Interleukin-1 alpha and vasoactive interstinal peptide: Enigmatic regulation of neuronal survival

Pergamon Int. J. Devl Neuroscience, Vol. 13. No. 3/4, pp. 187-200, 1995 Elsevier Science Ltd

ISDN 0736-5748(95)00014-3 Printed in Great Britain

INTERLEUKIN-1 ALPHA A N D VASOACTIVE INTESTINAL PEPTIDE: ENIGMATIC REGULATION OF N E U R O N A L SURVIVAL

D. E. BRENNEMAN,*t J. M. HILL,* G. W. GLAZNER,* I. GOZES~ and T. W. PHILLIPS § *Section on Developmental and Molecular Pharmacology, National Institute of Child Health and Human Development,

National Institutes of Health, Bethesda, Maryland, U.S.A.; ~:Department of Clinical Biochemistry, Sackler School of Medicine, Tel Aviv University, Tel Aviv, Israel; §Immunochemistry Laboratory, Department of Medicine,

George Washington University Medical Center, Washington, D.C., U.S.A.

(Received 13 October 1994; revised 6 January 1995; accepted 9 January 1995)

Abstraet--A neurotrophic role for interleukin-1 alpha (IL-la) was investigated in dissociated spinal cord-dorsal root ganglion cultures. Three observations suggested a survival-promoting action for IL-lc~ in nine-day-old cultures: (1) neutralizing antiserum to murine 1L-lc~ decreased neuronal survival; (2) treatment with IL-la in electrically blocked cultures increased neuronal survival; and (3) antiserum to the type I IL-1 receptor decreased neuronal survival. Treatment with VIP prevented neuronal cell death associated with the antiserum to IL-la. In contrast, treatment of one-month-old cultures with IL-lc~ produced neuronal cell death and neutralizing antiserum to the IL-1 receptor had no effect on neuronal survival in these cultures. These experiments suggested that an IL-l-like substance was necessary for neuronal survival during a specific stage in development and that a relationship between VIP and IL-lc~ might account in part for the neurotrophic properties of VIP.

To test if VIP might be a secretagogue for IL-1, a neuron-free model system was utilized: astroglial cultures derived from cerebral cortex. VIP treatment produced a concentration-dependent (EC50:50 pM) increase in the amount of IL-lc~ in the medium and a decrease in cellular IL-lcc Interleukin-1 beta (IL-113) was also increased (EC 50:1 nM) in the medium by VIP but without depleting IL-113 in the cytosol. Semi-quantitative measurements of the IL-lc~ mRNA after VIP treatment indicated a significant but transient decrease. These data indicate that VIP produced an increase in the secretion of IL-lc~ while depleting IL-la mRNA.

Keywords: interleukin-la, neuronal survival, VIP-IL-1 relationship.

The demarcation between molecules recognized as regulators of immune functions and those that mediate action in the nervous system is rapidly dissipating. The recognition of shared molecules for the immune and nervous systems has served to highlight the extent of neuro-immune interactions as well as to project the likelihood of additional functions for the shared molecules. An experimental arena where these functions are becoming increasingly apparent is the regulation of embryonic and nervous system development. Recent studies have demonstrated that interleukin-1 (IL-1), interleukin-6 (IL-6), colony stimulating factor-l, tumor necrosis factor and leukemia inhibitory factor (LIF) are all associated with successful early embryogenesis. 35,42,47

On the cellular level, cytokine regulation of nervous system development appears to be mediated in part through glial cells. LIF, a multifunctional cytokine that stimulates proliferation and differentiation in many tissues, has been shown to be regulated by IL-l[3 in human astrocytes. 1 In addition, IL-1 has been shown to stimulate IL-6 secretion from rat astrocytes and IL-6 has been implicated as a trophic factor in the nervous system. 24 Two structurally related peptides, pituitary adenylate cyclase activating polypeptide (PACAP) and vasoactive intestinal peptide (VIP) have been shown to stimulate the secretion of IL-6. Both peptides also acted synergistically with IL-I to release IL-6 from rat astrocytes. 21

Our interest in this field has been to investigate the relationship between VIP and IL-1 as a regulatory component influencing neuronal survival in the central nervous system. VIP increases the survival of CNS neurons during a critical period of development. 4 This survival-promoting action of VIP is mediated indirectly through high affinity receptors on astrocytes, which release substances necessary for neuronal survival. 1°,11,22 Previous studies have indicated that IL-loL was necessary for the survival of a sub-population of spinal cord neurons during a critical period of

tTo whom all correspondence should be addressed at: Chief, SDMP/LDN/NICHD, Building 49, Room 5A38, National Institutes of Health, Bethesda, MD 20892, U.S.A.

187

188 D.E. Brenneman et al.

development in vitro. 12 These data will be reviewed here followed by an examination of VIP as a regulator of IL-1 secretion and synthesis in glial cells.

