Isolation, sequencing, and functional analysis of the TATA-less human ATPase II promoter

http://www.elsevier.com/locate/bba

Biochimica et Biophysica Act

Promoter paper

Isolation, sequencing, and functional analysis of the TATA-less human

ATPase II promoter$

Tomasz Sobockia, Farah Jaymana, Malgorzata B. Sobockab, Ruth Duchatelliera,

Probal Banerjeea,*

aDepartment of Chemistry and the CSI/IBR Center for Developmental Neuroscience, The City University of New York at The College of Staten Island,

Staten Island, NY 10314, United StatesbDepartment of Medicine, SUNY Downstate Medical Center, Brooklyn, NY 10203, United States

Received 17 December 2004; received in revised form 10 February 2005; accepted 21 February 2005

Available online 24 March 2005

Abstract

Multiple lines of evidence indicate that the P-type Mg2+-ATPase, termed ATPase II, could play an important role in apoptosis. With the

long-term objective of studying the regulation of this protein during apoptosis, we delineated the exon–intron organization of the human

ATPase II gene (within chromosome 4). Subsequently, we used RNA ligase-mediated rapid amplification of cDNA ends to identify a major

transcription start site at position �143 with respect to the translation start site. Luciferase reporter analysis of a 1.2-kb 5V-flanking sequence

(�1222 to +94 with respect to the transcription start site) revealed strong promoter activity in three human cell lines, human

oligodendroglioma (HOG), SHSY5Y (hybrid neuroblastoma), and EA.hy926 (endothelial cell line). Serial deletions from the 5V end of this

sequence up to nucleotide �291 yielded some decrease in activity only in the EA.hy926 cells. Further deletion to �217 caused a drastic

decrease in activity in all three cell lines, but a �148 fragment showed preferential reduction in activity in the EA.hy926 cells. The promoter

activity was nearly equal in two sequence variants of the promoter, one of which (designated as Variant 2) contained a 15-bp direct repeat

within a GC-rich region. Additionally, there were several single base-pair changes from the sequence reported by the human genome project.

Despite the presence of enhancer/repressor elements, such as Sp1 and NFnB, relatively small differences in promoter activity were observed

in the three cell lines. However, it is likely that such sequence elements could cause major regulation of promoter activity in cells subjected to

conditions that trigger apoptosis. The ATPase II promoter sequence will provide valuable clues to the regulation and role of the ATPase II

protein.

D 2005 Elsevier B.V. All rights reserved.

Keywords: P-type ATPase; Promoter; Human ATPase II; Apoptosis; Aminophospholipid translocase

1. Introduction

In live cells, the aminophosphospholipid, phosphatidyl-

serine (PS), is normally sequestered to the inner leaflet of

0167-4781/$ - see front matter D 2005 Elsevier B.V. All rights reserved.

doi:10.1016/j.bbaexp.2005.02.007

Abbreviations: HGP, Human Genome Project; TF, transcription factor;

RLM-RACE, RNA ligase-mediated rapid amplification of cDNA ends;

APTL, aminophospholipid translocase$ The sequence data presented in this article have been entered into the

EMBL/GenBank database under accession numbers AY775564 and

AY775565.

* Corresponding author. Tel.: +1 718 982 3938; fax: +1 718 982 3944.

E-mail address: [email protected] (P. Banerjee).

the plasma membrane [1–7]. This is caused by an

enzymatic activity, termed aminophospholipid translocase

(APTL), which uses energy derived from ATP hydrolysis

to drive translocation of PS from the outer to the inner

leaflet of the plasma membrane [4]. The lipid translocase

activity is Mg2+-dependent, and is inhibited by vanadate,

high intracellular calcium, and the sulfhydryl-modifying

agent N-ethylmaleimide [4,8]. The mammalian enzyme

ATPase II that belongs to a family of P-type ATPases is

also inhibited by the same inhibitors described above for

APTL [6,7]. Both activities, i.e. the PS-translocating

activity of APTL as well as the ATPase activity of ATPase

II, are inhibited in the presence of increased intracellular

a 1728 (2005) 186 – 198

T. Sobocki et al. / Biochimica et Biophysica Acta 1728 (2005) 186–198 187

Ca2+ concentration (>0.2 MM) and selective depletion of

intracellular Ca2+, which causes an inhibition of the Ca2+-

ATPase, leaves the enzymes completely active [9,10].

Furthermore, a yeast strain with a mutant gene (Drs2),

which is homologous to the mammalian ATPase II gene,

showed inhibited translocation of PS across the plasma

membrane [7]. Finally, our earlier studies have demon-

strated that the overexpression of the mouse ATPase II

cDNA in the mouse hippocampus-derived, hybrid neuro-

blastoma (HN2) causes an increase in PS translocation and

expression of voltage-gated calcium currents (which

regulate apoptosis) in this otherwise calcium channel-

deficient cell line [6,11–13]. Thus, besides its activity as

an ATPase, ATPase II could play a major role in the

maintenance of lipid asymmetry of the plasma membrane

of a cell.

The P-type ATPases are so named because they harbor

a DKTG motif in which the Asp (D) residue accepts the

;-phosphate (P) from ATP during the catalytic cycle,

forming a covalent acylphosphate intermediate, which is a

signature property of these transporters [14]. For the

completion of the catalytic cycle of the P-type ATPases, it

is essential that this phosphate group is eventually cleaved

[15,16]. Remarkably, such dephosphorylation of ATPase

II proceeds only in the presence of phosphatidylserine

(PS) [17]. The large family of more than 150 P-type

ATPases includes many proteins that are believed to

perform important physiological functions such as the

transport of metal ions like Mg2+, Cu2+ or Ca2+.

Mutations in certain P-type ATPases cause a copper

transport defect named Wilson’s disease and also two

forms of hereditary Cholestasis [14,18]. As an Mg2+-

ATPase, ATPase II does not transport Na+ or K+ ions and

is insensitive to the concentrations of these ions in the

medium.

During apoptosis, PS is externalized to serve as a

marker, which is recognized by scavenger cells that engulf

and degrade apoptotic cells [1,3,19]. Since APTL inhib-

ition might be central to this PS-externalization, the

expression of ATPase II could be critical in this process

and thus may be tightly regulated so as to control

phagocytic clearance of specific cell types in many parts

of an organism. The tissue specificity of the expression of

the ATPase II mRNA has been reported earlier [6,12], but

no information has been available on the sequence of the

ATPase II promoter. Surprisingly, among the 150 or more

P-type ATPases known so far, the promoter of only one P-

type ATPase gene (the Wilson Disease gene) has been

identified [20]. Our study reports the isolation of the

ATPase II promoter, and analysis of its structure and

function. Further analysis of this promoter in more cell

types, under various conditions of growth factor-mediated

regulation, will reveal its mechanistic role in controlling

ATPase II expression under specific conditions. This will

help build a clearer understanding of the regulation and

role of this protein in apoptosis.

2. Materials and methods

2.1. Organization of the ATPase II gene

In order to elucidate the chromosomal organization of

the ATPaseII gene, we compared the sequences of ATPaseII

cDNAs AB013452, AF067820 and NM_006095 to Human

Genome Sequence using the Human Genome Browser

(http://genome.ucsc.edu/; [21,22]). The data presented in

this paper has been obtained using assembly as of May

2004 [21,22], which is the most resent version. Align-

ments of genomic and cDNA sequences were carried out

using ClustalW ([23]; http://www.ebi.ac.uk/clustalw/) or

BCM Search Launcher: Multiple Sequence Alignments

software package ([24]; http://searchlauncher.bcm.tmc.edu/

multi-align/multi-align.html). Wherever necessary, sequen-

ces were aligned manually using standard word process-

ing software and visually inspected.

