaletsky,

2000).

28

Sequencing of KATNB1 in Controls

The missense mutation was screened against 178 ethnically matched Saudi

Arabian controls and 82 tribe-specific controls. The splice site mutation is absent from

>800 exomes sequenced in the Walsh lab (many of whom are from individuals from the

Middle East with brain malformations or autism) and from the Exome Variant Server

(EVS, http://evs.gs.washington.edu/EVS/). No allele carrying the mutation was found in

these controls.

Animals

All animal experimentation was carried out under protocols approved by the

IACUCs of Harvard Medical School and Boston Children’s Hospital. Targeted gene-trap

ES cells (EUCOMM) were injected into C57BL/6 blastocysts to generate chimeric mice.

Male chimeras were be bred to WT C57BL/6 background females (Charles River

laboratories) to transmit the gene-trap allele. The mice are maintained on a C57/Bl6

background. For BrdU pulse-labeling experiments, E12.5 timed pregnant mice were

injected with 75 mg/kg BrdU intraperitoneally and euthanized 30 minutes later. For

histological analysis, brains were perfused with PBS and then followed by 4% PFA

before paraffin embedding and sectioning, or cryoprotected in 30% sucrose before

embedding in OCT (Tissue-Tek) and cryosectioning. Genotyping primers are available

upon request.

Transcription activator-like effector nucleases (TALENs) targeting the exon 6-

intron 6 boundary of zebrafish katnb1 (ENSDARG00000005456) were designed by and

ordered from ZGENEBIO Biotech Co. LTD (Supplementary Table 2). Plasmids were

linearized with NotI and RNA was subsequently synthesized using the mMESSAGE

29

mMachine SP6 Transcription kit (Life Technologies). To generate katnb1 mutants, 150-

200pg of RNA was injected into eggs (albino/slc45a2) at the 1-cell stage. Fish in the F1

generation, stemming from brother-sister matings of injected fish, were prescreened for

induced mutations by heteroduplex mobility assay(Ota et al., 2013). Genotyping was

subsequently confirmed by colony PCR and Sanger sequencing of individual fish to

identify the specific alleles. Genotyping primers are available upon request.

Culture Systems

HEK293T cells were grown in Dulbecco’s Modified Eagle Medium, High Glucose,

High Glucose (HyClone) with 10% fetal bovine serum (FBS, Gibco) and 1mM penicillin,

streptomycin and L-glutamine. Patient point mutations were generated using

QuikChange kit (Stratagene). For tagged KATNB1 mini-gene and cDNA

overexpression, we transfected 293T cells with specified plasmids using Fugene6

(Roche). Constructs were generated using cDNA for Refseq gene ID 10300.

Primary fibroblasts were established from Proband 1 and were maintained in

RPMI-1640 (Gibco) with 10% FBS, and 1mM Penicillin and Streptomycin. Human

iPSCs were generated according to published protocols(Takahashi et al., 2007) using

retroviral vectors encoding the human cDNAs of KLF4, SOX2, OCT4, and C-MYC

(Addgene) and grown in Knockout DMEM containing 20% knockout serum replacement,

2 mM L-glutamine, 1% NEAA, 0.1 mM b-mercaptoethanol, 1% NEAA, 0.1% penicillin

and streptomycin, and 4 ng/ml bFGF on irradiated fibroblast feeders. iPSC colonies

were manually picked after 3–4 weeks and cultured on irradiated MEFs. Control cell

lines are from an unrelated, unaffected ethnically-matched individual.

30

For neural stem cell (NSC) generation, iPSCs were dissociated into single cells

and 10,000 cells/well were seeded into a low attachment U-bottom 96-well plate to form

cell aggregates of embryoid bodies (EB) in neural induction medium (DMEM/F12

supplemented with 20% KOSR, 2mM L-glutamine, 0.2mM NEAA, 0.1mM 2-

mercaptoethanol and 1mM Sodium Pyruvate) for 7 days. EBs were then adhered onto

laminin-coated plates in neural precursor medium (Neurobasal medium supplemented

with 2mM L-glutamine, 1% B27, 1% N2 and 20ng/ml bFGF) for the formation of rosette-

like structures for additional 7-14 days. The neural rosettes were manually isolated and

further expanded as NSCs in neural induction medium. For formation of neurospheres,

8000 cells/well of NSCs were seeded into a low attachment U-bottom 96-well plate in

neural precursor medium to form neurospheres of equal sizes. Sphere size was

measured every day for 6 days.