IL-1 is a product of monocytes secreted in response to infection) 8 An alpha and a beta form of IL-1 have been identified, both with molecular weights of 17 kDa, but with differing isoelectric points. The two cytokines have been cloned and were found to be coded for by two separate genes. 26,27 In the nervous system, IL-1 is made in both astroglia 17 and in microglia) 9 but with differing regulation in the two cell types. 25 IL expression in the brain is increased after infection, 18 ischemia 38 or mechanical injury. 2° Indeed, IL-1 can mimic some of the effects of injury such as gliosis and neovascularization 2° and may have deleterious effects on brain structure and function. 37,38 In this context, our studies examined the effects of IL-1 in both developing and mature CNS cultures, with the potential of describing actions of IL-1 related to the state of differentiation of neurons and/or glia. The working hypothesis is that IL-1 not only has functions that are restricted to the nervous system but also has actions that are confined to distinct periods during ontogeny.

EXPERIMENTAL PROCEDURES

Materials

Antisera to murine IL-l~x was a generous gift from Dr P. T. Lomedico and Dr A. Stern (Hoffman-LaRoche, Nutley, N J). This antiserum was shown previously to neutralize the effects of IL-1 on both phytohemagglutinin-induced thymocyte proliferation and lymphocyte IL-2 receptor expression. 12 Neutralizing antiserum to the IL-1 receptor was raised against a synthetic peptide fragment of the murine lymphocyte IL-1 receptor protein. 43 Recombinant IL-la (free of endotoxin at a sensitivity of 0.06 ng/ml) from human coding sequences was obtained from Cistron Biotech. (Pinebrook, N J). Antibodies and standards to murine IL-l(x and IL-113 used in the immunoassay were obtained from Genzyme Corporation (Cambridge, MA). Filters employed in processing cytokine samples were obtained from Millipore, and the AMPPD (3-(2'-spiroadamantane)-4-meth- oxy-4-(3'-phosphoryloxy)phenyl-l,2-dioxetane) substrate used as chemiluminescent substrate in the ELISA assays was from Tropix (Bedford, MA). VIP was obtained from Peninsula Laboratories (Belmont, CA) and tetrodotoxin from Sigma Chemical Co. (St. Louis, MO).

Cell cultures and neuronal survival assay

Neuronal survival assays were performed on dissociated spinal cord-dorsal root ganglion cultures that were prepared from El2 fetal mice as previously described. 33 The spinal cord-dorsal root ganglion cultures contained a mixed population of cells, including neurons and glial cells. The neurons in this culture system undergo a well-defined course of adherence, growth, differentiation and limited cell death between days 7 and 21. 6,9 In developing cultures, cell death occurs at a rate of about 25% a week, whereas in cultures more than three weeks old, the number of neurons remains stable for at least five weeks. Cultures were plated at a density of 0.5 million cells/35 mm dish and maintained in a medium consisting of 5% (v/v) horse serum in MEM supplemented with defined medium components. 36 Prior to treatment with VIP or cytokines, all cultures were given a complete change into fresh nutrient medium. Neuronal cell counts were conducted after immunocytochemical identification with antiserum against neuron-specific enolase. 4° Counts were made in 30 fields from predetermined coordinate locations without knowledge of the treatment group) 2

Glial cultures and cytokine release

Astrocyte cultures were prepared from one-day-old rat cerebral cortices as previously described. 28 Briefly, tissue was dissociated with trypsin in the presence of DNase and cultured in MEM containing 10% fetal calf serum. Cells were plated in 75 cm 2 (250 ml) culture flasks (Falcon, Becton Dickinson Labware, Lincoln Park, NJ) and upon confluency (10 days) were vigorously shaken to remove nonadherent ceils. The tightly adherent astroglia were collected by trypsin treatment and then plated (2.5 million cells in 10 ml) again in the 75 mm 2 flasks. Cultures were allowed to grow to 80% confluency, at which time the cytokine release experiment was conducted. Cultures were maintained at 37°C in 10% CO2 and 90% air. To assess the purity of the cultures,

IL-1 and VIP regulate neuronal survival in CNS 189

immunocytochemical labeling of astroglia was performed using antiserum to glial fibrillary acidic protein. 10 Cultures were also monitored for microglia by the acetylated LDL method. 46 These studies indicated that the cultures were greater than 96% type I astrocytes. Microglia comprised less than 0.1% of the total cells as assessed by immunofluorescence using Dil-LDL (1,1'dioctade- cyl-l-3,3',3'-tetramehtyl-indocarbocyanine perchlorate-low density lipoprotein). Preliminary studies with microglial cultures 19 derived from cerebral cortex indicated that treatment with subnanomolar amounts of VIP resulted in no detectable release of cytokines. These studies suggested that astrocytes should be the focus of these experiments and not microglia. Contami- nation of cultures with type II astrocytes was <2% as described. 28 Non-neuronal spinal cord cultures from mice were not employed for these studies because of their relatively slow growth and the lower amounts of astroglia in comparison to other cell types.