2.2. Searching for the potential promoter region and

transcription factor binding sites in the ATPaseII gene

The search was performed on the Internet using

GenomatixSuite collection of software (Genomatix Soft-

ware GmbH, Munich, Germany) available at http://www.

genomatix.de. The PromoterInspector [25] mammalian

promoter prediction software was used to analyze the 5Vend of the ATPaseII gene for the presence of the promoter

and the MatInspector [26] to identify the potential tran-

scription factor binding sites. The parameters of the

MatInspector search were set to the core similarity of 1.00

and the optimized matrix similarity.

2.3. Primer design

In order to select PCR primers of specific length and

temperature of annealing, we used the ‘‘RAWPRIMER’’

program (http://alces.med.umn.edu/rawprimer.html). Pri-

mers were analyzed for the absence of stems or hairpin loops

using the ‘‘Primerdesign’’ utility (http://www.cybergene.se/

primer.html). The forward primers contained CGG GGT

ACC, while the reverse primers harbored CTA GCT AGC

(KpnI or NheI sites respectively, underlined plus three

protecting bases). These restriction sites enabled us to

perform directional cloning of the PCR products into the

reporter vector pGL3Basic (Promega Corporation, Madison,

WI). The custom primers used in this project (Table 1) were

synthesized by Invitrogen (Carlsbad, CA).

2.4. Preparation of human genomic DNA

Genomic DNA from human white blood cells was

prepared using the Wizard\ Genomic DNA Purification

Kit from Promega as specified in the manufacturer’s

protocol. The precipitated genomic DNA was re-hydrated

overnight at 4 -C. The concentration, purity and quality of

http:\\genome.ucsc.edu\

http:\\www.ebi.ac.uk\clustalw\

http:\\searchlauncher.bcm.tmc.edu\multi-align\multi-align.html

http:\\www.genomatix.de

http:\\alces.med.umn.edu\rawprimer.html

http:\\www.cybergene.se\primer.html

Table 1

Primers used in various stages of the project

Name Sequence (5V to 3V) Method used for GenBank Accession

number or source

ATPaseFORW TCT CCC TTC AGG ATG TGA AAA GAT

CTC

ATPaseII promoter amplifications (Fig. 2). HGP Draft freeze of

April 2001.

ATPaseRev GAG CGG ATC TCC GAC ACG GT

�1222sns CGG GGT ACC AAG GCC TCT ATG TGA

GGA TCT CTT TCG

Generation of serial deletions of the ATPaseII

promoter. Serial deletions were generated using

forward (‘‘sns’’) primers and +94antsns (reverse)

primer. Each forward primer contained a KpnI

site and the +94antsns an NheI site at the 5V end(underlined) with three bases added to protect

restriction sites (in italics font). The role of the

restriction sites is to facilitate directional cloning

into pGL3 Basic vector.

HGP Draft freezes

between April 2001

and May 2004,

sequencing data

obtained in these

studies.

�588sns CGG GGT ACC AAC AGT CAG TCG TTC

CTT TCC TGC TC

�419sns CGG GGT ACC CCA GAG CAG TCT TTC

CTT TCT GAG C

�291sns CGG GGT ACC CCC CTT TGA GTC GTG

ATA CGG TCC

�217sns CGG GGT ACC CTC ACC CGC CTT CCT

TGC TGA

�148sns CGG GGT ACC CCG GCG CCC GAG CTC

�98sns CGG GGT ACC AAG AGC TCG CCC AGC

TCT GC

+94antsns CTA GCT AGC CAC CTG TCA CGG CGT

GGT ACA

5RGSP GCA GCT CTT CTG AAC TGA GAG TAG

AGA AAT C

RLM-RACE (primary amplification), selected bp

230. . .200 upstream from ATG within exon 3.

AB013452, AF067820

and NM_006095.

5R nested GSP TGG GGC TGG TTG ATG AAA ATA GTC C RLM-RACE (secondary amplification), selected

bp 134. . .110 upstream from ATG, exon 2.

GeneRaceri 5V primer CGA CTG GAG CAC GAG GAC ACT GA RLM-RACE (primary amplification), binding

for this primer located within the GeneRaceri

RNA Oligo.

Provided in the

GeneRaceri kit.

GeneRaceri 5Vnested primer

GGA CAC TGA CAT GGA CTG

AAG GAG TA

RLM-RACE (secondary amplification), binding

for this primer located within the GeneRaceri

RNA Oligo.

T. Sobocki et al. / Biochimica et Biophysica Acta 1728 (2005) 186–198188

the nucleic acid were checked by absorbance measurements

at 260/280 nm and agarose gel electrophoresis.

2.5. PCR amplification of ATPase II promoter fragments

and preparation of ATPaseII promoter constructs

The amplification of the 5V end of the ATPaseII gene

(Fig. 2) was carried out using Platinum\ HiFi Taq or

Platinum\ pfx polymerase (both Invitrogen) in their

respective buffers, as suggested by the manufacturer. In

brief, primers were present at the concentration of 0.2 AM(HiFi Taq) or 0.3 AM (pfx), dNTPs at 0.2 mM (HiFi Taq)

or 0.3 mM (pfx), Mg2+ of 2 mM (HiFi Taq) or 1 mM

(pfx) and the genomic DNA template at 100 ng (HiFi Taq)

or 200 ng (Pfx). Enzymes were used at the quantity of

1.25 U (HiFi Taq) or 2 U (Pfx) per 50 Al reaction and, in

order to yield the product PCRx Enhancer Solution

(Invitrogen), had to be present at the concentration of

0.5� (HiFi Taq) or 0.3� (pfx). Amplification using

primers ATPaseFORW and ATPaseRev were carried out

as follows: (1) using HiFi Taq polymerase: 96 -C/2 min,

94 -C/1 min 45 s, followed by 5 cycles at 95 -C/1 min, 62

-C/1 min, 72 -C/3 min, followed by 28 cycles at 95 -C/1min, 57 -C/1 min, 72 -C/3 min, followed by a final

extension at 72 -C/10 min; (2) using pfx polymerase: 96

-C/2 min, 94 -C/2 min, followed by 5 cycles at 95 -C/1

min, 62 -C/1 min, 72-/3 min, followed by 28 cycles at 95

-C/1 min, 57 -C/1 min, 72 -C/3 min, and a final extension

at 72-C/10 min.

Using appropriate primers (Table 1), serial deletion

mutants were generated by PCR using HiFi Taq as specified

above and the cycling conditions were: 96 -C/2 min, 94 -C/2 min, followed by 5 cycles at 96 -C/45 s, 60 -C/30 s, 68

-C/1 min 30 s, followed by 28 cycles at 95 -C/45 s, 57 -C/30 s, 68 -C/1 min 30 s, followed by a final extension at 72

-C/10 min. The primers were designed appropriately to

obtain the desired deletions. We used only one reverse

primer in such a way that the 3V end of each promoter

fragment was at +94 position (Table 1).

2.6. DNA sequencing

The sequencing of the clones was done commercially by

ACGT, Inc. (Wheeler, IL) and by the Rockefeller University

DNA Sequencing Resource Center (New York, NY). The

promoter fragments and the 5V-RACE products were

sequenced in both directions using universal forward and

reverse primers. Each complete clone was sequenced on

both strands, and for the longer clones, we performed

sequencing more than once using either an internal primer

or by carrying out multiple sequencing on the same strand or

using shorter clones until all discrepancies in sequencing


were resolved. Any isolated sequence that was different

from the corresponding sequence obtained from the human

genome project (for example a 15-bp repeat observed in

human ATPase II promoter) was sequenced several times.