Lymphoblastoid cell lines were established from Proband 2 following Epstein-

Barr virus (EBV) immortalization and were maintained in RPMI-1640 (Gibco) with 10%

FBS, and 1mM Penicillin and Streptomycin. For imaging, they were grown on Poly-L-

Ornithine (Sigma) coated coverslips. Control cell lines are from an unrelated, unaffected

individual.

Gene-trap MEFs were isolated from E13.5 embryos and dissociated by

trypsinization. Cells were grown in Dulbecco’s Modified Eagle Medium, High Glucose

(HyClone) with 15% fetal bovine serum (FBS, Gibco) and 1mM penicillin, streptomycin

and L-glutamine. Cilia were induced by serum starvation for 48 hrs in Optimem (Gibco)

media, then treated with DMSO or 100nM SAG for an additional 24 hours.

31

RT-PCR and Quantitative RT-PCR

For RT-PCR, RNA was harvested using RNAeasy Plus kit (Qiagen). 1 ug of RNA

was used to synthesize cDNA using Superscript First Strand Synthesis kit (Invitrogen).

For qRT-PCR, total RNA was extracted from Proband 1-derived fibroblasts and

iPSCs using Nucleospine RNAII Kit (Macherey-Naga) with DNAse digestion. RNA was

quantified using ND-1000 spectrophotometer (Biofrontier Technology) and first strand

cDNA was produced with M-MulV reverse transcriptase (Biolabs) using 1 µg of total

RNA input. Quantitative RT-PCR, normalized to GAPDH expression levels, was

performed with the SYBER Green Mix (Roche). Primers were as follows: KATNB1

forward 5’-ACTGGTGCTGGGCAAAG; KATNB1 reverse 5’-

TGCAGTTGGGCTTGTTGA; KATNA1 forward 5’-GGCGGGTTTGTCTTGAAATTC;

KATNA1 reverse 5’-GTACTGCCCAGTTCAATCGT.

For Shh qRT-PCR, MEFs were plated in 6-well plates, starved overnight in Opti-

MEM, and then treated with DMSO or 100nM SAG for an additional 24 hours. RNA was

harvested using an RNAeasy Plus kit (Qiagen). 1 ug of RNA was used to synthesize

cDNA using a First Strand cDNA synthesis kit (Maxima). The resulting cDNA was

probed with primers to Gli1, Patched and beta-Actin and amplified using Sybr GreenER

(Invitrogen). Primer and probe sequences as previously described(Garcia-Gonzalo et

al., 2011).

Western Blot

Lysate was prepared using RIPA buffer (50 mM Tris-HCl 7.4, 150 mM NaCl, 1%

NP-40, 0.5% sodium deoxycholate, and 0.1% SDS) containing a protease inhibitor

cocktail mix (Roche). Protein concentrations were normalized using the bicinchoninic

32

acid assay (Thermo Scientific). Extracted proteins were separated by electrophoresis on

Bis-Tris polyacrylamide gels (Life Technologies) or SDS polyacrylamide gels with DTT,

followed by transfer on polyvinylidene difluoride membrane (Millipore).

For quantitative Western blotting, membranes were blocked for 1 hr in Odyssey

Blocking Buffer (LICOR Biosciences) at room temperature, incubated them with primary

antibodies according to the antibody manufacturer’s instructions, and then incubated

them with fluorescent-dye-conjugated secondary antibodies (LICOR Biosciences).

Bands were detected, normalized and quantified with the Odyssey Infrared Imaging

System (Li-Cor Biosciences).