For measurement of VIP-mediated release of IL- la and IL-113, the astroglial cultures were washed three times with Dulbecco's phosphate-buffered saline (DPBS). The release medium, consisting of DPBS supplemented with 2 ixg/ml leupeptin, was added just prior to the beginning of VIP treatment. At termination, the medium was decanted, centrifuged at 1000 g for 10 min and frozen on dry ice until analyzed. Cells were scraped in the presence of 400 txl of release medium and transferred to a vial which was then frozen on dry ice.

Cytokine assay Samples of culture release medium were thawed and passed through 20,000-D cut-off centrifugal

filters (Millipore) to remove high molecular weight contaminating proteins. Cell homogenates were clarified by centrifugation at 100,000 g for 30 min in a Beckman Airfuge (Beckman Instruments, Fullerton, CA) and the supernatant recovered using a Beckman Airfuge Mico-Fraction Collector. This material was then filtered as described above for the medium samples. The analysis of the cytokines was performed as described previously in a two step process: (1) separation of the cytokine mixture by high-performance capillary electrophoresis (HPCE); and (2) quantitation by chemiluminescence-enhanced enzyme-linked immunosorbent assay (CHEM-ELISA). 32 All HPCE separations were performed on a ISCO 3140 capillary electrophoresis system (Lincoln, NE) using the integrated method and analysis program supplied by the manufacturer. Unmodified internal surface, fused-silica capillaries (375 ~m O.D.×75 ~m I.D.) were obtained from ISCO and cut to a standard length of 75 cm, 60 cm to the detector cell. HPCE separations were performed at a controlled chamber temperature of 15°C. The interior surface of the capillaries was coated with polyethylene glycol polyether according to the previously described technique. 29 The capillary was purged five times with 100 mM phosphate buffer and filled with fresh buffer prior to analysis. Approximately 20 nl samples were introduced by vacuum injection and electrophoretically separated at 15 kV constant voltage. The migration of the sample components was monitored by on-line UV detection at 200 nm and the electropherogram directly read into a computerized recording system. A typical electropherogram of peaks observed with the medium from VIP-stimulated astroglia is shown in Fig. 1. Continuous fractions were collected on linear modification 31 of the circular membrane-based system. 14 Polyvinylidene difluoride (PVDF-ImmobilonTM-p membrane [Millipore]) membranes were used as collection devices. Similar separations were performed employing purified or recombinant cytokines as standards. The efficiency and reliability of the membrane fraction collector system was checked by collecting individual peaks during the electrophoretic separation. Individual peaks were collected by recording the migration time of each peak and then calculating its elution time (te) from the following formula:

te=(L/La)td

where L is the total length of the capillary, Ld is the capillary length to the detector and ta is the time when the peak passes the detector. Fractions were collected by interrupting the current just before the peak elution time and placing the detector end of the capillary and the electrode into a 75-~1 vial containing 10 ~1 of running buffer, placed under 25 ~1 of mineral oil. The current was reapplied and the peak forced to electromigrate into the collection vial. This process was repeated for each peak. Quantitative measurements of IL-lo~ and IL-113 were made by CHEM-ELISA on the fractions obtained from HPCE. Fractions were biotinylated by incubating with an equal volume of 50 mM N-hydroxysuccinimide-biotin for 30 min at room temperature prior to immobilization to


IL-1

0 40 Time (minutes)

Fig. 1. Electropherogram of membrane-filtered sample of conditioned medium from VIP-stimulated astroglial cultures. Samples were run in 100 mM phosphate buffer at 15 Kv for 40 min at 20"C. Detection was monitored at 200 nm, 0.02 AUF. The peak co-eluting with a murine IL-1 standard is depicted with the arrow. As described in Experimental Procedures, individual peaks were collected and then quantified by

chemiluminescence-based ELISA.

the wells of avidin-coated microtiter plates. HPCE fractions collected on Immobilon membrane were removed from the membrane by punching out defined areas of the membrane prior to direct incubation with the antiserum to the cytokines. Fifty microliters of 1:1000 dilution of alkaline phosphatase-labeled anti-cytokine antibody was added to each well and incubated overnight at 4°C. The wells were washed five times in 0.01 M phosphate-buffered saline/0.01% Tween 20, pH 7.2, before adding 250 p,l of a 25 mM solution of AMPPD chemiluminescent substrate (Tropix) to each well. 39 Following a 30-min incubation in the dark at room temperature, the chemiluminescent reaction product was read in a luminometer (Tropix) at 477 nm, analyzed by ANELISA software (Man-Tech Associates) and compared to standard curves constructed from known amounts of pure cytokines.