2.7. Transient transfection studies of the ATPase II promoter

Transient transfections with ATPase II promoter con-

structs in pGL3Basic (firefly luciferase) and pRL-TK

(Renilla luciferase) into HOG, SHSY5Y and EA.hy926

cells were carried out using the Effectene reagent (Qiagen,

Valencia, CA) according to the manufacturer’s recommen-

dations. In brief, cotransfection mixtures contained (per well

of cells in 24-well plates) promoter construct pDNA (195 ng

for EA.hy926 and SHSY5Y or 200 ng for HOG), pRL-TK

(5 ng for EA.hy926 and SHSY5Y or 2.5 ng for HOG), EC

buffer (60 Al), Enhancer (1.6 Al), Effectenei (5 Al) and

DMEM (350 Al, 10% FBS, 1% Penicillin–Streptomycin).

The cotransfection mixture was added to cells overlayered

with 350 Al of DMEM (10% FBS, 1% Penicillin–

Streptomycin). The medium plus cotransfection mixes were

subsequently removed after either 4 h (EA.hy926) or

approximately 24 h (SHSY5Y or HOG), and the cells were

overlayered with 1 ml of DMEM (10% FBS, 1% Penicillin–

Streptomycin) per well. Cells were harvested 48 h after

transfection, and luciferase activities were assayed using a

dual luciferase assay kit (Promega) as specified by the

manufacturer. Luminescence from either firefly or Renilla

luciferase was measured using a TD20/20 Luminometer

(Turner Design, Sunnyvale, CA). Results were expressed as

a ratio of Firefly to Renilla luminescence. All results were

normalized to the activity obtained from the pGL3Promoter

vector (Promega).

2.8. Analysis of the 5V-untranslated sequences by RLM-RACE

Total RNA samples (5 Ag each) obtained from human

brain and skeletal muscle (Ambion, Austin, TX) were

processed for RLM-RACE using the GeneRacer kit as

detailed in the manufacturer’s protocol. In brief, the RNA

samples were dephosphorylated in the presence of 10 U of

calf intestinal phosphatase (CIP) at 50 -C for 1 h.

Following the purification of the RNA sample by ethanol

precipitation, the mRNA cap structure was removed by

treating the dephosphorylated RNA with 0.5 U of tobacco

acid pyrophosphatase (TAP). The decapped mRNA was

purified and then ligated in the presence of T4 ligase (5U)

to an adapter RNA oligonucleotide sequence that was

specific for both the GeneRacer 5V Primer and the

GeneRacer 5V Nested Primer. An aliquot of the purified

ligation product, containing approximately 1.2 Ag of

RACE-ready RNA, was reverse transcribed in the presence

of an oligo dT primer using 15 U Thermoscripti RT

(Invitrogen). The product was subsequently treated with 2

U of RNase H at 37 -C for 20 min and then the cDNA

product used immediately for PCR amplification. PCR

amplification was performed first with the GeneRacer 5VPrimer and an ATPase II-specific primer 5RGSP (Table 1).

The conditions of PCR were 94 -C/2 min followed by 5

cycles of 94 -C/30 s, 70 -C/1 min 30 s, followed by 5

cycles of 94 -C/30 s, 68 -C/1 min 30 s, followed by 25

cycles of 94 -C/25s, 63 -C/30 s, 68 -C/1 min, followed by

a final extension at 72 -C/10 min. An aliquot containing 1/

50th of the primary PCR product was then reamplified

using the GeneRacer 5V Nested Primer and a second

ATPase II-specific primer 5RNestedGSP (Table 1). The

conditions of PCR were 94 -C/2 min, followed by 25

cycles of 94 -C/25 s, 63 -C/30 s, 68 -C/1 min 30 s, and a

final extension at 72 -C/10 min.

3. Results

3.1. Organization of the ATPase II gene

The alignment of the ATPaseII cDNAs with sequence

of Human Genome revealed that the ATPaseII gene is

located in chromosome 4p13 and spans the region from

42,255,563 to 42,499,828 with the coding region matching

to the negative strand between bases 42,255,864 and

42,499,818 within chromosome 4. The gene is composed

of 37 exons (sizes: 41 to 396 bp) and 36 introns (size: 92

to 29,715bp). The exon/intron organization is shown in

Table 2 and the schematic structure of the gene is shown

in Fig. 1. Analysis of the 5V end of the gene revealed the

presence of the CpG island of the size equal to 1272

(42,499,207 to 42,500,478) [27]. The percentage of CpG

within the island is 17.3% and the total percentage of

either C or G equals to 62.9%. The parts of the ATPaseII

gene where the CpG island was present included the entire

5VUTR, the entire first exon and first 563 bases of the first

intron. In order to predict a potential promoter within the

5Vend of the ATPaseII gene, we used PromoterInspector to

scan 30-kb of DNA sequence starting 20 kb upstream of

the translation start site and spanning even 10 kb down-

stream of this site. Thus, the sequence scanned included

the entire first exon and the 5V end of the first intron. The

search indicated a promoter region from bp 19,617 to

19,828, which corresponded to bases �250 to �38 in

Fig. 2. Our search also revealed the lack of a TATA box

and a consensus initiator sequence. Thus, the transcription

initiation of the ATPase II gene could occur within a

segment of the core promoter, densely lined with tran-

scription factor binding sites (Fig. 2, Table 2, and Fig. 3).

For our analysis of promoter activity, however, we

considered the complete 1.2-kb 5V-flanking region. Our

objective was to look for possible enhancer/repressor

sequences, the deletion of which would produce a dramatic

change in promoter activity. It should be noted that the

complete sequences presented in this article have been

entered into the EMBL/GenBank database under accession

numbers AY775564 and AY775565.

