Investigation of the Biosynthesis of Ganefromycins and ...

Investigation of the Biosynthesis of

Ganefromycins and Rishirilides

Dissertation

to obtain the doctorate

the Faculty of Chemistry, Pharmacy, and Earth Sciences

the Albert-Ludwigs-Universität Freiburg im Breisgau

submitted by

Xiaohui Yan

from Hubei, China

2012

Dekan: Prof. Dr. Andreas Bechthold

Vorsitzender des Promotionsausschusses: Porf. Dr. Thorsten Koslowski

Referent: Prof. Dr. Andreas Bechthold

Korreferent: Prof. Dr. Irmgard Merfort

Datum der Promotion: 05.07.2012

Herrn Prof. Dr. Andreas Bechthold danke ich für sein

stetes Interesse und viele wertvolle Diskussionen, die den

Weg zu der vorliegenden Arbeit begleitet haben.

Publications and Posters

Publications

1) Ostash, B., Yan, X., Fedorenko, V., Bechthold, A. 2010. Chemoenzymatic and

bioenzymatic synthesis of carbohydrate containing natural products.

Top. Curr. Chem. 297, 105.

2) Yan, X., Probst, K., Linnenbrink, A. Arnold M., Paululat, T., Zeeck, A.,

Bechthold, A. 2012. Cloning and herterologous expression of three type II

PKS gene clusters from Streptomyces bottropensis. Chembiochem. 13(2),

224.

3) Bechthold, A., Yan, X. 2012. SnoaW/SnoaL2: A Different Two-Component

Monooxygenase. Chemistry & Biology. 19, 549.

Poster:

Investigation of three PKS type two clusters from Streptomyces Go C4/4,

Irseer Naturstofftage, Irsee, 23.-25.02.2011

Abstract I

Abstract

Ganefromycins and rirshirilides are polyketides produced by Streptomyces spp.: the

former are biosynthesized by the modular polyketide synthases and display a very

narrow spectrum of antibacterial activity against human pathogens, while the latter,

which have highly-oxygenated anthracene skeleton and are able to inhibit plasma

α2-macroglobulin, are formed by aromatic polyketide synthases. The chemical

structures and the bioactivities of ganefromycins and rishirilides have been

characterized for more than thirty years, but their biosynthetic pathways have not been

reported so far. In this thesis, gene clusters responsible for the biosynthesis of

ganefromycins and rishirilides were identified by gene inactivation and heterologous

expression. Based on the results from the gene inactivation experiments, the putative

biosynthetic pathways for ganefromycins and rishirilides were proposed.

The whole ganefromycins biosynthetic gene cluster was obtained by the contigs of the

three cosmids identified by H. Weiss (cosmid26, cosmid201 and cosmid200) and the

two cosmids found in this thesis (cosmid21 and cosmid2H19). The loss of

ganefromycins production in the PKS-disrupted mutant clearly proves that this gene

cluster is responsible for the biosynthesis of ganefromycins.

Rishirilide A and B are α2-macroglobulin inhibitors. They both consist of an anthracene

structure with three side chains, which is quite rare for aromatic polyketides. Rishirilide

A was once isolated from the culture broth of S. bottropensis, but attempts to reproduce

this compound failed. In this thesie, the cos4 which contains probably the whole

rishirilides biosynthetic gene cluster was introduced into the heterologous expression

host S. albus, to obtain S. albus::cos4. This new strain can produce rishirilide B in

various media steadily and high efficiently. Analysis of the genes in the rishirilide

cluster reveals the existence of a unique priming ketosynthase (RslK4), two rare

luciferase-like monooxygenases (RslO1 and RslO6) as well as four transcriptional

regulators (RslR1-R4).

II Abstract

Inactivation of rslK4 in cos4 resulted in the production of two novel rishirilide B

derivatives with shorter side chains. This result is consistent with the presumption that

RslK4 is responsible for selecting the starter unit and priming the polyketide

biosynthesis. Together with an acyltransferase (RslA), RslK4 catalyzes the

condensation between the amino acid-derived isobutyryl-CoA and malonyl-ACP, to

form the 3-oxo-isohexanoyl-ACP intermediate. Without RslK4, the minimal PKS is

able to utilize acetyl-CoA and propionyl-CoA as starter units.

Inactivation of rslO1 and rslO6 led to unexpected results. Two similar compounds with

only two side chains but the same number of carbons as rishirilides were isolated from

the rslO1-deleted mutant. Based on the structures of the derivatives as well as the

putative function of RslO1, a Favorskii-like oxidative rearrangement is proposed to be

involved in the biosynthsis of rishirilides, which also clarifies the origin of the three

side chains in rishirilides. In the rslO6-deleted mutant, rishirilide B was still produced.

Therefore this gene is proposed to participate in the conversion of rishirilide B to

rishirilide A.

Analysis of the four regulators by expression and transcriptional fusion with gusA gene

showed that RslR3 and RslR4 occupy a higher position in the regulatory casacade for

rishirilides production, while RslR1 and RslR2, two SARP regulators, are in the lower

position and might function by directly binding to the promoter regions of the structural

and resistance genes. Even more, transcription of rslR1 is only regulated by RslR4, and

transcription of rslR2 is only controlled by RslR3. This complicated regulatory network

might be able to explain the irreproducibility of rishirilide A in the native producer, S.

bottropensis.

Table of contents III

Table of contents

Abstract ..................................................................................................................................... I

1 Introduction .......................................................................................................................... 1

1.1 Natural products as a source of therapeutic agents ......................................................... 1

1.2 Biosynthesis of polyketides by polyketide synthases ..................................................... 3

1.2.1 Polyketide ................................................................................................................ 3

1.2.2 Type I PKS .............................................................................................................. 6

1.2.3 Type II PKS ............................................................................................................. 8

1.2.4. Type III PKS ......................................................................................................... 11

1.3. Post-PKS modifications ............................................................................................... 12

1.3.1 Oxygenases ............................................................................................................ 13

1.3.2 Methyltransferases ................................................................................................. 18

1.3.3 Glycosyltransferaes ................................................................................................ 19

1.4 Regulation of polyketide biosynthesis by SARP regulators ......................................... 20

1.5 The Polyketides Ganefromcyins and Rishirilides ......................................................... 21

1.6 Aims of this study ......................................................................................................... 22

2 Materials and Methods ...................................................................................................... 25

2.1 Chemicals, media components ...................................................................................... 25

2.2 Enzymes and Kits .......................................................................................................... 26

2.3 Media, Buffers and Solutions ........................................................................................ 27

2.3.1 Media for bacterial culture ..................................................................................... 27

2.3.2 Buffers ................................................................................................................... 29

2.3.3 Solutions of Antibiotics ......................................................................................... 31

2.3.4 Solutions for blue/white selection of E. coli .......................................................... 32

2.3.5 Buffers for preparation of protoplast ..................................................................... 32

2.3.6 Buffers for protein purification .............................................................................. 33

2.3.7 Staining regents for the staining of TLC plates ..................................................... 34

2.4 Bacterial strains ............................................................................................................. 34

2.4.1 E. coli strains ......................................................................................................... 34

IV Table of contents

2.4.2 Streptomyces strains ............................................................................................... 35

2.5 General cultivation of Streptomyces strains .................................................................. 35

2.5.1 Preparation of permanent culture and spore suspension ........................................ 36

2.5.2 Production of secondary metabolites ..................................................................... 36

2.6 Vectors, cosmids and plasmids ..................................................................................... 36

2.7 Methods in Molecular Biology and Biochemistry ........................................................ 38

2.7.1 Methods in isolation, concentration and analysis of DNA .................................... 38

2.7.2 Methods in DNA cloning ....................................................................................... 41

2.7.3 Inactivation of genes on the cosmid by λ RED-mediated recombination .............. 41

2.7.4 PCR amplication .................................................................................................... 43

2.7.5 Transformation of DNA into E. coli ...................................................................... 46

2.7.6 Methods for introducing DNA into Streptomyces ................................................. 48

2.8 Method of biochemistry ................................................................................................ 50

2.8.1 SDS-PAGE ............................................................................................................ 50

2.8.2 Expression and purification of RslK4 from E. coli ................................................ 50

2.8.3 Expression and purification of RslK4 from S. lividans 1326 ................................ 50

2.8.4 Transcriptional fusion analysis with the gusA gene ............................................... 51

2.9 Production, isolation and characterization of secondary metabolites ........................... 51

2.9.1 Production and extraction of Ganefromycin .......................................................... 51

2.9.2 Production of Rishirilide B and its derivatives in S. albus and S. lividans ............ 52

2.9.4 Purification of seconadry metabolites for structural measurement with NMR...... 54

2.9.5 Structure elucidation by NMR ............................................................................... 57

2.10 Softwares, databases and online tools ......................................................................... 58

3 Results.................................................................................................................................. 61

3.1 Indentification of the Ganefromycins biosynthetic gene cluster ................................... 61

3.1.1 Analysis of the DNA sequence of cosmid 21 ........................................................ 62

3.1.2 Screening and analysis of cosmid 2H19 ................................................................ 62

3.1.3 Analysis of the putative gan-cluster ...................................................................... 66

3.2 Identification of the ganefromycin biosynthetic gene cluster ....................................... 70

Table of contents V

3.2.1 Conjugation of S. lydicus ....................................................................................... 70

3.2.2 Verification of the gan-Cluster by disrupting ganAIV ........................................... 71

3.3 Production of Rishirilide B and analysis of the rishirilide biosynthetic gene cluster ... 73

3.3.1 Production of rishirilide B ..................................................................................... 74

3.3.2 Analysis of the rishirilide biosynthetic gene cluster .............................................. 78

3.4 Inactivation of genes in the rsl-cluster .......................................................................... 87

3.4.1 Inactivation of rslK4- the priming ketosynthase gene ........................................... 87

3.4.2 Inactivation of rslO1- a luciferase-like monooxygenase gene............................... 90

3.4.3 Inactivation of rslO6- a luciferase-like monooxygenase gene............................... 93

3.5 Expression of RslK4 in E. coli and S. lividans.............................................................. 94

3.6 Investigation of the rishirilide regulators ...................................................................... 95

3.6.1 Overexpression of the regulatory genes ................................................................. 95

3.6.2 Investigation of the regulatory hierarchy amongst the regulators .......................... 97

4. Discussion ......................................................................................................................... 101

4.1 Biosynthesis of ganefromycin ..................................................................................... 101

4.1.1 Sequencing and analysis of the ganefromycin biosynthetic gene cluster ............ 101

4.1.2 Biosynthesis of the ganefromycin polyketide chain ............................................ 102

4.1.3 Biosynthesis and attachment of the three deoxy sugars ....................................... 104

4.2 Heterologous production of rishirilide B in S. albus ................................................... 105

4.3 Overview of key proteins involved in rishirilide biosynthesis .................................... 107

4.3.1 RslK4 and RslA provide the starter unit .............................................................. 107

4.3.2 The two luciferase-like monooxygenases ............................................................ 109

4.3.3 Aromatization and cyclization catalyzed by the three cyclases ........................... 112

4.3.4 Regulation of rishirlide biosynthesis ................................................................... 113

4.4 Inactivation of rslK4, rslO1 and rslO6 ....................................................................... 114

4.4.1 Inactivation of the ketoacylsynthase gene rslK4 ................................................. 114

4.4.2 Inactivation of rslO1 and rslO6 ........................................................................... 115

4.5 Proposed biosynthetic pathway to rishirilide A .......................................................... 119

5. References ........................................................................................................................ 123

VI Table of contents

6 Appendix ........................................................................................................................... 141

6.1 List of abbreviations .................................................................................................... 141

6.2 Maps of plasmids ........................................................................................................ 144

6.2.1 pKCXY01 and pKCXY02 ................................................................................... 144

6.2.2 pKCganAIVEP ..................................................................................................... 145

6.2.3 pSOK804, pCDFDuet and pKC1218E ................................................................ 145

6.2.4 pGUS and its derived plasmids ............................................................................ 147

6.2.5 pUWL-H .............................................................................................................. 148

6.3 NMR and MS spectra of the compounds characterized in this thesis ......................... 149

Acknowledgements .................................................................................................................. A

Curriculum vitae ..................................................................................................................... C

Introduction 1

1 Introduction

1.1 Natural products as a source of therapeutic agents

Natural products refer to naturally occurring substances derived from living organisms,

such as plants and microorganisms. The majority of natural products are secondary

metabolites- small molecules that play significant roles in the relationships between the

hosts and their surroundings. It’s believed that the primary function of secondary

metabolites is to increase the likelihood of its producer’s procreation and survival by

repelling or attracting other organisms.[1]

Therefore, a lot of natural products are toxic

against humans, animals and microorganisms. It has been estimated that there are more

than 300000 natural products in the earth and they play many important roles in our

Scheme 1. Representative natural drugs from animals, plants and microorganisms.

2 Introduction

daily lives (Scheme 1). The use of natural compounds derived from plants to control

diseases can be traced to ancient Egypt and Mesopotamia. The WHO (World Health

Organization) estimated that perhaps 80% of the world’s population mainly depends on

traditional medicines for primary health care.[2]

Microorganisms are currently one major source for the production of bioactive natural

products. An important reason for the widely use of microorganisms to produce

natural products is that they are generally easy to cultivate in large scales with a

relatively short time and low costs, facilitating a cheap and steady supply of the

products. Of all the microorganisms, actinomycetes, a group of gram-positive,

falimentous and mainly soil-inhabit bacteria with high GC-content, produced almost

80% of the world’s antibiotics (Table 1).[3]

It was estimated that the number of

antibiotics characterized so far is less than 5% of the total, making the actinomycetes

group, especially streptomyces, an important source for drug discovery in the future.[4]

Table 1: New antibacterial drugs launched since 2000 from microorganisms

Year Name Class Lead Source

2002 Biapenem β-Lactam ( carbapenem) Thienamycin Actinomycete

2002 Ertapenem β-Lactam ( carbapenem) Thienamycin Actinomycete

2005 Doripenem β-Lactam ( carbapenem) Thienamycin Actinomycete

2009 Tebipenem pivoxil β-Lactam ( carbapenem) Thienamycin Actinomycete

2008 Ceftobiprole medocaril β-Lactam ( Cephalosporin) Cephalosporin Fungus

2010 Ceftaroline fosamil β-Lactam ( carbapenem) Cephalosporin Fungus

2001 Telithromycin Macrolide (Ketolide) Erythromycin Actinomycete

2003 Daptomycin Lipopeptide Daptomycin Actinomycete

2005 Tigecycline Tetracycline Tetracycline Actinomycete

2007 Retapamulin Pleuromutilin Pleuromutilin Fungus

2009 Telavancin Glycopeptide Vancomycin Actinomycete

Over the last two decades, advances in structures analysis techniques such as X-ray

crystallography, nuclear magnetic resonance (NMR), high-resolution mass spectro-

scopy (HRMS), circular dichrosim (CD) and new drug discovery methods such as

rational drug design (RDD), high-throughput screening (HTS), fragment-based drug

discovery (FBDD) and combinatiorial chemistry have attracted most of the attention in

Introduction 3

pharmaceutical industries.[5]

Most major pharmaceutical companies have terminated or

scaled down their NP operations. However, natural products are still an important

source of novel drugs in some therapeutic areas such as anti-infection, oncology,

immunosuppression and metabolic diseases.[6]

According to a report of Newman and

Cragg, approximately 70% of the new approved drugs between 1981 and 2006 were

derived, more or less, from natural products.[7]

1.2 Biosynthesis of polyketides by polyketide synthases

1.2.1 Polyketide

Polyketides are an extraordinarily valuable family of natural products. They are

widely distributed in bacteria, fungi and plants, with a number of more than 10000 for

characterized polyketides. Medically important polyketides include antibiotics

Scheme 2. Bioactive complex polyketides with diverse structure and function.

4 Introduction

(erythromycin A, monensin A, tetracycline), anticancer (epothilones and doxorubicin)

anti-parasitics (avermectin), anti-fungals (amphotericin B), immunesupperssants

(rapamycin), and cholesterol-lowering (lovastatin) agents (Scheme 2). It has been

estimated that the sales of the more than 40 polyketide medicines total more than

US$20 billion a year, close to the total sales of protein therapeuticals.[6]

Because of

their importance and great potential, there has been a great interest in finding new

polyketide molecules in the last 60 years.

The broad spectrum of biological activities of polyketides arises from their

considerable structural diversity. Some polyketides are highly rigidified and aromatic

compounds, for example, doxorubicin. They derive from similar polyketone chains by

alternative modes of folding, cyclization and post-PKS modifications. Others,

represented by erythromycin A, are diversified molecules with different compositions

of starter and extender units for the poly-β-ketone skeletons and different

conformations formed by intramolecular end-to-end cyclization. The post-assembly

modifications of polyketides, including oxidation, reduction, epimerization, acylation

and glycosylation, give rise to the structural and functional diversity of the resulting

compounds.[8]

Polyketides are produced by polyketide synthases (PKSs) via repetitive Claisen

condensations of extender units derived from malonyl-coenzyme A (malonyl-CoA)

with an activated carboxylic acid starter unit in a manner resembling the biosynthesis

of fatty acid.[9]

The typical starter unit and extender unit for fatty acid synthases

(FASs) is an acetyl moiety and malonyl-CoA, repectively, whereas PKSs can utilize a

variety of starter units including acetyl-, ethyl-, propionyl-, and butyryl-CoA, and also

variable extender units such as malonyl-, methylmalonyl-, or occasionally

ethylmalonyl-CoA. While the end result of FAS-catalyzed fatty acid biosynthesis is

typically a fully reduced carbon chain of a defined length, polyketides usually have

varying degrees of reduction at different carbon centers within the chain. Based on

protein architecture, PKSs can be classified into four groups: modular type I PKSs,

iterative type I PKSs, type II PKSs, and type III PKSs (Table 2 and Figure 1.1).

Introduction 5

Numerous reviews have been published on the biosynthesis of polyketides.[9-12]

A

short description to the composition and catalytic mechanism of these PKSs is present

in the following sections.

Table 2 Characteristic features of type I, II, and III PKSs

Group Protein structure Synthesis mechanism Found in

Type I

(modular)

Single protein with multiple

modules

Linear (assembly-line style) in which

each active site is used only once.

Bacteria

Type I

(iterative)

Single protein with one module. Iterative, in which the active sites are

reused repeatly.

Fungi and

Bacteria

Type II Multiple proteins, each with

mono-functional active sites.

Iterative, in which active sites may

be used only once or repeatedly.

Bacteria

Type III Single protein with multiple

modules

Iterative, in which the active sites are

reused repeatly.

Plants, Fungi

and Bacteria

Figure 1.1 Schematic of the three types of PKS.

6 Introduction

1.2.2 Type I PKS

Type I PKSs consist of one or more proteins that contain different active domains.

Each domain is responsible for one reaction in the polyketide chain assembly and

modification. The domains in a module are covalently fused by the linkers. Each PKS

module consist of at least three core domains: an acyltransferase (AT) domain that

captures a nucleophilic β-carboxyacyl-CoA extender unit and transfers it to the

phosphorpantetheine arm of the acyl carrier proteins (ACP) domain (Figure 1.2),

where a thioester bond is formed to fix the growing polyketide to the synthase; and a

ketosynthase (KS) domain, which is responsible for the decarboxylic condensation

between the extender unit on the ACP domain of the same module and the polyketide

intermediate bound to the ACP domain of the preceding module. Optional domains

such as ketoreductase (KR), oxidation (Ox), dehydratase (DH), methyltransferase

(MT) and enoylreductase (ER) modify the growing polyketide molecule before it is

transferred to the next module in the assembly line. In the last step for the

biosynthesis of the polyketide skeleton, the full-length polyketide chain is transferred

to a thioesterase (TE) domain, where the polyketide is released. The variation of these

chain modifying reactions, together with the variety of the starter units and extender

units lead to the structural diversity of type I polyketides.

Type I PKSs can be divided into two groups, the modular type I PKSs of bacteria and

the iterative type I PKSs of fungi. The modular PKSs typically exhibit what is called

co-linearity with their products, that is to say each module is made-up of adjacent

domains, and modules and domains are utilized in the order suggested by the gene

organization.[13]

From the sequence of modules of the PKS, one can make a

reasonably accurate prediction about the structure of the resulting product.[14]

The best

example showing how modular PKS organization is reflected in polyketide structure

is the multienzyme complex known as 6-deoxyerythronolide B synthase (DEBS),

which synthesizes the aglycon core (6-deoxyerythronolide B) of erythromycin.[15]

Introduction 7

Figure 1.2 Proposed mechanism for the AT doamin.

DEBS is organized into six extension modules in addition to a loading module,

divided among three large polypeptides (DEBS1, DEBS2, and DEBS3). Each of the

three subunits of DEBS has two extender modules and the first module is preceded by

a loading didomain for the selection of the starter unit (propionyl-CoA), and the last

module is followed by a thioesterase (TE) domain for product release and cyclization

(Figure 1.3). Each module is comprised of a minimal set of the KS, AT and ACP core

domains plus a β-ketoacyl-ACP reductase (KR) domain. However, the KR domain in

module 3 is reductively inactive, leading to the presence of a keto group at C-9 in

6-dEB. Collaboration of the DH, ER and KR domains in module 4 generates the

saturated methylene at C-7 of 6-dEB. Other well-studied examples of modular PKS

include the methymycin/picromycin polyketide synthase (PICS) from S.

venezuelae[16]

and the tylactone polyketide synthase (TYLS) from S. fradiae.[17]

Investigations of these PKSs greatly promote the knowledge on polyketide

biosynthesis and helped to generate several novel polyketides by combinatorial

biosynthesis.[18]

8 Introduction

Figure 1.3 Modular organization of 6-deoxyerythronolide B synthase (DEBS) and putative

intermediates.

Like DEBS, the polyketide synthases responsible for biosynthesis of the fungal

metabolites 6-MSA (by 6-MSAS)[19]

and lovastatin (synthesized by LNKS) [20]

have a

type I or covalent architecture. However, whereas DEBS contains a distinct module

for each round of chain extension, the single modules of 6-MSAS and the lovastatin

nonaketide synthase are used iteratively to assembly a polyketide product. These

fungal aromatic polyketide are known as iterative type I PKSs.

1.2.3 Type II PKS

In contrast to Type I PKSs, type II PKSs comprise of several discrete enzymes that

are monofunctional and iteratively used to generate aromatic compounds, by a mech-

anism analogous to type II bacterial and plant FASs. Type II PKSs were only found in

gram-positive actinomycetes until the recent discovery of the alkaloid aurachin PKS

from gram-negative myxobacterium.[21]

All type II PKSs contain a minimal set of

Introduction 9

iteratively used enzymes, which are generally called minimal PKS, to catalyze the

iterative decarboxylative condensation of malonyl-CoA extendr units with an acyl

starter unit (Figure 1.4). The minimal PKS consists of two ketosynthease units (KSα

and KSβ) and an ACP, which serves as an anchor for the growing polyketide chain.[10]

With a few exceptions, genes encoding these three proteins are grouped together, and

show a typical KSα/KSβ/ACP architecture. Both the KSα and KSβ subunits are highly

similar in sequence, but in the KSβ component, the active cysteine residue which is

crucial for polyketide assembly is missing. Khosla and coworkers demonstrated that

KSα and KSβ form a heterodimer in analogy to the KS homodimers (FabF) from

bacterial FAS.[22]

Furthermore, they also proved that the KSα subunit catalyzes

Claisen-type C-C bond formation from activated acyl and malonyl building blocks,

while the KSβ subunit is responsible for the loading of malonyl CoA to form acetyl

KS[23]

and for the determination of carbon chain length [therefore it is also called as

‘chain length factor’ (CLF)].[24, 25]

Beside chain assembly, the minimal PKS can

Figure 1.4 Organization of the act genes of S.coelicolar and a proposed biosynthetic pathway

for actinorhodin.

10 Introduction

partially control the regiochemistry of the first cyclization. Another opinion believes

that other than the three “minimal PKSs”, a malonyl-CoA:ACP transferase (MCAT)

is involved in the basic component of type II PKS. Since genes encoding MCATs are

not found in most type II PKS gene clusters, it was proposed that an endogenous

MCAT from the bacteria fatty acid biosynthesis pathway is recruited to participate the

polyketide biosynthesis.[26]

The crystal structure of the KSα/KSβ heterodimer showed that these two proteins form

highly complementary contacts in the interface. It was deduced that a cleft between

KSα/KSβ keeps the nascent polyketide chain extended.[27]

Observation from the

cervimycin (cer) PKS and the act PKS suggested that the length of polyketide chain is

determined by a protein cavity located at the interface of the KSα/CLF dimer by

measuring the size of the chain.[25, 28]

However, Moore and Hunter found that the

chain length is determined not only by the CLF, but also by the whole PKS complex

including the cyclase and the aromatase.[29, 30]

Most of the type II PKSs use

malonyl-CoA as primer. It is proposed that biosynthesis of aromatic polyketide starts

by decarboxylation of a malonyl unit to form an acetyl-S-KS intermediate, which is

then processed by the minimal PKS. However, plenty of type II PKSs can use other

starter units such as propionate, (iso)butyrate, malonamate and benzoate.[31]

After modifying by the minimal PKS, The highly reactive linear poly-β-carbonyl

intermediate is then subjected to a series of downstream modifications such as

ketoreduction by KR, regioselctive cyclization and aromatization by cyclase (CYC)

and aromatase (ARO) (Figure 1.5), oxidation by the oxygenase (OXY) and so on, to

yield the final aromatic compounds. In the absence of these post-PKS enzymes, the

highly labile polyketide chain undergoes spontaneous cyclization to form a series of

shunt products, as exemplified by the case of actinorhodin derivatives.[32]

The minimal PKSs can only generate very limited core polyketide structures by

varying the chain length. However, the combination of different starter units, different

Introduction 11

types and positions of cyclization, as well as different post-PKS modifications make

the type II PKSs possible to produce the numerous aromatic compounds.

Figure 1.5 The three types of CYC/AROs

1.2.4. Type III PKS

The most well-known type III PKS are the enzymes for the biosynthesis of chalcones

(CHS) and stilbenes (STS) (Figure 1.6). Members of this family are proteins of 40-70

kDa that function as homodimers and carry out iterative condensation reactions with

malonyl-CoA.[33]

It was long believed that type III PKS only exists in plant, but

recently Horinouchi and Thomashow found type III PKS from S. griseus[34]

and from

Pseudomonas fluorescens [35]

, respectively. Fujii and coworker found a type III PKS

in the fungi Aspergillus oryzae.[36]

Comparing to CHS and STS, which choose

cinnamoyl-CoA as starter unit, the type III PKS from bacteria and fungi prefer shorter

chains such as acetyl-CoA and maloyl-CoA as the primers.

12 Introduction

Figure 1.6 Biosynthesis of chalcone and stilbene by type III PKS.

1.3. Post-PKS modifications

The tailoring steps catalyzed by oxidoreductases and group transferases, such as

methyltransferases (MTs), glycosyltransferase (GTs), halogenases and acyltrans-

ferases (ATs) are responsible for adding important groups to polyketide skeletons and

are crucial for the structural diversity and biological activity of polyketides. The

biosynthetic pathway of ansamitocin P-3, a potent antitumor agent produced by

Actinosynnema pretiosum, is an excellent example to show how an amateur

polyketide (proansamitocin) is converted into the active end-product by a series of

post-PKS modifications. The biosynthetic pathway of ansamitocin, revealing by

isotopic feeding experiments and by manipulating genes of the ansamitocin (asm)

biosynthetic gene cluster, involves the assembly of an initial macrocylic polyketide,

the hypothetical proansamitocin. Proansamitocin then undergoes a six post-PKS

modification steps to introduce a chlorine, two methyl groups, a cyclic carbamate, an

ester side chain, and an epoxide function, to give ansamitocin P-3 (Figure 1.7).

Introduction 13

Figure 1.7 Post-PKS modifications of an antitumor agent ansamitocin P-3.[38]

1.3.1 Oxygenases

The most frequently characterized post-PKS modifications are catalyzed by

oxidoreductases, a very broad group of enzymes consisting of oxygenases, oxidases,

peroxidases, reductases, and dehydrogenases. In generally, these enzymes introduce

oxygen-containing functionalities, i.e. hydroxyl groups, aldehyde or keto groups, and

epoxides or modify such functionalities by addition or removal of hydrogen atoms.

These enzymes are able to change the stereo-electronic and physico-chemical

properties of the substrate, as well as change the solubility of the molecule or convert

hydrogen bond donors into hydrogen bond acceptors and vice versa. Furthermore,

they often provide active sites for other post-PKS modifications, such as methyl- or

glycosyltransfer.[37]

Currently several types of oxygenases are known that play a role

in post-PKS modification: cytochrome P-450 monoxoygenases (CYP450),[38]

flavin-

dependent monooxygenases,[39, 40]

and anthrone-type oxygenases.[41]

These enzymes

catalyze different modification reactions, such as hydroxylation, epoxidation, quinine

formation, and oxidative rearrangement of the Baeyer-Villiger or the Favorskii type.

14 Introduction

Figure 1.8 Reactions catalyzed by the anthrone-type oxygenases TcmH and ActVA-orf6.

1.3.1.1 Anthrone-type oxygenases.

The anthrone-type monooxygenases don’t require cofactor for their catalysis. They

typically use their substrates as reducing equivalent for the reduction of an oxygen

atom (from dioxygen) to water.[41]

Hutchinson and coworkers characterized an

anthrone-type monooxygenase TcmH in the tetracenomycin biosynthetic gene cluster

from S. glaucescens. TcmH oxidizes the C-5 on naphthacenone tetracenomcin F1 to

form 5,12-naphthacenequinone tetracenomycin D3, using a radical process which

includes the generation of a superoxide anion radical.[42]

Incorporation studies with

18O and anthraquinone derivatives showed that one of the two oxygen atoms of the

quinine moiety is derived from molecular oxygen (Figure 1.8).[43]

Other well-studied

anthrone-type monooxygenases include ActVA-orf6 from the actinorhodin biosyn-

thetic pathway,[44]

AknX from the aklavinone biosynthetic pathway,[45]

and SnoaB

from the nogalamycin biosynthetic cluster.[46]

1.3.1.2 Flavin-dependent monooxygenases.

Flavin-dependent monooxyenases are attractive tailoring enzymes because of their

versatility, controllability and high enantio- and region-selectivity.[47]

Proteins of this

family incorporate an oxygen atom from molecular oxygen into the substrates with

the help of the electron rich flavin cofactor. They are widely present in a lot of

polyketides biosynthetic gene clusters[48]

. For most flavoproteins, a reactive

Introduction 15

C(4a)-hydroperoxy-flavin intermediate, which is derived from the adduction of a

molecular oxygen to the C(4a) of the flavin, is able to promote either a nucleophilic or

an electrophilic attack on the polyketide chain. As a result, one atom from molecular

oxygen is incorporated into the polyketide, while the other oxygen atom is reduced to

form water (Figure 1.9).[49]

Reactions catalyzed by the flavin-dependent monooxy-

genases include hydroxylations, epoxidations, Baeyer-Villiger and Favorskii-like

oxidative rearrangements.

Figure 1.9 Catalytic cycle of flavin-dependent monooxygenases

Baeyer-Villiger Monooxygenases [50]

The Baeyer-Villiger oxidation, a reaction oxidizing a ketone or aldehyde to an ester or

lactone, is a useful transformation in organic synthesis. The Baeyer-Villiger mono-

oxygenases (BVMO), one type of flavin-dependent monoxygenases, can catalyze the

insertion of an oxygen atom into a carbon-carbon chain of a carbonylic compound

with the help of NADPH.[50]

Rohr and coworkers studied the crystal structure of

MtmOIV, a BVMO from the mithramycin biosynthetic pathway, and provided a good

evidence for the catalytic mechanism of BVMOs.[51]

An In vitro assay in a system

contaning MtmOIV, NADPH, FAD and O2 showed that MtmOIV promotes the

cleavage of C-C bond in premithramycin B, to form an intermediate premithramycin

B-lactone, proving the Baeyer-Villiger reaction in the biosynthesis of mithramycin.

The Bayer-Villiger rearrangement is also reported to be involved in the biosynthesis

16 Introduction

of urdamycin[52]

, jadomycin,[53]

gilvocarcin (Figure 1.10),[54]

and 5-alkenyl-3,3(2H)

-furanones (E-837, E-492 and E975)[55]

, and play an important role in the biological

activity of these polyketide products.