Determination o f lL-1 m R N A

To obtain RNA, astroglia were sub-cultured and plated at a density of 106 cells/10 cm plate. After four days in culture, the astroglia were estimated to be 80-90% confluent. Plates were washed three times with PBS, then incubated in 10 ml PBS withl ixg/ml leupeptin. Cells were then treated with 10 -1° M VIP, 10 -7 M VIP, or vehicle and incubated at room temperature for 60 min. At the end of the treatment time, cells were harvested in 5 ml Star-60 (Tel-Test "B", Friendswood, TX) and frozen. After all samples were harvested, total RNA was isolated using the acid guanidinium/phenol chloroform method. 15 The RNA samples were then reverse-transcribed and a portion of the cDNA product semi-quantitated using the polymerase chain reaction. 23,44,45 The DNA sequences of IL-let and cyclophilin were obtained from the Genebank. The primer sets were designed using Oligo software (National Biosciences, Inc., Plymouth, MN) and were synthesized by Cruachem Inc (Dulles, VA). The following primer sequences were used: 17a,30 (1) IL-lod5: 5 'TCCGGAAACAC- CAAAACTCAT 3'; (2) IL-lod3: 5 'TGGTTCCACTAGGCqTFGCTC 3'; (3) cyclophilin/5: 5 'GGTCAACCCCACCGTGTTCT 3'; (4) cyclophilin/3: 5 'TGCCATCCAGCCACTCAGTCT 3'. Cyclophilin was used as a standard to determine the amount of cDNA in each reaction. Briefly, 20% of each RNA sample was reverse-transcribed with random hexamer primers. Eight ~1 of cDNA products were subjected to PCR amplification using the primers listed. Reactions were carried out in Taq DNA polymerase buffer (50 mM KC1, 10 mM Tris-HC1, pH 8.3) containing


200 p,M dNTP, 2 mM MgCI, 5 ~M of each primer and 2.5 U Taq DNA polymerase (Boehringer Mannheim, Indianapolis, IN). Samples were overlaid with 50 fxl mineral oil to prevent evaporation. PCR amplification was carried out in a Perkin-Elmer (Norwalk, CT) N801 programmable thermal controller. The amplification program consisted of a denaturing step at 95°C for 1 min, an annealing step at 60°C for 1 rain and a synthesis step at 72°C for 1 min. Initially, PCR reactions were performed for each primer pair and 5 Ixl aliquots were removed every four cycles from 15 to 40 cycles in order to determine the kinetics of amplification. Products were separated through a 4-20% acrylamide mini-gel (Novex, San Diego, CA) and stained in 1 p~g/ml ethidium bromide (Gibco BRL, Gaithersburg, MD). Gel Marker-1 (Research Genetics, Huntsville, AL) was used as an electrophoresis marker for determination of product size. From these data, a cycle was chosen for each primer pair which was at least four cycles below the amplification plateau in order to perform semi-quantitation. For the semi-quantitative experiments, a trace of 32p-dCTP was added to the PCR buffer. Gels were dried on a Bio-Rad (Richmond, CA) model 583 gel drier and exposed to a Molecular Dynamics, Inc. (Sunnyvale, CA), storage phosphor screen for 18-24 hr. Relative band intensities were analyzed using molecular Dynamics, Inc., Image Quant software. Data reported as the intensity of the IL-la product relative to the intensity of the cyclophilin product.

RESULTS

IL-1 and neuronal survival

Dissociated spinal cord cultures were used to assess the effects of IL-la on neuronal survival. Based on the hypothesis that IL-l-like substances were in the nine-day-old test cultures and that effective concentrations were present in the medium, the strategy was to add neutralizing antiserum to IL-IoL and then assay the cultures for the number of surviving neurons after a five-day test period. As shown in Fig. 2, treatment (EC50, 1:20,000 dilution) with antiserum to IL-le~ produced a 50% loss in the number of neurons in comparison to control cultures. Control rabbit serum resulted in

110

o 100

o

~. 90 o

80

o

7 0

"~ 6 0

o

Q) 5 0 2:

40 7/// i j

0 - 4 - 3

Ant iserum (Log Dilution)

Fig. 2. Antiserum to IL-lc~ decreases neuronal survival in dissociated spinal cord cultures. Antiserum (closed circles) from rabbits injected with murine IL-I~ were added to test cultures 24 hr after plating. After the nine-day test period, cultures were fixed, stained for neuron-specific enolase and counted. Cultures treated with normal rabbit serum are shown as closed triangles. Each point is the mean of four to six determinations. Significant changes from control were observed for the ant i-IL-la at following dilutions: 1:15,000 (P<0.05) and ~1:10,000 (P<0.004). (Redrawn with permission from Brenneman et al.,

1992.)


550

500 O~

= = o

.. 450

o 400

Z

350

/

I

3 0 0 ~ - ~ I i i J

0 0.1 I 10 30 I n t e r l e u k i n - 1 a lpha (Uni t s /ml )

Fig. 3. IL-I~ effects on neuronal survival in electrically active (open triangles) spinal cord cultures are compared to those co-treated with 1 txM tetrodotoxin (TrX) to block synaptic activity (closed circles). Cultures were treated for five days, beginning on day 9 after plating. Significant increases (P<0.05) in neuronal cell counts were observed at all IL-lct concentrations >0.07 U/ml (10-12 M) in cultures co-treated with TTX as compared with cultures ~given T r X alone. No significant difference was observed between control cultures and those treated with IL-la alone. Each point is the mean of three values. Error bars

represent the standard error. (Redrawn from Brenneman et al., 1990.)