Table 2

Exon– intron boundaries of the human ATPase II gene

Exon–Intron junctions on the human ATPase II gene

Exon cDNA AB013452 Exon size (bp) Chromosome 4p13 Intron|Exon|Intron

From To From To

1 1 62 �62 42499828 42499770 . . .. . .. . .. . .. . .. . .. . .. . .. . .. . .CCGAAG|GTAAGG

2 63 177 115 42470054 42469940 TTTAAG|GTTATG. . .. . .. . .TGTCAG|GTAAGA

3 178 277 100 42468658 42468559 TTCTAG|CACTGC. . .. . .. . .CTGCAG|GTAAAG

4 278 376 99 42467579 42467481 AAACAG|CAAATA. . .. . .. . .GATATT|GTAAGT

5 377 422 46 42459023 42458978 CTTTAG|AAACGA. . .. . .. . .CGCAAG|GTAGGA

6 423 463 41 42443463 42443423 TTCCAG|TTTTGA. . .. . .. . .GAAAAG|GTATGC

7 464 537 74 42433829 42433756 GTGTAG|GTGGCA. . .. . .. . .CTCAAG|GTTAGA

8 538 607 70 42431274 42431205 CTACAG|TGAGCC. . .. . .. . .AGACAG|GTAAGA

9 608 735 128 42429421 42429294 AAACAG|GGCTTA. . .. . .. . .ACATGG|GTATGT

10 736 847 111 42424677 42424566 TCCTAG|CACCGT. . .. . .. . .ATGCAG|GTGAAA

11 848 1013 166 42422923 42422758 TTACAG|AATTCA. . .. . .. . .TAAACT|GTAAGC

12 1014 1141 128 42421332 42421205 CAACAG|ATGGTG. . .. . .. . .AATTGG|GTAAAT

13 1142 1219 78 42418644 42418567 TTAAAG|GATCTT. . .. . .. . .GGCCAG|GTAAAC

14 1220 1308 89 42417652 42417564 TTTTAG|GTTAAA. . .. . .. . .TTATGG|GTGAGT

15 1309 1353 45 42412150 42412106 CTGAAG|CCATGT. . .. . .. . .TGAATG|GTAAGC

16 1354 1426 73 42398985 42398913 CTTCAG|GCAGAA. . .. . .. . .AATCAT|GTAAGT

17 1427 1532 106 42395555 42395450 TCACAG|CCAACT. . .. . .. . .CTCCAG|GTACAA

18 1533 1615 83 42394225 42394143 AAACAG|ATGAGG. . .. . .. . .GATTCA|GTAAGT

19 1616 1665 50 42392007 42391958 TCTTAG|CTGGGG. . .. . .. . .TACCAG|GTAAAA

20 1666 1735 70 42386931 42386862 TTTCAG|TGCTAG. . .. . .. . .GGAGCT|GTAAGT

21 1736 1820 85 42367792 42367708 TTCCAG|GACACT. . .. . .. . .CAGAAG|GTAAGT

22 1821 1960 140 42365244 42365105 TTTCAG|GGTTAA. . .. . .. . .GAAAAG|GTACGT

23 1961 2099 139 42350099 42349961 TTTCAG|AATCTT. . .. . .. . .ACATCG|GTAATT

24 2100 2164 65 42346459 42346395 ATACAG|GACACT. . .. . .. . .CTTGAT|GTAAGT

25 2165 2337 173 42328613 42328441 TTCCAG|GGAACA. . .. . .. . .CTGTCG|GTAAGT

26 2338 2521 184 42308021 42307838 TTTCAG|GGTTTC. . .. . .. . .GCTCAG|GTAAAG

27 2522 2632 111 42307745 42307635 TTTTAG|TTCAAA. . .. . .. . .ATCGAG|GTAACA

28 2633 2707 75 42298544 42298470 TCCTAG|ATCTGG. . .. . .. . .AACGTG|GTAAGT

29 2708 2830 123 42298364 42298242 CTTTAG|ATGTTT. . .. . .. . .ACCAAG|GTAGGG

30 2831 2909 79 42295004 42294926 CCTCAG|GTTTTC. . .. . .. . .AGTATG|GTAAGT

31 2910 2971 62 42289589 42289528 GTACAG|GTACTG. . .. . .. . .TACACT|GTGAGT

32 2972 3028 57 42287579 42287523 TTTTAG|TTTGTG. . .. . .. . .ACATGG|GTAAGA

33 3029 3136 108 42286617 42286510 CTACAG|TTCAGC. . .. . .. . .GGAGAG|GTAATG

34 3137 3225 89 42266650 42266562 ACACAG|GCAGCC. . .. . .. . .CAAGGT|GTAAGT

35 3226 3318 93 42265844 42265752 TTGCAG|TATCAA. . .. . .. . .AAAAAG|GTAAAA

36 3319 3410 92 42257663 42257572 CTGCAG|CCTGAC. . .. . .. . .TGCTCC|GTGAGT

37 3411 3806 �396 42255958 42255563 CTACAG|ATGGGT. . .. . .. . .GTATTC

Delineation of ATPase II gene structure: Exon– intron boundaries. The table shows consecutive exons, their corresponding position within ATPaseII cDNA

(AB013452) and within chromosome 4p13. Exon size and details of intron/exon/intron junctions are provided for each exon. Please note that according to the

HGP, ATPaseII exons match to the negative strand of the chromosome, which accounts for the fact that the consecutive numbering within the chromosome

decreases as the numbering within the cDNA increases.


3.2. Transcription factor binding sites

The putative promoter sequence harbored many tran-

scription factor-binding sites, which are summarized in

Fig. 2 and Table 3. We have found some deviations from

the genomic sequence reported in the human genome

database (Table 4 and Fig. 3). The region from position

�419 up to position +38, as shown in Fig. 2 and Table 3,

contained a large number of transcription factor binding

sites and also sites selective for the core promoter binding

protein (CPBP), which is often observed in TATA-less

promoters [28]. Other transcription factor binding sequen-

ces were identified upstream of this region of the putative

promoter (Fig. 2 and Table 3).

3.3. Dissimilarities between the isolated ATPase II sequence

variants and the human genome project (HGP)

Two sequence variants were obtained. One of them

contained a 15-bp direct repeat in the core promoter

region (Variant 2, Table 4 and Fig. 3). They were

designated as Variant 1 {without the repeat and (�)}

and Variant 2 {with the repeat and (+)} (Table 4). Both

Variant 1 and Variant 2 sequences showed further

difference from the HGP at single base pairs listed in

Table 4. These differences could be due to single

nucleotide polymorphism. Since this 15-bp sequence

contained a core promoter binding protein (CPBP), an

EGR1, a myc-associated zinc finger protein (MAZ), and a

Fig. 1. Gene structure of human ATPase II. Delineation of the ATPase II gene structure using bioinformatics data obtained from public databases (GenBank/

NCBI, Human Genome Project, etc.). Top panel: schematic illustration of human chromosome 4 as interpreted by the Human Genome Project (HGP). A thin

vertical line and a triangle above indicate the position of the ATPaseII gene. Bottom panel: Structure of the ATPase gene drawn to scale. Exons are indicated by

thin vertical lines.


myc-associated zinc finger protein related transcription

factor binding sites, the repeat introduced additional

copies of these sites to the core promoter sequence

(Table 5).

Fig. 2. Isolation and characterization of the ATPaseII promoter. Shown is the varian

transcription start site determined by 5VRACE (Fig. 4). The start of transcription as

position where the additional 15-bp direct repeat is present in the Variant 2 of the

different from the HGP (see Table 3). TF binding sites determined by MATINSPEC

factors above the sequence. Primers used to amplify this fragment (ATPaseFoRW a

end of the sequence. The promoter region detected by PROMOTERINSPECTO

transcription factor (TF) binding sites, which could not be incorporated in this f

promoter region detected by PROMOTERINSPECTOR.

3.4. The transcription-start site on the ATPase II promoter

The transcription start site of the ATPase II gene has

not been identified so far. Additionally, the predicted

t I of the promoter (AY775564). The numbering of bases is in relation to the

determined by the 5VRACE is shown as ‘‘�’’. The symbol ‘‘ ’’ indicates the

promoter (Fig. 3). Asterisks (F*_) above the sequence indicate bases that are

TOR are indicated by lines below the sequence with names of transcription

nd ATPaseRev, Table 1) are depicted in gray italics at the beginning and the

R (�250/�38) is shown in bold. For the purpose of clarity, additional

igure, are listed in Table 3. Majority of these TF binding sites are in the

*ATPase(-) -140 CGAGCTCCGCCCCTCGCCGAGCCGCTCCTC---------------CGCGGCTGCAGCAAG -96ATPase+ -155 CGAGCTCCGCCCCTCGCCGAGCCGCCCCTCGCCGAGCCGCCCCTCCGCGGCTGCAGCAAG -96

Fig. 3. ATPase II promoter variant II (AY775565) contains 15-bp direct repeat. Location of the direct repeat is indicated by a horizontal line, beginning and

ending with arrowheads. The asterisk (F*_) above indicates mutation at base �115 (Table 4). This figure shows only the fragment of the two variants of the

ATPase II promoter where the sequences differ. Flanking sequences are included for the purpose of clarity.