Favorskiiase

In contrast to the widely occurrence of of Baeyer-Villiger rearrangement, the

Favorskii–type oxidative rearrangement is much rare. This reaction is named for a

reaction in which the alpha-halogenated ketones are rearranged in the presence of

base to form carboxylic acids with loss of halide. Until now only a few oxygenases

that can catalyze Favorskii rearrangement have been identified. The most famous

Favorskii-like oxgenase, EncM, which catalyzes a C-C bond rearrangement in the

polyketide chain of enterocin, has been extensively characterized.[56]

Moore and

coworkers showed that EncM catalyzes the oxidation at C-12 on the C-9 reduced

octaketide to form an 11,12,13-trione intermediate (Figure 1.10). Moreover, EncM

also catalyzes two aldol condensations between C-6&C-11 and C-7&C-14.[57]

Introduction 17

Figure 1.10 The Baeyer-Villiger and Favorskii-like oxidative rearrangement.

1.3.1.3 Cytochrome-dependent P450 monooxygenases

CYP450 monooxygenases catalyze a lot of hydroxylation or oxidative steps in the

post-PKS modification stages. These oxidative reactions are often essential for the

structural diversity and biological activity of polyketide compounds.[58]

The CYP450

monooxygenase from the pikromycin biosynthetic gene cluster, PikC, demonstrates

high substrate flexibility towards 12- and 14-membered marcolactone, such as YC-17,

narbomycin, oleandomycin and can oxidize two positions on the marcolactone

system.[59]

DoxA, a CYP450 monooxygenase from the doxorubicin biosynthetic

pathway, exhibits a broad substrate specificity and catalyzes three oxidation steps in

the biosynthesis of doxorubicin.[60]

(Figure 1.11)

18 Introduction

Figure 1.11 Oxidation of YC-17 and DOD by CYP450 proteins PikC and DoxA.

1.3.2 Methyltransferases

Methyltransferases are responsible for the transfer of activated methyl group to the

O-, N- or C- atoms of the polyketides or deoxy sugars. O- and N-methylation increase

the lipophilicity of a molecule and also remove hydrogen-bond donor sites. Three

methyltransferase genes (asm7, asm10 and asm17) are involved in the O- and N-

methylations in the biosynthesis of ansamitocin P-3.[61]

Deletion of asm7 from

ansamitocin P-3 producer led to the accumulation of 20-O, N-didemethyl-ansamitocin

P-3 and 20-O-demethyl-ansamitocin P-3. Asm10 was identified as the N-methyltrans-

ferase by deletion experiment that led to the production of N-demethylansamitocin

P-3. Asm17 had been characterized as a C-10 O-methyltransferase due to its linkage

to asm13-asm16 genes which are involved in the biosynthesis of the extender unit

methoxymalonyl-CoA.[61, 62]

(Figure 1.7)

Introduction 19

1.3.3 Glycosyltransferaes

A large number of polyketides are glycosylated compounds, including erythromycin,

amphotericinB, avermectins and doxorubicin. These sugars contribute to the structural

biodiversity of compounds and participate in the interaction between the drug and the

cellular targets. The glycosylation reactions, in which the NDP-activated sugar donors

are attached to the acceptor molecules (aglycone), are carried out by glycosyltrans

ferases (GTs). Urdamycin A and landomycin A are two examples of glycosylated

aromatic polyketides (Figure 1.12). In most of the cases, attachment of the sugars to

the aglycone occurs through O-glycosidic linkages. But examples of C- (such as in

urdamycin) and N-glycosidic (such as in ansamitocins) linkages also exist.

Figure 1.12 Attachmentof the sugar side chains of landomycin A and urdamycin A.

20 Introduction

1.4 Regulation of polyketide biosynthesis by SARP

regulators

Streptomyces Antibiotics Regulatory Proteins (SARPs) are a novel family of

transcriptional regulators that activate the expression of specific antibiotic

biosynthetic gene clusters. Members of this family exhibit a winged helix-turn-helix

(HTH) motif near the N-termini that resembles the DNA-binding domain in the

C-terminus of the OmpR family of regulators[63]

. Some of these proteins are proved to

activate transcription by binding to the heptameric repeats within the -35 region of

their cognate promoters, and then initiate transcription by recruitment of RNA

polymerase to the appropriate sites.[64]

A well-studied SARP regulator, DnrI, has been

shown to bind to the direct-repeat sequence 5’-TCGAGC(G/C)-3’ near the -35 region

of the promoters it controls(Figure 1.13). Expression of SARP genes has been

reported to increase the production of many secondary metabolites.[65]

DnrI, the

SARP regulator from the mithramycin biosynthetic pathway can not only improve the

production of mithramycin in S. argillaceus, but also the production of actinorhodin

in S.coelicolor.[66]

Recent studies have shown that the SARP family contains not only

pathway-specific regulators but also some pleiotropic regulatory proteins, for example

AfsR from S. coelicolor.[67]

Figure 1.13 Alignment of the N-terminal amino acid sequence of DnrI with the C-terminal

DNA-binding domain of OmpR. Regions of OmpR sequence that binds to DNA (double underline)

and RNAP (dashed underline) are marked.[69]

Right: Ribbon diagram of OmpR.[70]

Introduction 21

1.5 The Polyketides Ganefromcyins and Rishirilides

Ganefromycins (ganefromycin α and ganefromycin β), a family of elfamycin

antibiotics produced by Streptomyces lydicus spp. Tanzanius Lechevalier (currently

named as S. lydicus ssp. Tanzanius NRRL18036 because of its high similarity to the

strain S. lydicus ISP 5461),[68]

have shown strong growth-promoting activity in

animals. The mechanism of the biological activity of ganefromycins is supposed to be

Figure 1.14 Chemical structure of ganefromycins, kirromycin and rishirilides.

the same as other elfamycin family antibiotics, such as aurodox, kirromycin,

kirrothricin and phenelfamycins. These substances bind to the interface of domains I

and II of the EF-Tu, leading to a protein conformation that no longer dissociates from

the ribosome, and thus inhibits protein biosynthesis in the microorganisms.[69]

Although ganefromcyins were classified into the elfamycin family, their chemical

structures are distinct from most molecules of this family. Firstly, they contain a

22 Introduction

trisaccharide moiety at O-21a other than O-24 for other members with deoxy sugars.

Secondly, the presence of a carboxylic acid on the truncated backbone structure is

also rare, because most of the elfamycin antibiotics contain a pyridine unit in the end

of molecules. Lastly, the phenacyl group at O-23 or O-24 is also not often (Figure

1.14). All the properties make ganefromycin an interesting target for investigating the

biosynthesis as well as the relationship between the structure and the mechanism of

action in the elfamycin antiobiotics.[70]

Rishirilides A and B, two α2-macroglobulin inhibitors, were firstly discovered in 1984

by Iwaki and coworkers from Streptomycs rishiriensis OFR-1056 (Figure 1.14).[71]

They were found to inhibit α2-macroglobulin with IC50‘s of 100 μg/ml for rishirilide

A and 35μg/ml for rishirilide B. Because α2-macroglobulin can inhibit protease via a

unique trapping mechanism, inhibitors of α2-macroglobulin are potential drugs in

treating thrombosis caused by fibrinolytic accentuation.[72]

During his work in the

discovery of the antitumor agent mensacarcin from the strain Streptomyces

bottropensis (formerly named as Streptomyces sp. Gö C4/4), Arnold Moritz also

isolated rishirilide A from the fermentation broth of S. bottropensis.[73]

However,

attempts to reproduce rishirilide A in this strain failed.

1.6 Aims of this study

Because of their therapeutic importance and structural diversity, polyketide has

always been a hot-spot both for the discovery of novel leading drugs and for the

investigation of the mechanism behind their biosynthesis. The biosynthesis of

ganefromycins by the type I PKS and rishirilides by the type II PKS are attractive, due

to their special biological activities and their unusual structures.

The aims of the ganefromycin project were:

1. Cloning and sequencing of the ganefromycin biosynthetic gene cluster.

2. Deducing of the functions of the ganefromycin biosynthetic genes.

3. Finding a method to introduce DNA into the ganefromycin producer.

Introduction 23

4. Disruption of the genes to verify the identity of the putative ganefromycin

biosynthetic gene cluster.

The aims of the rishirilides project were:

1. Production of rishirilides by heterologous expression.

2. Deletion and characterization of the rishirilides biosynthetic genes.

3. Investigation of the regulation of rishirilides biosynthetic genes.

Materials and Methods 25

2 Materials and Methods

2.1 Chemicals, media components

Table 2-1 Chemicals and media components used in this thesis

Chemical/Media Component Supplier

Aceton

Acetonitril

Acrylamide

Agar

Agarose

Ammonium persulfate (APS)

Arabinose

Bromophenol blue

Chlorofrom

Coomassie Brilliant Blue G250

Dextrin

1,4-Dithiothreitol (DTT)

Dimethyl sulfoxide (DMSO)

D-mannitol

Ethidium bromide

Ethyl acetate

Ethylene diamine tetraacetic acid (EDTA)

Glacial acetic acid

Glucose

Glycerol

Hygromycin B

Isopropanol

Isopropyl-β-thiogalactoside (IPTG)

Kanamycin sulfate

LB medium (Lennox)

Malt extract

3(N-Morpholino)-propanesulfonic acid (MOPS)

Phenol/Chloroform/Isoamylalkohol (25:24:1)

Rotiphorese Gel 30% (M/V)

Sodium dodecyl sulfate (SDS)

Roth (Karlsruhe, Germany)


N,N,N’,N’-Tetramethylethylenediamine (TEMED)

Tris(hydroxymethyl)aminomethane (Tris base)

Tris(hydroxymethyl)aminomethane hydrochloride

(Tris-HCl)

N-Tris-(Hydroxymethyl)-methyl-2-aminoethane

sulfonic acid (TES)

Tryptic soy broth (TSB)

Yeast extract

Roth (Karlsruhe, Germany)

Apramycin

5-Bromo-4-chlor-3-indolyl-β-D-galactopyranoside

(X-gal)

Carbenicillin

Spectionmycin

AppilChem (Darmstadt, Germany)

5-Bromo-4-chloro-3-indolyl β-D-glucuronide (X-gluc)

Phenylmethylsulfonyl fluoride (PMSF)

Phosphomycin disodium salt

Tetracycline

Thiostrepton

Sigma-Aldrich (Deisenhofen, Germany)

Coomassie Brilliant Blue R250 Serva (Heidelberg, Germany)

Casaminoacids

Malt extract

Peptone

Trypton

Becton-Difco, Heidelberg, Germany

Saccharose Suedzucker (Mannheim, Germany)

Soybean flour W. Schoenenberger GmbH (Magstadt,

Germeny)

Chloramphenicol Fluka (Ulm, Germany)

2.2 Enzymes and Kits

Table 2-2 Enyzmes and enzymatic buffers

Enzyme Supplier

Lysozyme from chicken egg white Fluka (Taufkirchen, Germany)

Oligo primers for PCR Eurofins MWG Operon (Ebersberg, Germany)

RNAse A Qiagen (Hilden)

Bovine serum albumin (BSA)

dNTP mixer

1 kb DNA ladder

Proteinase K

Restriction endonucleases

T4-DNA-Ligase

Promega (Mannheim, Germnay) or

NEB (Ipswich, US)


Pfu-Polymerase (5 U/μl)

Pfu-Polymerase reaction buffer (10x)

Taq-Polymerase (5 U/μl)

Taq-Polymerase reaction buffer

Lab-made

Table 2-3 Kits used for isolation and ligation of DNA

Kits Supplier

Pure Yield Plasmid Midiprep System

Wizard SV Minipreps DNA Purification System

Wizard SV Gel and PCR Clean-up System

pGEM-T Easy Vector System

Promega (Mannheim, Germnay)

Rapid DNA Ligation Kit Roche Diagnostics (Mannheim, Germnay)

2.3 Media, Buffers and Solutions

2.3.1 Media for bacterial culture

The components of the media used in the current dissertation were described as

follow. The pH of the media was adjusted by adding 1 M HCl or 1 M NaOH solution.

After well-mixed, the media were autoclaved for 20 min at 121 ℃ (15 psi). For media

used in Petri dish, 20 g/L agar was added before autoclave. If supplementary

components were required, they were commonly autoclaved seperatedly and added

into the sterile media at the time of use. Liquid media were kept at room temperature,

generally less than two weeks and Agar plates were stored at 4 ℃ for no more than

one month.

Table 2-4 Medium for cultivation of E. coli

Medium Components Note

LB-medium (Luria-Bertani

Medium)

LB medium 20 g

Restilled water 1000 mL

pH 7.3


Table 2-5 Media for cultivation of Streptomyces strains

Medium Components Note

CRM-medium Sucrose 103.0 g

Tryptic soy broth 20.0 g

MgCl2.6H2O 10.12 g

Yeast extract 10.0 g

Distilled water 1000 mL

CaCl2 10 mM

Glycine 0.75% (m/V)

pH 7.0, Sterile CaCl2

and Glycine

separatedly, then add to

the medium before use.

DNMP-medium Soytone 7.5 g

Baker’s yeast 5 g

MOPS 21 g


pH 6.8

HA-medium Glucose 4 g

Yeast extract 4 g

Malt extract 10 g

Tap water 1000 mL

pH 7.2

MS-medium Soybean flour 20 g

D-Mannito 20 g

Tap water 990 mL

MgCl2 10 mM

pH 7.2, autoclave

MgCl2 separately and

add at the time of use.

NL19 Soybean flour 20.0 g

D-Mannitol 20.0 g

Tap water 1000 mL

pH 7.2

PM-medium Soybean flour 10 g

Mannitol 10 g

CaCO3 5 g

Tap water 1000 mL

pH 7.3

R2YE-medium Sucrose 103.0 g

K2SO4 0.25 g

MgCl2.6H2O 10.12 g

Glucose 10.0 g

Casaminoacids 0.1 g

Trace elements solution 2.0 mL

Yeast extract 5.0 g

TES 5.73 g

Agar 20.0 g

Distill water 1000 mL

After autoclave, add

KH2PO4 (0.5%) 10 mL

CaCl2.2H2O (5M) 4 mL

L-Proline (20% (w/V)) 15 mL

NaOH (1M) 7 mL


R3 soft agar Sucrose 171.0 g

Glucose 10.0 g

Peptone 4.0 g

KCl 0.5 g

CaCl2.2H2O 2.2 g

MgCl2.6H2O 8.1 g

Agar 8.0 g


After autoclave, add

KH2PO4 (0.5%) 40 mL

TES (0.25 M, pH 7.2) 100 mL

SG-medium Soy peptone 10.0 g

Glucose 20.0 g

L-Valine 2.34 g

CaCO3 2.0 g

CoCl2-solution 1mg/mL 1 mL

Tap water 1000 mL

pH 7.2

Soft nutrient agar Nutrient broth 8 g

Agar 5 g


Trace elements solution ZnCl2 40 mg

FeCl3.6H2O 200 mg

CuCl2.2H2O 10 mg

MnCl2.4H2O 10mg

Na2B4O6.10H2O 10 mg

(NH4)6Mo7O24.4H2O 10 mg


TSB-Medium Tryptic Soy Broth 30 g

Tap water 1000 mL

pH 7.2

YEME medium Yeast extract 3.0 g

Peptone 5.0 g

Malt extract 3.0 g

Glucose 10.0 g

Sucrose 340.0 g


Add sterile

MgCl2.6H2O to end

concentration 5 mM

after autoclave.

2.3.2 Buffers

2.3.2.1 Buffers for isolation of plasmid from E.coli

Unless otherwise stated, the buffers were prepared with distilled water and stored at

room temperature.


Table 2-6 Buffers for isolation of plasmid from E.coli

Name Component Note

P1 Tris

EDTA

RNAse A

50 mM

10 mM

100 μg/mL

pH 7.8, add RNAse A just before use. Store at 4 ℃.

P2 NaOH

SDS

0.2 M

1% (m/V)

P3 KOAc 3 M pH 5.2, store at 4 ℃.

TE Tris

EDTA

10 mM

1 mM

pH 7.6

2.3.2.2 Buffers for isolation of genomic DNA from Streptomyces spp.

Table 2-7 Buffers for isolation of genomic DNA from Streptomyces strains

Puffer Component Note

SET-buffer Tris-HCl 20 mM

EDTA 25 mM

NaCl 75 mM

pH 8

Lysozyme solution Lysozyme 50 mg/mL Dissolved in SET buffer

Proteinase K solution Proteinase K 20 mg/ML Dissolved in SET buffer

SDS solution SDS 10%

NaCl solution NaCl 5 M

2.3.2.3 Buffers for DNA gel electrophoresis

Table 2-8 Buffers for DNA gel electrophoresis

Buffer Components Note

50 x TAE Tris base 2M

EDTA (0.5 M, pH 8.0) 0.05M

Glacial acetic acid 52.5 mL

Adjust the pH to 8.0 with glacial

acetic acid.

Load buffer Glycerol 30% (w/V)

Bromophenol blue 0.25% (w/V)

Store at 4 ℃

Agarose 0.7% (m/V) Agarose 7 g

TAE-buffer (1x) 1000 mL

Dissolve the agarose thorough in the

microwave oven, then store at 55 ℃.

Ethidium bromide

staining buffer

Ethidium bromide 10 μg/mL


2.3.2.4 Buffers and solutions for protein gel electrophoresis (SDS-PAGE) and for

Coomassie staining

Table 2-9 buffers and solutions for SDS-PAGE and Coomassie staining

Buffer/ Solution Component Note

Coomassie Brilliant Blue

G-250 solution

Coomassie Brilliant Blue G-250

Acetic acid

Methanol

Distilled water

0.25% (w/V)

10% (V/V)

45% (V/V)

45% (V/V)

Fixing buffer Acetic acid

Methanol

Distilled water

10% (V/V)

20% (V/V)

70% (V/V)

Resolving gel (10%) Distilled water

1.5 M Tris-HCl (pH 8.8)

10% (w/V) SDS

Rotiphorese® Gel 30

10% (w/V) APS

TEMED

4.1 mL

2.5 mL

0.1 mL

3.3 mL

50 μL

5 μL

Mixed all the

components except

APS and TEMED

sufficiently. Then

add APS and

TEMED just before

preparing the gel. Stacking gel (4%) Distilled water


10% (w/V) SDS

Rotiphorese® Gel 30

10% (w/V) APS

TEMED

6.1 mL

2.5 mL

0.1 mL

1.3 mL

50 μL

10 μL

Sample buffer Distilled water


Glycerol

10% SDS (w/V)

0.5% Bromophenol blue

3.55 mL

1.25 mL

2.5 mL

2.0 mL

0.2 mL

Add 50μL

β-mercapto- ethanol

to 950 μL sample

buffer prior to use.

10 x Running buffer Tris base

Glycine

SDS

Distilled water

30.0 g

144.0 g

10.0 g

1000 mL

Store at 4 ℃.

Stripping solution Distilled water

Acetic acid

Methanol

45% (w/V)

10% (w/V)

45% (w/V)

2.3.3 Solutions of Antibiotics

Antibiotics were dissolved in appropriate solvents at stock solution and kept at -20℃.

The aqueous solutions were sterilized by filtrated through 0.22 μm filter. The


solutions in ethanol and DMSO were sterile by the solvents. For antibiotic selection,

the described antibiotics were added to the media in appropriate concention unless

otherwise stated.

Table 2-10 Solutions of antibiotics

2.3.4 Solutions for blue/white selection of E. coli

Table 2-11 Stock solutions for blue/white selection

2.3.5 Buffers for preparation of protoplast

Components in the following buffers were sterized separatedly, and then mixed

together to obtained the buffers with appropriate volumes. The P-buffer and T-buffer

were mixed according to the description, then aliquoted in 2 mL and stored at -20℃.

Antibiotic Abbre. Concentration in stock

solution (mg/ml)

Concentration in

media (μg/ml)

Solvent

Apramycin Apra 100 50 H2O

Carbenicillin Carb 100 100 H2O

Chloramphenicol Cam 34 34 Ethanol

Hygromycin Hyg 100 100 H2O

Kanamycin Kana 50 50 H2O

Phosphomycin Phos 400 200 H2O

Spectinomycin Spec 100 100 H2O

Tetracycline Tet 10 10 70% Ethanol

Thiostrepton Thio 50 50 DMSO

Solution Component Note

IPTG solution IPTG 2 mM Sterilize by filtering, store at -20 ℃. Add 20 μL for each

plate.

X-Gal solution X-Gal 10 g/L Dissolved in DMSO, store at 20 ℃, keep away from

light. Add 40 μL for each plate.


Table 2-12 Buffers for preparation and transformation of Streptomyces protoplast

2.3.6 Buffers for protein purification

Table 2-13 Buffers for protein purification (Stored at 4 ℃)

Buffer Component Note

P (protoplast) buffer 12% Sucrose (w/V) 85.5 mL

MgCl2.6H2O (1 M) 1.0 mL

K2SO4 (140 mM) 1.0 mL


KH2PO4 (40 mM) 1.0 mL

CaCl2.2H2O (250 mM) 1.0 mL

TES (0.25 M, pH7.2) 10.0 mL

Autoclave separately. Then

mix the components

according to the description

and aliquot the buffer in 2

mL and store at -20 ℃.

T (transformation) buffer 25% (w/V) Sucrose 1.0 mL


K2SO4 (140 mM) 0.1 mL

KH2PO4 (40 mM) 0.1 mL

MgCl2.6H2O (1 M) 0.1 mL

CaCl2.2H2O (5 M) 1.0 mL

Tris-maleate (0.5 M, pH 8.0) 1.0 mL

50% (w/V) PEG1000 5.0 mL

Autoclave separately. Then

mix the components

according to the description

and aliquot the buffer in 2

mL and store at -20 ℃.

Denaturing reagent 25x TE buffer 400 μL

EDTA (0.1 M) 100 μL

Glycerol 5 mL

Ethyleneglycol 5 mL

Buffer Component

Elution buffer NaH2PO4/Na2HPO4 50 mM (pH 8.0)

NaCl 300 mM

Imidazol 250 mM

G1 buffer Tris-HCl 50 mM (pH 8.0)

DTT 5 mM

PMSF 50 μM

G2 buffer NaCl in G1 buffer 150 mM

Lysis buffer NaH2PO4/Na2HPO4 50 mM (pH 8.0)

NaCl 300 mM

Lysozyme 4 mg/mL

Imidazol 10-15 mM

Triton X-100 (1% (w/V)) 0.2%

PMSF stock solution PMSF in isopropanol 50 mM


2.3.7 Staining regents for the staining of TLC plates

Table 1-14 Staining regents for the staining of TLC plates

2.4 Bacterial strains

Cultivation of E. coli was always carried out in the LB medium. Single clones from

the LB plates were picked with toothpick and inoculated into test tubes containing 4

mL LB liquid medium, or into 300 mL Erlenmeyer flasks containing 100 mL LB

liquid medium. For plasmid isolation, the E. coli cells were grown overnight at 37 ℃

on a ratary shaker with the speed 180 rpm. For the λ Red-mediated recombination, E.

coli DH5α cells harboring the pBADαβγ plasmid were cultivated at 30 ℃. In order to

obtain single clone, E. coli cells were incubated on LB agar plates overnight at 37 ℃.

When a temperature sensitive plasmid (such as pSC101) is used, the E. coli cells were

incubated at 28 ℃ or 30 ℃.

2.4.1 E. coli strains

Storage buffer Tris-HCl 0.2 M (pH 7.5)

Glycerol 15%

Wash buffer NaH2PO4/Na2HPO4 50 mM (pH 8.0)

NaCl 300 mM

Imidazol 20-30 mM

Name Component

Anisaldehyde Anisaldehyde 1.0 mL

Methanol 85 mL

Acetic acid 10 mL

Concentrated sulfuric acid 5 mL

Vanillin/H2SO4 Vanillin 1.0 g

Concentrated sulfuric acid 100 mL

Ehrlichs reagent 4-dimethylaminobenzaldehyde 1.0 g

Hydrochloride acid (36%) 25 mL

Methanol 75 mL


Table 2-15 E.coli strains used in this thesis

2.4.2 Streptomyces strains

Table 2-16 Streptomyces strains used in this thesis

2.5 General cultivation of Streptomyces strains

Streptomyces strains were generally grown in HA or TSB liquid medium in baffled

Erlenmeyer flasks containing a stell spring at 180 rpm for 2 to 3 days. The routine

temperature for cultivation is 28 ℃. For inoculation, a 1cm2 well-grown agar from

the petri plate or 1 mL mycelium from 25% saccharose stock was added into the

medium. For protoplast preparation and isolation of genomic DNA, Streptomyces

were cultured in CRM medium with glycine. For proteins expression, S. lividan 1326

was grown in YEME medium at 28 ℃, 180 rpm for 2 days. Antibiotics were added

into the medium at appropriate concentration when necessary.

Strain Relevant characteristics Reference

E. coli BL21

(DE3) pLysS

F-, ompT, hsdSB (rB

-mB

-), gal, dcm, (DE3)pLysS (Cam

R) Invitrogen

E. coli DH5α F-, φ80dlacZΔM15, Δ(lacZYA-argF)U169, deoR, recA1, endA1,

hsdR17(r k-, m k

+), phoA, supE44, thi-1, gyrA96, relA1, λ

-

[74]

E. coli ET12567 F-, dam-13::Tn9, dcm-6 hsdM, hsdR, zjj-202::Tn10, recF143,

galK2, galT22, ara-14, lacY1, xyl15, leuB6, thi1, tonA31,

rpsL136, his64, tsx78, mtl-I, glnV44

[75]

E. coli XL1 blue recA1, endA1, gyrA96, thi-1, hsdR17, supE44, relA1,

lac[F´proAB, lacIqZDM15, Tn10 (tet)]

[76]

Strain Relevant characteristics Reference

Streptomyces albus J1074 Host for heterologous expression [77]

Streptomyces lividan 1326 Wild type, host for protein expression [78]

Streptomyces. lydicus ssp. Tanzanius

NRRL18036

Ganefromycin producer [79]

Streptomyces bottropensis Formerly named as Streptomyces sp. Goe C4/4.

Mensacarcin and Rishirilide A producer

[80]

Streptomyces collinus Tue 365 Kirromycin producer [81]


2.5.1 Preparation of permanent culture and spore suspension

In order to prepare permanent culture, 10-50 mL well-grown culture in HA or TSB

medium was harvested by centrifugation (4,000 rpm, 10 min). After wash with 20 mL

of 25% sterile saccharose, the cells were resuspended in 10 mL 25% Saccharose. The

storage was carried out at -80 ℃.

For preparation of spore suspension, the Streptomyces were grown on HA agar or MS

agar plates at 28 ℃ until full sporulation. 5 mL sterile H2O was added to the top of

each plate and then the spores were scraped off and transferred from the plates to a 10

mL falcon tube. After vigorous vortex and wash by centrifugation, the spores were

separated from the mycelium by passing the suspension through sterile cotton pluged

in a disposable syringe. Spores were collected by centrifugation (4,000 rpm, 10 min, 4

℃), washed with 10 mL 25% saccharose and resuspended in 5 mL 25% saccharose.

Spores suspension was kept at -80 ℃.

2.5.2 Production of secondary metabolites

For the production of secondary metabolites, Streptomyces strains were precultured in

50 mL HA or TSB medium at 28 ℃ and 180 rpm for one or two days. 10 mL of this

preculture were inoculated into 500 mL baffled flask containing 100 mL appropriate

medium and grown at 28 ℃ and 180 rpm for 5-7 days.

2.6 Vectors, cosmids and plasmids

Table 2-17 Vectors and plasmids used in this thesis

Name Description Resistance Reference

pBADαβγ Vector containing code-optimized protein for the

λ-Red recombination. red-exo, red-bet, red-gam

from the λ-phage; temperature sensitive replicon

from plasmid pSC101

Tetr

[82]

pBluescript SK(-) Cloning vector, Ampr, lacZ’(α-complementation),

f1(-)-origin, ColE1-origin

Carbr Stratagene


pCDFDuet Cloning vector, template for spectinomycin

resistant gene

Specr Novagen

pET-28a(+) Vector for protein expression. N-terminal His-Tag/

Thrombin/T7 Tag, with optional C-terminal His

Tag sequence. f1 origin, pBR322 origin, lacI,

Kanar Novagen

pGEM-T Linearized vector with T-overhang, for direct

cloning of PCR Fragments with A-overhang.

Carbr Promega

pHPΩ45aac pBR322 derivative vector carrying the resistant

gene for spectinomycin and streptomycin, flanked

by transcription terminator.

Carbr

Specr

[83]

pIJ778 Redirect cassette with aadA gene and FRT-sites

into pBSK+, oriT

Carbr

Specr

[84]

pKC1132 Non-replicative vector in Streptomyces Aprar

[85]

pKCorf20EP Insert the 6.6 kb EcoRI + PstI fragment from orf20

of ganefromycin into the pKC1132 vector.

Aprar This study

pKCXY02 Vector for double cross-over screening. A codon

optimized GUS gene under the control of tipA was

inserted into pKC1132 into the BglII site.

Aprar This study

pUWL-H Streptomyces expression vector, LacZα, ermE* up

promoter, pIJ101-origin, ColE1-origin

Carbr

Hygr

[86]

pUWL-H-rslR1 Plasmid for rslR1 overexpression Carbr Hyg

r This study


r This study


r This study

pUWL-H-rslR1R2R3 Plasmid for overexpression of rslR1, rslR2 and

rslR3.

Carbr Hyg

r This study


r This study

pSET152 Integrative plasmid for Streptomyces, LacZ’α,

pMB1-replicon, Containing integration system from

from phage φC31, oriT RK2

Aprar

[87]

pSETGUS pSET152 based integrative plasmid for checking

gusA activity in Streptomyces spp.

Aprar

[88]

pGUS-PR-rslR1 pSETGUS-based plasmid with the ~500 bp

promoter region of rslR1 in front of the gusA gene

Aprar This study



Aprar This study



Aprar This study



Aprar This study

pKC1128E Replicative plasmid for Streptomyces,

pMB1-replicon and SCP*- replicon, oriT, LacZ’α

Aprar

[87]


pSOK804 Integrative plasmid contains an integrase gene and

attachment site for the phage VWB.

Aprar

[89]

pKC1139 Replicative plasmid for Streptomyces, pMB1-

replicon and SG5 temperature sensitive replicon,

oriT, LacZ’α

Aprar

[87]

pUC19 Cloning and sequencing vector for E. coli, with bla,

LacZ’α, and pMB1-replicon

Carbr

[90]

pUZ8002 Helper plasmid for conjugating plasmid containing

the oriT sequence, RK2-derived (IncP-1α group),

tra1 and tra2 region

Kanar

[78]

Table 2-18 Cosmids used in this thesis

2.7 Methods in Molecular Biology and Biochemistry

2.7.1 Methods in isolation, concentration and analysis of DNA

2.7.1.1 Isolation of plasmids from E. coli

Plasmid DNA extraction was performed using the alkaline lysis method described by

Birnbiom and Doly in 1979.[93]

The 4 mL overnight culture of E. coli was harvested

by centrifugation (14, 000 rpm, 4 ℃, 1 min). The cells were thoroughly suspended in

Cosmid Description Resistance Reference

Cos26 The first cosmid in the ganfromycin biosynthetic gene

cluster.

Aprar

[91]

Cos201 The second cosmid in the ganfromycin biosynthetic gene

cluster.

Aprar

[91]

Cos21 The third cosmid in the ganfromycin biosynthetic gene

cluster.

Aprar This study

Cos2H19 The last cosmid in the ganfromycin biosynthetic gene

cluster.

Aprar This study

Cos4 The cosmid contains the Rishirilides biosynthetic gene

cluster.

Aprar

[92] and

this study

Cos4ΔrslK4 Cos2-derived cosmid with rslK4 inactivated by Red/ET

mediated recombination

Aprar This study

Cos4ΔrslO1 Cos2-derived cosmid with rslO1 inactivated by Red/ET


Aprar This study

Cos4ΔrslO6 Cos2-derived cosmid with rslO6 inactivated by Red/ET


Aprar This study


200 μL P1 buffer by vortex. Add 200 μL P2 buffer to the suspension and mix gently

by inversion until the solution is clear. Incubation at RT for about 5 min, add 200μL

P3 buffer and incubate the solution for another 10 min. After centrifugation (14, 000

rpm, 4 ℃, 10 min), the supernatant was poured into a new Eppendorf tube. DNA was

precipitated by adding 500 μL ice-cold isopropanol and centrigation (14, 000 rpm, 4

℃, 30 min). DNA pellet was washed once with 500 μL 70% ethanol and air-dried for

10-15 min. Finally, the plasmid DNA was dissolved in 30 μL distilled water and

stored at -20 ℃.