no detectable changes in the number of surviving neurons. As previously reported, 12 two additional antisera directed against IL- la also produced neuronal cell death in this culture system. The cell death associated with the anti-IL-let could be prevented by co-treatment with 10 U/ml (10 -12 M) of purified IL-ltx. 12 To more directly assess the effects of IL-let in developing spinal cord cultures, the cytokine was added to the cultures either in the presence or absence of tetrodotoxin, an agent used to suppress spontaneous electrical activity. 9 As demonstrated in Fig. 3, treatment with IL-let on electrically active cultures produced no detectable change in neuronal survival; whereas in electrically blocked cultures, IL- la produced a potent, concentration-dependent increase in neuronal survival. To further substantiate the importance of an IL-l-like substance to neuronal survival, cultures were treated with antiserum to the type I IL-1 receptor (IL-lr). 43 As shown in the Fig. 4, a significant decrease neuronal survival was evident in nine-day-old cultures after the addition of antiserum to IL-1 a. In contrast, identical treatment in cultures that were one month old produced no detectable effects on neuronal survival.

IL-1 and neuronal cell death

The previous observations indicated that the antiserum to the IL-1 receptor had a differential affect on neuronal survival that was dependent on the age of the test culture. 13 To assess the possibility that IL-1 itself might have an effect on neuronal survival that was conditional on the age of the culture, a series of experiments was conducted that examined the effect of IL-1 on one-month-old cultures. Treatment of mature spinal cord cultures with low concentrations (10-13-10 -1° M) of recombinant human IL-la produced significant losses in the number of surviving neurons 13 (Fig. 5) the deleterious action of IL-1 was not apparent in cultures treated with concentrations >-- 1 nM. Thus, opposite pharmacological responses to IL-lot were observed in spinal cord cultures that were dependent on the age of the culture.

VIP and IL-1 interaction

VIP, a substance with recognized survival-promoting action in dissociated spinal cord cultures, was tested for its ability to protect neurons from cell death produced by antiserum to IL-la.


5 5 0

-I

.,.o

0 r..)

o 4 0 0

Z

3 5 0

soo 7"/ ~ ~ '

0 - 4 - 3 - 2

A n t i s e r u m t o I L - I R e c e p t o r (Log D i l u t i o n )

Fig. 4. Antiserum to a peptide from the murine lymphocyte IL-I receptor produced neuronal cell death in nine-day-old spinal cord cultures (closed circles) but not in one-month-old cultures (open triangles). The duration of treatment was five days. Each point is the mean of three dcterminations-+SE. Significant

decreases in cell counts for the younger cultures were observed at all dilutions ---1:10,000 (P<0,01).

O

O L

Z

4 0 0

300

20o 7//' J J '

- 14 - - 1 2 - 1 0 - 8

I n t e r l e u k i n - t a l p h a Log (M)

Fig. 5. Recombinant human IL-la decreases neuronal survival in one-month-old spinal cord-dorsal root ganglion cultures. Duration of treatment was five days. Significant decreases in cell number from control cultures were observed at concentrations between l and 100 pM (P<0.002). Each value is the mean_+SE

of three determinations. (Redrawn from Brenneman et al., 1993.)

194 D . E . B r e n n e m a n et al.

400

300 c~

,..1

c 200

o

~ 100 . r , q

0 0

O

- - 1 3 - - 1 2 - - 1 1 - - 1 0 - 9 - 8 - - 7

V a s o a c t i v e I n t e s t i n a l P e p t i d e Log (M)

Fig. 6. Release of IL-1 into the medium after VIP treatment of cerebral cortical astrocyte cultures. IL- la (closed circles) and IL-113 (open circles) were determined after treatment for 1 hr with various concentrations of VIP. Significant increases from spontaneous release were observed at concentrations->10 -13 M

for IL-lc~ (P<0.001) and at concentrations-> 10-11 M for ILt3 (P<0.05).

.,=~

o

~3

o

co

cJ

0

o ~=~

500

400

300

200

100

0

G

,.___~ili j l

/ / / I I I I k I I

- - 1 3 - - 1 2 - - 1 1 - - 1 0 - -g - - 8 - - 7

V a s o a c t i v e I n t e s t i n a l P e p t i d e Log (M)

Fig. 7. Cytosolic content of astroglial cultures treated with VIP: comparison of IL-let (closed circles) and IL-113 (open circles). Significant decreases in IL-lc~ content were observed at all VIP concentrations----- 10-12 M. For IL-11~, significant increases from control were observed at 10 -13 and 10 -7 M VIP (P<0.001); in

contrast, significant decreases from control were observed at 10 -10 and 10 -9 M VIP (P<0.002).