ATPase II promoter sequence is devoid of a TATA box or

a consensus eukaryotic initiator sequence, and it is known

that such TATA-less promoters often contain multiple

transcription start sites, which had to be determined. One

important part of our strategy was to design the reverse,

gene-specific primer in such a way that no genomic DNA

contamination was obtained in the 5V-RACE product. This

was achieved by positioning the gene-specific reverse

5RGSP and the nested gene-specific reverse 5RNes-

tedGSP primers (Table 1) on exon 3 and exon 2

respectively (Table 2). Since the 5V-untranslated region

of the ATPase II gene contains many GC-rich regions,

RT-PCR amplification of such templates could have been

difficult. We overcame this difficulty by using the

Thermoscripti RT (Invitrogen) for the reverse tran-

scription step.

5V-RACE required two rounds of PCR amplification i.e.

initial amplification of primary RACE products, followed

by subsequent re-amplification as described in Materials

and methods. Secondary products were clearly visible

upon analysis by agarose gel electrophoresis. The

Table 3

Additional transcription factor binding sites in the ATPase II promoter

Transcription factor Strand

OCT1 (�)

EGR1 (+)

(+)

(�)

Myc-associated zinc finger protein related TF (+)

(+)

(�)

(+)

(�)

GC Box/SP1 (+)

(�)

(�)

Myeloid zinc finger protein (MZF1) (�)

Myc associated zinc finger protein (MAZ) (�)

(�)

(�)

(�)

ZBP-89 (�)

(+)

Zinc finger/POZ domain TF (+)

(+)

AP2 (+)

CPBP (�)

(�)

HEN1 (�)

AP4 (�)

expected size of such secondary products is exactly 30

bp larger due to the presence at the 5V ends of the

products an additional stretch of oligodeoxynucleotide

originating from a part of reverse transcribed GeneR-

aceri RNA oligonucleotide sequence. We obtained major

bands of approximately 300-bp in RACE from brain and

skeletal muscle samples. In addition, 5V-RACE of brain

mRNA gave two shorter species of approximately 280 and

230 bp, respectively (Fig. 4A). The products were cloned

into pCR4-TOPO vector and sequenced (total of nine

clones). In the brain, the major band at ¨300 bp

corresponded to products from two closely spaced tran-

scription start sites at �150G and �143C with respect to the

translation initiation codon (Fig. 4A and B). The shorter

species at ¨230 bp corresponded to a transcription start

site at �71C. None of these transcription initiation sites

corresponded to the consensus, eukaryotic initiation

sequence. Nonetheless, such deviations are observed in a

large number of promoters. In the skeletal muscle, there

was one major band immediately below 300 bp, which

corresponded to the same transcription start site at �143C

Sequence Position

TAAATTTTAATTTGC �973/�959

GCGGGGCGGGGCGGGGC �264/�248

GCGGGGCGGGGCGAAGG �259/�243

CGGGTGAGGGGCGGGGA �226/�210

CGGGGCGGGGCGG �263/�251

CGGGGCGGGGCGA �258/�246

AGGGGCGGGGAGA �228/�216

GCGGGAGGGGGAG �190/�178

GGGGGAGGGGCCT �165/�153

GGCGGGGCGGGGCGA �260/�246

TGAGGGGCGGGGAGA �228/�214

CGAGGGGCGGAGCTC �139/�125

GCGGGGA �226/�220

GGGTGAGGGGCGG �223/�211

CGGCGAGGGGCGG �134/�122

CGCGGAGGAGCGG �119/�107

GGAGGAGGAGAAA �46/�34

GGCTCGCGCTCCCCCTCCCGCGG �192/�170

GCAGGCCCCTCCCCCGGCGCCGG �167/�145

GGGAGCGCGAG �182/�172

CTGAGCGCTCT +38/+48

CGCCCGGCGGCGG �14/�3

CGCGCCGCCGCCCACCTAGGGCA +2/+24

GCCTGGGCCGCGCCGCCGCCCAC +10/+32

GAGCGCTCAGCTGCAGCCTGG +27/+47

GCGCTCAGCTGCAGCCT +29/+45

Table 4

Point mutations found in various variants of the ATPaseII promoter

Position (Fig. 2) Point variations in the ATPase II promoter

Variant 1

ATPase (�)

Variant 2

ATPase (+)

HGP

�514 G C C

�486 A G A

�308 A G A

�115 T C C

+4 G A A

Point mutations found in various variants of the ATPase II promoter. We

compared sequences of ATPaseII promoters, variants I and II, Accession

numbers: AY775564 and AY775565 respectively, with their counterpart

proposed by the HGP. The sequences of all three variants are almost

identical except for single base substitutions listed. The positions of the

substitutions correspond to the numbering of bases on Fig. 2.


as observed in the brain. Such multiple transcription start

sites have been reported in TATA-less promoters of

IgCAMs [29,30], as well as promoters of genes other

than IgCAMs [31,32].

3.5. Serial-deletion analysis of the ATPase II promoter

The sequence, termed as core promoter, started at

position �419 and stretched up to position +94 with

respect to the transcription start site (Fig. 5A). This

fragment yielded the same promoter activity as the full

promoter (Fig. 5B, C, D). Further deletion of the core

promoter to �291 to +94 resulted in a sharp drop in

activity in EA.hy926, but no decrease in the neural cells,

SH-SY-5Y and HOG. However, the fragment �217/+94

yielded sharply decreased activity in all the cell types

(Fig. 5). Subsequent deletions, �148 to +94 and �98 to

+94, produced further decrease in activity to almost the

basal levels in EA.hy926 and SH-SY5Y, but not as much

in HOG cells (Fig. 5). Since the basal activity (luciferase

activity obtained after transfecting pGL3Basic) in the

HOG cells was very low, the activity of the �98 to +94

fragment in these cells was still significant in this cell

line. Probably, the transcription factors present in these

glioma cells yield transcriptional activity by binding to

the GC-rich region present downstream of the �98

position (Fig. 2). In general, the ATPase II promoter or

its fragments showed some difference in activity between

Table 5

The presence of the 15-bp repeat in the ATPase II promoter variant II results in

Transcription factor Strand

CPBP (+)

EGR1 (�)

Myc associated zinc finger protein (MAZ) (�)

Myc-associated zinc finger protein related TF (�)

The presence of the 15-bp repeat in the ATPase II promoter variant II introduces

identified by MatInspector.a Position within ATPase(+) (Variant 2) promoter relative to TSS (+1).

the EA.hy926 and the neural cells, SH-SY5Y and HOG,

but from experiments performed only in these three cell

lines, we did not observe any dramatic cell type-

specificity in the shortest fragment �291 to +94 that

showed full promoter activity.

3.6. Possible enhancer/repressor activity in the promoter

Neural selectivity of expression is often conferred by a

21-bp neural-restrictive silencer element (NRSE), which

binds to the neuron-restrictive silencer factor (NRSF), also

known as RE-1 silencing transcription factor (REST) [33].