Antibodies: Flag (Cell Signaling, 1:1000); GAPDH (Abcam, 1:2000); Katanin p60

(Proteintech, 1:200; Atlas, 1:200); Katanin p80 (Proteintech, 1:500; Santa Cruz, 1:200;

LSBio, 1:2000; Sigma, 1:100)

Immunostaining

Cells were grown on glass coverslips and fixed in either 4% PFA for 20 minutes

at room temperature, or 100% Methanol for 3 minutes at -20C. Cells were blocked (5%

serum in PBS-0.1% Triton-X), incubated with antibodies and mounted using Gelvatol or

Fluoromount-G (Southern Biotech) mounting media.

Embryos were drop fixed in 4% PFA overnight, followed by PBS wash. Paraffin

sections (5 um) of brains were rehydrated and subjected to antigen retrieval with

Retrievagen A (BD Pharmingen), followed by blocking (5% serum in PBS),

permeabilization (0.1% Triton X-100), and antibody incubation. Alternatively,

cryosections (50 um) were permeabilized (0.1% Triton X-100), blocked, and incubated

with antibodies (24h-48h).

33

All samples were counterstained with DAPI or Hoechst 33258 (Sigma). Images were

acquired with a Zeiss LSM 700 on an upright Axio Imager.M2 equipped with 405, 488,

555 and 639 nm solid state lasers, motorized stage and a CCD AxioCam MR; an

inverted Zeiss Axio Observer D1; or a DeltaVision RT GE microscope.

For Gli3 immunocytochemistry quantification, Gli3 intensity was measured at the

ciliary tip and background intensity was subtracted.

Antibodies: Acetylated tubulin (Abcam, 1:500; MeOH); Arl13b (kind gift of Tamara

Caspary, 1:500; PFA); Beta catenin (BD Biosciences, 1:100; PFA); Beta tubulin

(Abcam, 1:400; PFA); BrdU (AbD Serotec, 1:500; PFA); CAMSAP2 (Proteintech,

1:1000; MeOH); Centrin (Millipore, 1:1000; MeOH); Centromere (Antibodies Inc, 1:100;

PFA); Cep164 (kind gift of Erich Nigg, 1:1000; MeOH); Cep170 (Abcam, 1:500; PFA);

Cep63 (Millipore, 1:500; MeOH); Cleaved Caspase 3 (Abcam, 1:500; PFA); Cyclin A

(Santa Cruz, 1:200; MeOH); DCX (Santa Cruz, 1:250; PFA); EB1 (BD Biosciences,

1:250; MeOH); Gamma tubulin (Sigma, 1:200, MeOH; Abcam, 1:300, PFA); GFP

(Abcam, 1:1000; PFA); Gli3 (kind gift of Suzie Scales, 1:1000; MeOH); GT335 poly

glutamylated tubulin (Enzo Life Sciences, 1:500; PFA); IFT88 (Proteintech, 1:500;

MeOH); Katanin p60 (Proteintech, 1:500; Atlas, 1:250; PFA); Katanin p80 (Proteintech,

1:500; Santa Cruz, 1:500; Sigma, 1:2000; PFA); LacZ (MP biomedicals, 1:250; PFA);

Ninein (kind gift of James Sillibourne, 1:2500; MeOH); OCT4 (Santa Cruz, 1:100; PFA);

Pericentrin (Abcam, 1:1000; PFA); Phosphorylated Histone H3 (Cell Signaling, 1:1000,

MeOH); Smoothened (Abcam, 1:500; PFA); Sox2 (Santa Cruz, 1:500; R&D, 1:200;

PFA); SSEA4 (Millipore, 1:100; PFA); STIL (Bethyl Labs, 1:200; MeOH); Tbr2 (Abcam,

34

1:500; PFA); TRA-1-60 (Millipore, 1:100; PFA); TRA-1-81 (Millipore, 1:100; PFA); Yo

Pro (Invitrogen, 1:500; PFA)

Electron Microscopy

Cells were grown on aclar coverslips and fixed for 20 minutes in a 1:1 dilution of

culture media to 5% Glutaraldehyde, 2.5% Paraformaldehyde, 0.06 % picric acid in 0.2

M sodium cacodylate buffer (pH 7.4), washed 3x in 0.1M Cacodylate buffer, then post-

fixed in 1% Osmium tetroxide (OsO4)/1.5% Potassiumferrocyanide (KFeCN6) for 30

min, washed in water 3x and incubated in 1% aqueous uranyl acetate for 30min

followed by 2 washes in water and subsequent dehydration in grades of alcohol (5min

each; 50%, 70%, 95%, 2x 100%). Cells were embedded in TAAB Epon (Marivac

Canada Inc. St. Laurent, Canada) and polymerized at 60 degrees C for 48 hrs. After

polymerization the aclar coverslip was peeled off and 1mm squares of the embedded

monolayer was glued onto an empty Epon block for sectioning.