Analytic DNA extraction with the “Wizard SV Minipreps DNA Purification System”

or preparative extraction with the “Pure Yield Plasmid Midiprep System” kits from

Promega was performed according to the manufacter’s protocol.

2.7.1.2 Isolation of genomic DNA from Streptomyces

Genomic DNA from Streptomyces was isolated as described by Pospiech et al.[78]

2

mL of 24 h culture in HA or TSB medium was harvested by centrifugation (4,000

rpm, 4 ℃, 10 min). The cells were washed with 1 mL H2O and resuspended in 500 μL

SET buffer containing 4 mg/mL lysozyme and 100 μL RNase by vortexing. The

suspension was incubated at 37 ℃ for 30 min, with occasional inversion. Then

added 50 μL 10% SDS solution and 14 μL Proteinase K solution, and incubated at 55

℃ for 1-2 hours. After adding and mixing with 200 μL 5 M NaCl solution and 500

μL chloroform, the lysate was centrifuged (14,000 rpm, 4 ℃ , 10 min). Then

transferred the supernatant to a fresh tube, added 0.6 vol isopropanol and mixed by

inversion. After about 3 min, genomic DNA was spooled onto a sealed Pasteur

pipette, rinsed with 5 mL 70% ethanol, air dried and dissolved in 1 mL TE buffer.

2.7.1.3 Agarose gel elxctrophoresis of DNA

DNA fragment separation and size determination was performed by electrophoresis

on 0.7% (w/V) agarose gel. The buffer used for electrophoresis was 1x TAE buffer.

The DNA samples and the 1 kb DNA ladder from Pormega were added into the caves

on the gel. After the running, the gel was stained with ethidium bromide and detected


under the UV light at 312 nm. The size of the DNA fragments could be evaluated by

comparing to the DNA ladder.

For DNA fragment preparation, the agarose band containing the aim DNA was cut out

from the gel and dissolved in the column binding solution of the “Wizard SV Gel and

PCR Clean-Up System” by heating. Further steps were performed according to the

manufacturer’s protocol.

Figure 2. 1 kb DNA ladder from Promega.

2.7.1.4 Methods in concentration and quantification of DNA

Concentration of DNA was carried out according to the method of Maniatis et al.[94]

1/10 volume of the P3 buffer for plasmid isolation was added into the DNA solution.

Then 1 volume of isoprapanol was added to precipitate the DNA. After thorough

vortex and incubation on ice for 20 min, the DNA was precipitated by centrifugation

(4 ℃, 14,000 rpm, 10 min). The supernatant was discarded and the resulting DNA

pellet was washed with 70% ethanol. Finally, dry the DNA pellet in the incubator at

60 ℃ for 10 min and dissolved in 30-100 μL sterile H2O.

2.7.1.5 DNA denaturation for ssDNA transformation in Streptomyces lydicus

The single stand DNA used for protoplast transformation was prepared by alkaline

treatment of plasmid DNA.[95]

9 μL dsDNA in H2O was mixed with 2 μL 1 M NaOH

and incubated for 10 min at 37 ℃. The mixture was cooled on ice and the reaction

was terminated by adding 2 μL 1 M HCl.


2.7.2 Methods in DNA cloning

2.7.2.1 DNA restriction

Restriction of DNA with endonucleases was performed according to the

manufacturer’s instructions. For a typical analytic digestion, a total volume of 20 μL

was used, while for preparative digestion, a total volume of 50 μL was used. Unless

otherwise stated, the restriction was carried out at 37 ℃.

Table 2-19 Composition for typical restriction reactions.

2.7.2.2 DNA ligation

DNA ligation was carried out using T4-DNA ligase at RT for 2-4 h or at 16 ℃

overnight. The ligation system contains 1 U T4-DNA ligase, 1x ligase buffer and

appropriate insert and vector, with a total volume of 20 μL.

2.7.3 Inactivation of genes on the cosmid by λ RED-mediated

recombination

λ RED-mediated recombination was first developed by Detsenko and Wanner to

promote the efficiency of homologous recombination in E. coli with linear DNA.[96]

Gust et al. adapted this tool in streptomycetes and had established a method for gene

inactivation in Streptomyces.[97]

Gene inactivation was first performed on a cosmid in

E. coli with a PCR product. Then the cosmid contains the inactivated gene was

introduced into the Streptomyces strain by intergeneric conjugation. In this thesis, the

Name Analytic digestion Preparative digestion

BSA (10 ×) 2.0 μL 8.0 μL

DNA 2.0 μL 20 μL

10 × restriction buffer 2.0 μL 8.0 μL

H2O 14 μL 40 μL

Enzyme 1 1.0 μL (for single enzyme, use 1.5μL) 4.0 μL

Enzyme 2 (optional) 1.0 μL 4.0 μL

Total 20 μL 80 μL


plasmid pBADαβγ that contains the λ RED genes redα, redβ, redγ was used to

promote gene inactivation. Details for the principles in λ RED-mediated gene

replacement please refer to the article by Gust et al.[84]

In order to obtain the PCR fragment for gene inactivation, two 64 bp primers were

designed, synthesized and purified by the HPLC method. The primers contain a 5’ 39

bp homologous arm identical to the upstream or downstream bases of the aim gene

and overlaps with the aim gene by the first three (the start codon) or the last three

bases (the stop codon). In the middle of the primers are 6 nucleotides for the

restriction enzyme (NheI in this thesis) which will be used to cut out the resistant gene

(aadA) in the PCR product. In the 3’ end bases of the primers are identical to the

beginning and the end of the resistant cassette. With these primers and the plasmid

containing the resistant cassette as template, a fragment in which the resistant gene

(aadA) is flanked by the 39 bp homologous arms could be obtained by PCR. The

plasmid pBADαβγ was introduced into DH5α by CaCl2-mediated transformation and

incubated on the LB plate containing tetracycline for 16 h at 28 ℃. Single colony was

picked from the plate, inoculated into 10 mL LB medium and cultured at 28 ℃, 180

rpm for 14-16 h. Then 1 mL of this preculture was inoculated into 100 mL of fresh

LB medium containing 20 μg/mL tetracycline and cultured at the same conditions

until the OD600 reached 0.6. After washing twice with ice-cold 10% glycerol, the

DH5α/pBADαβγ cells were used as competent cells for the transformation of cos4 by

electroporation, to obtain DH5α/ pBADαβγ/cos4.

A single colony of DH5α/pBADαβγ/cos4 was inoculated into 10 mL LB medium

containing 20 μg/mL of tetracycline and 100μg/mL of apramycin and cultured

overnight at 28 ℃, 180 rpm. Then 1 mL of this preculture was inoculated into 100 mL

of fresh LB medium containing 20 μg/mL tetracycline, 100μg/mL apramycin and 10

mM freshly prepared arabinose at cultured at the same conditions until the OD600

reached 0.6. These cells were made competent with the method for preparation of

electroporation competent cells. 10 μL of the purified PCR product was used to

transform the DH5α/pBADαβγ/cos4 competent cells. After the addition of 700 μL of


LB medium and incubated at 28 ℃ for 2 h, the cells were plated on LB plate with 100

μg/mL apramycin and 100 μg/mL spectinomycin and incubated at 37 ℃ overnight.

The plasmid pBADαβγ was eliminated by incubation at 37 ℃. The colonies on the LB

plate were inoculated on a fresh LB plate with the same antibiotics and cultured again

for 16-20 h, to completely remove the pBADαβγ plasmid and the false colonies. The

cells with the gene-inactivated cos4 were inoculated into LB medium containing 100

μg/mL apramycin and 100 μg/mL spectinomycin and cultivated at 37 ℃ for 16 h. The

cosmid in which the aim gene was replaced by the aadA gene was isolated with the

“Wizard SV Minipreps System” kit and the aadA gene was then excised by digestion

with NheI. The linear cosmid DNA was religated with T4-DNA ligase for 4 h and

transformed into DH5α competent cells. The plate for this transformation contained

only apramycin. The mutant cosmid (cos4Δx) could be isolated from these cells.

During these procedures, the replacement and the excision of the aadA gene in the

cosmid was controlled by colony PCR or PCR using the isolated cosmids as template.

2.7.4 PCR amplication

PCR amplification was performed on the Mastercycler Epgradient (Eppendorf, Ham-

burg, Germany) and Gene Amp®

PCR System 9700 (Applied Biosystems, Forster

City, USA). The components for PCR mixture and amplification conditions are given

in Table 2-20.

Table 2-20 Composition of a typical PCR reaction system

Component Final concentration Note

DMSO 10% Used for GC-rich templates

Polymerase reaction buffer 1 x 10 x or 5 x

dNTP-mix 0.2 mM each

Primer 1 20 pmol

Primer 2 20 pmol

Template DNA 250 ng (1 μL) For genomic DNA, use 10 μL

Polymerase 5 U (1μL) Taq or Pfu (5 U/μL)

H2O Add to total volume of 100 μL For analytic purpose use 50μL


Table 2-21 Conditions for a standard PCR reaction

PCR primers were designed with the help of Primer Primier 5.0 and synthesized by

Eurofins. Unless otherwise stated, the annealing temperature for the primers was set

to 61 ℃.

Table 2-22 Primers for PCR amplification

Steps Temperature Time Cycles

Hot start 95 ℃ 5 min 1

Denaturing 95 ℃ 45 s 30-32

Annealing 60 ℃ 1 min

Elongation 72 ℃ For Taq: 1 min/kb, For Pfu: 2 min/kb

Stored at 4 ℃ ∞ 1

Name Sequence Note

Primers for screening the cosmids behind cosmid21

Cosmid21PWF GTCAGGGACTGGGACTGGCCG

Cosmid21PWR CGGTGTGCTCGGCAGGGAAGT

Primers for screening the cosmid spanning the sugar biosynthetic genes

SupercosleftFW TGTCCTCGTCGGCCGGTTC

SupercosleftRV TAGATCCGGGCCGAACCTAGG

SupercosrightFW CGCCTGACGAAGACGCCG

SupercosrightRV GAGGAGCCGGGGGAGGGT

Primers for sequencing the two ends of the inserts of cosmids based on pOJ436

pOJ436F AGGAAGCAGCCCAGTAGTAG

pOJ436R GAAGATGCGTCGTGCTATCC

Primers for amplification of KirN gene, using genomic DNA from S. collinus Tue365 as template

KirNF CGATCGATCATGAGAAGCTTCCGCAGTCGCGTACAC ClaI and HindIII

KirNR CGATATCGTTATCATTTGTTTCCCTTCCCTGTAGG EcoRV

Primers for checking the possible frame-shift in the sequencing.

FSgan1F CGTGAGGTCGTACGGAGACAGC The fragments

amplified by these

primers were

cloned into

pGEM-T vector

and sequenced.

FSgan1R CACATGGACCCGCATCTGCT

FSgan2F TTACGTCCGCCGCACCCT

FSgan2R CGTCGTGGCCGGTGTGGT

FSgan3F CGCTGGTGTTCCGCTGGT

FSgan3R GCTGGTGAAGCGCGGGT

FSgan4F ACAACATGGCCCGCACCCT

FSgan4R GGTCGGCTGCCCGGTCAC

FScheckPKS6F TCCGGCAGCACATCGACGC


FScheckPKS6R CCCTCGAAGTACGTCCGCCAGT

Primers for verifying the single cross-over of pKCorf20.

Orf20scoprobeFw CACGTCTCGCCGCGCACCC Using genomic DNA of the

mutant as template. Orf20scoprobeRv TCCTGGAGGAGCCGCCCGAG

Primers for over expression the regulators in pUWL-H. msc24: rslR1; msc30: rslR2; msc31 rslR3.

msc24overExfw CCCATCGATTCTCTTAAGGACCACGGAAGCCGCACC ClaI, AflII,

msc24overExrv GAACAGAAGCTTACGGCCGGCGCCGG HindIII

msc30overExfw ATTCCGAAGCTTCAAGCCAGCCCTGGAGG HindIII

msc30overExrv AACACTGCAGAGCTAGCGGGGGTCAGCCGGCC NheI, PstI

msc31overExfw TACGAATTCTCGCTAGCGGAGCGGACGGCCTG EcoRI, NheI

msc31overExrv GGACTAGTCACTGCTCCCGCCACCGT SpeI

rslR4amplifFw CCATCGATGGAGGCGGACATGGCGG ClaI

rslR4amplifRv GTACTAGTACGCGCTTAAGGGGTGGC SpeI

Primers for expression the priming ketosynthase (msc17: rslK4) in E. coli by pET-28a(+)

msc17ExEcoliNF CGCATTCCATATGAGGTTCGAGGACCTGTACAT NdeI

msc17ExEcoliNR ATAAGAATGCGGCCGCTTATCATCCGGATCCCGTCTCT NotI

Primers for expression the priming ketosynthase (msc17: rslK4) in S. lividans by pUWL-H

msc17-expressionFw GGGAAGCTTGGAGGCACAGTCATGCACCACCACCACC

ACCACCACCACAGGTTCGAGGACCTGTACATCGC

HindIII

msc17-expressionRv CGCGAATTCGCATTTGGCATGCTTATTATCATCCGGAT

CCCGTCTCTCC

EcoRI

Primers for inactivating rslO1 (msc21) by λ Red-mediated recombination

msc21NheIRedFw ACACCGTCCGTCCAGCCATCACATCGAGAGGACCCC

ATGGCTAGCGGAGCGTAGCGACCGAGTG

NheI

msc21NheIRedRv GCTCGGTGCGCAAGGAAACCATCGGCGGTCCGTCCC

TCAGCTAGCGGCTATTTAACGACCCTGC

NheI


msc32NheIRedFW CCCCTCCTTTCGGCCCTGTCCGTGAAGGAGACCAGCG

TGGCTAGCGGAGCGTAGCGACCGAGTG

NheI

msc32NheIRedRv GTTCCGGACATTCTTCGGCAGGCCGTCCGCTCCGCTT

CAGCTAGCGGCTATTTAACGACCCTGC

NheI


msc17NheIRedFw TGGTTCCCCTGACGGCCGGTGAAAGGGCATCGGGAC

ATGGCTAGCGGAGCGTAGCGACCGAGTG

NheI

msc17nheIRedRv CCCGCTCGGCGCGCATGCGCCACCGGCGCGGCGCGG

TCAGCTAGCGGCTATTTAACGACCCTGC

NheI

Primers for amplification of the promoter regions of the regulators

PromoRslR1Fw GCTCTAGAGATGGATCAGCTGCGCGGT XbaI

PromoRslR1Rv CCGGTACCTTCCGTGGTCCTTCCAGCG KpnI

PromoRslR2Fw CCTCTAGACACCCGCACTCTGGCCAT XbaI

PromoRslR2Rv CGGGTACCGTGGCCGCTGGATCTTG KpnI


2.7.5 Transformation of DNA into E. coli

Transformation of plasmid DNA into E. coli was performed according to a modified

method from Maniatis et al.[94]

In current thesis, two methods for DNA transformation

were used: for small plasmids (<15 kb), CaCl2-mediated heat shock transformation

was chosen; for large plasmids (>15 kb) and cosmids, the electroporation method was

used because of its much higher transformation efficiency.

2.7.5.1 Transformation of E. coli by CaCl2-mediated heat shock

Preparation of CaCl2-competent cells

100 mL LB-medium was inoculated with 1 mL of overnight culture of E. coli and

cultured at 37 ℃, 180 rpm until the OD600 (detected by the UV-spectrometer Uvikon

933) reached 0.6 (2-4 h for DH5α, BL21 DE(3) pLysS and XL-1 blue, 6 h for ET

12567 (pUZ8002)). The cells was harvested by centrifugation (3,000 rpm, 4 ℃, 10

min), resuspended in 40 mL ice-cold 0.1 M MgCl2 and centrifugated again (3,000

rpm, 4 ℃, 10 min). The cell pellet was resuspended in 20 mL ice-cold CaCl2 (0.1 M)

and incubated on ice for 30 min. After centrifugation (3,000 rpm, 4 ℃, 10 min), the

pellet was suspended in 2-5 mL buffer containing 0.1 M CaCl2 and 15% glycerol. The

competent cells could be used immediately or stored at -80 ℃ in 100 μL aliquots in

the 1.5 mL eppis.

PromoRslR3Fw GGTCTAGAGGAGGCCCGGCGGGTC XbaI

PromoRslR3Rv CCGGTACCGTGCCCAGCGCCACAG KpnI

PromoRslR4Fw CGTCTAGACGGCGAGCAGATAGCCG XbaI

PromoRslR4Rv GGGGTACCGCTCACTCCCCCTCCACTAT KpnI

Primers for complementation of the inactivated genes (the genes were expressed under the ermE

promoter of pUWL-H with the restriction enzymes ClaI and SpeI)

rslK4CFw CCATCGATGGAGGCGGGACATGAGGTTCGAGGAC ClaI

rslK4CRv CCACTAGTCATCCGGATCCCGTCTCTC SpeI

rslO1CompleFw CTATCGATGGAGGACCCCATGAAGTTCGGC ClaI

rslO1CompleRv GCACTAGTCCCTCAGTCGTTCGCTGC SpeI

rslO6CFw TCATCGATGAAGGAGACCAGCGTGAAACTG ClaI

rslO6CRv GGACTAGTCCGCTCCGCTTCACGCG SpeI


CaCl2-mediated transformation

5 μL plasmid DNA was added to the eppi containing 100 μL competent cells and

incubated on ice for 30 min, with occasional inversion. Then eppi was put into the

water bath at 42 ℃ for 90 seconds and cooled down on ice (about 3 min). 700 μL

LB medium was pipette into the eppi and incubated in the 37 ℃ water bath for 1 h.

The cells were harvested by centrifugation (6,000 rpm, 10 min). The supernatant was

discarded and the pellet was resuspended in the remaining medium. Finally plate the

pellet on a LB agar plate containing appropriate antibiotic. Colonies could be seen

after incubation for 12-16 h

2.7.5.2Transformation by electroporation

Preparation of electroporation competent cells

100 mL LB-medium was inoculated with 1 mL of overnight culture of E. coli and

cultured at 37 ℃, 180 rpm until the OD600 (detected by the UV-spectrometer Uvikon

933) reached 0.6 (2-4 h for DH5α, BL21 DE(3) pLysS and XL-1 blue, 6 h for ET

12567/pUZ8002). The cells was harvested by centrifugation (3,000 rpm, 4 ℃, 10

min), washed with 40 mL 10% glycerol (ice-cold). After centrifugation (3,000 rpm, 4

℃ , 10 min) and washed with 15 mL ice-cold 10% glycerol, the pellet was

resuspended in 1-2 mL cold 10% glycerol and stored in 80 μL aliquots at -80 ℃.

Transformation by electroporation

The electroporation competent cells were defrozen on ice. Then 5-10 μL plasmid

DNA or PCR fragment was added into the eppi and incubated on ice for about 15

min. Afterwards the cells and DNA were transferred into a pre-cooled electroporation

cuvette (0.1 cm gap). Electroporation was carried out with the Bio-Rad E. coli pulser

with the voltage 1.8 kv and the duration 5 ms. After the electroporation, 700 μL fresh

LB medium was added into the cuvette, mixed with the cells by pipetting, transferred

into a sterile 1.5 mL eppi and incubated at the 37 ℃ water bath for 2 h. The cells

were harvested by centrifugation (6,000 rpm, 10 min). The supernatant was discarded


and the pellet was resuspended in the remaining medium. Finally plate the pellet on a

LB agar plate containing appropriate antibiotic. Colonies could be seen after

incubation for 14-18 h.

2.7.6 Methods for introducing DNA into Streptomyces

2.7.6.1 DNA transfer by PEG-mediated protoplast transformation

Preparation of protoplasts

Protoplasts preparation was performed according to the modified mothod From

Maniatis et al.[94]

200 μL Streptomyces spores or mycelia from the 25% saccharose

stock was inoculated into 100 mL CRM medium and grown at 28 ℃, 180 rpm for

24-48 h. The cells was harvested by centrifugation (3,000 rpm, 4 ℃, 10 min), washed

first with 10 mL 10% saccharose and then with 10 mL P-buffer. The cell pellet was

resuspended in P-buffer with lysozyme (4 mg/mL) and incubated at 28 ℃, 30 rpm for

30-60 min with interval control the protoplast formation under microscopy. When

majority of the cells became protoplast, the reaction was stopped by adding 20 mL

ice-cold P buffer and incubation of ice for 10 min. The cell wall and intact mycelia

was removed by filtered through sterile cotton. The resulting protoplasts were

harvested by centrifugation at 4 ℃, 3,000 rpm for 10 min. The supernatant was

poured off and the pellet was resuspended in 1 mL P buffer. The protoplasts could be

used immediately or stored at -80 ℃ in 200 μL aliquots in 1.5 mL Eppi.

PEG-mediated protoplast transformation

The plasmid DNA used for protoplast transformation was first propagated in the

dam-& dcm

- E. coli strain ET12567 to avoid the methyl-specific restriction system in

Streptomyces. In the case of non-replicative plasmid (suicide plasmid), which was

introduced into Streptomyces to obtain single cross-over colony by homologous

recombination, the non-methylated DNA was further denatured by the treatment with

NaOH to form single strand DNA, because the ssDNA efficiently facilitates the

homologous recombination.


200 μL of protoplasts were added with 10-15 μL unmethylated DNA and 500 μL

T-buffer, mixed by gentle inversion and incubate for less than 1 min. The the mixture

was added on the top of R2YE agar plates (each plate 200-250 μL), followed by

covering with about 5 mL pre-warm R3 soft agar for each plate. After 16-20 h

incubation at 28 ℃, the plates were overlaid with 5 mL of soft nutrient agar

containing appropriate antibiotics for selection of mutants. The plates were grown in

the incubator at 28 ℃ for 5-10 days. In order to check the quality of the protoplasts,

control experiments were also necessary. Negative control was carried out by mixing

the protoplasts with sterile H2O and then plating on the R2YE plate, while positive

control was done by covering the R2YE plate with 5 mL soft nutrient agar without

any antibiotic.

2.7.6.2 DNA transfer by intergeneric conjugation

Intergeneric transfer of plasmids from methylation-deficient E. coli strain ET12567/

pUZ8002 to Streptomyces strains is getting more and more popular, because this

method is much easier to work with comparing to the PEG-mediated protoplast

transformation. The vectors contain oriT from the IncP-group plasmid RP4 are first

transformed into ET12567, and then transferred in trans from the ET12567 donor

strain to Streptomyces acceptor strain with the help of the non-transmissible pUZ8002

plasmid. In this thesis, this conjugal transfer of DNA is carried out according to a

modified method of Flett et al.[98]

10 mL culture of ET12567/pUZ8002 containing the aim plasmid was grown to an

OD600 of 0.4-0.6. The cells were pelleted by centrifugation, washed in fresh LB

medium, pelleted again and finally resuspended in 200 μL of LB. 50 mL overnight

culture of Streptomyces strain was washed three times with 1 volume, 0.1 volume and

0.01 volume of TSB medium sequentially. Then the E. coli cells and Streptomyces

cells were combined in a 1.5 mL eppi and thoroughly mixed by vortex. After

centrifugation (6,000 rpm, 1 min) and discarding the supernatant, the pellet was

resuspended with 200 μL of TSB and plated on the MS agar plate. The conjugation


plate was incubated for 12-16 h at 28 ℃, then overlaid with 1 mL sterile H2O

containing 8 mg phosphomycin and 2 mg of the antibiotic for plasmid maintaining.

The plate was then incubated for a further 5-7 days 28 ℃.

2.8 Method of biochemistry

2.8.1 SDS-PAGE

SDS-PAGE was carried out according to the method of Laemmli.[99]

5% and 12.5%

polyacrylamide gel were used as stacking gel and resolving gel respectively. Gel

electrophoresis was performed with the Mini-PROTEAN II Electrophoresis system

(Bio-Rad, Muechen, Germany). All the buffers for the electrophoresis were listed in

Table 2-9. Before the running, the proteins were mixed with an equal volume of

loading buffer and cooked at 100 ℃ for 5 min. After centrifugation (4 ℃, 14,000

rpm, 5 min), the protein samples were added to the slots of the polyacrylamide gel. In

order to determine the size of the proteins, protein markers were also added into the

slots. The gel electrophoresis was carriedout at 40 mA until the front blue line reached

the bottom of the gel. Then the gel was stained with Coomassie Brilliant Blue by

heating 30 s in the microwave oven. The stained gel was decolorized in the stripping

solution. The size of the proteins could be estimated by comparing to the protein

markers.

2.8.2 Expression and purification of RslK4 from E. coli

Overexpression and purification of 6×His-tagged RslK4 from E. coli BL21 were

performed as described in the user manual of Qiagen (Hilden, Germany): “A

Handbook for High Level Expression and Purification of 6×His-tagged proteins”.

2.8.3 Expression and purification of RslK4 from S. lividans 1326

Expression of RslK4 with the pUWL-H vector was conducted in S. lividans 1326, in

which this protein was believed to have good activity due to the high rishirilide B

production in this strain. The protein purification from S. lividans 1326 was carried out


using a modified method described by Enguita et al.[100]

S. lividans harboring the

expression plasmid pUWL-A-rslK4 was pre-cultured in TSB medium with apramycin

(100 μg/mL) at 28 ℃, 180 rpm, for 24-36 h. Then 1 mL of the preculture was

inoculated into a 500 mL flask containing 100 mL of YEME medium with Apramycin

and grown for 48 h. The cells were harvested by centrifugation (4,000 rpm, 4 ℃, 10

min) and washed twice with fresh ice-cold TSB medium. After incubating the cells

with 5 mL ice-cold lysis buffer for 30 min, the cell suspension was sonicated for 6

min at intervals of 45 s ultrasonication followed by 45 s break. The cell debris was

removed by centrifugation (25,000 rpm, 4 ℃ , 60 min) and the yield of the

recombinant protein was determined by SDS-PAGE.

2.8.4 Transcriptional fusion analysis with the gusA gene

In order to reveal the relationships among the regulators in the rishirilide biosynthetic

gene cluster, transcriptional fusions of the promoter regions of these regulators with

the gusA gene on the promoter probe vector pMAXGUS were performed. Promoters

of the regulatory genes were fused to the gusA gene using the restriction enzymes

KpnI and XbaI, to obtain the pGUS-PR-rslR1, pGUS-PR-rslR2, pGUS-PR-rslR3, and

pGUS-PR-rslR4 plasmids. Together with the plasmid for negative control

(pMAXGUS), all these five plasmids were introduced into S. albus WT, respectively.

The resulting exconjugants were inoculated and incubated on MS or HA agar plates at

28 ℃ for 24 h. Then each plate was overlaid with 1 mL of 1 mM X-gluc

(5-bromo-4-chloro-3-indolyl-β-D-glucuronide) solution and incubated for 24 h.

2.9 Production, isolation and characterization of secondary

metabolites

2.9.1 Production and extraction of Ganefromycin

For ganefromycins production, the S. lydicus ssp. Tanzanius NRRL18036 strain was

first cultivated in 50 mL of TSB medium for 24 h at 28 ℃, 180 rpm in 300 mL


shaking flask. Then 10 mL of the preculture was inoculated in 100 mL of

PM-medium and incubated for 3-5 days in 500 mL flasks. After cultivation, the pH of

the broth was adjusted to pH 7.0 with 1 M HCl. The culture supernatant was extracted

twice with 100 mL ethyl acetate and concentrated completely in vicuo. The extract

was then dissolved in 1 mL methanol and used for LC/MS analysis.

LC/MS analyses of ganefromycins were performed on an Agilent 1100 system with

Xbridge C18 column (3.5 μm, 100 mm × 4.6 mm) with a flow rate of 0.7 mL/min. For

detection of the compounds, a diode array detector (DAD) and a quadrupole mass

detector (MSD) are used. The ionization of the analytes was carried out using the

API-ESI (atmospheric pressure electrospray ionization) method. Control of the system

and analysis of the data were using the ChemStation software (version A. 09. 03). The

gradient for elution was applied as follow (Table 2-23)

Table 2-23 Gradient for method gan2re (Solvent A: acetonitrile with 0.5% acetic acid, solvent B:

100% water with 0.5% acetic acid.

2.9.2 Production of Rishirilide B and its derivatives in S. albus

and S. lividans

The wild-type cosmid Cos4 and its gene-inactivated mutant were introduced into S.

albus J1074 and S. lividans 1326 by intergeneric conjugation. After 6-10 days, the

exconjugants were picked, inoculated on the top of TSB plates containing 100 μg/ mL

apramycin and 400 μg/mL phosphomycin, and incubated at 28 ℃ for a further 4-6

days to eliminate the false exconjugants. After the sporulation of exconjugants on the

TSB plates, the Streptomyces spores were collected, washed with fresh TSB, and store

Time (min) Solvent A (%) Solvent B (%)

0 5 95

23 95 5

27 5 95

29 5 95


in 25% saccharose at -80 ℃. The resulted strains were designated as S. albus::cos4 (S.

albus::cos4Δx) or S. lividans::cos4 (S. lividans::cos4Δx).

For the production of rishirilide B and its derivatives, the Streptomyce strains were

precultured in 50 mL TSB medium at 28 ℃, 180 rpm for 24 h. Then 10 mL preculture

was inoculated into the 100 mL DNPM medium, or HA medium or NL19 medium in

500 mL shaking flasks and cultivated at 28 ℃, 180 rpm for 5-7 days. After cultivation,

the broth was adjusted to pH 4.0 with 1 M HCl and centrifugated in the falcon tubes at

4,000 rpm for 10 min. The culture supernatant was extracted twice with 100 mL ethyl

acetate and concentrated completely in vicuo. The extract was then dissolved in 1 mL

methanol and used for LC/MS analysis with the following conditions (Table 2-24 and

Table 2-25)

Table 2-24 Gradient for LC/MS analysis of the rishirilides, mensacarcin and their derivatives.

(method: mens04R) (Solvent A: Acetonitrile with 0.5% (V/V) acetate; solvent B: H2O with 0.5%

(V/V) acetate. Flow rate 0.5 mL/min; column temperature: 30 ℃; Detection: 230 nm (Ref. 400 nm),

254 nm (Ref. 400 nm), 330 nm (Ref. 500 nm), 400 nm (Ref. 600 nm).

Table 2-25 Parameters for the ESI-Ionization


0 20 80

6 20 80

7 30 70

25 95 5

28 95 5

30 20 80

35 20 80

Parameter Setting

MSD Scan (200-1000 Dalton) MSD(+), MSD(-) mode

Dry gas flow 12 L/min

Dry gas temperature 350 ℃

Nebuliser pressure 50 psi

spray capillary voltage (Vcap positive) 3,000 V

spray capillary voltage (Vcap negative) 3,000 V


2.9.3 Production and extraction of Rishirilide B and Mensacarcin from S.

bottropensis

Mensacarcin and rishirilides were produced by S. bottropensis in the HA medium and

the NL19 medium. One eighth piece of a well-covered agar from S. bottropensis was

inoculated into a 250 mL Erlenmeyer flask containing 50 mL of TSB medium and

cultured at 28 ℃, 180 rpm for 24-48 h. Then 10 mL of the preculture was added into

500 mL flasks containing 100 mL of HA or NL19 medium and cultivated for 5-7

days. After the production, the broth was adjusted to pH 4.0 with 1 M HCl and

centrifugated in the falcon tubes at 4,000 rpm for 10 min. The culture supernatant was

extracted twice with 100 mL ethyl acetate and concentrated completely in vicuo. The

extract was then dissolved in 1 mL methanol and used for LC/MS analysis with the

following conditions:

2.9.4 Purification of seconadry metabolites for structural

measurement with NMR

Before the structure determination with NMR and the element analysis with high

resulation mass spectrum (HRMS), the attractive compounds were produced in large

volume (5-10 L) and purified by the combination of solid phase extraction (SPE), thin

layer chromatography (TLC)/or silica gel column chromatography, preparative HPLC

and column chromatography with Sephadex LH-20 (Amersham Biosciences,

Freiburg, Germany). The amount and purity for the purified compounds was

controlled by LC/MS and proton NMR (when necessary) during the purification

procedures.