NRSF is a 116-kDa C2H2 zinc finger protein that is

expressed ubiquitously in developing non-neural tissues

between embryonic days 8.5 and 9.5 [33]. At the onset of

neuronal differentiation, NRSF expression is down-regu-

lated, assuming a very low to negligible level in mature

neurons [33]. The consensus for NRSE is TTCAGCAC-

CACTTA GAGTGCC [33]. An analysis of the ¨1.2-kb

5V-flanking sequence of ATPase II revealed two homol-

ogous sequences in the ATPase II promoter from �721 to

�701 and from �427 to �407 (Fig. 2) [33]. Of these,

one NRSE sequence (�427 to �407) was found on the

(+) strand. Additionally, the upstream region of the 1.2-kb

5V-flanking sequence analyzed here also harbors one

NFjB-specific site (Fig. 2). Despite such possibility of

transcriptional regulation by the NRSE and NFjBsequences, luciferase reporter analysis by including the

NRSE at �427 to �407 and comparison with the activity

of the complete ¨1.2-kb 5V flanking sequence (presented

in Fig. 5) showed that the deletion of both NRSE and

NFjB binding sites had no effect on the neural cell-

specificity of the promoter (Fig. 6). However, it should be

noted that none of our experiments involved growth

factor treatment of cells to cause the activation of NFjB.Therefore, the NFjB sequence may still have a strong

effect on ATPase II expression in specific cell types,

which can be stimulated by growth factors or ligands that

cause signaling activity leading to the activation of NFjB.The additional transcription factor binding sites introduced

in the 15-bp direct repeat had no effect on the activity of

the ATPase II promoter or its fragments (Fig. 6). It

should be noted again that to confirm the effect (or lack

of effect) of such additional enhancer elements, the

additional TF binding sites

Sequence Positiona

CGCCGAGCCGCCCCTCCGCGGCT �126/�104

CCGCGGAGGGGCGGCTC �122/�106

CGCGGAGGGGCGG �119/�107

CGCGGAGGGGCGG �119/�107

additional TF binding sites. The additional sites present in Variant 2 were

A.

B.+1

PromoVar1: GTGCGGGGGC CGCGCCCGGC GGCGGCTCTG CCCTAGGTGG GCGGCGGCGC GGCCCAGGCT GCAGCTGAGC GCTCTGCGCG GCGCAGCCGG GTCTCCCGCG 1328/+73Clone1: 1GGCGGCTCTG CCCTAGGTGG GCGGCGGCGC GGCCCAGGCT GCAGCTGAGC GCTCTGCGCG GCGCAGCCGG GTCTCCCGCG 80Clones2-5: 1 CTG CCCTAGGTGG GCGGCGGCGC GGCCCAGGCT GCAGCTGAGC GCTCTGCGCG GCGCAGCCGG GTCTCCCGCG 73Clone6: 1 CTG CCCTAGGTGG GCGGCGGCGC GGCCCAGGCT GCAGCTGAGC GCTCTGCGCG GCGCAGCCGG GTCTCCCGCG 73Clone7: 1 G CCCTAGGTGG GCGGCGGCGC GGCCCAGGCT GCAGCTGAGC GCTCTGCGCG GCGCAGCCGG GTCTCCCGCG 71Clones8,9: 1 CTCCCGCG 8

(Coding sequence…)PromoVar1: TGTACCACGC CGTGACAGGT GCAGAGTCCG GGCTGAGGAC CCACCTGCAG CCGCCGCCGC GATGCCCACC ATGCGGAGGA CCGTGTCGGA GATCCGCTC- 1427/+172Clone1: TGTACCACGC CGTGACAGGT GCAGAGTCCG GGCTGAGGAC CCACCTGCAG CCGCCGCCGC GATGCCCACC ATGCGGAGGA CCGTGTCGGA GATCCGCTCG 180Clones2-5: TGTACCACGC CGTGACAGGT GCAGAGTCCG GGCTGAGGAC CCACCTGCAG CCGCCGCCGC GATGCCCACC ATGCGGAGGA CCGTGTCGGA GATCCGCTCG 173Clone6: TGTACCACGC CGTGACAGGT GCAGAGTCCG GGCTGAGGAC CCACCTGCAG CCGCCGCCGC GATGCCCACC ATGCGGAGGA CCGTGTCGGA GATCCGCTCG 173Clone7: TGTACCACGC CGTGACAGGT GCAGAGTCCG GGCTGAGGAC CCACCTGCAG CCGCCGCCGC GATGCCCACC ATGCGGAGGA CCGTGTCGGA GATCCGCTCG 171Clones8,9: TGTACCACGC CGTGACAGGT GCAGAGTCCG GGCTGAGGAC CCACCTGCAG CCGCCGCCGC GATGCCCACC ATGCGGAGGA CCGTGTCGGA GATCCGCTCG 108

350 bp

250 bp

300 bp

50bp

ladd

er

BrainSke

letal

muscle

Fig. 4. RLM-RACE analysis of the ATPase II promoter shows that the major transcription start site in the brain and skeletal muscle is 143-bp 5V of thetranslation initiation site. (A) Secondary 5VRACE products obtained using GeneRaceri 5V Nested Forward and 5RNestedGSP (Table 5) are shown. In the

brain, there was a major band at ¨300 bp and a few bands with lesser molecular weights. The skeletal muscle showed one major band that moves slightly faster

than 300 bp. (B) The major band at ¨300 bp in the brain corresponded to products from two closely spaced transcription start sites at – 150G (clone 1), – 143C

(clone 6) and – 141G (clone 7) with respect to the translation initiation codon. A faster-moving band at ¨230 bp corresponded to a transcription start site at – 71C

(clones 8 and 9). The skeletal muscle samples showed one major band below 300 bp, which corresponded to the same transcription start site at – 143C (clones

2–5) as observed in the brain. The promoter region (Variant 1, AY775564) shown corresponds to bases 1229 to 1427 (�27 to +172 relative to a transcription

start site; Fig. 2). Even though all the clones were obtained with 5RNestedGSP (Table 1) as a reverse primer, only the 5V part of the sequences of the clonescorresponding to the promoter region indicated is shown on the figure. The location of the coding sequence within the ATPase II gene is indicated.


promoter activity has to be tested in many more cell

types.

4. Discussion

Many P-type ATPases have been identified and their

coding sequences identified. However, the promoter

sequence of only one of these genes (the Wilson disease

gene-WD gene) has been identified [20]. Although some of

the ATPase genes are believed to be putative amino-

phospholipid translocases, our previous study showed for

the first time that the overexpression of the cDNA for such a

P-type ATPase (the ATPase II cDNA) causes an increase in

aminophospholipid translocase activity [13]. Therefore,

such studies are likely to shed new light on the identity

and expression of the enigmatic aminophospholipid trans-

locase enzyme. As discussed earlier, further studies will

include testing the effect of signaling pathways that are

known to activate transcription factors specific for number

of the enhancer/repressor elements identified on the ATPase

II promoter. Such studies in a wider variety of cell lines

would reveal the expression profile of the ATPase II gene,

which is likely to mimic its expression in various human cell

types.

Earlier studies on the ATPase II gene reported its cDNA

sequences from bovine, mouse, and human [7,11,12].

However, the intron–exon organization of the gene had

not been delineated in these reports. Our analysis has

yielded the complete organization of the gene at the locus

4p13 on the human genome (Fig. 1 and Table 1). ATPase II

appears to be a large gene with 37 exons (Fig. 1 and Table

1). Interestingly, both the WD gene promoter and the

ATPase II promoter lack a TATA box and contain GC-rich

regions harboring multiple transcription factor binding

sequences. The promoter region on the WD gene is,

however, located further upstream (¨�700 bp) from the

translation-start site than the promoter of the ATPase II gene

(¨�250 bp). Furthermore, unlike the WD gene promoter,

which contains a repressor element, deletion analysis of the

ATPase II promoter indicated the lack of such repressor

elements. However, repressor elements could still exist

either upstream or downstream of the (¨1.2-kb sequence

analyzed in this study).