( a )

cut) ,,...,,

T

¢)

350

300

250

200

150

100

50

e_..._.~ ._..r-.~O-.---.--.~, o .--=...~ 0 o t i t t t J I i i i

10 20 30 40 50 60 70 80 90 100

Time (Min)

(b ) 250

2 0 0

150 ¢)

T 100

op,,~

50

/ ,

T/ 4, :=

8~--v--8 o o - o, o

0 10 20 30 40 50 60 70 80 90 100

T i m e ( M i n )

Fig. 8. (a) Time-course of IL-lc~ release f rom VIP-st imulated astroglial cultures. The concentration of cytokines in the medium is compared after t rea tment with two concentrat ions of VIP: 10 - ]° M (closed circles) or 10 -7 M (closed triangles). Spontaneous release in control cultures is shown as open circles. Significant increases from control were observed after 15 rain, with either concentrat ion of VIP (P<0.001). Each value is the mean of four de te rmina t ions_SE. (b) Time-course of IL-113 release from VIP-st imulated astroglial cultures. The symbols are the same as in (a). Significant increases from control were observed after 15 min with both 10 -1° M VIP (P<0.05) and 10 -7 M VIP (P<0.001). Each value is the mean of four

determinations_+SE.


Addition of 10 -1° M VIP was found to completely prevent neuronal cell death associated with treatment with the neutralizing antiserum to IL-le~. 12 As observed previously, addition of VIP to electrically active spinal cord cultures produced no significant change in the number of surviving neurons in comparison to controls.

VIP as a secretagogue for IL-1

The previous experiments suggested that IL-1 and VIP action were linked. To test the possibility that VIP may act as a secretagogue for IL-1 from glial cells, a series of experiments were conducted with a neuron-free model system which contained no endogenous VIP: astroglial cultures from rat cerebral cortex. 28 This preparation is widely used because it contains a relatively high purity of astroglia vs other cell types. Treatment with VIP for 1 hr produced a concentration-dependent increase in the amount of IL-IoL and IL-1 [3 recovered in the culture medium (Fig. 6). Although both cytokines were increased, there were significant differences in their responses. IL-lot was released at a lower concentration of VIP (EC50:0.05 nM) than that observed for IL-113 (EC50:1 nM). In addition, the maximal amount of IL-IoL released was 60-70% greater than that for IL-113. In the same experiments, the amount of IL-le~ and IL-l[3 was also measured in the cytosolic fraction of the astroglial cultures (Fig. 7). During the 1-hr incubations with VIP, a progressive loss of cellular IL-le~ was observed. The maximum depletion in cellular IL-le~ after VIP treatment was about 75% of the total in control cultures. The plateau responses for both cytosolic and secreted IL-la occurred at 1 nM VIP. The cytosolic concentration of IL-113 was different than that observed for IL-la. A more complex profile was observed for IL-113, with low concentrations of VIP producing a small depletion in cellular content and higher concentrations producing a significant increase in IL-113 immunoreactivity.

The kinetics of VIP-induced increases in medium IL- la and IL-113 are shown in Fig. 8(a) and (b), respectively. For both cytokines, significant increases in the medium were detected within 15 min of treatment with either 0.1 nM or 0.1 ixM VIP. Maximal secretion for both IL-ls was observed within 1 hr of treatment with VIP. Although the kinetics of secretion were similar as assessed by the medium contents, the cytosolic changes induced by VIP were very different between the two interleukins. As shown in Fig. 9(a), a significant depletion of cytosolic IL-la was observed within 45 min for 0.1 I~M VIP and within 30 min in cultures treated with 0.1 nM VIP. In the case of both cytokines, a plateau was reached within an hour; longer incubations resulted in no further depletion of cytosolic cytokine levels. In contrast, analysis of the same cytosolic samples for IL-I[3 revealed that VIP treatment resulted in no apparent depletion of cytosolic IL-113 at any of the times tested; rather, small but significant increases in cytosolic IL-113 were observed early after the initiation of VIP treatment (Fig. 9b).

IL-1 gene expression

The aforementioned kinetic experiments suggested that VIP treatment might affect the synthesis/processing of IL-la in the astroglial cultures. To begin testing this possibility, the mRNA for IL-Iot was assessed semi-quantitatively by reverse transcriptase-polymerase chain reaction. A time-course of mRNA levels for IL-la and cyclophilin after VIP treatment are shown in Fig. 10. Levels of mRNA for IL-lot relative to cyclophilin were decreased by 46___10% (P<0.05) after 30 min treatment with 10 -7 M VIP and by 70___5% (P<0.05) in comparison to controls after 1 hr incubation with 10 -7 M VIP. After 2 hr of VIP treatment, the changes in IL-let mRNA were no longer apparent. Cyclophilin mRNA was not affected by VIP treatment in comparison to controls at any time interval examined.