2.9.4.1 Prepurification of the compounds by SPE

After the production and extraction steps, the crude extract which is dissolved in

methanol was first purified with the Oasis® HLB20 35 cc (6g) extraction cartridge.

Before the purification, the cartridge was equilibrated with methanol solutions: first

with 100 mL 100% methanol, then with the same volume of 50% methanol and 20%


methanol respectively. After the equilibration, the cartridge was sinked in 20%

methanol overnight. Then the crude extract was dissolved in as less as possible 20%

methanol and loaded on the equilibrated cartridge. When all the crude extract was

loaded, the chromatography could be fractioned with the solvents from 100 mL of

20% methanol to 100 mL 100% methanol, and each fraction was collected in one

round bottom flask. The concentration of methanol for each fraction was increased by

10%. The resulting fractions were evaporated to dryness in the rotary evaporator and

analyzed by LC/MS with the method MENS04R. If the amount of the analyte was too

much to elute with 100 mL solvent, a large volume (200 mL or 300 mL) can also be

used for some fractions.

2.9.4.2 Purification of the compounds by TLC and silica gel column

chromatography

After SPE, the aim compounds were further purified by the Kieselgel 60 F254 TLC

plates (20 ×20 cm, 2 mm layer thick; Merck, Darmstadt, Germany) or the column

chromatography using silica gel 60 (40-63 μm, Roth). The solvent for TLC was

dichloromethane: methanol 9:1 with 0.05% acetic acid. In order to determine the

position of the band for the compounds, the TLC plates were check under the UV

light at the wavelength 254 nm and 366 nm. In the prerun with analytic TLC plates,

the plates could also be stained by the anisaldehyde staining reagents. The bands

containing the aim compounds were cut out with knife and extracted three time with

methanol. The particles from the TLC plates were removed by centrifugation (4 ℃,

14,000 rpm, 10 min). The supernatant was concentrated to dryness by the rotary

evaporator and redissolved in 1 mL methanol.

The chromatography in silica gel column was carried out using 2 → 15%

MeOH/CH2Cl2. The resulting fractions were collected in the 20 mL test tubes and

checked by analytic TLC plates. The fractions contain the aim product were

evaporated to dryness in the rotary evaporator, dissolved in 1 mL methanol and

analyzed by LC/MS using the method MENS04R.


2.9.4.3 Purification of the compounds by preparative HPLC

In order to obtain compounds pure enough for the NMR measurement, the partially

purified compounds were further purified by preparative HPLC. The preparative

HPLC system used in this thesis was from Waters equipped with 717 plus

autosampler, 2 Waters 515 pumps, and a Waters 2996 photodioden array detector.

The separation of the metabolites was achieved on an Aligent Zorbox C18 pre-column

(50 mm × 9.4 mm; particle size 5 μm) and a main column (150 mm × 9.4 mm;

particle size 5 μm). The software controlling the HPLC operation was “Empower

2002 Waters Corporation” The methanol solution containing the compounds were

first filtrated through a Rotilabo® syringe filter (0.45 μm, PVDF) to remove large

particles. Then 30-100 μl of the MeOH solution was injected into the HPLC system

and the aim compounds were collected two seconds after the appreance of the peak on

the screen. The collected fractions were concentrated and tested with LC/MS. The

gradient for the preparative HPLC was as Table 2-26.

Table 2-26 Gradient for the preparative HPLC. (Solvent A: Acetonitrile with 0.5% acetic acid;

Solvent B: H2O with 0.5% acetic acid).

2.9.4.4 Column chromatography using Sephadex® LH-20

Before the NMR measurement, the purified products were often further purified with

Sephadex LH-20. The Sephadex LH-20 was first suspended with methanol or aceton,

loaded onto a glass column (100 × 2.6 cm), equilibrated for 2 days in the solvent and

was then ready to use. The producted were dissolved in the same solvent as that in the


0 20 80

6 20 80

7 30 70

25 95 5

28 95 5

30 20 80

35 20 80

Flow rate 2 mL/min; Detection: 254 nm and 361 nm.


column and loaded onto the column. Elution was performed with the same solvent as

the column with a flow rate of about 1 mL/min. Each 4 mL elute was collected by

fraction collector and controlled by LC/MS. The right fractions were pooled and

concentrated in vacuum.

2.9.5 Structure elucidation by NMR

Nuclear magnetic resonance (NMR) was employed to elucidate the structures of

rishirilide B and its derivatives from the mutants. The 1H (400 MHz) and

13C-NMR

(100 MHz) spectra of these compounds were detected on the Bruker DRX-500

spectrometers (Bruker, Karlsruhe, Germany). In addition of 1D NMR, the 2D NMR

including 1H/

1H-COSY (correlation spectroscopy), HSQC (Heteronuclear Single

Quantum Coherence), HMBC (Heteronuclear Multiple Bond Correlation) and NOESY

(Nuclear Overhauser Effect Spectroscopy) were also measured to determine the

structures of the compounds. Analsysis of the NMR data and interpretation of the

structures were undergone with the help of Renato Murillo from Costa Rica. In this

thesis, the NMR data for the following 4 compounds were obtained (Table 2.27)

Table 2-27 Compounds measured by NMR in the thesis

Compound Produced by Solvent Time of measurement

Rishirilide B S. albus::cos4 CD3OD 09.2011

Rishi1a S. albus::cos4ΔrslK4 CD3OD 02.2012

Rishi2a S. albus::cos4ΔrslO1 CDCl3 03.2012

Rishi2b S. albus::cos4ΔrslO1 CDCl3 03.2012


2.10 Softwares, databases and online tools

Table 2-28 Softwares, databases and online tools used in this thesis

Name Supplier, note and link Ref.

Artemis The Sanger Institute, United Kingdom

a DNA sequence viewer and annotation tool

http://www.sanger.ac.uk/Software/Artemis

[101]

BioEdit Tom Hall, Ibis Biosciences, Canada

A biological sequence alignment tool

http://www.mbio.ncsu.edu/bioedit/bioedit.html

BLAST

NCBI, NIH (National Institutes of Health)

Basic Local Alignment Search Tool, an algorithm for comparing primary

biological sequence information

http://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastH

ome

Block Maker The Fred Hutchinson Cancer Research Center

http://bioinformatics.weizmann.ac.il/blocks/blockmkr/www/make_blocks.

html

ChembioDra

w Ultra 11

Cambridge soft，Cambridge, UK

A versatile software for chemical strucute drawing and analysis.

ChemStation

Rev. A.09.03

Agilent Technologies, Inc. USA

Software for control and analysis of LC/MS

Chromas 2.3 Technelysium Pty Ltd., Tewantin, Queensland, Australia

Software for view chromatogram for DNA sequencing

Clone

Manager 7

Scientific und Educational Software, Cary, USA

Software for DNA sequence analysis

Clustal W EBI (European Bioinformatics Institute), Cambridge, UK

Tool for multiple sequence alignment for DNA or proteins

http://www.ebi.ac.uk/Tools/msa/clustalw2/

[102]

Conserved

domain

search

NCBI, NIH

A toole for the annotation of functional units in proteins

http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi

[103]

Empower

2002

Waters, Milford, USA

Program for control the HPLC system from Waters and data analysis

MestreC

4.9.9

Mestrelab Research, Santiago de Compostela, Spain

Program for the analysis of NMR data

Pfam (Protein

Families)

Tool for searching conserved domains in proteins

http://pfam.sanger.ac.uk/

[104]

http://www.sanger.ac.uk/Software/Artemis

http://www.mbio.ncsu.edu/bioedit/bioedit.html

http://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastHome

http://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastHome

http://bioinformatics.weizmann.ac.il/blocks/blockmkr/www/make_blocks.html

http://bioinformatics.weizmann.ac.il/blocks/blockmkr/www/make_blocks.html

http://www.ebi.ac.uk/Tools/msa/clustalw2/

http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi

http://pfam.sanger.ac.uk/


SciEd Clone

Manager 7

Scientific & Educational Software, Durham, NC, USA

Program for in silico DNA sequence analysis and manipulation

SEARCHPKS National Institute of Immunology, New Delhi, Indian

A software for detection and analysis of polyketide synthase (PKS)

domains in a polypeptide sequence

http://www.nii.res.in/searchpks.html

[105]

Softberry Online gene and protein analysis tool

http://linux1.softberry.com/berry.phtml

Spectral

Database for

Organic

Compounds

National Institute of Advanced Industrial Science and Technology (AIST),

Japan.

An integrated spectral database system for organic compounds.

http://riodb01.ibase.aist.go.jp/sdbs/cgi-bin/direct_frame_top.cgi

Vector NTI

™ 10

Life Technologies Corporation, California, USA

Softwaer for DNA and protein sequence analysis

http://www.nii.res.in/searchpks.html

http://linux1.softberry.com/berry.phtml

http://riodb01.ibase.aist.go.jp/sdbs/cgi-bin/direct_frame_top.cgi

Results 61

3 Results

3.1 Indentification of the Ganefromycins biosynthetic gene

cluster

With the three homologous probes for detection of the PKSI genes and the 2,3- or

4,6-dehydratase genes, Holger Weiss screened the cosmid library of S. lydicus ssp.

Tanzanius NRRL 18036 by colony PCR and successfully identified four sequential

cosmids (cosmid 26, cosmid201, cosmid200 and cosmid21). Sequencing of these

cosmids was performed by the Göttingen Genomics Laboratory (Göttingen,

Germany). The contig of the first cosmid spans 89,167 bp. Analysis of the sequence of

the contig by Softberry revealed the presence of 20 open reading frames (ORFs),

which were proposed to be involved in the biosynthesis of ganefromycins.[91]

Comparison of the ORFs from the kirromycin biosynthetic gene cluster showed that

the genes encoding the type I PKS were not accomplished (Figure 3.1). In order to

obtain the whole gene clster, it was necessary to screen the downstream cosmid with

the primers for amplifying fragments overlapping the end of cosmid 21.

Figure 3.1 Putative ganefromycin biosynthetic genes identified by H. Weiss. (Figure taken from

Figure 4.30 in the thesis of H. Weiss because this project in was taken over from the imcompeleted

project of H. Weiss)[91]

62 Results

The screening and analysis of the remaining cosmids for ganefromycins biosynthesis

were continued by the author of this thesis from July, 2009.

3.1.1 Analysis of the DNA sequence of cosmid 21

The cosmid 21 spans 43,923 bp. Prediction of the ORFs (with the help of Dr. Tilmann

Weber, University of Tuebingen, Germany) showed that this cosmid contains three

intact genes encoding the type I PKSs in the middle and two partial genes also

encoding type I PKSs in the head and tail of the sequence, respectively. The first 2

ORFs were located in the overlap region of cosmid 200 and cosmid 21, while the

other 3 ORFs were situated in cosmid 21. The first 2 ORFs were identical, partially or

entirely, to the genes named by H. Weiss as orf18 and orf19. In order to facilitate

understanding of the names of the genes, orf18 and orf19 were named ganAV and

ganAIV in this thesis, according to their sequence in the modular PKSs. The other 3

genes were designated as ganAIII, ganAII and ganAI, respectively. The encoded

proteins by these three genes were analyzed by the SEARCHPKS software (see 2.10).

In GanAIII, 5 intact modules for type I PKSs were present, whereas in GanAII and

GanAI, the numbers of modules were 1 and 5 respectively. No exceptionally, these

proteins possess typical domain organization and several modules were located in two

adjacent genes. The identities of these proteins with the type I PKSs in the kirromycin

biosynthetic gene cluster[81]

were 55% (GanAIV with KirAIV), 56% (GanAIII with

KirAIII), and 51% (GanAII with KirAII), respectively.

3.1.2 Screening and analysis of cosmid 2H19

3.1.2.1 Screening of 2H19

The cosmids containing DNA sequence in the downstream of cosmid21 were

screened by colony PCR with the primer pairs Cosmid21PWF/Cosmid21PWR. 14

colonies showed positive PCR product for the first PCR with these primers and the

colonies from the 24 plates of the cosmid library constructed by the Combinature

Biopharm AG (Berlin, Germany) (Figure 3.2). A second round of PCR was conducted

Results 63

using the cosmid DNA isolated from these colonies to verify the reliability of the

colony PCR.

Figure 3.2 Results for colony PCR Screening of the cosmids located in the downstream of

cosmid21. The right colonies should have PCR product at the size of 1.0 kb. Ladder: 1 kb DNA ladder

from Promega.

Figure 3.3 Pattern of the 14 cosmids digested with BamHI. L: 1 kb DNA ladder from Promega. 1-14:

The 14 cosmids with which the aim 1 kb fragment was obtained for the colony PCR, showing their

overlapping with cos21.

64 Results

After colony PCR, all the possible colonies were cultivated and the cosmids inside were

isolated. Digestion of these cosmids with BamHI led to the identification of 14 cosmid

which had different restriction patterns among each other (Figure 3.3).

Among the 14 different cosmids, 6 were selected ramdonly for primer-walking

sequencing to determine the length of their overlapping regions with cosmid21.

However, localization of the ends of 3 cosmids failed due to strong noise in the

sequencing, the positions of the front end of other 3 cosmids (named as 2H19, 3B10

and 4C12, according to the location of the colonies which contain these cosmids,

respectively.). The cosmid 2H19 possesses the smallest overlapping region (14 kb) and

was selected to undergo the shotgun sequencing.

3.1.2.2 Analysis of the sequence of 2H19

The insert of cosmid 2H19 spans 39,320 kb and was predicted to include 20 ORFs by

Softberry and BLAST analysis (See 2.10). The first two putative ORFs were identical

to the last two ORFs of the cosmid 21, representing the overlap region of these two

cosmids. The next three ORFs putatively encoded a LuxR family transcriptional

regulator, a thioesterase and an elongation factor Tu. These three types of proteins often

exist in the gene clusters for the biosynthesis of type I polyketides. The LuxR family

transcriptional regulators are generally able to activate the key enzymes for polyketide

biosynthesis.[106]

Thioesterase (TE) domains or proteins catalyze the release of

polyketide chain from the PKSs.[107]

The elongation factor Tu in the putative

gan-cluster is proposed to confer resistance to the produced antibiotic, because

ganefromycins action by interfering the binding of elongation factor Tu and GTP.[108]

The other genes were responsible for encoding the 30S or 50S ribosomal proteins,

DNA-directed RNA polymerase subunits and ion-transporting ATPases. As the

ribosomal proteins and polymerase proteins are important for the growth of the cells

and belong the the primary metabolic pathway, the gene encodes the elongation factor

Tu was most possible the last one in the ganefromycin biosynthetic gene cluster.

Results 65

Table 3-1 Proteins involved in ganefromycin biosynthesis

Protein Aa Putative function Blast Score

/E Value

Highest Similarity to Ref.

ORF(-1) 188 hypothetical protein 157/4e-45 hypothetical protein

(Streptomyces hygroscopicus

ATCC 53653)

ganAT1 575 Acyltransferase 309/2e-95 KirCII (Streptomyces collinus) [81]

ganGT1 409 Glycoslytransferase 310/2e-98 AveBI (Streptomyces

avermitilis MA-4680)

[109]

ganM 317 SAM-dependent

methyltransferase

318/3e-104 KirM (Streptomyces collinus) [81]

ganAT2 1091 Acyltransferase 1482/0.0 KirC1 (Streptomyces cattleya

NRRL 8057)

[110]

ganO1 402 Putative cytochrome

P450 hydroxylase

492/9e-170 EryF (Streptomyces cattleya

NRRL 8057)

[110]

GanS1 265 dTDP-6-deoxy-L-

hexose

3-O-methyltransferase

409/2e-141 CalS11 (Micromonospora

echinospora)

[111]

GanS2 328 dTDP-4-keto-6-deoxy-

hexose 2,3- reductase

459/2e-159 VinE (Streptomyces halstedii) [112]

GanS3 321 Putative NDP-hexose

4-ketoreductase

216/3e-64 PokS6 (Streptomyces

diastatochromogenes)

[113]

GanS4 197 Putative NDP-hexose

3,5-epimerase

218/1e-68 PokS7 (Streptomyces

diastatochromogenes)

[113]

GanO2 394 cytochrome P450

monooxygenase

298/7e-94 PtmO5 (Streptomyces

platensis)

[114]

GanH 286 hypothetical protein 387/3e-132 KirHVI (Streptomyces

collinus)

[81]

GanI 473 Indoleacetamide

hydrolase

635/0.0 Bam (Streptomyces cattleya

NRRL 8057)

[110]

GanGT2 424 Glycosyltransferase 411/3e-137 DesVII (Streptomyces

venezuelae)

[115]

GanS5 290 NDP-glucose-synthase 398/2e-136 AclY (Streptomyces galilaeus) [116]

GanS6 335 NDP-glucose

4,6-dehydratase

428/6e-147 RfbB (Streptomyces olivaceus) [117]

GanS7 477 NDP-hexose

2,3-dehydratase

449/2e-150 SnogH (Streptomyces

nogalater)

[118]

GanAT3 427 Putative acyltransferase 272/1e-83 PldC (Streptomyces platensis) [119]

66 Results

Table 3-1 Proteins involved in ganefromycin biosynthesis

3.1.3 Analysis of the putative gan-cluster

A fragment of 89,281 bp, which was proposed to be the ganefromycins biosynthetic

gene cluster, was obtained by the contig of the all five cosmids (cosmid 26, cosmid 201,

cosmid 200, cosmid 21 and cosmind 2H19) and by removing the nucleotides proposed

to be located outside the gene cluster (figure 3.4). The sequenced region has a G+C

content of 74%, which is a typical value for the Streptomyces genomic DNA.[124]

ORF

prediction with Softberry and ORF Finder revealed 26 ORFs with typical conserved

domains (Table 3-1). Approximately 65 kb nucleotides contain ten genes coding

proteins for the biosynthesis of the polyketide skeleton. The region also contains nine

genes for the biosynthesis of deoxy sugars, one for methyltransferase, three genes with

Protein Aa Putative function Blast Score

/E Value


GanAVI 2745 Type I PKS 1573/0.0 ObsB (Saccharopolyspora

spinosa NRRL 18395)

[120]

GanAV 2605 Type I PKS 1722/0.0 KriAV (Streptomyces

collinus)

[81]

GanAIV 6834 Type I PKS 6115/0.0 kirAIV (Streptomyces

collinus)

[81]

GanAIII 1617 Hybrid non-ribosomal

peptide synthetase

1585/0.0 KirAIII (Streptomyces

collinus)

[81]

GanAII 4735 Type I PKS 3638/0.0 KirAII (Streptomyces

collinus)

[81]

GanAI 2092 Tpye I PKS 1815/0.0 KirAI (Streptomyces

collinus)

[81]

GanR 921 LuxR-family

transcriptional

regulator

455/2e-141 GdmRII (Streptomyces

hygroscopicus)

[121]

GanT 276 Putative thioesterase 234/6e-73 RifR (Amycolatopsis

mediterranei S699)

[122]

GanF 397 Elongation factor Tu 691/0.0 Tuf1 (Streptomyces collinus ) [123]

Orf(+1) 690 Elongation factor G 1307/0.0 Elongation factor G

(Streptomyces cattleya

NRRL 8057)

[110]

Results 67

similarities to oxidoreductases, one regulatory gene, one resistant gene and one

hypothetic protein.

Figure 3.4 Organization of the complete ganefromycin biosynthetic gene cluster.

3.1.3.1 The type I PKSs and the hybrid non-ribosomal peptide synthase

In the putative ganefromycin biosynthetic gene cluster, there are 5 type I PKSs (GanAI,

GanAII, GanAIV, GanAV and GanAVI) and one hybrid non-ribosomal peptide

synthase (GanAIII). Except GanAVI, all the other enzymes show rather high similarity

to the proteins for the biosynthesis of the kirromycin polyketide chain.[81]

The

organization of the modules in these proteins was obtained by analysis of their amino

acid sequence by SEARCHPKS or NRPS/PKS. All of these enzymes consist of two or

more type I PKS modules and altogether 15 modules were present, implying that the

ganefromycins polyketide was biosynthesized from 14 successive condensation steps.

Intriguingly, only two AT domains were found in the two modules of the last PKS

GanAVI. (Figure 3.5) The absence of AT domain in the other modules suggests that the

other modules belong to the atypical “Trans-AT” PKS family, in which the extender

units were selected by the independent Acyltransferase enzymes. The similarity

between GanAVI and KirAVI, the last PKS in the putative ganefromycin biosynthetic

68 Results

gene cluster and the the kirromycin biosynthetic gene cluster respectively, was little

lower (42%). The three new type I PKSs found in current thesis were proposed to be

Figure 3.5 The predicted type I PKS modules in the six genes (GanAI-GanAVI). The modules

span two adjacent genes were marked with a black circle. X in the 4th module (M4) means the function

of the domain is not clear. In ganAVI, there is a incomplete module downstreams module 15, but its

function in the biosynthesis of ganefromycin could not be proposed.

responsible for the initiation of the polyketide biosynthesis. The hybrid non-ribosomal

peptide synthase (GanAIII) was responsible for the condensation of the polyketide

chain with glycine. This condensation yielded the amide bond and the polyketide chain

was further extended by the action of GanAIV-VI.

3.1.3.2 The LuxR-family transcriptional regulator

GanR, the only regulatory gene in the gan-cluster, encodes a protein of 921 amino

acids. In BLASTP analysis, GanR shows high similarity to the LuxR family

transcriptional regulator GdmRII in Saccharopolyspora erythraes NRRL 2338,

implying the identity of GanR as a member of the novel large ATP- binding regulators

of the LuxR family (LAL). The LAL family, represented by the regulator of maltose

regulon in E. coli MalT,[125]

contain an N-terminal ATP/GTP-binding domain,[126]

and

a C-terminal helix-turn-helix motif. Several members of the LAL family have been

Results 69

reported to be present in Streptomyces antibiotic gene cluster, such as PikD from the

pilromycin biosynthetic gene cluster,[127]

RapH from the rapamycin pathway[128]

and

PimR from the pimaricin biosynthetic pathway.[129]

3.1.3.3 The Thioesterase GanT

GanT consists of 276 aa and is most similar to RifR, a characterized type II

thioesterase.[130]

Type I TEs are covalently attached to the terminal module of the PKSs

and usually unload the final polyketide from the polyketide assembly line complex,

while type II TEs are independent proteins and they can remove intermediates from any

module. Structural and biochemical studies of RifR showed that this protein were able

to hydrolyze both carboxylated and decarbolylated acyl thioesters. Especially, RifR

preferred aberrant decarboxylated acyl thioester over natural building blocks of

rifamycin, consistent with the function of type II TEs as a “housekeeper” for ensuring

the extension of the polyketide chain in the right manner.

3.1.3.4 GanF: an elongation factor Tu

The kirromycin and elfamycin family antibiotics were reported to inhibit bacteria

protein synthesis by binding to elongation factor Tu (EF-Tu).[131]

In some of the

kirromycin-type antibiotics producers, such as Streptomyces cinnamomeus (produces

kirrothricin), Streptomyces lactamdurans (produces efrotomycin) and Streptovertici-

llium mobaraense (produces pulvomycin), the resistace to this family of antibiotics was

attributed to drug-insensitive EF-Tu. Mutagensis analysis of the EF-Tu in S.

cinnamoneus showed that the Thr378

residue in this protein was an important

determinant of kirromycin resistance.[132]

Alignment analysis of the sequence of GanF

with other kirromycin-resistant EF-Tu showed that the Thr amino acid was also found

in GanF, imply that this protein was responsible for the resistance to the product (Figure

3.6).

70 Results

Figure 3.6 Alignment of selected Streptomyces EF-Tu sequences. The important residues which are

important for the resistance to kirromycin-family antibiotics were marked below the sequence and

labelled red.

3.2 Identification of the ganefromycin biosynthetic gene

cluster

3.2.1 Conjugation of S. lydicus

After the identification of the genes for ganefromycin biosynthesis, genetic operation

on the type I PKS genes as well as the post-PKS modification genes was conducted.

Due to the special polyketide structure and the presence of the phenyl acetic acid group

and the three sugars, investigation of the ganefromycin biosynthetic enzymes would be

of great importance in revealing the mechanism for type I polyketide biosynthesis and

for the post-PKS modification reactions. During his work on ganefromycin, Holger

Weiss constructed several plasmids for inactivating genes in the gan-cluster, however,

no conjugation or protoplast transformation was successful.

In this thesis, protoplast transformation and conjugation experiments were carried out

first with two integrative plasmids pSET152 (φ31-based) and pSOK804 (VWB-based),

Results 71

as well as three replicative plasmids (pKC1139, pKC1218, and pUWL201) with

different replicons. Although pSET152 was able to integrate into the chromosome of

most Streptomyces, no exconjugants were obtained by conjugation of S. lydicus with

pSET152. The plasmid pSOK804 was able to integrate into the genome of S. lydicus

efficiently. Ostash et al. had shown that a putative tRANArg

(AGG) gene served as the

integration site for VWB-based plasmid.[133]

The different ability of pSET152 and

pSOK804 in integration into the chromosome of S. lydicus implies the presence of the

VWB-integration site and the absence of the attB site in this strain. In the case of

transformation by replicative plasmids, only the SCP*2-based pKC1218 was able to

replicate in S. lydicus. (Figure 3.7)

Figure 3.7 Plates for conjugation of S. lydicus with pKC1218 and pSOK804.

3.2.2 Verification of the gan-Cluster by disrupting ganAIV

Although domain prediction of the type I PKSs in the putative gan-cluster fitted

perfectly with the PKSs from the kirromycin biosynthetic pathway, and the presence of

the ganefromycin-insensitive EF-Tu in this cluster strongly suggest that the current

cluster is responsible for the biosynthesis of ganefromycins, direct proofs from gene

inactivation are still required to verify the hypothesis. In order to carry out the gene

disruption experiments, the two glycosyltransferase genes (ganGT1 and ganGT2) and

one PKS gene, ganAIV, were selected.

72 Results

The inactivation plasmids of ganGT1 and ganGT2 were constructed by PCR

amplification, ligation of the upstream and downstream regions of these two genes,

respectively, and insertion of the ligated fragments into the inactivation plasmid

pKC1132. The inactivation plasmid for ganAIV (pKC-ganAIVEP) was constructed by

insertion of a 6.6 kb EcoRI + PstI digested fragment into pKC1132. Conjugation of the

inactivation plasmids into S. lydicus was tried with different conditions and repeated for

about 150 times, until one exconjugants with pKC-ganAIVEP was observed on the

conjugation plates. This clone was termed S. lydicus ganAIV::pKC-ganAIVEP. In the

LC/MS analysis of extracts from this clone, no ganefromycin production was detected

(Figure 3.8).The loss of ganefromycins production in the S. lydicus mutant, proves that

the putative cluster is involved in the biosynthesis of ganefromycins.

Figure 3.8 LC/MS analysis of extracts from S. lydicus wild-type and its ganAIV mutant strains. In

the ganAIV disrupted mutant, the peak for ganefromycin (16.7 min) disappeared.

From the LC/MS figure of the culture from the S. lydicus wild-type, the peak at 16.7

min shows the UV and mass spectra identical to those reported in the thesis of Maria

Koutloubasi.[134]

In the culture of S. lydicus ganAIV::pKC-ganAIVEP, the peak for

ganefromycins disappeared, but two new peaks could be observed at 9.9 min and 10.1

Results 73

min. The UV spectrum of the peak at 9.9 min shows high absorption at 270 nm and 320

nm (Figure 3.9). In order to check whether this peak is the compound produced by the

GanAI-III intact PKSs, the mutant strain was cultivated in 5 L production medium and

purified. However, the amount of the purified compound was not enough to elucidate

its structure.

Figure 3.9 UV spectra of ganefromycin and of the product from the ganAIV disrupted mutant. A:

ganefromycin. B: the compound at 9.9 min from the S. lydicus ganAIV::pKC-ganAIVEP mutant.

3.3 Production of Rishirilide B and analysis of the rishirilide

biosynthetic gene cluster

During his PhD research, Anton Linnenbrink isolated three different type II PKS-

containing cosmids from S. bottropensis using the ketosynthase specific probes and

termed them cos2 (contains majority of the mensacarcin biosynthetic gene cluster),

cos3 (contains the gene cluster for spore pigment biosynthesis) and cos4.

Heterolougous expression of cos2 in S. albus resulted in the production of didesmethyl-

mensacarcin (DDMM), a precursor of mensacarcin.[92]

Katharina Probst inactivated a

large number of gene in the cos2 and obtained several mensacarcin derivatives from the

mutants.[135]

Although the product from heterologous expression of cos3 was not

detected by LC/MS, inactivation experiments in S. bottropensis had proved that the

gene cluster located in this cosmid is responsible for the biosynthesis of a so far

unknown spore pigment. Because rishirilide A was once isolated from S. bottropensis,

and the aromatic structure of rishirilide A is most possibly derived from type II PKSs, it

74 Results

was proposed that the putative gene cluster (A. Linnenbrink termed it msc-cluster) in

cos4 is responsible for the synthesis of rishirilide A. However, no product from the

msc-cluster had been identified.

3.3.1 Production of rishirilide B

3.3.1.1 Heterlogous production of rishirilide B in S. albus and S. lividans

Cos4 was introduced into S.albus J1074 and S. lividans 1326 by intergeneric

conjugation with ET12567/pUZ8002, respectively (see method 2.7.6.2). For each

conjugation, one exconjugant that was arpamycin resistant was picked and tested for

the integration of the cosmid into their chromosomes by colony PCR. The PCR results,

which showed the correct fragment size of the specifc genes from cos4, proved the

integration of cos4 into the genome of these two strains.

In order to check the production of rishirilides by heterologous expression, the two

strains S. albus::cos4 and S. lividans::cos4 were cultivated in HA-, SG- and NL19-

media respectively (see 2.9.2). LC/MS analysis of the extracts showed the presence of a

peak with the characteristic UV spectra of rirhirilide B (218 nm, 264 nm, 305 nm and

370 nm) and the mass of rishirilide B in negative mode ([M-H]-= 371.2) at 22.1 min

(Figure 3.10).

In order to prove that this new compound is rishirilide B, S. albus::cos4 was cultured

in 5 L HA-medium (See 2.9.2). Then the main compound was sequentially purified by

SPE, preparative HPLC and column chromatography by Sephadex LH20. Finally 3.2

mg of compound was obtained and measured by NMR. The 1H and

13C NMR data of

this compound is in good accordance to the data reported for synthetic rashirilide B,[136]

unequivocally proving the identity of this compound to be rishirilide B (Table 3-2 and

Figure 3.11). Because rishirilide A is not reproducible in S. bottropensis, cultivation of

S. albus::cos4 and S. lividans::cos4 in the HA-medium were repeated independently for

three times. Peak of rishirilide B could be detected all the time at very close peak area,

implying the repeatability and stability of rishirilide B production in the two

Results 75

heterlogous expression hosts. However, no peak for rishirilide A was found in these

cultures.

Figure 3.10 LC/MS analysis of the cos4-integrated strains in HA medium. (UV detection at λ =

254 nm); The mass of the main peak was shown in negative mode. The UV-absorption characteristics

of S. albus and S. lividans wild-type in HA medium was almost identical due to an unknown reason.

76 Results

Table 3-2 The 1H and

13C NMR data of rishirilide B isolated from S. albus::cos4.

Figure 3.11 Structure of rishirilide B.

3.3.1.2 Production of rishirilide B in S. bottropensis

S. bottrpensis from the saccharose stock solution was cultured in the HA-medium and

the NL111-medium in attempt to verify its identity. Interestingly, LC/MS analysis of

the culture revealed the production of mensacarcin in the HA-medium and the

production of rishirilide B in the NL111 medium (Figure 3.12). Although only

rishirilide A was isolated from the culture broth of S. bottropensis in the dissertation

of M. Arnold,[73]

the isolation of rishirilide B in the broth of S. bottropensis in the

NL111 medium was not a surprise, because the latter was proposed to be a precursor

of rishirilide A. The reason for the production of rishirilide B instead of A could be

attributed to the oxygen concentration in the broth, or to the difference in the

extraction processes for the fermentation broth.