The ATPase II message levels show dramatic variation in

different cell types [6,12]. Based on such observations, we

planned to investigate the structure and role of the ATPase II

promoter. Although the overall activity of both the full and

core promoters of this gene show similar levels of activity in

three different cell types (Fig. 5), the deletions of the core

Fig. 5. Deletion analysis of the ATPase II promoter. (A) Schematic representation of deletion mutants generated. Mutants were obtained using appropriate

forward primers as indicated. The 3V end of all the promoter fragments was at +94, with respect to the transcription-start site. The figure is drawn approximately

to scale. The transcription and translation start sites are indicated as ‘‘�’’ and FATG_ respectively. TF binding sites, which we deemed most biologically relevant,

are indicated. The thick line indicates the promoter detected by PROMOTERINSPECTOR. (B–D) Luciferase activity of the promoter constructs transfected

into different cell lines. The data has been normalized to the activity of the pGL3-Promoter vector. The NRSE sequence upstream of the core promoter does not

influence expression in neuronal cells.


promoter showed a sharp decrease in activity between

�588/�291 in the endothelial EA.hy926 cells. This region

harbors an SP1 site (Fig. 2), which may be important in the

activity of the ATPase II promoter in the EA.hy926 cells. In

contrast, these two fragments of the promoter showed

almost the same activity in both oligodendroglial HOG cells

and neuronal SH-SY5Y cells (Fig. 5). In addition to the SP1

site, this region also contains an ELK1, a MAZ, and an

NRSF site. NRSF binding causes inhibition of gene

expression in non-neural cells [33]. Therefore, elimination

of the NRSE sequence is expected to cause an increase in

the gene expression in non-neural cells. Contrary to such

expectations, serial deletions from position �588 to �291

of the promoter produced a decrease in luciferase activity.

Fig. 6. Deletion analysis of the ATPase II promoter: the 15-bp insert does not alter promoter activity. Mutants were obtained using appropriate forward primers

as indicated. After cloning, the mutants were tested for the presence of the 15-bp repeat. The 3V end of all the promoter fragments was at +94, with respect to the

transcription-start site. Panels A–C: Luciferase activity of the promoter constructs transfected into different cell lines. The data were normalized to the activity

of the pGL3-Promoter vector (Promega, CA). The inclusion of the NRSE sequence in the promoter fragments did not influence expression in neuronal cells.

There was no significant difference in the activity of the promoter fragments with and without the insert.


Therefore, the NRSE site does not play an important role in

the activity of the ATPase II promoter in the EA.hy926

cells. Further deletion beyond �217 (�148 and �98)

caused a suppression of promoter activity to a minimum

in all the three cell types. Intriguingly, the minimum activity

of the deleted promoter was still significantly higher than

that of the empty vector (pGL3Basic) in the HOG cells but

not in the other two cell lines. This could be due to the

presence of an EGR1, a Zinc finger/POZ, and a core

promoter binding protein (CPBP) sites present in this short

fragment of the promoter (Fig. 2 and Table 2). The presence

of three CPBP sites in the region upstream of the

transcription start site is typical for a TATA-less promoter

and strongly supports the results of MatInspector analysis

suggesting the presence of a core promoter between �491

and +94.

One 15-base pair direct repeat and several single base-

pair changes were observed in the clones of the ATPase

II promoter (Figs. 2 and 3). The 15-base pair repeat

occurs in a GC-rich region within the core promoter and

thus contains several additional transcription factor-bind-

ing sites including a CPBP and an EGR1 sites (Fig. 3b

and c). Thus, transcription factors could bind to this

repeat to cause regulation of gene expression. However,

in the three cell lines tested, this repeat sequence did not

produce any change in the activity of the promoter

fragments (Fig. 6). Nonetheless, only by testing such

promoter variations in more cell types, and under

conditions that affect the activity of these transcription

factors, we would be able to understand the effect of such

sequence variations in the actual expression of the

ATPase II gene in human cells.

Like ATPase II, another similar protein, ATPase 1B [12],

is also believed to harbor lipid-translocating activity that

could be crucial in the phagocytic uptake of apoptotic cells.

It has been reported that this gene is highly expressed in the

brain [6,12]. As opposed to our earlier expectation that the

ATPase II promoter is neuron-cell specific, our data shows

that this promoter may not have any dramatic cell type-

specificity. Therefore, among other likely candidates,


ATPase 1B protein could be the main regulator of

phagocytosis in the brain. In our earlier studies, we had

expressed the ATPase II cDNA in neuronal cells to show an

increase in PS internalization in these cells [13]. Such

studies should also be performed with the ATPase 1B cDNA

and a thorough analysis of the ATPase 1B promoter and its

possible neural-cell specificity are required.

The P-type ATPases have received much attention in

recent years. The involvement of these proteins in multiple

drug resistance, Wilson’s disease, and familial Cholestasis

has been established in many studies. The genes for such

physiologically important proteins often undergo regulated

expression to help maintain appropriate levels of the gene

products. Moreover, during apoptosis, many other genes and

their products are regulated to effect signature changes that

are observed in apoptotic cells. As discussed earlier, the

overexpression of ATPase II in the hybrid neuroblastoma cell

line HN2 causes an increase in APTL activity [13]. Our

earlier studies have also shown that apoptosis is associated

with an inhibition of APTL and externalization of PS [19].

Because of this correlation, it could be expected that ATPase

II could be linked to the expression and regulation of

apoptosis-associated proteins. Thus, there is an acute need

for a thorough analysis of ATPase II expression in various cell

types under different conditions of trophic support or stress.

Results reported here lay the groundwork for such future

experiments, which will help delineate the role of ATPase II.

Acknowledgment

FJ and RD were supported by funds from the New

York Louis Stokes Alliance for Minority Participation

Program, MAGNET/AGEP, and NIH minority supple-

ments. This project was supported by a grant from the

NIH (CA77803-03).

References

[1] V.A. Fadok, D.R. Voelker, P.A. Campbell, J.J. Cohen, D.L. Bratton,

P.M. Hensen, Exposure of phosphatidylserine on the surface of

apoptotic lymphocytes triggers specific recognition and removal by

macrophages, J. Immunol. 148 (1992) 2207–2216.

[2] S.J. Martin, D.M. Finucane, G.P. Amarante-Mendes, G.A. O’Brien,

D.R. Green, Phosphatidylserine externalization during CD95-induced

apoptosis of cells and cytoplasts requires ICE/CED-3 protease activity,

J. Biol. Chem. 271 (1996) 28753–28756.

[3] T. Adayev, R. Estephan, S. Meserole, B. Mazza, E.J. Yurkow, P.

Banerjee, Externalization of phosphatidylserine may not be an early

signal of apoptosis in neuronal cells, but only the phosphatidylserine-

displaying apoptotic cells are phagocytosed by microglia, J. Neuro-

chem. 71 (1998) 1854–1864.

[4] R.F.A. Zwaal, R.A. Schroit, Pathophysiologic implications of

membrane phospholipid asymmetry in blood cells, Blood 89 (1997)

1121–1132.

[5] B. Verhoven, S. Krahling, R.A. Schlegel, P. Williamson, Regulation of

phosphatidylserine exposure and phagocytosis of apoptotic T lym-

phocytes, J. Cell Death Differ. 6 (1999) 262–270.