DISCUSSION

A fundamental dilemma of IL-1 action in the nervous system has been addressed: is this cytokine neurotrophic or neurotoxic? Previous studies have indicated that a variety of interleukins may be both neurotrophic and neurotoxic, depending on culture conditions, concentration and duration of exposure. 2 Our results with IL-lot in CNS cultures support this conclusion; IL-1 may be an integral component of a permissive, survival-promoting system that has an important role in determining which neurons live and die during the course of development in the central nervous system; and

IL-1 and V I P regula te n e u r o n a l survival in CNS 197

(a) 400

.u-i

IX:: z , ,

200

T

= 100 0 r~ 0

0 10 20 30 40 50 60 70 80 90 1 0 0

Time (Min)

(b) 250

200

0-,

"~ 150

¢1

, . 100 I

,..-1

0 50

0

0 I I I I I 1 1 I I P

0 10 20 30 4.0 50 60 70 80 90 100

T i m e ( M i n )

Fig. 9. (a) Time-course of IL- la content in the cytosol of astroglial cultures treated with VIP. Symbols are • - 1 0 as described in Fig. 8(a). In comparison to control cultures taken at the same time, 10 M VIP produced

significant decreases (P<0.01) at all time points longer than 30 min. Treatment with 10 -7 M resulted in decreases in content at times->45 min (P<0.001). These data are derived from the same cultures as those presented in Fig. 8(a). (b) Time-course of IL-113 content in the _c~¢tosol of astroglial cultures treated with VIP. Symbols are the same as in Fig. 8(a). Treatment with 10- M VIP produced small but significant increases in IL-113 observed after 10 and 20 min (P<0.01). A significant decrease in IL-113 was observed

after treatment of 1 hr with 10 -1° M VIP. Each value is the mean of four determinations_+SE.


SIZE (bp)

-1000 -700 -500 -400

-300

-200

-100

1 2 3 4 5 6 7 8 9 1 0 1 1 1 2 1 3 Fig. 10. Kinetics of IL - l a and cyclophilin gene expression in astrocyte cultures following VIP treatment. Cultured astrocytes from rat cerebral cortex were treated with 10 -7 M VIP or vehicle. At various time intervals, astrocytes were harvested and total R N A extracted. Reverse transcription was performed on 200 ng of each sample, followed by polymerase chain reaction amplification using primers specific for either cyclophilin or IL-la . Reactions were stopped at a cycle below the amplification plateau. Products were separated on 4-20% acrylamine electrophoresis and stained with ethidium bromide. Lances 1-6 are cyclophilin and lanes 8-13 are IL-la. Samples are as follows: lanes 1 and 8, 30 min control; lanes 2 and 9, 30 rnin after 10 -7 M VIP treatment; lanes 3 and 10, 1-hr control; lanes 4 and 11, 1-hr after 10 -7 M VIP treatment; lanes 5 and 12, 2-hr controls; lanes 6 and 13, 2 hr after VIP treatment. The sizing standards are

in lane 7.

IL-1, if not highly regulated, may be an extremely toxic substance that can produce damage and death in the mature nervous system. Although the mechanisms of this dual action are not yet evident, the experiments presented here do at least give these findings a developmental context.

Previous studies indicated that cell death was produced in spinal cord cultures by the addition of neutralizing antiserum to IL-112 or the IL-1 receptor. These data suggested that IL-1 or an IL-l-like substance was endogenous to these cultures and that interruption of IL-1 action produced neuronal cell death. However, when IL- la was applied directly to the cultures, no apparent increase in neuronal survival was observed unless the test cultures were electrically blocked. Taken together, these studies strongly suggest that IL-1 was present in the these cultures and that it was there at an effective concentration. Therefore application of additional IL-la was found to be ineffective. The effectiveness of IL-I~ treatment in electrically blocked cultures may be due to decreased medium concentrations of IL-loL produced by the inhibition of VIP release. 4 These studies indicate that to demonstrate the importance of IL-1 to neuronal survival in CNS cultures, the action of this cytokine must be interrupted. The simple addition of IL-1 to test cultures will not definitively establish its potential as a neurotrophic agent. Thus, IL- la like VIP, must be blocked in these cultures in order to reveal its survival-promoting properties. This strategy should be extended to any substance that is suspected of having a permissive role in cellular or intercellular processes. This orientation is of particular importance in complex test systems that involve multiple, interacting cell types.

Sources of the enigmatic effects of IL-la on neuronal survival are: (1) IL-la 's developmental and cellular context; and (2) IL-la 's unusual pharmacology. Severallines of evidence have indicated that the effects of IL-lc~ were dependent on the age of the culture. The fact that antiserum against the IL-1 receptor only had an effect on young cultures and not older cells suggests a fundamental alteration in the IL-1 system or a change in the requirements of the target cells. The most facile explanation of these data is that IL-la was present in effective concentrations only in young cultures and not in the older cultures. In non-stimulated cultures, IL-1 was very difficult to detect. The fact that exogenous IL-la produced neuronal cell death in the older cultures indicates that functional receptors were present. However, other factors could also play a role, such as the presence of the endogenous IL-1 antagonist 3,34 or the presence of soluble IL-1 receptors 16 that could effectively attenuate the biological response to IL-1. Another confounding aspect of IL-1 is its presence in multiple cell types including astroglia, microglia and neurons. As previously cited,


the regulation of IL-1 in these various cell types is different, 25 and it may be that cytokines and growth factors released from one cell type certainly influence other cell types.