Interestingly, in the raw extract of S. bottropensis from the NL111 medium, one peak

(17.2 min) with the same mass as bottromycin A2, a potent antibiotic against

Pos. C

[ppm]

H (J Hz) Pos. C

[ppm]

H (J Hz) Pos. C

[ppm]

H (J Hz)

1 197.3 6 119.6 6.92 d (7.4) 11 48.0 1.63-1.49 m

2 35.1 2.95 (q,6.6) 7 125.6 7.28 (dd, 8.1, 7.4) 12 31.2 2.30-2.15 m

3 77.0 8 119.8 7.45 d (8.1) 13 29.0 1.33-1.21 m

4 83.5 9 126.4 8.27 s 14 22.8 0.76 d (6.6)

4a 140.6 9a 126.1 15 22.5 0.65 d (6.6)

5 153.2 10 109.8 8.25 s 16 174.2

5-OH 10.25 10a 130.2 17 10.2 1.17 d (6.6)

Results 77

methicillin-resistant Streptococcus aureus (MRSA) and vancomycin-resistant

Enterococci (VRE) strains, was also detected[137, 138]

(Figure 3.13). But the UV

spectrum of this peak was not clear due to the low yield in the NL111 medium. This

result is consistent with the discovery of bottromycins in S. bottropensis.

Figure 3.12 The LC/MS profiles of S. bottropensis in NL111-medium and HA-medium.

Figure 3.13 Production of bottromycin by S. bottropensis in NL111-medium.

78 Results

3.3.2 Analysis of the rishirilide biosynthetic gene cluster

Analysis of the sequence in cos4 by Softberry and BLASTP resulted in the

identification of 42 ORFs. The first 11 genes enconde peptide with high identities

(>77%) to proteins for the biosynthesis of exoplysaccharide in Streptomyces sp.

139.[139]

Therefore, they are supposed to be involved in the biosynthesis of

exoploysaccharide in S. bottropensis. The last 3 ORFs in cos4 encode two peptides

similar to putative transcriptional anti-termination regulator from S. ambofaciens

ATCC 23877[140]

and one hypothetic protein. The rishirilide biosynthetic gene cluster

(rsl-cluster) is located in the middle of cos4 with 28 ORFs, including 20 structural

genes, 4 regulatory genes (rslR1-R4) and 4 resistance-related genes (rslT1-T4).

Five of the 20 structural genes were predicted to be responsible for the biosynthesis of

the polyketide chain, including genes encoding the the “minimal PKS” (rslK1-k3),

and genes encoding proteins for the selection of the unusual starter unit (rslK4 and

rslA). Besides these genes, there are three cyclase/aromatase-encoding genes

(rslC1-C3), ten genes encoding oxidoreductases, as well as a putative phosphotrans-

ferase-encoding gene (rslP) and a putative amidohydrolase-encoding gene (rslH).Two

of the four regulatory genes (rslR1 and rlsR2) encode proteins of the SARP-family,

while the other two genes encode a LAL-family regulator (RslR3) and a MarR family

transcriptional regulator (RslR4), respectively. Proteins encoded by rslT1, rslT2, and

rslT3 were proposed to form a three-component ABC-transporter. The RslT4 protein

shows homology to drug resistance transporter. These two transporters were supposed

to be responsible for the formation of self-resistance to rishirilide A and B. The

organization of the rsl-cluster and the putative proteins are shown in Figure 3.14 and

Table 3-3.

Results 79

Table 3-3 Proteins involved in rishirilides biosynthesis

Protein aa Proposed function Blast Score

/E Value


Orf(-1) 441 1-aminomutase 774/0.0 SMCF_2541 (Streptomyces

coelicoflavus ZG0656)

RslC1 315 Aromatase 302/5e-98 SnoaE (Streptomyces nogalater) [141]

RslK1 89 Acyl carrier protein 79.0/3e-17 AknD (Streptomyces galilaeus) [116]

RslK2 407 Ketosynthase (β) 461/1e-157 AknC (Streptomyces galilaeus) [116]

RslK3 422 Ketosynthase (α) 610/0.0 AknB (Streptomyces galilaeus) [116]

RslA 363 Acyl transferase 288/3e-91 AknF (Streptomyces galilaeus) [142]

RslK4 347 3-oxoacyl-ACP

synthase III

362/2e-120 CosE (Streptomyces olindensis) [143]

RslT1 321 ABC-transporter

(substrate binding)

284/8e-91 Sfla_5075 (Streptomyces

flavogriseus ATCC 33331)

RslT2 249 ABC-transporter(AT

P- binding)

302/5e-100 ArtC (Streptomyces scabiei 87.22) [144]

RslT3 319 ABC-transporter

(transmembrane)

312/2e-101 ArtQ (Streptomyces sp.

SA3_actG)

RslO1 354 Luciferase-like

monooxygenase

409/3e-138 PyrC (Streptomyces

pyridomyceticus)

[145]

RslO2 172 Flavin reductase 102/4e-24 Pyr9 (Streptomyces

vitaminophilus)

[146]

RslP 375 Phosphotransferase 313/9e-101 Tcur_3974 (Thermomonospora

curvata DSM 43183)

RslR1 269 SARP family

regulator

196/6e-58 AknI (Streptomyces galilaeus) [142]

RslC2 300 Second ring cyclase 295/1e-95 AlnR (Streptomyces sp. CM020) [147]

RslO3 238 3-oxoacyl-ACP

reductase

199/6e-60 SsfK (Streptomyces sp. SF2575) [148]

RslO4 100 Anthrone

monooxygenase

77/4e-16 SnoaB (Streptomyces nogalater) [118]

RslO5 363 NADH:flavin

oxidoreductase

295/3e-94 SSLG_05708 (Streptomyces sp.

SPB78)

RslC3 161 Aromatase 108/2e-25 AknE1 (Streptomyces galilaeus) [142]

RslR2 274 SARP family

regulator

200/2e-59 Lct15 (Streptomyces rishiriensis) [149]

RslR3 1077 LAL-family

Regulator

297/5e-82 AfsR (Streptomyces coelicolor) [150]

RslO6 342 Luciferase-like

monooxygenase

261/2e-81 MXAN_3632 (Myxococcus

xanthus DK 1622)

80 Results

Figure 3.14 Location and organization of the rsl-cluster. The PKS genes were marked red, pink or

dark red. The cyclases and aromatase were labeled yellow. Genes encoding oxidoreductases were

marked blue. Regulatory genes and transporter genes were marked purple and green, respectively.

Hypothetic genes were shown with white arrows.

3.3.2.1 The minimal PKS

In the aclacinomycin biosynthetic gene cluster, the minmal PKS genes aknB (KSα),

aknC (KSβ) and aknD (ACP) are organized in a transcriptionally coupled manner.

Homologues to aknB-D were found in the rsl-cluster, which carries the minimal PKS

Table 3-3 Proteins involved in rishirilides biosynthesis

Protein aa Proposed function Blast Score

/E Value


RslR4 153 MarR family

transcriptioanl

regulator

88.2/2e-19 AMED_0951 (Amycolatopsis

mediterranei U32)

RslT4 512 drug resistance

transporter

375/2e-120 Francci3_2014 (Frankia sp. CcI3)

RslO7 298 Putative NADPH

quinone reductase

201/8e-58 SSOG_04025 (Streptomyces

hygroscopicus ATCC 53653)

RslO8 325 NADPH: quinone

oxidoreductase

249/3e-77 GrhO7 (Streptomyces sp. JP95) [151]

RslO9 533 FAD-dependent

monooxygenase

392/8e-127 GrhO9 (Streptomyces sp. JP95) [151]

RslO10 273 C9-keto reductase 378/3e-129 AknA (Streptomyces galilaeus) [142]

RslH 402 Amidohydrolase 259/3e-79 SPW_0780 (Streptomyces sp.

W007)

Orf(+1) 241 transcription

antitermination

regulator

364/1e-124 SAMT0075 (Streptomyces

ambofaciens ATCC 23877)

Results 81

genes in the following order: KSα (rslK3), KSβ (rslK2) and ACP (rslK1) (Figure

3.13). The gene rslK3 encodes a peptide of 422 amino acids with highly conserved

domains for KS and AT. rslK2 encodes a 407-amino acid protein with about 42%

similarity to rslK3, but it lacks the active centers for KS and AT like other KSβ

proteins. rslK1 encodes a 89 amino acid peptide. Sequence analysis by BLASTP

showed that RslK1is an ACP. In rslK2, the highly conserved glutamine residue,

which is important for the polyketide initation is present. Interestingly, rslK3 overlaps

with rslK2 by 3 bp and rslK2 overlaps with rslK1 by 4 bp.

3.3.2.2 Enzymes for the selection and biosynthesis of the starter unit

Like the gene clusters for the biosynthesis of R1128, daunorubicin and aclacinomy-

cins, the rsl-cluster contains two genes encoding an acyltransferase (RslA) and a

starter unit-specific β-ketoacyl:ACP synthase III (RslK4), respectively. RslA consists

of 363 amino acids and show high similarities (63%) to AknF from the aclacinomycin

biosynthetic pathway[142]

and DpsD from the daunorubicin pathway[152]

. RslK4

contains 347 amino acids and shows 55% identity to CosE from the cosmomycin

pathway[143]

and DpsC from the daunorubicin pathway[152]

.Alignment results of RslK4

with other KASIII enzymes showed that RslK4 contains a Cys-His-Asp catalytic

triads (Figure 3.15). rslO3 encodes a peptide similar to a 3-oxoacyl-ACP reductase,

ssfK. SsfK is an enzyme catalyzing the β-ketoreduction of 2-methyl-acetoacetyl-CoA

to form 3-hydroxyl-2-methyl-butyryl-CoA.[148]

Therefore, RslO3 is proposed to

participate in the biosynthesis of the starter unit, converting a 3-oxoacyl-ACP

reductase substrate to its hydroxylation product, which is recognized by the minimal

PKS to start the extension reactions with malonyl-CoA.

82 Results

Figure 3.15. Sequence alignment of RslK4 with other KASIII enzymes for secondary metabolites

biosynthesis from Streptomyces. The catalytic triads were marked red. AknE2: ketosynthase from the

aclacinomycins pathway.[142]

CerJ: a ketoacylsynthas from the cervimycin pathway.[153]

ChlB3:

ketosynthase from the chlorothricin pathway.[154]

CosE: ketosynthase from the cosmomycin

pathway.[143]

DpsC: ketosynthase from the daunorubicin (DNR)-doxorubicin (DXR) pathway.[155]

HedS:

ketosynthase from the hedamycin pathway.[156]

ZhuH: priming ketosynthase from the R1128

pathway.[157]

Results 83

3.3.2.3 The three aromatases and cyclases

In the rsl-cluster, there are three aromatase/cyclase encoding genes: rslC1, rslC2 and

rslC3. RslC1 encodes 315 amono acids protein which shows high similarity to SnoaE

from the nogalamycin cluster. SnoaE was shown by Metsä-Ketelä et al. to be

responsible for the formation of the first ring of nogalamycin. RslC1 is also similar to

ChaF and RmdK, aromatases from the type II polyketide biosynthetic pathways.

rslC2 encodes a enzyme with 300 amino acids. BLASTP analysis shows that RslC2 is

homologous to cyclases responsible for the second ring closure in polyketide

biosynthesis, such as AlnR from the alnumycin pathway, SsfY2 from the SF2575

pathway and ActIV from the actinorhodin pathway. Therefore, RslC2 is proposed to

be involved in the formation of the second ring in rishirlide biosynthesis. rslC3

encodes a 161 amino acid protein, which shows high similarity to several cyclases,

such as AknE1 from S. galilaeus, CmmX from S. griseus, OxyI from S. rimosus and

SnoO from S. nogalater. (See figure 3.16)

Figure 3.16 Phylogenetic tree analysis of the three cyclases/Aromatases with other cyclases from

aromatic polyketide biosynthesis gene clusters. RslC1, RslC2 and RslC3: the three cyclases from the

rsl-cluster. RdmK: aromatase from the rhodomycin cluster.[142]

SnoaE: An aromatase responsible for

the aromization of the first ring in nogalamycin biosynthesis.[158]

ChaF: a putative aromatase from the

chartreusin cluster.[159]

CmmX: a putative cyclase proposed to be involved in the forth ring closure.[160]

SnoO: a putative cyclase from the nogalamycin cluster. OxyI: a putative cyclase from the

oxytetracycline biosynthetic pathway.[161]

AlnR: cyclase from the alnumycin gene cluster[147]

SsfY2:

second ring cyclase from the SF2575 biosynthetic pathway.[148]

ActIV: cyclase from the actinorhodin

biosynthetic pathway.[162]

84 Results

3.3.2.4 The tailoring genes

In the rsl-cluster, there are ten oxidoreductase-encoding genes. rslO1 encodes a

354-amino acid peptide, which is highly similar (58% identity) to luciferase-like

monooxygenase PyrC from S. pyridomyceticus. The luciferase-like monooxygenases

utilize FMN or F420 as cofactor to catalyze the oxidation of their substrates. The

structures of several luciferase-like monooxygenases have been elucidated. All these

enzymes consist of an (αβ)8 TIM barrel, which is proposed to form the flavin-binding

cave, however, non structure of these enzymes in complex with their coenzyme, FMN

or F420 was obtained. Modeling of RslO1 based on a F420-dependent secondary

alcohol dehydrogenase (Adf) from Methanoculleus thermophilicus by SWISS-

MODEL showed that RslO1 also consists of a TIM barrel (Figure 3.17).

Figure 3.17 Comparison of RslO1 modelling (A) with crystal structure of Adf from Methano-

culleus thermophilicus (B)[163]

. Modelling of RslO1 was perfomed based on the crystal structure of a

monooxygenase (Pdb ID: 2I7G) with SWISS-MODEL. Adf is a F420-dependent secondary alcohol

dehydrogenase.[164]

Ribbon diagram of the Adf dimer shows the TIM barrel architecture of the

monomer (B). In the modeling of RslO1, the TIM barrel can also be seen (A).

RslO2 is a putative flavin reductase. The close localization of rslO1 and rslO2 might

imply that RslO1/RslO2 is a two-component flavin-dependent monooxygenase, and

that RslO1 possibly utilizes FMN as cofactor. The protein encoded by rslO4 is highly

similar (45% identity, 56% similarity) to SnoaB, an anthrone monooxygenase from

the nogalamycin pathway. SnoaB catalyzes the conversion of 12-deoxy-nogalonic

acid to nogalonic acid in the biosynthesis of aromatic polyketide nogalamycin in S.

Results 85

nogalater (Figure 3.18).[165]

Beside SnoaB, RslO4 also has homologues in

biosynthetic pathways of other aromatic polyketides, such as AknX in aclacinomycin

biosynthesis,[116]

DnrG/DauG in daunomycin biosynthesis[166]

and MsnO6 in

mensacarcin biosynthesis.[167]

Therefore, RslO4 is proposed to be responsible for the

formation of the anthracene quinone intermediate in the biosynthesis of rishirilides.

RslO5 is a putative NADH:flavin oxidoreductase, an enzyme that catalyzes the

reduction of FMN by NADH to give NAD and FMNH2. Proteins of the NADH:flavin

oxidoreductase family usually act as auxillary enzymes for the supplying reduced

FMN to another enzyme in oxidative chemistry.

rslO6 encodes a luciferase-like monooxygenase, which is homologous to MsnO8

from the mensacarcin biosynthetic cluster.[135]

BLASTP analysis showed that both

RslO6 and MsnO8 contain a COG2141 domain. This domain is characteristic for

coenzyme F420-dependent N5,N10-methylene tetrahydromethanopterin (methylene-

H4MPT) reductase and related flavin-dependent oxidoreductase. The methylene

H4MPT reductase forms a homodimer and catalyzes the oxidative reaction using F420

cofactor.[168]

Analysis of RslO7 by BLASTP didn’t provide clear hint for its function. RslO8 is a

putative NADPH:quinone reductase, resembling several well-studied enzymes such as

ActVI-ORF2 from actinorhodin pathway[169]

and GrhO7 from the Griseorhodin A

biosynthetic pathway.[151]

ActVI-ORF2 recognizes (S)-DNPA (4- hydro-9-hydroxy-

1-methyl-10-oxo-3-H-naphtho-[2,3-c]-pyran-3-(S)-acetic acid) as a substrate for

stereospecific reduction at C-15 (Figure 3.18). Disrupton of ActVI-ORF2 leads to no

actinorhodin production.

RslO9 is a putative FAD-dependent monooxygenase, with 40% identity to GrhO9 in

the biosynthesis of Griseorhodin A[151]

and 39% identity to XanO5 from the

Xantholipin biosynthetic pathway.[170]

XanO5 catalyzes the C4 hydroxylation of the

carbon backbone in the biosynthesis of Xantholipin (Figure 3.18).

86 Results

rslO10 encodes a C-9 keto reductase, like AknA from the aclacinomycin pathway.

AknA is proposed to be responsible for reducing the keto group at C2 of the

polyketide to a hydroxyl group that is removed during closing and aromatizing of the

first ring by ARO. Further mutational analysis will provide further knowledge about

their functions in the biosynthesis of rishirilides. In the rsl-cluster, there is one

hypothetic protein (rslH) which shows low similarity to other known proteins.

Figure 3.18 Functions of the homologues of RslO4, RslO8 and RslO9 in the biosynthesis of

aromatic polyketides.

3.3.2.5 Genes involved in transportation of rishirlides

There are 4 genes involved in the export of rishirilides in the rsl-cluster. The first

three genes (rslT1-T3) encode peptides belong to the ABC-transporter family. The

sequence similarity, conserved domains and hydrophobicity profiles strongly imply

that the rslT1T2T3 gene products are integrated into a typical three-component ABC

transporter system, which consists of the substrate-binding subunit RslT1, the

ATP-binding subunit RslT2 and the membrane fusion protein RslT3. Beside these

three proteins, a putative resistance gene, rslT4, is found in the rsl-cluster. The

deduced protein of rslT4 is homologous to members of the EmrB/QacA family drug

Results 87

resistance transporter. These proteins may be involved in rishirilides export and

self-protection against the products.

3.3.2.6 Genes involved in regulation

Intriguingly, four regulators are present in the rsl-cluster, including two SARP-family

regulators (RslR1 and RslR2), one LAL-family global regulators and one MarR

(multiantibiotic resistance) family transcriptional regulator (RslR4). BLASTP analysis

showed that RslR1 and RslR2 were similar to AknI from the aclacinomycin

pathway[151]

and Lct15 from the lactonamycin pathway[149]

, respectively. Both of

AknI and Lct15 are activator proteins, therefore, RslR1 and RslR2 are also proposed

to be activator for rishirilides biosynthesis. rslR3 encodes a 1077-amino acid peptide

with high similarity (28%) to AfsR from S. coelicolor.[171]

AfsR is a putative

pleitropic regulator protein that participates in the activation of ActII-ORF4 and of

RedD, two pathway-specific regulatory proteins required for the production of the

antibiotics undecylprodigiosin (Red) and actinorhodin (Act), respectively. Therefore,

it is proposed that RslR3 is a pleitropic regulator. RslR4 shows homology to MarR

family transcriptional regulators. In E. coli, the MarR protein represses expression of

the multiple antibiotic resistance operon.[172]

The MarR family consists largely of

negative regulators but also includes a number of positive regulators. No TTA codon

was found in all of these four regulators.

3.4 Inactivation of genes in the rsl-cluster

After the identification of the rsl-cluster by heterologous expression of cos4 in S.

albus, mutational analysis of several key genes in the rishirilide biosynthetic pathway

was carried out in S. albus::cos4 using the Red/ET recombination (See Materials and

Methods 2.7.3).[84]

3.4.1 Inactivation of rslK4- the priming ketosynthase gene

Using the Red/ET recombination, rslK4 in cos4 was inactivated to generate a mutant

cosmid cos4ΔrslK4. Then cos4ΔrslK4 was introduced into S. albus WT by

88 Results

intergeneric conjugation to obtain S. albus::cos4 ΔrslK4. The integration of

cos4ΔrslK4 into the ribosome of S. albus was verified by colony PCR and PCR with

isolated genomic DNA from the exconjugants. LC/MS analysis of the culture from

S.albus::cos4ΔrslK4 revealed that beside the peak for rishirilide B, there were two

new peaks (18.2 min and 19.6 min) with the same UV-spectra as rishirilide B. The

mass for the peak at 18.2 min is 343.1[M-H]-, and the mass for the peak at 19.6 min is

Figure 3.19 The LC/MS (λ = 254 nm) chromatography of S. albus::cos4 ΔrslK4 compared with S.

albus::cos4. Above: Profiles of the raw extract from S. albus::cos4 ΔrslK4 and S. albus::cos4. Below:

The UV and mass spectrum of the two derivatives: A: rishi1a; B: rishi1b.

Results 89


13C NMR data of rishi1a.

Position 1H m d

13C m HMBC correlation with

1 200.0 s

2 3.05 q 6.8 49.3* d C-1, C-3, C-14, C-15

3 84.5** s

4 78.9 s

4a 140.8

5 154.6 s

6 6.89 d 8 111.2 d

7 7.28 dd 8, 8 127.6 d C-5, C-8a,

8 7.43 d 8 121.5 d C-10a

8a 131.3

9 8.39 s 127.9 d C-1, C-8, C-10a

9a 131.4

10 8.43 s 121.1 d C-4, C-5, C-8a, C-9a

10a 128.2

11 1.68 ddd 12.4, 4.4, 4.4 41.0 t

11´ 2.30 ddd 14.4, 4.4, 4.4 C-4

12 1.05 m 17.2 t

12´ 1.55 m

13 0.80 t 7.2 14.7 q C-11, C-12

14 178.0**

15 1.30 d 6.8 10.5 q C-1, C-2, C-3

* overlapped with CH3OH signal **data obtained indirectly from HMBC

Figure 3.20 The structures of rishirilide B, rishi1a and rishi1b. Rishi1a lacks the two methyl

groups in the isobutyryl side chain of rhisirlide B, while rishi1b has one more carbon than rishi1a and

lacks one of the two methyl groups in the side chain of rishirilide B.

90 Results

357.2 [M-H]-. These two compounds were termed rishi1a (the peak at 18.2 min) and

rishi1b (the peak at 19.6 min), respectively. After cultivation in 10 L DNPM-medium

and the following purification, 3.4 mg purified rishi1a was obtained and its structure

was determined by NMR (Figure 3.20). The amount of purified rishi1b was less than

0.6 mg and elucidation of its structure by NMR was not possible. Because of their

similarity in the UV and mass spectrum, the structure of rishi1b was also proposed

(Figure 3.20).

3.4.2 Inactivation of rslO1- a luciferase-like monooxygenase gene

BLASTP analysis showed that rslO1 and rslO2 encode a Flavin-dependent monooxy-

genase and a flavin reductase, repectively. Because of their close location in the rsl-

cluster and complementary properties in flavin conversion, these two proteins were

proposed to form a two-component monooxygenase, like SnoaL2/SnoaW in the

biosynthesis of nogalamycin,[173]

AlnT/AlnH from the alnumycin pathway[174]

and

ActVA-ORF5/ActVB from the actinorhodin pathway.[175]

These two-component

monooxygenases are responsible for the introduction of an oxygen atom into the

aromatic polyketides.

In this thesis, rslO1 was deleted in cos4 to yield cos4ΔrslO1. Then the rslO1 deleted

cosmid was introduced into S. albus to obtain S. albus:: cos4ΔrslO1. After

verification by colony PCR, S. albus::cos4ΔrslO1 was cultivated in DNPM medium

and its raw extract was analyzed by LC/MS (Figure 3.21). In the LC/MS

chromatography of the raw extract from S. albus::cos4ΔrslO1, the peaks at 26.9 min

and at 31.6 min were intriguing. The two peaks were absent in the raw extract of S.

albus::cos4 and showed similar mass spectra to rishirilide B. According to the time of

purification, these two compounds were termed rishi2a (31.6 min) and rishi2b (26.9

min), respectively.

In order to elucidate the structures of these two compounds, S. albus::cos4ΔrslO1 was

cultured in 6 L DNPM-medium and the raw extracts was purified by the combination

Results 91

Figure 3.21 The LC/MS (λ = 254 nm) chromatography of S. albus::cos4ΔrslO1 compared with S.

albus::cos4. Above: Raw extract from S. albus::cos4 ΔrslO1 and S. albus::cos4. A: The UV and mass

spectrum of rishi2b. B: The UV and mass spectrum of rishi2a. The mass spectra were measured by ESI

in the negative mode.

of solide phase extract (SPE), silica gel column chromatography, preparative TLC and

column chromatography with Sephadex LH20. Finally, 4 mg of rishiri2a and 3.4 mg

of rishi2b were obtained and analyzed by NMR and MS. Their structures were

elucidated based on the NMR data (Table 3-5 and Table 3-6, respectively).

Interestingly, the structures of rishi2a and rishi2b differ significantly from that of

rishirilide B. In rishiri2a and rishi2b, there are only two side chains attached to the

aromatic ring, while in rishirilide B, three groups are connected to the aromatic ring.

The total number of carbon atoms in the two derivatives is the same as that in

92 Results

rishirlide. Therefore, a carbon-carbon rearrangement reaction was proposed to occur

during the biosynthesis of rishirides.


13C NMR data of Rishi2a

Position 1H ppm J

13C HMBC correlations

1 2,38 s 20,3 with C-2, C-3, C-15

2 145,5

3 7,69 s 122,3 with C-13, C-5, C-4

4 137,4

5 181,5

6 133,1

7 7,85 dd 11.4, 1.8 120,3 with C-11, C-5, C-9

8 7,73 dd 11.4, 11.4 137,7 with C-6, C-10

9 7,32 dd 11.4, 1.8 124,9 with C-7, C-11

10 162,7

11 115,9

12 192,7

13 114,2

14 159,4

15 136,7

16 205,8

17 2,88 m 42,5 with C-16, C-18, C-19

18 1,63 m 32,2 with C-17, C-19, C-20/21

19 1,64 m 27,8

20 0,94 d 7,2 22,5 with C-18, C-19

21 0,94 d 7,2 22,5 with C-18, C-19

OH-C-10 12,02 s withC-9, C-10, C-11

OH-C-14 with C-13, C-14, C-15

Figure 3.22 The structures of rishi2a and rishi2b.

Results 93


13C NMR data of rishi2b

3.4.3 Inactivation of rslO6- a luciferase-like monooxygenase gene

In this thesis, rslO6 in cos4 was deleted by Red/ET recombination to generate the

mutant cosmid cos4ΔrslO6 and then this cosmid was introduced into S. albus to

obtain S. albus::cos4ΔrslO6. The raw extract of S. albus::cos4ΔrslO6 in the DNPM

medium was analyzed by LC/MS. Unexpectedly, the peak for rishirilide B could also

be seen in the culture from S. albus::cos4ΔrslO6. Actually, the yield of rishirilide B

production in the rslO6 mutant was almost the same as that in S. albus::cos4 (Figure

3.23).

Position 1H ppm J

13C HMBC correlations

1 3.75 s 63.0 with C-2, C-3, C-15

2 141.3

3 7,77 s 122,5 with C-5, C-13, C-15

4 137,8

5 181,0

6 133,4

7 7,85 dd 12.6, 1.2 120,5 with C-5, C-6, C-9

8 7,71 dd 12.6, 12.6 137,8 with C-6, C-10

9 7,33 dd 12.6, 1.8 125.1 with C-7, C-10, C-11

10 162,8

11 115,8

12 192,8

13 115,5

14 160,3

15 135.8

16 206.5*

17 3,00 m 42,4

18 1,62 m 32,4

19 1,64 m 27,8

20 0,93 d 7,2 22,5 with C-18, C-19

21 0,93 d 7,2 22,5 with C-18, C-19

OH-C-10 11,90 s with C-9, C-10, C-11

OH-C-14 12,55 s with C-13, C-14, C-15

* data obtained indirectly from HMBC.

94 Results

Figure 3.23 LC/MS profiles of the raw extracts from S. albus::cos4ΔrslO6 and S. albus::cos4.

λ=254 nm.

3.5 Expression of RslK4 in E. coli and S. lividans

To reveal the mechanism for the selection of the starter unit in rishirilide biosynthesis,

expression and crystallization of the priming ketosynthase, RslK4, was carried out.

For RslK4 expression in E. coli, the 1.3 kb PCR product of rslK4 was inserted into the

expression vector pET-28a(+), with an N-terminal 6×-His tag. Then the plasmid was

transformed into BL21/pLysS. SDS-PAGE results showed that in the lane for

insoluble proteins there was a strong band with the size of 37 kD, but in the lane for

supernatant there was only a very weak band with the size of about 37 kD. Western

blotting and mass spectrum detection of the 37 kD bands in both the soluble and

insoluble fractions showed that the protein in these band were not RslK4. Because

RslK4 was predicted to be insoluble in E. coli,[176]

the rslO4 gene was also cloned into

a high copy number Streptomyces expression vector pUWL-A-ermE* and expressed

in S. lividans 1326, however, no production of the recombinant protein was detected.

Results 95

3.6 Investigation of the rishirilide regulators

Plenty of SARP-encoding genes have been found by sequence analysis of secondary

metabolites biosynthesis gene clusters, and in the majority of cases, these clusters

contain only one SARP-encoding gene. Some clusters, such as the aclacinomycin

cluster,[142]

the griseorhodin biosynthesis cluster[151]

and the pristinamycin gene

cluster and,[177]

harbor more than one SARP-encoding gene. In S. fradiae, the tylosin

biosynthesis gene cluster contains five regulatory genes (tylP, tylQ, tylR, tylS and

tylT).[178]

Among them, two are SARP-encoding genes (tylS and tylR). It was shown

that TylS was essential for tylosin production but TylT was not. In the rishirilide

biosynthesis gene cluster, the relationship among the four regulatory proteins is

intriguing.

3.6.1 Overexpression of the regulatory genes

In order to check the influence of the regulators on the production of rishirilide B, the

four regulatory genes (rslR1-R4) were amplified by PCR, cloned into pUWL-H vector

and overexpressed in S. albus::cos4. The resulting strains were cultivated in 100 mL

HA-medium for 5 days and extracted twice with equal volume of ethyl acetate. Then

the raw extracts were dried and dissolved in 1 mL methanol. Finally 15 μL of each

solution was analyzed by LC/MS (Figure 3.24).

It can be seen from the chromatography that there was no obvious difference in the

production of rishirilide B in the stains that overexpress rslR1 or rslR4, but the yields

of rishirlide B were much higher in the strains that overpress rslR2 or rslR3 than the

strains with rslR1 or rslR4 overexpression. The amount of rishirilide B in the strain

that coexpresses rslR1R2R3 was similar to the strains that ovexpress rslR2 or rslR3.

Interestingly, three new peaks can also be seen in the strains in which rslR2 or rslR3

was overexpressed. All these peaks have similar UV spectrum as rishirilide B. The

peak at 18.3 min ([M-H]- = 387.3) shows the same mass, but different UV spectrum,

as rishirlide A. The peak at 19.7 min and 21.8 min show the M/Z value of 358.2 and

96 Results

386.3, respectively, which are 14 Dalton smaller or bigger than rishirilide B. Because

of their similarities in UV and mass spectrum, these peaks were proposed to be

rishirlide B related compounds.

Figure 3.24 LC/MS profiles of the raw extracts from S. albus::cos4 with the overexpressed

regulators and the UV and mass spectra of the new peaks in figure B and C. λ=254 nm. A:

overpression of rslR1; B: overpression of rslR2; C: overpression of rslR3; D: overpression of rslR1,

rslR2 and rslR3 in one plasmid; E: overpression of rslR4. F: the UV spectra of the peaks at 18.3 min,

19.6 min, 20.7 min (rishirilide B) and 21.8 min in figure B. G: The m/z value of the peak at 18.3 min;

H: The m/z value of the peak at 19.7 min; I: The m/z value of the peak at 20.7 min (rishirilide B); J:

The m/z value of the peak at 21.8 min; All the mass data were measured by ESI in the genative mode.

Results 97

3.6.2 Investigation of the regulatory hierarchy amongst the

regulators

Myronovskyi et al. reported a sensitive reporter system for actinomycetes that is

based on gusA, which encodes the β-glucuronidase enzyme.[88]

Several vectors for

transcriptional and translational fusion were constructed to investigate the regulatory

cascade of the phenalinolactone biosynthetic gene cluster in his paper. In order to

study the relationship amongst the regulators in the rsl-cluster, plasmid pGUS, a

promoter-probe vector based on the integrative plasmid pSET152, was used to

perform the transcriptional fusion analysis of the promoter regions of the regulators

and the gusA gene (Figure 3.25).