Ultrathin serial sections (80nm) were cut on a Reichert Ultracut-S microtome,

picked up on to formvar/carbon coated copper grids, stained with lead citrate and

examined in a JEOL 1200EX Transmission electron microscope. Images were recorded

with an AMT 2k CCD camera.

Statistical Analyses

All data are represented as Mean ± SEM. Analyses were performed using at least 3

samples each from 3 different animals of each genotype, or using at least 2 replicates

for Proband-derived cell lines. ANOVAs were analyzed using Bonferroni test correction

for multiple comparisons. No F-tests were significant for unequal variances; therefore,

unpaired t-tests were analyzed assuming equal variances

35

References

Adzhubei, I.A., Schmidt, S., Peshkin, L., Ramensky, V.E., Gerasimova, A., Bork, P., Kondrashov, A.S., and Sunyaev, S.R. (2010). A method and server for predicting damaging missense mutations. Nat Meth 7, 248–249.

Garcia-Gonzalo, F.R., Corbit, K.C., Sirerol-Piquer, M.S., Ramaswami, G., Otto, E.A., Noriega, T.R., Seol, A.D., Robinson, J.F., Bennett, C.L., Josifova, D.J., et al. (2011). A transition zone complex regulates mammalian ciliogenesis and ciliary membrane composition. Nat Genet 43, 776–784.

González-Pérez, A., and López-Bigas, N. (2011). Improving the assessment of the outcome of nonsynonymous SNVs with a consensus deleteriousness score, Condel. Am J Hum Genet 88, 440–449.

Kumar, P., Henikoff, S., and Ng, P.C. (2009). Predicting the effects of coding non-synonymous variants on protein function using the SIFT algorithm. Nat Protoc 4, 1073–1081.

Major, J.E. (2007). Genomic mutation consequence calculator. Bioinformatics 23, 3091–3092.

McKenna, A., Hanna, M., Banks, E., Sivachenko, A., Cibulskis, K., Kernytsky, A., Garimella, K., Altshuler, D., Gabriel, S., Daly, M., et al. (2010). The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res 20, 1297–1303.

Ota, S., Hisano, Y., Muraki, M., Hoshijima, K., Dahlem, T.J., Grunwald, D.J., Okada, Y., and Kawahara, A. (2013). Efficient identification of TALEN-mediated genome modifications using heteroduplex mobility assays. Genes Cells 18, 450–458.

Rozen, S., and Skaletsky, H. (2000). Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol 132, 365–386.

Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K., and Yamanaka, S. (2007). Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131, 861–872.

Wang, K., Li, M., and Hakonarson, H. (2010). ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data. Nucleic Acids Res 38, e164.

WHO Multicentre Growth Reference Study Group (2006). WHO Child Growth Standards based on length/height, weight and age. Acta Paediatr Suppl 450, 76–85.

Yourshaw, M., Taylor, S.P., Rao, A.R., Martín, M.G., and Nelson, S.F. (2014). Rich annotation of DNA sequencing variants by leveraging the Ensembl Variant Effect Predictor with plugins. Brief. Bioinformatics.

36

Yu, T.W., Mochida, G.H., Tischfield, D.J., Sgaier, S.K., Flores-Sarnat, L., Sergi, C.M., Topçu, M., McDonald, M.T., Barry, B.J., Felie, J.M., et al. (2010). Mutations in WDR62, encoding a centrosome-associated protein, cause microcephaly with simplified gyri and abnormal cortical architecture. Nat Genet 42, 1015–1020.

Katanin p80 Regulates Human Cortical Development by Limiting Centriole and Cilia Number

Documents

Transcript of Katanin p80 Regulates Human Cortical Development by Limiting Centriole and Cilia Number