[6] M.S. Halleck, D. Pradhan, C. Blackman, C. Berkes, P.

Williamson, R.A. Schlegel, Differential expression of putative

transbilayer amphipath transporters, Physiol. Genomics 1 (1999)

139–150.

[7] X. Tang, M.S. Halleck, R.A. Schlegel, P. Williamson, A subfamily of

P-Type ATPases with aminophospholipid transporting activity, Sci-

ence 272 (1996) 1495–1497.

[8] R.F.A. Tilly, J.M.G. Senden, P. Comfurius, E.M. Bevers, R.F.A.

Zwaal, Increased aminophospholipid translocase activity in human

platelets during secretion, Biochim. Biophys. Acta 1029 (1990)

188–190.

[9] D.L. Daleke, W.H. Heustis, Incorporation and translocation of

aminophospholipids in human erythrocytes, Biochemistry 24 (1985)

5406–5416.

[10] M. Bitbol, P. Fellmann, A. Zachowski, P.F. Devaux, Ion regulation of

phosphatidylserine and phosphatidylethanolamine outside-inside

translocation in human erythrocytes, Biochim. Biophys. Acta 904

(1987) 268–282.

[11] I. Mouro, M.S. Halleck, R.A. Schlegel, M.M. Genevieve, P.

Williamson, A. Zachowski, P. Devaux, J. Cartron, Y. Colin, Cloning,

expression, and chromosomal mapping of a human ATPase 2 gene,

member of the third subfamily of P-Type ATPases and Orthologous to

the presumed bovine and murine aminophospholipid translocase, J.

Biol. Chem. 257 (1999) 333–339.

[12] M.S. Halleck, D. Pradhan, C. Blackman, C. Berkes, P. Williamson,

R.A. Schlegel, Multiple members of a third subfamily of P-Type

ATPases identified by genomic sequences and ESTs, Genome Res. 8

(1998) 354–361.

[13] G. Chin, Y. El-Sherif, F. Jayman, R. Estephan, A. Wieraszko, P.

Banerjee, Appearance of voltage-gated calcium channels following

overexpression of ATPase II cDNA in neuronal HN2 cells, Mol. Brain

Res. 117 (2003) 109–115.

[14] R. Tsivkovskii, J.F. Eisses, J.H. Kaplan, S. Lutsenko, Functional

properties of the copper-transporting ATPase ATP7B (the Wilson’s

Disease Protein) expressed in insect cells, J. Biol. Chem. 277 (2002)

976–983.

[15] W. Kuhlbrandt, Biology, structure and mechanism of P-type ATPases,

Nat. Rev. 5 (2004) 282–295.

[16] P.L. Pederson, E. Carafoli, Ion motive ATPases: I. Ubiquity, proper-

ties, and significance to cell function, Trends Biochem. Sci. 12 (1987)

146–150.

[17] J. Ding, Z. Wu, B.P. Crider, Y. Ma, X. Li, C. Slaughter, L. Gong, X.-S.

Xie, Identification and functional expression of four isoforms of

ATPase II, the putative aminophospholipid translocase, J. Biol. Chem.

275 (2000) 23378–23386.

[18] L.N. Bull, M.J.T. van Eijk, L. Pawlikowska, J.A. De Young, J.A.

Juijn, M. Liao, L.W.J. Klomp, N. Lomri, R. Berger, B.F. Scharsch-

midt, A.S. Knisely, R.H.J. Houwen, N.B. Freimer, A gene encoding a

P-type ATPase mutated in two forms of hereditary cholestasis, Nat.

Genet. 18 (1998) 219–224.

[19] P. Das, R. Estephan, P. Banerjee, Apoptosis is associated with an

inhibition of aminophospholipid translocase (APTL) in CNS-derived

HN2-5 and HOG cells and phosphatidylserine is a recognition

molecule in microglial uptake of the apoptotic HN2-5 cells, Life Sci.

72 (2003) 2617–2627.

[20] W.-J. Oh, E.K. Kim, K.D. Park, S.H. Hahn, O.J. Yoo, Cloning and

characterization of the promoter region of the Wilson disease gene,

Biochem. Biophys. Res. Commun. 259 (1999) 206–211.

[21] W.J. Kent, BLAT—The BLAST-like alignment tool, Genome Res. 12

(2002) 656–664.

[22] W.J. Kent, C.W. Sugnet, T.S. Furey, K.M. Roskin, K.M. Roskin, T.H.

Pringle, A.M. Zahler, D. Haussler, The human genome browser at

UCSC, Genome Res. 12 (2002) 996–1006.

[23] J.D. Thompson, D.G. Higgins, T.J. Gibson, CLUSTALW: improving

the sensitivity of progressive multiple sequence alignment through

sequence weighting, position-specific gap penalties and weight matrix

choice, Nucleic Acids Res. 22 (1994) 4673–4680.


[24] R.F. Smith, B.A. Wiese, M.K. Wojzynski, D.B. Davison, K.C. Worley,

BCM Search Launcher—an integrated interface to molecular biology

data base search and analysis services available on the World Wide

Web, Genome Res. 6 (1996) 454–462.

[25] M. Scherf, A. Klingenhoff, T. Werner, Highly specific localization of

promoter regions in large genomic sequences by PromoterInspector: a

novel context analysis approach, J. Mol. Biol. 297 (2000) 599–606.

[26] K. Quandt, K. Frech, H. Karas, E. Wingender, T. Werner, MatInd and

MatInspector: new fast and versatile tools for detection of consensus

matches in nucleotide sequence data, Nucleic Acids Res. 23 (1995)

4878–4884.

[27] M. Gardiner-Garden, M. Frommer, CpG islands in vertebrate

genomes, J. Mol. Biol. 196 (1987) 261–282.

[28] C.D. Novina, A.L. Roy, Core promoters and transcriptional control,

Trends Genet. 12 (1996) 351–355.

[29] R.J. Gumina, N.E. Kirschbaum, K. Piotrowski, P.J. Newman, Charac-

terization of the human platelet/endothelial cell adhesion molecule-1

promoter: identification of a GATA-2 binding element required for

optimal transcriptional activity, Blood 89 (1997) 1260–1269.

[30] P.J. Cowan, D. Tsang, C.M. Pedic, L.R. Abbott, T.A. Shinkel, A.J.

d’Apice, M.J. Pearse, The human ICAM-2 promoter is endothelial

cell-specific in vitro and in vivo and contains critical Sp1 and GATA

binding sites, J. Biol. Chem. 273 (1998) 11737–11744.

[31] J. Lu, W. Lee, C. Jiang, E.B. Keller, Start site selection Sp1 in the

TATA-less human Ha-ras promoter, J. Biol. Chem. 269 (1994)

5391–5402.

[32] C. Muller, R. Yang, L. Beck-von-Peccoz, G. Idos, W. Verbeek, H.P.

Koefffler, Cloning of the cyclin A1 genomic structure and character-

ization of the promoter region. GC boxes are essential for cell cycle-

regulated transcription of the cyclin A1 gene, J. Biol. Chem. 274

(1999) 11220–11228.

[33] C.J. Schoenherr, A.J. Paquette, D.J. Anderson, Identification of

potential target genes for the neuron-restrictive silencer factor, Proc.

Natl. Acad. Sci. 93 (1996) 9881–9886.

Isolation, sequencing, and functional analysis of the TATA-less human ATPase II promoter

Documents

Transcript of Isolation, sequencing, and functional analysis of the TATA-less human ATPase II promoter