Figure 3.25 Schematic for the regulatoion of the promoter region (PR) of gene B by regulator A

using transcriptional fusion analysis. A fragment of about 500 bp unstream the gene B, which

propably contains the promoter of the aim gene (gene B), was amplified by PCR and cloned into the

XbaI + KpnI site of pGUS, to obtain plasmid pGUS-PR-B. On the other hand, the putative regulator

gene (gene A) was amplified and cloned into a replicative plasmid pUWL-H, to generated plasmid

pUWL-H-A. Then these two plasmids were introduced into S. albus wild-type by intergeneric

conjugation. The exconjugants were cultivated on the HA plates for 24 h, then overlaid with 1 mL 1

mM X-Gluc and incubated at 28 ℃ overnight. If regulator A indeed regulates the promoter of gene B,

the gusA gene downstream the promoter region of gene B will be trancripted and the resulting

β-glucuronidase activity will convert the colorless X-Gluc to blue. If A does not regulate the promoter

of gene B, the gusA will not be transcripted, therefore, no blue color can be seen on the HA plate

overlaid with X-Gluc.

98 Results

In order to study the relationship among rslR1-R4, the regulatory genes themselves

and their respective promoter regions were cloned into pUWL-H and into pGUS, to

generate expression plasmids pUWL-H-rslR1, pUWL-H-rslR2, pUWL-H-rslR3,

pUWL-H-rslR4, and transcriptional fusion plasmids pGUS-PR-rslR1, pGUS-PR-

rslR2, pGUS-PR-rslR3, pGUS-PR-rslR4, respectively. Then the pGUS-derived

transcriptional fusion plasmids were firstly introduced into S. albus wild-type by

conjugation. After verification of the integration of these plasmids by colony PCR, the

pGUS-integrated strains were conjugated a second time with the pUWL-H-based

expression plasmids. For negative control, pUWL-H was introduced into S. albus WT

or into S. albus contains gusA-harboring plasmids. Finally 25 different strains were

obtained and each strain contains both one integrative plasmid and one replicative

plasmid. Then the β-glucuronidase activities in these strains were indicated by the

color of the strains after overlaid with X-Gluc (Table 3-7 and Figure 3.26). In attempt to

check the reason behind the very often irreproducibility of rishirlides in S. bottropensis,

the five gusA gene harboring plasmids were also introduced into the native producer of

rishirilides, to study the level of transcription of the regulatory genes in the rsl-cluster.

Table 3-7. The GUS activities of the S. albus strains contain both the pGUS-based transcription

fusion plasmids and the pUWL-H-based plasmids for the expression of the regulatory genes.

GUS activity pUWL-H-rslR1 pUWL-H-rslR2 pUWL-H-rslR3 pUWL-H-rslR4 pUWL-H

PR-rslR1 - - - + -

PR-rslR2 - - + - -

PR-rslR3 + + + + +

PR-rslR4 + + + + +

pGUS - - - - -

It can be seen from the below figure that the promoters for rslR3 and rslR4 were

always active, whether the regulatory genes were expressed or not. In the cases of

risR1 and rslR2, the results are different. The promoter for rslR1 is active only when

rslR4 is expressed, while the promoter for rslR2 is active only when rslR3 is

expressed. These results implied that rslR3 and rslR4 were probably in the higher

Results 99

Figure 3.26 Colonies of S. albus and S. bottropensis strains overlaid with X-Gluc solution. Blue

halos are 5,5’-dibromo-4,4’-dichloro-indigo, formed by the β-glucuronidase activity. Gus means the

pGUS empty vector, PR-1 means strains contain the plasmid harboring the promoter region (PR) of

rslR1. The plate labelled with pUWL-H-rslR1 means all the five S. albus strains on the plate contain

the plasmid pUWL-H- rslR1.

hierarchy of the regulatory cascade, while rslR1 and rslR2, the two SARP regulators,

were in the lower level for the regulation. However, so far it is not clear whether rslR3

and rslR4 are pleiotropic regulators or pathway-specific regulatory proteins. Further

studies with reverse trancription PCR of specific genes and mutanenesis analysis of

these regulatory genes might be possible to elucidate the relationship amongst these

four regulators.

Discussion 101

4. Discussion

4.1 Biosynthesis of ganefromycin

4.1.1 Sequencing and analysis of the ganefromycin biosynthetic

gene cluster

The complete sequence of the putative ganefromycin biosynthetic gene cluster was

obtained by the contig of five sequential cosmids screened from the cosmid library of

S. lydicus ssp. tanzanius. Analysis of the DNA sequence by Softberry and BLASTP

revealed that the putative gan-cluster spans 89,281 bp and consists of 26 ORFs. The

putative functions of proteins encoded by these ORFs were assigned based on their

conserved domains and similarities to other characterized proteins. Disruption of

ganAIV with pKC-GanAIVEP by homologous recombination led to the abolishment

of ganefromycin production, uniequivocally proving that the putative gan-cluster is

responsible for the biosynthesis of ganefromycins.

Interestingly, ganefromycins and kirromycin are similar not only in their chemical

structures, but also in the organization of the modules in their type I PKSs. Based on

the arrangement of the type I PKS modules, a putative pathway for the biosynthesis of

ganefromycin polyketide can be proposed. Alignment analysis of the elongation

factor Tu in the gan-cluster (GanF) with other elfamycin family antibiotic-resistance

determinants showed that GanF contains all the key residues conferring the resistance

to elfamycin family antibiotics, therefore, it was proposed to be responsible for the

self-resistance of S. lydicus to ganefromycins.

The origin of the phenyl acetic acid group attached at C-23 or C-24 of ganefromycins

is also an attractive topic. No possible enzymes for the biosynthesis of phenylacetate

were found in the gan-cluster; therefore it is possibly derived from other pathways.

Because there are three acyltransferases (GanAT1, GanAT2 and GanAT3) in the

gan-cluster and only two ATs in the kirromycin biosynthetic gene cluster, GanAT3,

102 Discussion

which shows no obvious similarity to the two ATs from the kirromycin pathway, was

proposed to be responsible for the selection and transfer of phenylacetate-CoA to

C-23 or C-24 of ganefromycin polyketide skeleton. In order to test this hypothesis,

ganAT3 was cloned and heterologously expressed in S. collinus Tue365, the

kirromycin producer; however, no difference was observed from the raw extract of S.

collinus wild type and S. collinus×ganAT3.

4.1.2 Biosynthesis of the ganefromycin polyketide chain

Analysis of the six type I PKSs SEARCHPKS in the gan-cluster revealed the

existence of 15 continuous modules in these enzymes. By comparing these modules

with the modules in the type I PKSs from kirromycin pathway, a putative pathway for

the biosynthesis of the ganefromycin polyketide chain could be proposed (Figure 4.1).

Although this prediction fits quite well to ganefromycin polyketide chain in the numer

of carbons and carbon-carbon double bonds, some details such as the stereochemistry

of the hydroxyl groups, the selection of the still unknown starter unit and extender

units are still not clear.

After the condensation reactions catalyzed by the six type I PKSs and NRPS/PKS

proteins, the nascent polyketide chain was methylated at C-13 by the O-methyl

transferase GanM, and oxidized by two cytochrome-P450 oxidoreductases (GanO1

and GanO2). GanO1 and GanO2 possess 49% and 41% identities to KirOII and KirOI

from kirromycin pathway, respectively. Based on their putative functions, they were

proposed to be responsible for the formation of the tetrahydrofuran ring[81]

and the

sugar-like C-22/C-26 ring structure. Further experiments by deletion or replacement

of the modules or proteins for the polyketide e biosynthesis might be able to elucidate

the mechanism behind the formation of this polyketide structure

Discussion 103

Figure 4.1 Hypothetical biosynthetic pathway for the ganefromycin polyketide. A:adenylation

domain; ACP: acyl carrier protein; AT: acyltransferase domain; C: condensation domain; DH:

dehydratase domain; ER: enoyl reductase domain; KR: keto reductase domain; KS: keto synthase

doamin; MT: methyl transferase domain; PCP: peptidyl carrier protein; X: domain with unknown

function. The function of the last module in GanAI is not known. Except the modules in GanAI, no AT

domains were found in the the other modules, and the functions of their AT domains were

complemented by the two independent ATs (GanAT1 and GanAT2).

104 Discussion

4.1.3 Biosynthesis and attachment of the three deoxy sugars

There are 7 deoxy sugar biosynthetic genes and two glycosyltransferases in the

gan-cluster, which are responsible for the biosynthesis and the attachment of the two

L-oleandroses (sugar 1 and 3) and one L-cymarose (sugar 2) to the polyketide chain

of ganefromycins. L-oleandrose and L-cymarose are both 2,6-dideoxy-3-O-methyl-

hexoses, differing only in the position of 3-O-methyl. L-oleandrose is a common

deoxy sugar in natural products, such as oleandomyin, avermectin,[179]

while

L-cymarose is not frequently found in bioactive compounds. To our knowledge,

L-cymarose was only found in heliquinomycin, an antibiotic of the rubromycins

family (Figure 4.2).[180]

In the characterization of the sugars in oleandomycin

produced by S. antibioticus, Salas et al. presented the putative pathway from glucose

-1-phosphate to L-oleandrose.[181]

Hutchinson and coworkers also proposed a pathway

for the biosynthesis of L-oleandrose in avermectin.[179]

The difference between the

Hutchinson pathway and the Salas pathway is the step of 4-ketoreduction. GanS3, the

putative 4-ketoreductase in the gan-cluster, showed higher similarity to the

4-ketoreductase (avrE) in the avermection biosynthetic gene cluster. Therefore, the

4-ketoreduction in the biosynthesis of L-oleandrose in ganefromycins was proposed to

Figure 4.2 Structures of Avermectin A1a, Heliquinomycin andOleandomycin.

Discussion 105

occur in the late stage of the sugar biosynthesis, like the biosynthesis of TDP-L-

oleandrose in the avermectin pathway.[179]

Based on the Hutchinson pathway, the

putative pathways for the biosynthesis of L-oleandrose and L-cymarose were

proposed (Figure 4.3). After their biosynthesis, L-oleandrose and L-cymarose were

attached to the ganefromycin polyketide skeleton by the two glycosyltransferases

GanGT1 and GT2. Because there are two L-oleandroses, it could be proposed that one

of these two GTs catalyzes the attachment of the two glycosylation iteratively. Futher

mutagenesis or in vitro assay of these two GTs might be able to elucidate which GT

transfers L-oleandrose to the polyketide chain and catalyzes the iterative glycosylation

reaction.

Figure 4.3 Porposed pathways for the biosynthesis of L-oleandrose and L-cymarose by S. lydicus.

4.2 Heterologous production of rishirilide B in S. albus

Rishirilide A and B were firstly discovery by Fukuyama and coworkers in 1984 from

the culture broth of Streptomyces rishiriensis OFR-1056.[71]

In his PhD thesis, Arnold

Moritz reported the discovery of three CD-active secondary metabolites from the

fermentation broth of Streptomyces. bottropensis (formely termed S. sp. Gö C4/4) in

106 Discussion

2002: the antumor agent mensacarcin and its precursor didesmethylmensacarcin

(DDMM), and rishirilide A, respectively (Figure 4.4). Mensacarcin attracted most of

the attention because of its potent anticancer property.[73]

Extensive studies on the

biosynthesis of mensacarcin using isotopic labeled precursor were carried out and the

origin of the building blocks for mensacarcin were identified. However, the study on

the biosynthesis of rishirilide A and B was much surfical, which was caused mainly

by the irreproducibility of rishirlides in S. bottropensis. Because of the discovery of

bioactive mensacarcin and rishirilide A in S. bottropensis, the cosmid library of this

strain was constructed by Combinature in 2002. In the same year, screening of

cosmids harboring the mensacarcin biosynthetic cluster in the S. bottropensis cosmid

library was also conducted.

Figure 4.4 The structures of four aromatic polyketides produced by S. bottropensis.

Three different type II PKS gene cluster (msn-cluster, mec-cluster and msc-cluster)

were found by colony PCR using degenerated oligonucleotide primers for amplying

ketosynthase genes.[182]

Cos2 contains most of the genes in the msn-cluster. By

heterologous expression of cos2 in S. albus J1074, A. Linnenbrink successfully

produced didesmethylmensacarcin (DDMM), the precursor of mensacarcin, proving

that the putative msn-cluster is responsible for the biosynthesis of mensacarcin. Cos3

Discussion 107

consists of a putative spore pigment biosynthetic gene cluster (the mec-cluster), which

shows extremely high similarity (>94%) to spore pigment biosynthetic gene cluster

from Streptomyces scabies 87.22.[144]

However, no possible product of the mec-cluster

was observed from the culture broth of S. albus::cos3. A. Linnenbrink also tried to

identify the product of the msc-cluster which is located in cos4. But no product was

obtained.

In this thesis, cos4 was introduced into S. albus J1074 by intergeneric conjugation.

LC/MS analysis revealed the existence of a product with the same UV and mass

spectra as rishirilide B in the raw extract of S. albus::cos4. Measurement of the

purified product by NMR verified that this product is rishirilide B. In the broth of S.

albus::cos4, another product with the same mass as rishirlide A (m/z 388.3) was also

detected, however, the UV spectrum of the product was different from that of

rishirilide A and identical to rishirilide B. Therefore, it was proposed that this product

is an intermediate compound between rishirilide B and A. Furthermore, it was found

that the yield of rishirilide B produced by S. albus::cos4 in the DNPM-medium was

much more than that in the HA-medium. This might be attributed to the richer

nutrients and stronger buffering ability in the DNPM-medium.

4.3 Overview of key proteins involved in rishirilide

biosynthesis

4.3.1 RslK4 and RslA provide the starter unit

During the BLASTP analysis of the proteins encoded by the genes in the rsl-cluster, a

KASIII type priming ketosynthase RslK4 was discovered. RslK4 shows similarities to

a number of KS III type ketosynthases, such as AknE2 from the aclacinomycins

pathway,[142]

DpsC from the daunorubicin-doxorubicin pathway,[155]

and ZhuH from

the R1128 pathway.[157, 183]

These priming ketosynthases play crucial roles in

providing and selecting the unusual starter units, which are subsequentially

transferred to the minimal PKSs and elongated to form complete polyketide chains.

108 Discussion

Using a cell-free experiment, Mäntsälä and coworker exhibited that DpsC and DpsD

played primary roles in the selection of the starter unit and the initiation of

daunorubicin polyketide biosynthesis.[142]

In the biosynthesis of aclacinomycins, the

gene products of AknE2 and AknF also cooperated to provide the propionyl-CoA

starter unit.[184]

Because of their high similarites to AknE2 and AknF, RslK4 and RslA

are supposed to select the isobutyryl starter unit and then catalyze a condensation with

malonyl-CoA to form the 3-oxoacyl-ACP intermediate.

One of the R1128 compounds, R1128C, possesses the same isobutyryl side chain as

rishirlides (Figure 4.5). Therefore it was supposed that ZhuH and RslK4 select their

starter units in a similar mechanism. Pan et al. characterized the crystal structure of

ZhuH in 2002.[157]

It was observed that in ZhuH a primer unit acetyl-CoA was bound

in a 20 Å-long channel, which placed the acetyl starter unit against the

Cys121-His257-Asn288 catalytic traids. In the channel, the acetyl primer unit is

covalently attached to the CYS121 residue. ZhuH was proposed to be flexible to

alternative CoA-derived primer units, due to the existence of the multiple R1128

polyketide congeners. However, sequence alignment of RslK4 with ZhuH showed

that RslK4 probably does not contain the Cys-His-Asn catalytic triads. A closer

inspection of the results of the amino acid sequence alignment revealed that RslK4

features a Cys-His-Asp motif, like the catalytic triads in the primging ketosynthase

CerJ [153]

(Table 4.1).

The different substrate flexibility of ZhuH and RslK4 might to attribute to the

difference in the catalytic triads. In ZhuH, the Cys-His-Asn catalytic triads located in

the interface of the acyl group binding site and the CoA binding channel, which

determines the type of the priming acyl groups. It is proposed that in RslK4, the

interface between the CoA binding channel and the acyl group site is occupied by the

Cys-His-Asp catalytic triads, leading to the rigider acetyl substrate specificity in this

protein. Elucidation of the crystal structure of RslK4, therefore, would enable the

interpretation of the difference in the substrate specificity between RslK4 and ZhuH.

Discussion 109

Figure 4.5 Structures of aromatic polyketides with unusual starter units.

Table 4.1 Active site comparision of KS III enzymes. The catalytic residues of DpsC, ChlB3 and

RslK4 were tentatively assigned.

4.3.2 The two luciferase-like monooxygenases

In the biosynthesis of rishilide A and B, two luciferase-like monooxygenases (RslO1

and RslO6) are involved. Pair sequence alignment showed that RslO1 and RslO6 have

65% and 51% identies to MsnO2 and MsnO8, two luciferase-like monooxygenases

Protein Important residues

FabH Cys121 His274 Asn288 Ser279

CHS Cys117 His247 Asn326 Ser331

DpsC Cys109 His266 His297 Asp302

ChlB3 Cys113 Val261 His296 Asp301

CerJ Cys116 Val263 His295 Asp300

RslK4 Cys104 Val269 His293 Asp298

110 Discussion

from the mensacarcin pathway, respectively. Luciferase-like monooxygenases utilize

FMN or F420 as coenzyme for the oxidation. F420 is a deazaflavin analog of FMN,

which is distributed sparsely among prokaryotes (Figure 4.6).

Figure 4.6 Structures of FMN and F420.

Alignment of the protein sequences of RslO1 and RslO6 with other luciferase-like

monooxygeanses by Clustal-W (see 2.10) showed that the key Histidine and Arginine

residues which is important for the attachment of the coenzyme were found in both

enzymes (Figure 4.7).[92]

Sequence analysis suggests that RslO1 probably uses FMN

as coenzyme, while RslO6 utilizes F420 as coenzyme, because it belongs to the

COG2141 motif-containing family, members of which were reported to catalyze the

oxidative reactions with the help of F420. The presence of several luciferase-like

monooxygenases in one type II PKS gene cluster is quite rare in streptomycetes. Until

now only a few luciferase-like monooxygenases were reported from the secondary

metabolites biosynthetic pathways, such as MitH from the mitomycin C biosynthetic

pathway,[185]

LmbY from the lincomycin A pathway,[186]

and SnaA/SnaB (or VirN)

from the virginiamycin (pristinamycin IIA) pathway.[187]

Discussion 111

Figure 4.7 Clustal W alignment of the amino acid sequences of RslO1 and RslO6 with other

characterized luciferase-like monooxygenases from secondary metabolites biosynthetic pathways.

The Histidine and Arginine residues which are important for the binding of the coenzyme were marked

red.

During the investigation of the biosynthetic pathway for mensacarcin, K. Probst and U.

Hardter inactivated all the three luciferase-like monooxygenase genes (msnO2, msnO4

and msnO8) in the mensacarcin biosynthetic gene cluster and found that MsnO4 and

MsnO8 are responsible for the introduction of exoxy group into the atomatic polyketide

(Figure 4.8). From these results, RslO1 and RslO6 were first supposed to be involved in

the formation of epoxy-containing intermediates.

Figure 4.8 Structures of virginiamycin M, mitomycin C and lincomycin A and the proposed

functions of MsnO4 and MsnO8 in the introduction of epoxy groups to the mensacarcin

polyketide.

112 Discussion

4.3.3 Aromatization and cyclization catalyzed by the three

cyclases

After the polyketie chain extension reactions, the three Aromatase/cyclases (RslC1,

RslC2 and RslC3) catalyze the aromatization and cyclization of the nascent

polyketide chain. The homologues of RslO1 (e.g. SnoaE), RslO2 (e.g. ActIV) and

RslO3 (e.g. SnoO) were shown to be responsible for the formation of the first ring, the

Figure 4.9 Hypothetical cyclization functions of the homologues of RslO1, RslO2 and RslO3.

second ring and the fourth ring in aromatic polyketides, respectively (Figure 4.9).

Therefore, based on the functions of their homologues, RslO1, RslO2 and RslO3 were

proposed to catalyze the cyclization of the first, the second and the third ring,

respectively. In order to form the first ring in nogalamycin, the polyketide chain is

first reduced by the ketoreductase SnoaD, to form the C-9 hydroxyl group and to form

the C7-C12 ring closure. Then SnoaE catalyzes the aromatization of the C-9

hydroxyl-containing intermediate to generate the first aromatic ring. In the rsl-cluster,

rslO10 encodes a protein similar to SnoaD, implying the occurrence of C-9

hydroxylation in the biosynthesis of rishirlides. From this fact, it is proposed that

RslO10 reduces the keto- group at C9 to form the hydroxyl group and the cyclized

intermediate. Then RslC1 aromatizes the intermediate to obtain the first aromatic ring

of rishirilides.

Discussion 113

4.3.4 Regulation of rishirlide biosynthesis

Four regulators are involved in the biosynthesis of rishirilides. From the results of

transcriptional analysis of the interaction between the regulatory proteins and the

promoter regions of these regulatory genes in S. albus, transcription of the two SARP-

encoding genes (rslR1 and rslR2) were shown to be inactive, while transcription of

the LAL-family regulatory gene (rslR3) and the Mar family regulatory gene (rslR4)

were active. When rslR3 is expressed, transcription of rslR2 is activated, and rslR1

transcription is activated when rslR4 is expressed. Expression of rslR1 has no effect

on rslR2 trancription, and vice versa. It is not clear whether RslR3 or RslR4 has effect

on the transcription of rslR4 or rslR3, due to the original transcription of these two

genes in S. albus. From the above results, it is proposed that RslR3 and RslR4 occupy

higher hierarchies in the regulation cascade for rishirilides biosynthesis, while RslR1

and RslR2 are in the lower position. Like most other SARP-proteins, RslR1 and

RslR2 were proposed to function by binding to the promoters of other structural and

modification genes.

What’s more, the complicated regulation network in the rsl-cluster might account for

the irreproducibility of rishirilides in S. bottropensis. It was supposed that in S.

bottropensis there are up-level regulators which might inhibit the transcription of

rslR3 and/or rslR4, leading to the inactivation of the promoters of rlsR1 and rslR2,

and the abolishment of rishirilides production in S. bottropensis. When the rsl-cluster

was expressed in S. albus, rslR3 and rslR4 can well transcripted without the up-level

inhibitors, resulting in the steady production of rishirilides B in S. albus. Based on

these facts, a hypothetical regulatory cascade for the biosynthesis of rishirilides can be

proposed (Figure 4.10).

114 Discussion

Figure 4.10 Hypothetical transcriptional regulation network of the rsl-cluster in S. albus and S.

bottropensis.

Nevertheless, it is worth to mention that in a tentative cultivation of S. bottropensis in

the NL111 medium, production of rishirilide B was achieved. So far it is not clear the

reason behind this reproduction. Further comparison of the genome sequence of S.

albus J1074 and S. bottropensis, as well as transcriptional analysis of the genes in the

rsl-cluster might be able to explain the difference in rishirilides production between S.

albus and S. bottropensis.

4.4 Inactivation of rslK4, rslO1 and rslO6

4.4.1 Inactivation of the ketoacylsynthase gene rslK4

The ketoacylsynthases (KASIII) are crucial for providing and selecting the unusual

starter units in the biosynthesis of aromtatic polyketides. In the rsl-cluster, rslK4

encodes a KASIII similar to a series of FabH like proteins, such as DpsC, AknE2 and

BenQ from daunorubicin, aclacinomycin and benastatin biosynthetic pathways,

respectively. Benastatins A and B are inhibitors of glutathione S-transferase produced

by Streptomyces sp. MI384-DF12.[188]

Xu et al. showed that heterologous expression

of the benQ-deleted benastatin biosynthetic gene cluster in S. albus resulted in the

production of novel penta- and hexacyclic benastatin derivatives (Figure 4. 11).[189, 190]

Discussion 115

In this thesis, inactivation of rslK4 in cos4 led to the production of two novel

rishirilide B derivatives rishi1a and rishi1b. This result clearly revealed that RslK4 is

responsible for the providing and selecting of the isobutyryl side chain for rishirilides.

In the absence of RslK4, the minimal PKS recruits alternative branched and straight-

chain acyl starter units from the fatty acid biosynthesis pool, yielding rishirilide B

derivatives with three- and four-carbon side chains. The lacking of these side chains

in the presence of RslK4 indicates that the KASIII functions as a gatekeeper. When

RslK4 is expressed, it preferably selects the isobutyryl group and catalyzes the

condensation between the isobutyryl-CoA and malonyl-ACP, to form branched-chain

3-oxoisohexanoyl-ACP, which is then reduced by a 3-oxoacyl-ACP reductase

(RslO3) and other dehydratase to form isohexanoyl-CoA. Then the isohexanoyl-CoA

is accepted by the elongation enzymes.

Figure 4.11 Strucutres of benastatins A and B and the novel penta- and hexacyclic benastatin

deravatives (E-I) resulted from the BenQ-deleted mutant.[190]

4.4.2 Inactivation of rslO1 and rslO6

In order to test whether RslO1 and RslO6 are responsible for introducing epoxy

groups into the aromatic polyketide, their encoding genes were inactivated with the

help of Red/ET and the cosmid containing the resulting mutants were introduced into

116 Discussion

S. albus. Interestingly, in the rslO1 null mutant, two products with only two side

chains were isolated. Trom the point of polyketide biosynthesis, the origin of two side

chains is much easier to deduce from the PKS machinery, while the biogenesis of

three side chains on the aromatic polyketides is often difficult to predict. The

discovery of the two-side-chain derivatives from the rslO1 mutant unequivocally

deciphered the origin of the three side chains on the rishirilides polyketides, however,

a new question about how the two side chains are converted to three parts is

following. In the biosynthesis of some polyketides, such as mithramycin,[191]

methyltransferases are able to introduce a methyl group to the polyketide backbone,

however, no methyltransferase is found in the rsl-cluster.

After comparison of the difference between rishirilide B and rishiri2a, the isopentyl

side chain in rishirilide B was proposed to be formed via a Favorskii-like oxidative

rearrangement, resembling the reaction catalyzed by EncM in the biosynthesis of

enterocin.[192]

Until now only a few Favorskii-like rearrangements have been

proposed in secondary metabolic pathways based on feeding experiments. Other

examples include the aspyrone polyketide biosynthesis pathway in Aspergillus

melleus[193]

and the dinoflagellate polyether okadaic acid.[194]

EncM is a FAD-

dependent oxygenase which catalyzes the Favorskii rearrangement with the assistance

of EncK, an O-methyltransferase. Sequence alignment of RslO1 and EncM showed

that these two proteins are similar to some extent (Figure 4.12).

According to the mechanism of Favorskii rearrangement and the reaction catalyzed by

EncM, RslO1 was proposed to first introduce an oxygen atom to C-16 of the first-ring

formed rishirilide polyketide to generate a highly active intermediate, in which the

C-18 carbon atom is attached to C-15. Then a Favorskii-like rearrangement is

occurred in this intermediate and the C-18 isopentyl group was transferred to C-15, in

the mean time a carboxyl group and a hydroxyl group were formed at C-17 and C-16,

respectively, because of a Michael addition reaction between the intermediate and

water (Figure 4.13). However, it should be noticed that in a common Favorskii

rearrangement, a tri-membered ring is involved, but in proposed rishirilide

Discussion 117

rearrangement, the C-C breach happens via a four-membered ring. An in vitro assay

containing RslO1, the FMN coenzyme and the proposed substrate might be able to

make clear how the rearrangement is carried out in the biosynthesis of rishirilides.

Figure 4.12 Sequence alignment of RslO1 with EncM. The Histidine residue that was proposed to be

important for FAD binding is marked red.

118 Discussion

Figure 4.13. The proposed Favorskii-like oxidative rearrangement in the biosynthesis of

enterocin (A) and rishirilides (B).

Discussion 119

Unexpectedly, in the rslO6 deletion mutant, rishirlide B was still produced. No

obverious difference was found in the yield of rishirilide B produced by S. albus::cos4

and S. albus::cos4ΔrslO6. This result suggests that RslO6, a hypothetical

F420-utilizing luciferase-like monooxygenase, might be involved in the conversion of

rishirilide B to rishirilide A. Comparison of the composition of these two compounds

shows that rishirilide A harbors one more oxygen atom, implying the function of

RslO6 in introducing an oxygen atom. Because MsnO8, the protein with the highest

similarity to RslO6, introduces an epoxy group to the aromatic polyketide of

mensacarcin,[135]

therefore, RslO6 was proposed to introduce an oxygen atom to

rishirilide B to form an epoxy group. Actually, in the raw xtract of S. albus::cos4, a

peak with the same UV spectrum as rishirilide B and with the mass of 388.3 can be

seen. But the attempt to purify this compound was failed, maybe because of the

instability of the product. Then this putative epoxy group is proposed to be attacked

by the C-16 carboxyl group spontaneously or assisted by the putative hydrolase RslH,

to form a lactone structure (Figure 4.14). The currently ongoing experiments of

overexpressing rslO6 and rslH in S .albus::cos4 might be able to verify this

hypothesis.

Figure 4.14 Hypothetical biosynthetic pathway from rishirilide B to rishirilide A.

4.5 Proposed biosynthetic pathway to rishirilide A

Although rishirlide A and B are not able to be steadily produced by S. bottropensis,

their native producer, heterlogous expression of the rsl-cluster in S. albus led to

constant and high efficient production of rishirilide B. When the three regulators

120 Discussion

RslR1R2R3 were overexpressed in S. albus::cos4, the production of rishirilide B was

increased threefold. Twenty-eight genes involved in rishirilides biosynthesis were

identified. Their putative functions were assigned based on homology with other

genes from aromatic polyketide biosynthesis gene clusters. Among them, three

intriguing genes were inactivated using Red/ET recombination and four novel

rishirilide B derivatives were obtained and structurally characterized. The regulatory

cascade among the four transcriptional activators were investigated using gusA gene

as a reporter. Based on the results from protein sequence comparison, gene

inactivations and transcription fusion analysis, a biosynthetic pathway for rishirilides

can be proposed.

The polyketide backbone of rishirilides is presumably primed by isobutyryl-CoA,

which is probably derived from the branched-chain amind acid L-valine.[195]

Together

with an acyltransferase (RslA), a 3-oxoacyl-ACP reductase (RslO3), as well as an

ACP, a dehydratase and an enoylreductase from the bacterial fatty acid biosynthesis

pathway, RslK4 is predicted to generate an ACP-bound intermediate (isohexonyl-

ACP). This intermediate is then transferred to the KSα/KSβ heterodimer (encoded by

RslK1 and RslK2). Together with an ACP (encoded by RslK3) and a malonyl-CoA:

ACP malonyltransferase (MAT) from the bacterial fatty acid synthase, the PKSs

catalyzed eight extension reactions to generate the full-length polyketide chain. This

reactive polyketide chain is firstly reduced by a C-9 reductase (RslO10) to produce

C-9 hydroxylated intermediate, which undergoes a C7-C12 ring closure and then

aromatized by an aromatase (RslC1) to form the first aromatic ring. Then a Favorskii-

like rearrangement, which is catalyzed by a luciferase-like monooxygenase RslO1 and

a FMN reductase (RslO2), is occurred to yield a polyketide molecule with three side

chains. The second and the third cyclizations leading to the formation of the

anthracene core of rishirilides are presumably catalyzed by RslC2 and RslC3,

respectively. Then the aromatic polyketide is tailored by the various oxidoreductases,

such as RslO4, RslO7, RslO8 and RslO9, to form rishirilide B (Figure 4.15).

Discussion 121

The biosynthetic pathway from rishirilide B to rishirilide A is presumably happened

in two steps. Firstly, RslO6, another luciferase-like monooxygenase, putatively

catalyzes the incorporatin of an oxygen atom to rishirilide B to yield an epoxidized

intermediate. Secondly, the intermediate undergoes a lactonization spontaneously or

assisted by RslH, to generate rishirilide A. The ongoing experiments in feeding

isotopically labeled acetate and in activation of the tailoring genes in the rsl-cluster

would be of great help to decipher the biosynthesis pathway of these two α2-

macroglobulin inhibitors.

Figure 4.15 Proposed biosynthetic pathway for rishirilide A and B.

References 123

5. References

[1] R. Verpoorte, in Comprehensive Natural Products II: Chemistry and Biology, Vol. 3

(Eds.: L. Mander, H. W. Liu), Elsevier Science Ltd., Amsterdam, 1999.

[2] N. R Farnsworth, O. Akerele, A. S. Bingel, D. D. Soejarto, Z. Guo. Medicinal plants

in therapy. Bull. WHO. 1985, 63, 965-981.

[3] A. Raja, P. Prabakarana. Actinomycetes and Drug- A review. Am. J. Drug. Dis. Dev.

2011, 1, 75-84.

[4] S. B. Singh, F. Pelaez, F. Petersen, R. Amstutz, in Prog. Drug Res., Vol. 1 (Ed.: E.

Jucker), Birkhäuser Basel, Basel, 2008, pp. 141-174.

[5] C. W. Murray, D. C. Rees. The rise of fragment-based drug discovery. Nat. Chem.

2009, 1, 187-192.

[6] M. S. Butler. Natural products to drugs: natural product-derived compounds in

clinical trials. Nat. Prod. Rep. 2008, 25, 475-516.

[7] D. J. Newman, G. M. Cragg. Natural Products as Sources of New Drugs over the Last

25 Years. J. Nat. Prod. 2007, 70, 461-477.

[8] D. H. Kwan, F. Schulz. The Stereochemistry of Complex Polyketide Biosynthesis by

Modular Polyketide Synthases. Molecules 2011, 16, 6092-6115.

[9] B. J. Rawlings. Biosynthesis of polyketides. Nat. Prod. Rep. 1997, 14, 523-556.

[10] B. Shen. Biosynthesis of Aromatic Polyketides. Top. Curr. Chem. 2000, 209, 1-51.

[11] C. Hertweck, A. Luzhetskyy, Y. Rebets, A. Bechthold. Type II polyketide synthases:

gaining a deeper insight into enzymatic teamwork. Nat. Prod. Rep. 2007, 24,

162-190.

[12] J. Staunton, K. J. Weissman. Polyketide biosynthesis: a millennium review. Nat. Prod.

Rep. 2001, 18, 380-416.

[13] D. E. Cane, C. T. Walsh, C. Khosla. Harnessing the Biosynthetic Code:

Combinations, Permutations, and Mutations. Science 1998, 282, 63-68.

[14] G. Yadav, R. S. Gokhale, D. Mohanty. Towards Prediction of Metabolic Products of

Polyketide Synthases: An In Silico Analysis. PLoS Comput. Biol. 2009, 5, e1000351.

[15] J. Cortes, S. F. Haydock, G. A. Roberts, D. J. Bevitt, P. F. Leadlay. An unusually

large multifunctional polypeptide in the erythromycin-producing polyketide synthase

of Saccharopolyspora erythraea. Nature 1990, 348, 176-178.

[16] Y. Xue, L. Zhao, H.-w. Liu, D. H. Sherman. A gene cluster for macrolide antibiotic

biosynthesis in Streptomyces venezuelae: Architecture of metabolic diversity. Proc.

Natl. Acad. Sci. U. S. A. 1998, 95, 12111-12116.

124 References

[17] A. R. Gandecha, S. L. Large, E. Cundliffe. Analysis of four tylosin biosynthetic genes

from the tylLM region of the Streptomyces fradiae genome. Gene 1997, 184,

197-203.

[18] E. Rodriguez, H. G. Menzella, H. Gramajo, in Complex Enzymes in Microbial

Natural Product Biosynthesis, Part B: Polyketides, Aminocoumarins and

Carbohydrates, Vol. 459, 2009, pp. 339-365.

[19] S. Wattanachaisaereekul, A. E. Lantz, M. L. Nielsen, J. Nielsen. Production of the

polyketide 6-MSA in yeast engineered for increased malonyl-CoA supply. Metab.

Eng. 2008, 10, 246-254.

[20] J. Kennedy, K. Auclair, S. G. Kendrew, C. Park, J. C. Vederas, C. R. Hutchinson.

Modulation of Polyketide Synthase Activity by Accessory Proteins During Lovastatin

Biosynthesis. Science 1999, 284, 1368-1372.

[21] A. Sandmann, J. S. Dickschat, H. Jenke-Kodama, B. Kunze, E. Dittmann, R. Müller.

A Type II Polyketide Synthase from the Gram-Negative Bacterium Stigmatella

aurantiaca is Involved in Aurachin Alkaloid Biosynthesis. Angew. Chem. Int. Edit.

2007, 46, 2712-2716.

[22] A. C. Price, C. O. Rock, S. W. White. The 1.3-Angstrom-Resolution Crystal

Structure of β-Ketoacyl-Acyl Carrier Protein Synthase II from Streptococcus

pneumoniae. J. Bacteriol. 2003, 185, 4136-4143.

[23] C. Bisang, P. F. Long, J. Cortes, J. Westcott, J. Crosby, A.-L. Matharu, R. J. Cox, T. J.

Simpson, J. Staunton, P. F. Leadlay. A chain initiation factor common to both

modular and aromatic polyketide synthases. Nature 1999, 401, 502-505.

[24] R. McDaniel, S. Ebert-Khosla, D. A. Hopwood, C. Khosla. Rational design of

aromatic polyketide natural products by recombinant assembly of enzymatic subunits.

Nature 1995, 375, 549-554.

[25] K. K. Burson, C. Khosla. Dissecting the Chain Length Specificity in Bacterial

Aromatic Polyketide Synthases using Chimeric Genes. Tetrahedron 2000, 56,

9401-9408.

[26] A.-L. Matharu, R. J. Cox, J. Crosby, K. J. Byrom, T. J. Simpson. MCAT is not

required for in vitro polyketide synthesis in a minimal actinorhodin polyketide

synthase from Streptomyces coelicolor. Chem. Biol. 1998, 5, 699-711.

[27] A. T. Keatinge-Clay, D. A. Maltby, K. F. Medzihradszky, C. Khosla, R. M. Stroud.

An antibiotic factory caught in action. Nat. Struct. Mol. Biol. 2004, 11, 888-893.

[28] K. Herold, F. A. Gollmick, I. Groth, M. Roth, K.-D. Menzel, U. Möllmann, U. Gräfe,

C. Hertweck. Cervimycin A–D: A Polyketide Glycoside Complex from a Cave

Bacterium Can Defeat Vancomycin Resistance. Chem. -Eur. J. 2005, 11, 5523-5530.

References 125

[29] Y. Shen, P. Yoon, T.-W. Yu, H. G. Floss, D. Hopwood, B. S. Moore. Ectopic

expression of the minimal whiE polyketide synthase generates a library of aromatic

polyketides of diverse sizes and shapes. Proc. Natl. Acad. Sci. U. S. A. 1999, 96,

3622-3627.

[30] H. Petkovic, A. Thamchaipenet, L.-H. Zhou, D. Hranueli, P. Raspor, P. G. Waterman,

I. S. Hunter. Disruption of an Aromatase/Cyclase from the Oxytetracycline Gene

Cluster of Streptomyces rimosus Results in Production of Novel Polyketides with

Shorter Chain Lengths. J. Biol. Chem. 1999, 274, 32829-32834.

[31] B. S. Moore, C. Hertweck. Biosynthesis and attachment of novel bacterial polyketide

synthase starter units. Nat. Prod. Rep. 2002, 19, 70-99.

[32] H. Fu, D. A. Hopwood, C. Khosla. Engineered biosynthesis of novel polyketides:

evidence for temporal, but not regiospecific, control of cyclization of an aromatic

polyketide precursor. Chem. Biol. 1994, 1, 205-210.

[33] B. S. Moore, J. N. Hopke. Discovery of a New Bacterial Polyketide Biosynthetic

Pathway. ChemBioChem 2001, 2, 35-38.

[34] N. Funa, Y. Ohnishi, I. Fujii, M. Shibuya, Y. Ebizuka, S. Horinouchi. A new pathway

for polyketide synthesis in microorganisms. Nature 1999, 400, 897-899.

[35] M. G. Bangera, L. S. Thomashow. Identification and Characterization of a Gene

Cluster for Synthesis of the Polyketide Antibiotic 2,4-Diacetylphloroglucinol from

Pseudomonas fluorescens Q2-87. J. Bacteriol. 1999, 181, 3155-3163.

[36] Y. Seshime, P. R. Juvvadi, K. Kitamoto, Y. Ebizuka, T. Nonaka, I. Fujii. Aspergillus

oryzae type III polyketide synthase CsyA is involved in the biosynthesis of

3,5-dihydroxybenzoic acid. Bioorg. Med. Chem. Lett. 2010, 20, 4785-4788.

[37] U. Rix, C. Fischer, L. L. Remsing, J. Rohr. Modification of post-PKS tailoring steps

through combinatorial biosynthesis. Nat. Prod. Rep. 2002, 19, 542-580.

[38] C. Olano, C. Mendez, J. A. Salas. Post-PKS tailoring steps in natural

product-producing actinomycetes from the perspective of combinatorial biosynthesis.

Nat. Prod. Rep. 2010, 27, 571-616.

[39] C. T. Walsh, Y. C. J. Chen. Enzymic Baeyer–Villiger Oxidations by

Flavin-Dependent Monooxygenases. Angew. Chem. Int. Edit. 1988, 27, 333-343.

[40] W. J. H. van Berkel, N. M. Kamerbeek, M. W. Fraaije. Flavoprotein

monooxygenases, a diverse class of oxidative biocatalysts. J. Biotech. 2006, 124,

670-689.

[41] S. Fetzner, R. Steiner. Cofactor-independent oxidases and oxygenases. Appl.

Microbiol. Biotech. 2010, 86, 791-804.

126 References

[42] B. Shen, C. R. Hutchinson. Tetracenomycin F1 monooxygenase: Oxidation of a

naphthacenone to a naphthacenequinone in the biosynthesis of tetracenomycin C in

Streptomyces glaucescens. Biochemistry 1993, 32, 6656-6663.

[43] S. Fetzner. Oxygenases without requirement for cofactors or metal ions. Appl.

Microbiol. Biotech. 2002, 60, 243-257.

[44] J. L. Caballero, E. Martinez, F. Malpartida, D. A. Hopwood. Organisation and

functions of the actV A region of the actinorhodin biosynthetic gene cluster of

Streptomyces coelicolor. Mol. Gen. Genet. 1991, 230, 401-412.

[45] K. Räty, T. Kunnari, J. Hakala, P. Mäntsälä, K. Ylihonko. A gene cluster from

Streptomyces galilaeus involved in glycosylation of aclarubicin Mol. Gen. Genet.

2000, 264, 164-172.

[46] K. Ylihonko, J. Tuikkanen, S. Jussila, L. Cong, P. Mäntsälä. A gene cluster involved

in nogalamycin biosynthesis from Streptomyces nogalater: sequence analysis and

complementation of early-block mutations in the anthracycline pathway. Mol. Gen.

Genet. 1996, 251, 113-120.

[47] A. H. Westphal, A. Matorin, M. A. Hink, J. W. Borst, W. J. H. van Berkel, A. J. W. G.

Visser. Real-time Enzyme Dynamics Illustrated with Fluorescence Spectroscopy of

p-Hydroxybenzoate Hydroxylase. J. Biol. Chem. 2006, 281, 11074-11081.

[48] Y.-H. Chen, C.-C. Wang, L. Greenwell, U. Rix, D. Hoffmeister, L. C. Vining, J. Rohr,

K.-Q. Yang. Functional Analyses of Oxygenases in Jadomycin Biosynthesis and

Identification of JadH as a Bifunctional Oxygenase/Dehydrase. J. Biol. Chem. 2005,

280, 22508-22514.

[49] B. Entsch, W. J. van Berkel. Structure and mechanism of para-hydroxybenzoate

hydroxylase. FASEB J. 1995, 9, 476-483.

[50] D. E. Torres Pazmino, H. M. Dudek, M. W. Fraaije. Baeyer-Villiger monooxy-

genases: recent advances and future challenges. Cur. Opion. Chem. Biol. 2010, 14,

138-144.

[51] M. P. Beam, M. A. Bosserman, N. Noinaj, M. Wehenkel, J. Rohr. Crystal Structure

of Baeyer-Villiger Monooxygenase MtmOIV, the Key Enzyme of the Mithramycin

Biosynthetic Pathway. Biochemistry 2009, 48, 4476-4487.

[52] U. Rix, L. L. Remsing, D. Hoffmeister, A. Bechthold, J. Rohr. Urdamycin L: A

Novel Metabolic Shunt Product that Provides Evidence for the Role of the urdM

Gene in the Urdamycin A Biosynthetic Pathway of Streptomyces fradiae TÜ 2717.

ChemBioChem 2003, 4, 109-111.

[53] U. Rix, C. Wang, Y. Chen, F. M. Lipata, L. L. Remsing Rix, L. M. Greenwell, L. C.

Vining, K. Yang, J. Rohr. The Oxidative Ring Cleavage in Jadomycin Biosynthesis:

A Multistep Oxygenation Cascade in a Biosynthetic Black Box. ChemBioChem 2005,

6, 838-845.

References 127

[54] T. Liu, C. Fischer, C. Beninga, J. Rohr. Oxidative Rearrangement Processes in the

Biosynthesis of Gilvocarcin V J. Am. Chem. Soc. 2004, 126, 12262-12263.

[55] A. H. Banskota, J. B. McAlpine, D. Sorensen, M. Aouidate, M. Piraee, A.-M. Alarco,

S. Omura, K. Shiomi, C. M. Farnet, E. Zazopoulos. Isolation and Identification of

Three New 5-Alkenyl-3,3(2H)-furanones from Two Streptomyces species using a

Genomic Screening Approach. J. Antibiot. 2006, 59, 168-176.

[56] L. Xiang, J. A. Kalaitzis, B. S. Moore. EncM, a versatile enterocin biosynthetic

enzyme involved in Favorskii oxidative rearrangement, aldol condensation, and

heterocycle-forming reactions. Proc. Natl. Acad. Sci. U. S. A. 2004, 101,

15609-15614.

[57] J. Piel, K. Hoang, B. S. Moore. Natural Metabolic Diversity Encoded by the

Enterocin Biosynthesis Gene Cluster. J. Am. Chem. Soc. 2000, 122, 5415-5416.

[58] L. M. Podust, H. Bach, Y. C. Kim, D. C. Lamb, M. Arase, D. H. Sherman, S. L.

Kelly, M. R. Waterman. Comparison of the 1.85 Å structure of CYP154A1 from

Streptomyces coelicolor A3(2) with the closely related CYP154C1 and CYPs from

antibiotic biosynthetic pathways Protein Sci. 2004, 13, 255-268.

[59] Y. J. Yoon, B. J. Beck, B. S. Kim, H.-Y. Kang, K. A. Reynolds, D. H. Sherman.

Generation of Multiple Bioactive Macrolides by Hybrid Modular Polyketide

Synthases in Streptomyces venezuelae. Chem. Biol. 2002, 9, 203-214.

[60] R. J. Walczak, M. L. Dickens, N. D. Priestley, W. R. Strohl. Purification, Properties,

and Characterization of Recombinant Streptomyces sp. Strain C5 DoxA, a

Cytochrome P-450 Catalyzing Multiple Steps in Doxorubicin Biosynthesis. J.

Bacteriol. 1999, 181, 298-304.

[61] P. Spiteller, L. Bai, G. Shang, B. J. Carroll, T.-W. Yu, H. G. Floss. The

Post-Polyketide Synthase Modification Steps in the Biosynthesis of the Antitumor

Agent Ansamitocin by Actinosynnema pretiosum. J. Am. Chem. Soc. 2003, 125,

14236-14237.

[62] T.-W. Yu, L. Bai, D. Clade, D. Hoffmann, S. Toelzer, K. Q. Trinh, J. Xu, S. J. Moss,

E. Leistner, H. G. Floss. The biosynthetic gene cluster of the maytansinoid antitumor

agent ansamitocin from Actinosynnema pretiosum. Proc. Natl. Acad. Sci. U. S. A.

2002, 99, 7968-7973.

[63] A. Wietzorrek, M. Bibb. A novel family of proteins that regulates antibiotic

production in streptomycetes appears to contain an OmpR-like DNA-binding fold.

Mol. Microbiol. 1997, 25, 1181-1184.

[64] R. P. Garg, R. J. Parry. Regulation of valanimycin biosynthesis in Streptomyces

viridifaciens: characterization of VlmI as a Streptomyces antibiotic regulatory protein

(SARP). Microbiology 2010, 156, 472-483.

128 References

[65] C. Olano, Felipe Lombó, Carmen Méndez, J. A. Salas. Improving production of

bioactive secondary metabolites in actinomycetes by metabolic engineering. Metab.

Eng. 2008, 10, 281-292.

[66] G. Blanco, E. Fernández, M. J. Fernández, A. F. Braña, U. Weissbach, E. Künzel, J.

Rohr, C. Méndez, J. A. Salas. Characterization of two glycosyltransferases involved

in early glycosylation steps during biosynthesis of the antitumor polyketide

mithramycin by Streptomyces argillaceus. Mol. Gen. Genet. 2000, 262, 991-1000.

[67] A. Tanaka, Y. Takano, Y. Ohnishi, S. Horinouchi. AfsR Recruits RNA Polymerase to

the afsS Promoter: A Model for Transcriptional Activation by SARPs. J. Mol. Biol.

2007, 369, 322-333.

[68] W. M. Maiese, M. P. Lechevalier, H. A. Lechevalier, J. Korshalla, J. Goodman, M. J.

Wildey, N. Kuck, S. D. Conner, M. Greenstein. LL-E19020α and β, animal growth

promoting antibiotics: Taxonomy, Fermentation and Biological activity. J. Antibiot.

1989, 42, 1489-1493.

[69] L. Vogeley, G. J. Palm, J. R. Mesters, R. Hilgenfeld, Vol. 276, 2001, pp.

17149-17155.

[70] G. T. Carter, D. W. Phillipson, R. R. West, D. B. Borders. Chemistry and Structure of

Ganefromycin. J. Org. Chem. 1993, 58, no-6588-6595.

[71] H. Iwaki, Y. Nakayama, M. Takahashi, S. Uetsuki, M. Kido, Y. Fukuyama.

Structures of Rishirilides A and B, alpha2-macroglobulin inhibitors produced by

Streptomyces rishiriensis OFR-1056. J. Antibiot. 1984, 37, 1091-1093.

[72] L. H. Mejorado, T. R. R. Pettus. Total Synthesis of (+)-Rishirilide B:Development

and Application of General Processes for Enantioselective Oxidative Dearomatization

of Resorcinol Derivatives. J. Am. Chem. Soc. 2006, 128, 15625-15631.

[73] M. Arnold,CD-aktive Metabolite aus Streptomyceten sowie Untersuchung der

Biosyntheseleistungen des Mensacarcin-Bildners Streptomyces sp. Gö C4/4.

Dissertation, University of Göttingen (Göttingen), 2002.

[74] D. Hanahan. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol.

1983, 166, 557-580.

[75] D. J. MacNeil, K. M. Gewain, C. L. Ruby, G. Dezeny, P. H. Gibbons, T. MacNeil.

Analysis of Streptomyces avermitilis genes required for avermectin biosynthesis

utilizing a novel integration vector. Gene 1992, 111, 61-68.

[76] E. A. Raleigh, J. Benner, F. Bloom, H. D. Braymer, E. DeCruz, K. Dharmalingam, J.

Heitman, M. Noyer Weidner, A. Piekarowicz, P. L. Kretz. Nomenclature relating to

restriction of modified DNA in Escherichia coli. J. Bacteriol. 1991, 173, 2707-2709.

[77] K. F. Chater, L. C. Wilde. Streptomyces albus G Mutants Defective in the SaZGI

Restriction-midification system. J. Gen. Microbiol. 1980, 116, 323-334.

References 129

[78] D. A. Hopwood, M. J. Bibb, K. F. Chater, T. Kieser, C. J. Bruton, H. M. Kieser, D. J.

Lydiate, C. P. Smith, J. M. Ward, H. and Schrempf. Genetic manipulation of

streptomyces: A laboratory manual., The John Innes Foundation., Norwich, 1985.

[79] Maiese WM, Lechevalier MP, Lechevalier HA, Korshalla J, Goodman J, Wildey MJ,

Kuck N, Conner SD, G. M. LL-E19020 alpha and beta, animal growth promoting

antibiotics: taxonomy, fermentation and biological activity. J. Antibiot. 1989, 42,

1489-1493.

[80] M. Arnold,CD-aktive Metabolite aus Streptomyceten sowie Untersuchung der

Biosyntheseleistungen des Mensacarcin-Bildners Streptomyces sp. Gö C4/4.

Dissertation, Georg-August-Universität zu Göttingen (Göttingen), 2002.

[81] T. Weber, K. J. Laiple, E. K. Pross, A. Textor, S. Grond, K. Welzel, S. Pelzer, A.

Vente, W. Wohlleben. Molecular Analysis of the Kirromycin Biosynthetic Gene

Cluster Revealed ?Alanine as Precursor of the Pyridone Moiety. Chem. Biol. 2008, 15,

175-188.

[82] Y. M. Zhang, J. P. P. Muyrers, J. Rientjes, F. Stewart. Phage annealing proteins

promote oligonucleotide-directed mutagenesis in Escherichia coli and mouse ES cells.

BMC Mol. Biol. 2003, 4, 1-14.

[83] R. Fellay, J. Frey, H. Krisch. Interposon mutagenesis of soil and water bacteria: a

family of DNA fragments designated for in vivo insertional mutagenesis of

Gram-negative bacteria. Gene 1987, 52, 147-154.

[84] B. Gust, G. L. Challis, K. Fowler, T. Kieser, K. F. Chater. PCR-targeted Streptomyces

gene replacement identifies a protein domain needed for biosynthesis of the

sesquiterpene soil odor geosmin. Proc. Natl. Acad. Sci. U. S. A. 2003, 100,

1541-1546.

[85] M. Bierman, R. Logan, K. O'Brien, E. T. Seno, R. N. Rao, B. E. Schoner. Plasmid

cloning vectors for the conjugal transfer of DNA from Escherichia coli to

Streptomyces spp.. Gene 1992, 116, 43-49.

[86] M. Doumith, P. Weingarten, U. F. Wehmeier, K. Salah-Bey, B. Benhamou, C.

Capdevila, J.-M. Michel, W. Piepersberg, M.-C. Raynal. Analysis of genes involved

in 6-deoxyhexose biosynthesis and transfer in Saccharopolyspora erythraea. Mol.

Gen. Genet. 2000, 264, 477-485.

[87] M. Bierman, R. Logan, K. Obrien, E. T. Seno, R. N. Rao, B. E. Schoner. Plasmid

cloning vectors for the conjugal transfer of DNA from Escherichia coli to

Streptomyces spp. Gene 1992, 116, 43-49.

[88] M. Myronovskyi, E. Welle, V. Fedorenko, A. Luzhetskyy. Beta-Glucuronidase as a

Sensitive and Versatile Reporter in Actinomycetes. Appl. Environ. Microbiol. 2011,

77, 5370-5383.

130 References

[89] O. N. Sekurova, T. Brautaset, H. Sletta, S. E. F. Borgos, M. Jakobsen, T. E. Ellingsen,

A. R. Strøm, S. Valla, S. B. Zotchev. In Vivo Analysis of the Regulatory Genes in the

Nystatin Biosynthetic Gene Cluster of Streptomyces noursei ATCC 11455 Reveals

Their Differential Control Over Antibiotic. Biosynthesis J. Bacteriol. 2004, 186,

1345-1354.

[90] C. Yanischperron, J. Vieira, J. Messing. Improved M13 phage cloning vectors and

host strains - nucleotidesequences of the M13 MP18 and PUC19 Vectors. Gene 1985,

33, 103-119.

[91] H. Weiß, Klonierung neuer Glykosyltransferasen aus Aktinomyceten sowie

Charakterisierung zweier Polyketidbiosynthesegencluster aus Streptomyces

aureofaciens Tü117 und Streptomyces lydicus ssp. tanzanius. Dissertation,

Universität Freiburg (Freiburg), 2009.

[92] A. Linnenbrink,Gewinnung glykosylierter Naturstoffe durch Biotransformation von

Saccharothrix espanaensis sowie Charakterisierung dreier Polyketidbiosynthese

gencluster aus dem Mensacarcinproduzent Streptomyces spp. Gö C4/4. Dissertation,

Universität Freiburg (Freiburg), 2009.

[93] H. C. Birnbiom, J. Doly. A rapid alkaline extraction procedure for screening

recombinant plasmid DNA. Nucl. Acids Res. 1979, 7, 1513-1523.

[94] T. Maniatis, E. Fritsch, J. Sambrook. Molecular cloning. A laboratory manual., Cold

Spring Habor, New York, 1989.

[95] S. H. Oh, K. F. Chater. Denaturation of circular or linear DNA facilitates targeted

integrative transformation of Streptomyces coelicolor A3(2): possible relevance to

other organisms. J. Bacteriol. 1997, 179, 122-127.

[96] K. A. Datsenko, B. L. Wanner. One-step inactivation of chromosomal genes in

Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U. S. A. 2000, 97,

6640-6645.

[97] T. P. Korman, J. A. Hill, T. N. Vu, S.-C. Tsai. Structural Analysis of Actinorhodin

Polyketide Ketoreductase:Cofactor Binding and Substrate Specificity. Biochemistry

2004, 43, 14529-14538.

[98] F. Flett, V. Mersinias, C. P. Smith. High efficiency intergeneric conjugal transfer of

plasmid DNA from Escherichia coli to methyl DNA-restricting streptomycetes FEMS

Microbio. Lett. 1997, 155, 223-229.

[99] U. K. Laemmli. Cleavage of Structural Proteins during the Assembly of the Head of

Bacteriophage T4 Nature 1970, 227, 680-685.

[100] F. J. Enguita, J. L. Fuente, J. F. Martín, P. Liras. An inducible expression system of

histidine-tagged proteins in Streptomyces lividans for one-step purification by Ni2+

affinity chromatography FEMS Microbiol. Lett. 1996, 137, 135-140.

References 131

[101] K. Rutherford, J. Parkhill, J. Crook, T. Horsnell, P. Rice, M. A. Rajandream, B.

Barrell. Artemis: sequence visualization and annotation Bioinformatics (Oxford,

England) 2000, 16, 944-945.

[102] J. D. Thompson, D. G. Higgins, T. J. Gibson. CLUSTAL W: improving the

sensitivity of progressive multiple sequence alignment through sequence weighting,

position-specific gap penalties and weight matrix choice Nucl. Acids Res. 1994, 22,

4673-4680.

[103] A. Marchler-Bauer, S. Lu, C. Zheng, S. H. Bryant. CDD: a Conserved Domain

Database for the functional annotation of proteins Nucl. Acids Res. 2011, 39,

D225-D229.

[104] M. Punta, P. C. Coggill, A. Bateman, R. D. Finn. The Pfam protein families database.

Nucl. Acids Res. 2012, 40, D290-D301.

[105] G. Yadav, R. S. Gokhale, D. Mohanty. SEARCHPKS: a program for detection and

analysis of polyketide synthase domains Nucl. Acids Res. 2003, 31, 3654-3658.

[106] W. He, J. Lei, Y. Liu, Y. Wang. The LuxR family members GdmRI and GdmRII are

positive regulators of geldanamycin biosynthesis Streptomyces hygroscopicus17997

Arch. Microbiol. 2008, 189, 501-510.

[107] D. L. Akey, J. D. Kittendorf, J. W. Giraldes, R. A. Fecik, D. H. Sherman, J. L. Smith.

Structural basis for macrolactonization by the pikromycin thioesterase Nat. Chem.

Biol. 2006, 2, 537-542.

[108] L. N. Olsthoorn-Tieleman, R.-J. T. S. Palstra, G. P. van Wezel, M. J. Bibb, C. W. A.

Pleij. Elongation Factor Tu3 (EF-Tu3) from the Kirromycin Producer Streptomyces

ramocissimus Is Resistant to Three Classes of EF-Tu-Specific Inhibitors. J. Bacteriol.

2007, 189, 3581-3590.

[109] S. Omura, H. Ikeda, J. Ishikawa, A. Hanamoto, C. Takahashi, M. Shinose, Y.

Takahashi, H. Horikawa, H. Nakazawa, T. Osonoe, H. Kikuchi, T. Shiba, Y. Sakaki,

M. Hattori. Genome sequence of an industrial microorganism Streptomyces

avermitilis: Deducing the ability of producing secondary metabolites. Proc. Natl.

Acad. Sci. U. S. A. 2001, 98, 12215-12220.

[110] V. Barbe, M. Bouzon, S. Mangenot, B. Badet, J. Poulain, B. Segurens, D. Vallenet, P.

Marlière, J. Weissenbach. Complete Genome Sequence of Streptomyces cattleya

NRRL 8057, a Producer of Antibiotics and Fluorometabolites. J. Bacteriol. 2011, 193,

5055-5056.

[111] J. Ahlert, E. Shepard, N. Lomovskaya, E. Zazopoulos, A. Staffa, B. O. Bachmann, K.

Huang, L. Fonstein, A. Czisny, R. E. Whitwam, C. M. Farnet, J. S. Thorson. The

Calicheamicin Gene Cluster and Its Iterative Type I Enediyne PKS Science 2002, 297,

1173-1176.

132 References

[112] Y. Ogasawara, K. Katayama, A. Minami, M. Otsuka, T. Eguchi, K. Kakinuma.

Cloning, Sequencing, and Functional Analysis of the Biosynthetic Gene Cluster of

Macrolactam Antibiotic Vicenistatin in Streptomyces halstedii. Chem. Biol. 2004, 11,

79-86.

[113] M. Daum, Peintner,I., Linnenbrink,A., Frerich,A., Weber,M.,Paululat,T. and

Bechthold,A. Organisation of the biosynthetic gene cluster and tailoring enzymes in

the biosynthesis of the tetracyclic quinone glycoside antibiotic polyketomycin.

ChemBioChem 2009, 10, 1073-1083.

[114] M. J. Smanski, Z. Yu, J. Casper, S. Lin, R. M. Peterson, Y. Chen, E.

Wendt-Pienkowski, S. R. Rajski, B. Shen. Dedicated ent-kaurene and ent-atiserene

synthases for platensimycin and platencin biosynthesis. Proc. Natl. Acad. Sci. U. S. A.

2011, 108, 13498-13503.

[115] Y. Xue, L. Zhao, H. Liu, D. H. Sherman. A gene cluster for macrolide antibiotic

biosynthesis in Streptomyces venezuelae: Architecture of metabolic diversity. Proc.

Natl. Acad. Sci. U. S. A. 1998, 95, 12111-12116.

[116] J.-y. Chung, I. Fujii, S. Harada, U. Sankawa, Y. Ebizuka. Expression, Purification,

and Characterization of AknX Anthrone Oxygenase, Which Is Involved in

Aklavinone Biosynthesis in Streptomyces galilaeus. J. Bacteriol. 2002, 184,

6115-6122.

[117] A. Ramos, F. Lombó, A. F. Braña, J. R. Rohr, C. Méndez, J. A. Salas. Biosynthesis of

elloramycin in Streptomyces olivaceus requires glycosylation by enzymes encoded

outside the aglycon cluster. Microbiology 2008, 154, 781-788.

[118] S. Torkkell, K. Ylihonko, J. Hakala, M. Skurnik, P. Mäntsälä. Characterization of

Streptomyces nogalater genes encoding enzymes involved in glycosylation steps in

nogalamycin biosynthesis. Mol. Gen. Genet. 1997, 256, 203-209.

[119] K. Machida, A. Arisawa, S. Takeda, T. Tsuchida, Y. Aritoku, M. Yoshida, H. Ikeda.

Organization of the Biosynthetic Gene Cluster for the Polyketide Antitumor

Macrolide, Pladienolide, in Streptomyces platensisMer-11107. Biosci. Biotech.

Biochem. 2008, 72, 1-7.

[120] Zirkle R., Black T.A., Gorlach J., Ligon J.M., M. I. Analysis of a 108-kb region of

the Saccharopolyspora spinosa genome covering the obscurin polyketide synthase

locus. DNA Seq. 2004, 15, 123-134.

[121] A. Rascher, Z. Hu, N. Viswanathan, A. Schirmer, R. Reid, W. C. Nierman, M. Lewis,

C. R. Hutchinson. Cloning and characterization of a gene cluster for geldanamycin

production in Streptomyces hygroscopicus NRRL 3602 FEMS Microbiol. Lett. 2003,

218, 223-230.

References 133

[122] T.-W. Yu, R. Müller, M. Müller, X. Zhang, G. Draeger, C.-G. Kim, E. Leistner, H. G.

Floss. Mutational Analysis and Reconstituted Expression of the Biosynthetic Genes

Involved in the Formation of 3-Amino-5-hydroxybenzoic Acid, the Starter Unit of

Rifamycin Biosynthesis in Amycolatopsis mediterranei S699. J. Biol. Chem. 2001,

276, 12546-12555.

[123] K. Mikulik, E. Zhulanova. Sequencing of the tuf1 Gene and the Phosphorylation

Pattern of EF-Tu1 during Development and Differentiation in Streptomyces collinus

Producing Kirromycin. Biochem. Biophys. Res. 1995, 213, 454-461.

[124] F. Wright, M. J. Bibb. Codon usage in the G+C-rich Streptomyces genome Gene

1992, 113, 55-65.

[125] W. Boos, H. Shuman. Maltose/maltodextrin system of Escherichia coli: transport,

metabolism, and regulation. Microbiol. Mol. Biol. Rev. 1998, 62, 204-229.

[126] J. E. Walker, M. Saraste, M. J. Runswick, N. J. Gay. Distantly related sequences in

the alpha- and beta-subunits of ATP synthase, myosin, kinases and other

ATP-requiring enzymes and a common nucleotide binding fold. EMBO J. 1982, 1,

945-951.

[127] D. J. Wilson, Y. Xue, K. E. Reynolds, D. H. Sherman. Characterization and analysis

of the PikD regulatory factor in the pikromycin biosynthetic pathway of Streptomyces

venezuelae. J. Bacteriol. 2001, 183, 3468-3475.

[128] I. Molnár, J. F. Aparicio, S. F. Haydock, L. E. Khaw, T. Schwecke, A. König, J.

Staunton, P. F. Leadlay. Organisation of the biosynthetic gene cluster for rapamycin

in Streptomyces hygroscopicus: analysis

of genes Xanking the polyketide synthase. Gene 1996, 169, 1-7.

[129] N. Anton, M. V. Mendes, J. F. Martin, J. F. Aparicio. IdentiWcation of PimR as a

positive regulator of pimaricin biosynthesis in Streptomyces natalensis. J. Bacteriol.

2004, 186, 2567-2575.

[130] H. B. Claxton, D. L. Akey, M. K. Silver, S. J. Admiraal, J. L. Smith. Structure and

Functional Analysis of RifR, the Type II Thioesterase from the Rifamycin

Biosynthetic Pathway J. Biol. Chem. 2009, 284, 5021-5029.

[131] C. Glockner, H. Wolf. Mechanism of natural resistance to kirromycin-type antibiotics

in actinomycetes FEMS Microbio. Lett. 1984, 25, 121-124.

[132] C. Cappellano, F. Monti, M. Sosio, S.Donadio, E. Sarubbi. Natural kirromycin

resistance of elongation factor Tu from the kirrothricin producer Streptomyces

cinnamoneus. Microbiology 1997, 143, 617-624.

[133] B. Ostash, R. Makitrinskyy, S. Walker, V. Fedorenko. Identification and

characterization of Streptomyces ghanaensis ATCC14672 integration sites for three

actinophage-based plasmids. Plasmid 2009, 61, 171-175.

134 References

[134] M. Koutloubasi, Stammcharakterisierung von Streptomyces lydicus ssp. Tanzanius

NRRL18036 und Screening nach dem Ganefromycinbiosynthese-gencluster.

Dissertation, Universität Tübingen (Tübingen), 2004.

[135] K. Probst.,Untersuchungen zur Biosynthese von Didesmethylmensacarcin.

Dissertation, Universität Freiburg (Freiburg), 2011.

[136] K. Yamamoto, M. F. Hentemann, J. G. Allen, S. J. Danishefsky. On the Total

Synthesis and Determination of the Absolute Configuration of Rishirilide B:

Exploitation of Subtle Effects to Control the Sense of Cycloaddition of

o-Quinodimethides. Chem. Eur. J. 2003, 9, 3242-3252.

[137] H. Gouda, Y. Kobayashi, T. Yamada, T. Ideguchi, A. Sugawara, T. Hirose, S. mura,

T. Sunazuka, S. Hirono. Three-Dimensional Solution Structure of Bottromycin A2: A

Potent Antibiotic Active against Methicillin-Resistant Staphylococcus aureus and

Vancomycin-Resistant Enterococci. Chem. Pharm. Bull. 2012, 60, 169-171.

[138] J. M. Waisvisz, M. G. van der Hoeven, J. van Peppen, W. C. M. Zwennis.

Bottromycin. I. A New Sulfur-containing Antibiotic J. Am. Chem. Soc. 1957, 79,

4520-4521.

[139] X.-Q. Qi, Q.-L. Sun, L.-P. Bai, J.-J. Shan, Y. Zhang, R. Zhang, Y. Li. Identification

of α-D-glucose-1-phosphate cytidylyltransferase involved in Ebosin biosynthesis of

Streptomyces sp. 139. Appl. Microbiol. Biotech. 2009, 83, 361-368.

[140] F. Choulet, B. Aigle, A. Gallois, S. Mangenot, C. Gerbaud, C. Truong, F.-X. Francou,

C. Fourrier, M. Guérineau, B. Decaris, V. Barbe, J.-L. Pernodet, P. Leblond.

Evolution of the Terminal Regions of the Streptomyces Linear Chromosome. Mol.

Biol. Evol. 2006, 23, 2361-2369.

[141] M. Metsä-Ketelä, K. Palmu, T. Kunnari, K. Ylihonko, P. Mäntsälä. Engineering

Anthracycline Biosynthesis toward Angucyclines. Antimicrob. Agents Chemother.

2003, 47, 1291-1296.

[142] K. Räty, J. Kantola, A. Hautala, J. Hakala, K. Ylihonko, P. Mäntsälä. Cloning and

characterization of Streptomyces galilaeus aclacinomycins polyketide synthase (PKS)

cluster. Gene 2002, 293, 115-122.

[143] L. Garrido, F. Lombó, I. Baig, M. Nur-e-Alam, R. Furlan, C. Borda, A. Braña, C.

Méndez, J. Salas, J. Rohr, G. Padilla. Insights in the glycosylation steps during

biosynthesis of the antitumor anthracycline cosmomycin: characterization of two

glycosyltransferase genes. Appl. Microbiol. Biotech. 2006, 73, 122-131.

[144] D. R. D. Bignell, R. F. Seipke, J. C. Huguet-Tapia, A. H. Chambers, R. J. Parry, R.

Loria. Streptomyces scabies 87-22 Contains a Coronafacic Acid-Like Biosynthetic

Cluster That Contributes to Plant-microbe Interactions. Mol. Plant Microbe In. 2010,

23, 161-175.

References 135

[145] T. Huang, Y. Wang, J. Yin, Y. Du, M. Tao, J. Xu, W. Chen, S. Lin, Z. Deng.

Identification and Characterization of the Pyridomycin Biosynthetic Gene Cluster of

Streptomyces pyridomyceticus NRRL B-2517. J. Biol. Chem. 2011, 286,

20648-20657.

[146] X. Zhang, R. J. Parry. Cloning and Characterization of the Pyrrolomycin Biosynthetic

Gene Clusters from Actinosporangium vitaminophilum ATCC 31673 and

Streptomyces sp. Strain UC 11065. Antimicrob. Agents Chemother. 2007, 51,

946-957.

[147] T. Oja, K. Palmu, H. Lehmussola, O. Leppäranta, K. Hännikäinen, J. Niemi, P.

Mäntsälä, M. Metsä-Ketelä. Characterization of the Alnumycin Gene Cluster Reveals

Unusual Gene Products for Pyran Ring Formation and Dioxan Biosynthesis. CHem.

Biol. 2008, 15, 1046-1057.

[148] L. B. Pickens, W. Kim, P. Wang, H. Zhou, K. Watanabe, S. Gomi, Y. Tang.

Biochemical Analysis of the Biosynthetic Pathway of an Anticancer Tetracycline

SF2575. J. Am. Chem. Soc. 2009, 131, 17677-17689.

[149] X. Zhang, L. B. Alemany, H.-P. Fiedler, M. Goodfellow, R. J. Parry. Biosynthetic

Investigations of Lactonamycin and Lactonamycin Z: Cloning of the Biosynthetic

Gene Clusters and Discovery of an Unusual Starter Unit. Antimicrob. Agents

Chemother. 2008, 52, 574-585.

[150] S. Horinouchi, M. Kito, M. Nishiyama, K. Furuya, S. K. Hong, K. Miyake, T. and

Beppu. Primary structure of AfsR, a global regulatory protein for secondary

metabolite formation in Streptomyces coelicolor A3(2). Gene 1990, 95, 49-56.

[151] A. Li, J. Piel. A Gene Cluster from a Marine Streptomyces Encoding the Biosynthesis

of the Aromatic Spiroketal Polyketide Griseorhodin A. Chem. Biol. 2002, 9,

1017-1026.

[152] V. B. Rajgarhia, N. D. Priestley, W. R. Strohl. The Product of dpsC Confers Starter

Unit Fidelity upon the Daunorubicin Polyketide Synthase of Streptomyces sp. Strain

C5. Metab. Eng. 2001, 3, 49-63.

[153] T. Bretschneider, G. Zocher, M. Unger, K. Scherlach, T. Stehle, C. Hertweck. A

ketosynthase homolog uses malonyl units to form esters in cervimycin biosynthesis.

Nat. Chem. Biol. 2012, 8, 154-161.

[154] X.-Y. Jia, Z.-H. Tian, L. Shao, X.-D. Qu, Q.-F. Zhao, J. Tang, G.-L. Tang, W.

Liu. .Genetic Characterization of the Chlorothricin Gene Cluster as a Model for

Spirotetronate Antibiotic Biosynthesis Chem. Biol. 2006, 13, 575-585.

[155] A. Grimm, K. Madduri, A. Ali, C. R. Hutchinson. Characterization of the

Streptomyces peucetius ATCC 29050 genes encoding doxorubicin polyketide

synthase. Gene 1994, 151, 1-10.

136 References

[156] T. Bililign, C.-G. Hyun, J. S. Williams, A. M. Czisny, J. S. Thorson. The Hedamycin

Locus Implicates a Novel Aromatic PKS Priming Mechanism. Chem. Biol. 2004, 11,

959-969.

[157] H. Pan, S.-c. Tsai, E. S. Meadows, L. J. W. Miercke, A. T. Keatinge-Clay, J.

O'Connell, C. Khosla, R. M. Stroud. Crystal Structure of the Priming β-Ketosynthase

from the R1128 Polyketide Biosynthetic Pathway. Structure 2002, 10, 1559-1568.

[158] M. Metsä-Ketelä, J. Niemi, P. Mäntsälä, G. Schneider, K. Krohn, Vol. 282, Springer

Berlin / Heidelberg, 2008, pp. 101-140.

[159] Z. Xu, K. Jakobi, K. Welzel, C. Hertweck. Biosynthesis of the Antitumor Agent

Chartreusin Involves the Oxidative Rearrangement of an Anthracyclic Polyketide.

Chem. Biol. 2005, 12, 579-588.

[160] N. Menéndez, M. Nur-e-Alam, A. F. Braña, J. Rohr, J. A. Salas, C. Méndez.

Biosynthesis of the Antitumor Chromomycin A3 in Streptomyces griseus: Analysis of

the Gene Cluster and Rational Design of Novel Chromomycin Analogs. Chem. Biol.

2004, 11, 21-32.

[161] W. Zhang, K. Watanabe, C. C. C. Wang, Y. Tang. Investigation of early tailoring

reactions in the oxytetracycline biosynthetic pathway. J. Biol. Chem. 2007, 282,

25717-25725.

[162] R. McDaniel, S. Ebert-Khosla, D. A. Hopwood, C. Khosla. Engineered Biosynthesis

of Novel Polyketides: actVII and actIV Genes Encode Aromatase and Cyclase

Enzymes, Respectively. J. Am. Chem. Soc. 1994, 116, 10855-10859.

[163] S. W. Aufhammer, E. Warkentin, H. Berk, S. Shima, R. K. Thauer, U. Ermler.

Coenzyme Binding in F420-Dependent Secondary Alcohol Dehydrogenase, a

Member of the Bacterial Luciferase Family. Structure 2004, 12, 361-370.

[164] F. Widdel, R. S. Wolfe. Expression of secondary alcohol dehydrogenase in

methanogenic bacteria and purification of the F420-specific enzyme from

Methanogenium thermophilum strain TCI. Arch. Microbiol. 1989, 152, 322-328.

[165] T. Grocholski, H. Koskiniemi, Y. Lindqvist, P. Ma ntsa la , J. Niemi, G. Schneider.

Crystal Structure of the Cofactor-Independent Monooxygenase SnoaB from

Streptomyces nogalater: Implications for the Reaction Mechanism. Biochemistry

2010, 49, 934-944.

[166] V. B. Rajgarhia, W. R. Strohl. Minimal Streptomyces sp. strain C5 daunorubicin

polyketide biosynthesis genes required for aklanonic acid biosynthesis. J. Bacteriol.

1997, 179, 2690-2696.

[167] X. Yan, K. Probst, A. Linnenbrink, M. Arnold, T. Paululat, A. Zeeck, A. Bechthold.

Cloning and Heterologous Expression of Three Type II PKS Gene Clusters from

Streptomyces bottropensis. ChemBioChem 2012, 13, 224-230.

References 137

[168] K. Ma, R. K. Thauer. Purification and properties of N5, N10-methylenetetrahydro

methanopterin reductase from Methanobacterium thermoautotrophicum (strain

Marburg). Eur. J. Biochem. 1990, 191, 187-193.

[169] S. Okamoto, T. Taguchi, K. Ochi, K. Ichinose. Biosynthesis of Actinorhodin and

Related Antibiotics: Discovery of Alternative Routes for Quinone Formation

Encoded in the act Gene Cluster. Chem. Biol. 2009, 16, 226-236.

[170] W. Zhang, L. Wang, L. Kong, T. Wang, Y. Chu, Z. Deng, D. You. Unveiling the

Post-PKS Redox Tailoring Steps in Biosynthesis of the Type II Polyketide Antitumor

Antibiotic Xantholipin. Chem. Biol. 2012, 19, 422-432.

[171] B. Floriano, M. Bibb. afsR is a pleiotropic but conditionally required regulatory gene

for antibiotic production in Streptomyces coelicolor A3(2). Mol. Microbiol. 1996, 21,

385-396.

[172] A. S. Seoane, a. S. B. Levy. Characterization of MarR, the repressor of the multiple

antibiotic resistance (mar) operon in Escherichia coli. J. Bacteriol. 1995, 177,

3414-3419.

[173] S. T. Torkkell, T. K. Kunnari, K. P. Palmu, P. M. Mäntsälä, J. H. Hakala, K. Y.

Ylihonko. The entire nogalamycin biosynthetic gene cluster of Streptomyces

nogalater: characterization of a 20-kb DNA region and generation of hybrid

structures. Mol. Genet. Genomics 2001, 266, 276-288.

[174] T. Oja, K. D. Klika, L. Appassamy, J. Sinkkonen, P. Mäntsälä, J. Niemi, M.

Metsä-Ketelä. Biosynthetic pathway toward carbohydrate-like moieties of

alnumycins contains unusual steps for C-C bond formation and cleavage. Proc. Natl.

Acad. Sci. U. S. A. 2012, 109, 6024-6029.

[175] S. Okamoto, T. Taguchi, K. Ochi, and K. Ichinose. Biosynthesis of actinorhodin and

related antibiotics: discovery of alternative routes for quinone formation encoded in

the act gene cluster. Chem. Biol. 2009, 16, 226-236.

[176] D. L. Wilkinson, R. G. Harrison. Predicting the Solubility of Recombinant Proteins in

Escherichia coli. Nat. Biotech. 1991, 9, 443-448.

[177] M. Folcher, H. Gaillard, L. T. Nguyen, K. T. Nguyen, P. Lacroix, N. Bamas-Jacques,

M. Rinkel, C. J. Thompson. Pleiotropic Functions of a Streptomyces pristinaespiralis

Autoregulator Receptor in Development, Antibiotic Biosynthesis, and Expression of a

Superoxide Dismutase. J. Biol. Chem. 2001, 276, 44297-44306.

[178] N. Bate, A. R. Butler, A. R. Gandecha, E. Cundliffe. Multiple regulatory genes in the

tylosin biosynthetic cluster of Streptomyces fradiae. Chem. Biol. 1999, 6, 617-624.

[179] S.-E. Wohlert, N. Lomovskaya, K. Kulowski, L. Fonstein, J. L. Occi, K. M. Gewain,

D. J. MacNeil, C. R. Hutchinson. Insights about the biosynthesis of the avermectin

deoxysugar L-oleandrose through heterologous expression of Streptomyces

avermitilis deoxysugar genes in Streptomyces lividans. Chem. Biol. 2001, 8, 681-700.

138 References

[180] M. Brasholz, S. Sörgel, C. Azap, H.-U. Reißig. Rubromycins: Structurally Intriguing,

Biologically Valuable, Synthetically Challenging Antitumour Antibiotics. Eur. J. Org.

Chem. 2007, 2007, 3801-3814.

[181] I. Aguirrezabalaga, C. Olano, N. Allende, L. Rodriguez, A. F. Braña, C. Méndez, J. A.

Salas. Identification and Expression of Genes Involved in Biosynthesis of

l-Oleandrose and Its Intermediatel-Olivose in the Oleandomycin Producer

Streptomyces antibioticus. Antimicrob. Agents Chemother. 2000, 44, 1266-1275.

[182] M. Metsä-Ketelä, V. Salo, L. Halo, A. Hautala, J. Hakala, P. Mäntsälä, K. Ylihonko.

An efficient approach for screening minimal PKS genes from Streptomyces. FEMS

Microbio. Lett. 1999, 180, 1-6.

[183] T. Marti, Z. Hu, N. L. Pohl, A. N. Shah, C. Khosla. Cloning, Nucleotide Sequence,

and Heterologous Expression of the Biosynthetic Gene Cluster for R1128, a

Non-steroidal Estrogen Receptor Antagonist. J. Biol. Chem. 2000, 275, 33443-33448.

[184] K. Räty, J. Kantola, A. Hautala, J. Hakala, K. Ylihonko, P. Mäntsäläa. Cloning and

characterization of Streptomyces galilaeus aclacinomycins polyketide synthase (PKS)

cluster Gene 2002, 293, 115-122.

[185] Y. Mao, M. Varoglu, D. H. Sherman. Molecular characterization and analysis of the

biosynthetic gene cluster for the antitumor antibiotic mitomycin C from Streptomyces

lavendulae NRRL 2564. Chem. Biol. 1999, 6, 251-263.

[186] M. Koběrská, J. Kopecký, J. Olšovská, M. Jelínková, D. Ulanova, P. Man, M. Flieger,

J. Janata. Sequence analysis and heterologous expression of the lincomycin

biosynthetic cluster of the type strain Streptomyces lincolnensis ATCC 25466. Folia.

Microbiologica. 2008, 53, 395-401.

[187] V. Blanc, D. Lagneaux, P. Didier, P. Gil, P. Lacroix, J. Crouzet. Cloning and analysis

of structural genes from Streptomyces pristinaespiralis encoding enzymes involved in

the conversion of pristinamycin IIB to pristinamycin IIA (PIIA): PIIA synthase and

NADH:riboflavin 5'-phosphate oxidoreductase. J. Bacteriol. 1995, 177, 5206-5214.

[188] Takaaki Aoyagi, Takayuki Aoyama, Fukiko Kojima, Naoko Matsuda, Masato

Maruyama, Masa Hamada, T .Takeuchi. Benastatins A and B, new inhibitors of

glutathione s-transferase, produced by Streptomyces sp. MI384-DF12. I. taxonomy,

production, isolation, physico-chemical properties and biological activities. J.

Antibiot. 1992, 9, 1385-1390.

[189] Z. Xu, A. Schenk, C. Hertweck. Molecular Analysis of the Benastatin Biosynthetic

Pathway and Genetic Engineering of Altered Fatty Acid-Polyketide Hybrids. J. Am.

Chem. Soc. 2007, 129, 6022-6030.

[190] Z. Xu, M. Metsä-Ketelä, C. Hertweck. Ketosynthase III as a gateway to engineering

the biosynthesis of antitumoral benastatin derivatives. J. Biotech. 2009, 140, 107-113.

References 139

[191] M. J. F. Lozano, L. L. Remsing, L. M. Quirós, A. F. Braña, E. Fernández, C. Sánchez,

C. Méndez, J. Rohr, J. A. Salas. Characterization of Two Polyketide

Methyltransferases Involved in the Biosynthesis of the Antitumor Drug Mithramycin

by Streptomyces argillaceus. J. Biol. Chem. 2000, 275, 3065-3074.

[192] Q. Cheng, L. Xiang, M. Izumikawa, D. Meluzzi, B. S. Moore. Enzymatic total

synthesis of enterocin polyketides. Nat. Chem. Biol. 2007, 3, 557-558.

[193] T. J. Simpson, J. S. E. Holker. The biosynthesis of a pyrone metabolite of Aspergillus

melleus an application of long-range 13

c-13

c coupling constants. Tetrahedron Lett.

1975, 16, 4693-4696.

[194] J. L. C. Wright, T. Hu, J. L. McLachlan, J. Needham, J. A. Walter. Biosynthesis of

DTX-4: Confirmation of a Polyketide Pathway, Proof of a Baeyer-Villiger Oxidation

Step, and Evidence for an Unusual Carbon Deletion Process. J. Am. Chem. Soc. 1996,

118, 8757-8758.

[195] B. S. Moore, C. Hertweck. Biosynthesis and attachment of novel bacterial polyketide

synthase starter unit. Nat. Prod. Rep. 2001, 19, 70-99.

Appendix 141

6 Appendix

6.1 List of abbreviations

°C degree celsius

1H,

1H-COSY

1H,

1H-correlated spectroscopy

2D two dimensional

6×His hexahistidines

aa amino acids

aac(3)IV 3’-N-acetyltransferase

ACP acyl carrier protein

Amp ampicillin

APS ammonium persulphate

AT acyltransferase

ATP adenosine triphosphate

BLAST basic logical alignment search tool

bp base pair

BSA bovine serum albumin

CDCl3: deuterated chloroform

CoA coenzyme A

CYP450 cytochrome P450

Da Dalton

DAD diode array detector

DH dehydrogenase

DMSO dimethyl sulfoxide

DNA deoxyribonucleic acid

dNTP deoxyribonucleoside 5´-triphosphates

dsDNA double-stranded deoxyribonucleic acid

142 Appendix

DTT 1,4-dithiothreitol

E. coli Escherichia coli

EDTA ethylenediamine tetraacetic acid

ER enoylreductase

ESI electrospray ionization

eV electron volt

g gram

h hour

HAc acetic acid

HCl hydrochloric acid

HMBC heteronuclear nultiple-bond correlation

HPLC high performance liquid chromatography

HSQC heteronuclear single-quantum coherence

Hz hertz

IPTG isopropyl-β-thiogalactoside

J coupling constant

k kilo

KAc potassium acetate

kb kilobase

kDa kilodalton

KR ketoreductase

KS ketosynthase

L liter

lacZ β-galactosidase gene

LC-MS liquid chromatography-mass spectrometry

M molar

m milli-

Appendix 143

μ micro-

min minute

m/z mass-to-charge ratio

MW molecular weight

MS mass spectroscopy

n nano

NaAc sodium acetate

NaOH sodium hydroxide

Ni-NTA nickel-nitrilotriacetic acid

NMR nuclear magnetic resonance

ORF open reading frame

oriT origin of transfer

PCR polymerase chain reaction

PCP peptidyl carrier protein

PEG polyethylene glycol

PKS polyketide synthase

PMSF phenylmethylsulfonyl fluoride

RNA ribonuclear acid

RNase ribonuclease

RP reverse phase

rpm rotation per minute

RT room temperature

s second

S. Streptomyces

SDS sodium dodecyl sulphate

SDS-PAGE sodium dodecyl sulphate-polyacrylamide gel electrophoresis

ssDNA single-stranded deoxyribonucleic acid

144 Appendix

TEMED N,N,N´,N´-tetramethylethylenediamine

TES N-Tris-(hydroxymethyl)-methyl-2-aminoethanesulfonic acid

Tris 2-amino-2-(hydroxymethyl)-1,3-propanediol

Tris-maleate Tris-(hydroxymethyl)-aminomethane-maleate

UV ultraviolet

WT wild-type

X-gal 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside

X-Gluc 5-bromo-4-chloro-3-indolyl-β-D-glucuronic acid

cyclohexylammonium salt

6.2 Maps of plasmids

6.2.1 pKCXY01 and pKCXY02

These two plasmids were constructed to facilitate selection of double cross-over in

Streptomyces. The toxic gene CodA and the gusA gene were inserted into pKC1132,

respectively.

pKCXY02

5407 bp

tipA

gusA

aac(3)IV

lacZa

ori(pUC)

oriT

BamHI (7)

Cla I (2300)

Eco RI (31)

Eco RV (27)

Pst I (5400)

Xba I (1)

pKCXY01

4551 bp

ori(pUC18)

aac(3)IV

oriT

CodA(sm)

promoter

Afl II (1449)

Eco RI (1465)

HindIII (1421)

Nsi I (1459)

Spe I (1439)

Bgl II (91)

Bgl II (216)

Appendix 145

6.2.2 pKCganAIVEP

6.2.3 pSOK804, pCDFDuet and pKC1218E

pKCganAIVEP

10146 bpori(pUC18)

aac(3)IV

oriT

fragment of ganAIV

Eco RI (6603)

Pst I (1)

pSOK804

5493 bp

integrase

transcription terminator

attP site

aac3(IV)

oriT

RBS

ColE1ori

146 Appendix

pKC1218E

6121 bp

ermE

oriT aac(3)IV

rep-pUC

SCP2 minimal replicon

pCDFDuet

3781 bp

SmR

lacI

-10

-35CDF

BamHI (107)

Eco RI (113)

HindIII (144)

Nco I (70)

Pst I (136)

Xba I (2367)

Kpn I (353)

Eco RV (320)

Appendix 147

6.2.4 pGUS and its derived plasmids

pGUS-PR-rlsR1

10249 bp

GUS

aac(3)IV

aadA

int

ori (pUC18)

OriT

Xba I (1)

Kpn I (532)

pGUS-PR-rslR2

10225 bp

GUS

aac(3)IV

aadA

int

PR-rslR2

ori (pUC18)

OriT

Xba I (1)

Kpn I (508)

pGUS-PR-rslR3

10185 bp

GUS

aac(3)IV

aadA

int

ori (pUC18)

OriT

Xba I (1)

Kpn I (468)

pGUS

10228 bp

GUS

aac(3)IV

aadA

int

PR-rslR4

ori (pUC18)

OriT

Xba I (1)

Kpn I (511)

pGUS

9737 bp

GUS

aac(3)IV

aadA

int

ori (pUC18)

OriT

148 Appendix

6.2.5 pUWL-H

For the overpression of rlsR1, rslR2, rslR3, rslR1R2R3, and rslR4, the respective PCR

fragments were digested with ClaI+SpeI, and then inserted into pUWL-H.

pUWL-H

7791 bp

rep

ori

hph

'fd ter

ori ColE1

bla

ermE up

oriT

Cla I (7088)

Spe I (7045)

Appendix 149

6.3 NMR and MS spectra of the compounds characterized in

this thesis

Figure 6.1 The 1H and

13C-NMR spectra of the product from S. lydicus ganAIV::pKC-ganAIVEP.

Up: 1H -NMR spectrum. Down:

13C-NMR spectrum.

150 Appendix


13C-NMR spectra of rishirilide B isolated from the culture of S. albus. Up:

1H -NMR spectrum. Down:

13C-NMR spectrum.

Appendix 151


13C-NMR spectra of rishi1a. Up:

1H -NMR spectrum. Down:

13C-NMR

spectrum.

152 Appendix

Figure 6.4 1H,

1H COSY of rishi1a.

Figure 6.5 HMBC spectrum of rishi1a.

Appendix 153

Figure6.6 Mass spectrum of rishi1a.

154 Appendix

Figure 6.7 1H NMR spectrum of rishi2a.

Figure 6.8 13

C-NMR spectrum of rishi2a.

Appendix 155

Figure 6.9 1H,

1H COSY of rishi2a.

Figure 6.10 HMBC of rishi2a.

156 Appendix

Figure 6.11 Mass spectrum of rishi2a by the CI method.

Appendix 157

Figure 6.12 1H NMR spectrum of rishi2b.

Figure 6.13 1H,

1H COSY of rishi2b.

158 Appendix

Figure 6.14 13

C-NMR data of rishi2b.

Figure 6.15 HMBC of rishi2b.

Appendix 159

Figure 6.16. Mass spectrum of rishi2b by the ESI method.

Acknowledgement A

Acknowledgements

This study is performed in the Institute of Pharmaceutical Sciences, Pharmaceutical

Biology and Biotechnology, Faculty of Chemistry, Pharmacy, and Earth Sciences,

University of Freiburg from Septermber 2008 to June 2012.

I want to give my greatest thanks to my supervisor, Prof. Dr. Andreas Bechthold.

Thank him for providing the opportunity to study in this nice group and to live in such

a nice Freiburg city. Thank him for his unlimited support and encouragement, without

which the achievements in this thesis could not be obtained. More importantly, his

guidance and thinking recharged my enthusiasm in scientific research.

I am grateful to Dr. Gabriele Weitnauer and Dr. Andriy Luzhetskyy for their generous

help on the operations of and discussion about my experiments. I learned a lot from

their help.

I express my greatest gratitude to Dr. Tilmann Weber on the analysis of gene

sequence in the ganefromycin project; to Prof. Dr. Alex Zeeck on the precious

discussion about the production of rishirilides, the techniques in the feeding

experiments as well as the help on the manuscript for Chembiochem; to Dr. Thomas

Paululat for the great help on the interpretation of the NMR data for rishirilide B.

I am especially grateful to Prof. Dr. Willi Bannwarth and Mr. Stephan Mundinger for

their generous help on the purification of rishirilide B derivatives. I want to express

my greatest thanks to Prof. Dr. Renato Murillo from the Escuela de Quimica and

Ciprona, Universidad de Costa Rica, Costa Rica for his nice help on interpreting the

structures of the derivatives of rishirilide B.

I would like to thank all my colleges in the lab. The help from Anton, Arne, Holger,

Irene, Johannes, Julia, Katharina, Lutz, Sarah, Simone, Suzan, Tanja, Theresa, Tina,

and Uwe is very important and makes me feel not depressed in the difficult time. I

B Acknowledgement

also offer my warmest gratitude to the three very nice technicians in the lab:

Elizabeth, Marcus, and Miss Weber.

Last but not the least, I want to thank my dear wife, Ying. With her company, nothing

is impossible for me. Thank her for giving birth to my beloved angel, Shuman, before

I finish my study in Freiburg.

.

Curriculum vitae C

Curriculum vitae

Name Xiaohui Yan

Date of Birth 06.02.1979

Place of Birth Hubei Province, P. R. China

1986-1992 Elementary school in Macheng City, Hubei Province, P. R. China

1992-1995 Secondary school in Macheng City, Hubei Province, P. R. China

1995-1998 Huanggang middle school in Huanggang City, Hubei Province, P. R.

China

1998-2002 Department of Chemical Engineering and Process, Tianjin University.

Tianjin City, P. R. China

07.2002 Bachelor of Engineering

2002-2004 Zhenhai Refining & Chemical Company, Sinopec.

Ningbo City, Zhejiang Province, P. R. China

2005-2008 Deparment of Biological Sciences and Technology, Tsinghua University.

Beijing City, P. R. China

Supervisor: Prof. Dr. Guoqiang Chen

07.2008 Master of Science

2008-2012 PhD student at the University of Freiburg.

The faculty of Chemistry, Pharmacy, and Earth Sciences

Institute of Pharmaceutical Sciences, Biology and Biotechnology

Supervisor: Prof. Dr. Andreas Bechthold

Investigation of the Biosynthesis of Ganefromycins and ...

Documents

Transcript of Investigation of the Biosynthesis of Ganefromycins and ...