VIP treatment of astroglial cultures produced a 20-fold increase in the amount of IL-la in the medium. Our experiments do not indicate if this is a direct action of VIP or whether other substances may mediate the secretion of IL-1. Preliminary studies 8 have indicated that IL-l~x and IL-113 are just two of many cytokines released by VIP. In this context, it is possible that other cytokines may mediate the release of IL-1.

In astroglial cultures treated with VIP, several differences between IL-la and IL-113 were apparent. The release of IL-let into the medium was significantly greater than IL-113, as was the cellular content. The release of both cytokines was rapid, with significant increases observed within 15 min after the initiation of VIP treatment. These data imply that the cytokine is readily available for secretion and that induction of the IL-ls was not necessary before secretion was possible. Additional differences between the two cytokines were the depletion of IL-la immunoreactivity after VIP treatment as compared to virtually no change in the concentration of IL-113. The reason for this dichotomy of responses is not apparent from the current studies. Several explanations could account for such differences. One possibility is that different cells contain the two cytokines; i.e. astrocyte heterogeneity. Alternatively, the functions and the regulation of the two cytokines may be different, IL-113 perhaps having a role that is linked more closely to infection or trauma and therefore more responsive to stimulus or products from infectious agents. In contrast, IL-lo~ may have a role in development or repair that may be regulated by another set of stimuli. Whatever the physiological rubric, these studies suggest that the two molecular forms of IL-1 have distinctive and developmentally defined roles not only in immune responses, but also in regulation of embryonic and nervous system development.

Our studies have shown that IL-la should be viewed as having distinct, and quite possibly, opposite functions that vary according to the age of the nervous system. Furthermore, our results show that IL-1 can be regulated by VIP, a substance that has been shown to co-ordinate growth of an entire embryo during mid-gestation. 22a These conclusions predict that IL-1, and possibly many other VIP-associated cytokines, may play important roles in mediating the normal development of the brain during critical periods of organogenesis.

REFERENCES

1. Aloisi F., Rosa S., Testa U., Bonsi P., Russo G., Peschale C. and Levi G. (1994) Regulation of leukemia inhibitory factor synthesis in cultured human astrocytes. Z lmmunoL 152, 5022-5031.

2. Araujo D. M. and Cotman C. W. (1993) Trophic effects of interleukin-4, -7 and -8 on hippocampal neuronal cultures: potential involvement of glial-derived factors. Brain Res. 600, 49-55.

3. Arend W. P. (1991) Interleukin-1 antagonist. A new member of the interleukin-1 family. J. clin. lnvest. 88, 1445-1451. 4. Brenneman D. E. and Eiden L. E. (1986) Vasoactive intestinal peptide and electrical activity influence neuronal survival.

Proc. natn. Acad. Sci. U.S.A. 83, 1159-1162. 5. Brennman D. E,, Eiden L. E. and Siegel R. E. (1985) Neurotrophic action of VIP on spinal cord cultures. Peptides 6

(Suppl. 2), 35-39. 6. Brenneman D. E., Fitzgerald S. and Litzinger M. J. (1985) Neuronal survival during electrical blockade is increased by

8-bromo cyclic adenosine, 3', 5' monophosphate. J. PharmacoL exp. Ther. 263, 402-408. 7. Brenneman D. E., Fitzgerald S. and Nelson P. G. (1984) Interaction between trophic action and electrical activity in

spinal cord cultures. Devl Brain Res. 15, 211-217. 8. Brenneman D. E., Hill J. M., Gozes I. and Phillips T. M. (1994) Vasoactive intestinal peptide increases the secretion of

eight cytokines from cerebral cortical astrocytes. Soc. Neurosci. Abstr. 20, 695. 9. Brenneman D. E., Neale E. A., Habig W., Bowers L. M. and Nelson P. G. (1983) Developmental and neurochemical

specificity of neuronal death produced by electrical blockade in dissociated spinal cord cultures. Devl Brain Res. 9, 211-217.

10. Brenneman D. E., Neale E. A., Foster G. A., d'Autremont S. and Westbrook G. (1987) Nonneuronal cells mediate neurotrophic action of vasoactive intestinal peptide. J. Cell Biol. 104, 1603-1610.

11. Brenneman D. E., Nicol T., Warren D. and Bowers L. M. (1990) Vasoactive intestinal peptide: a neurotrophic releasing agent and an astroglial mitogen. J. Neurosci. Res. 25, 386-394.

12. Brenneman D. E., Schultzberg M.. Bartfai T. and Gozes I. (1992) Cytokine regulation of neuronal survival. J. Neurochem. 58, 454-460.

13. Brenneman D. E., Page S. W., Schultzberg M., Thomas F. S., Zelazowski P., Burnet P., Avidor R. and Sternberg E. M. (1993) A decomposition product of a contaminant implicated in L-tryptophan eosinophilia myalgia syndrome affects spinal cord neuronal cell death and survival through stereospecific, maturation and partly interleukin-l-dependent mechanisms. J. Pharmacol. exp. Ther. 266, 1029-1035.

14. Chen Y.-F., Fuchs M. and Carson W. (1993) Post-capilary ImmobilonTM-p membrane fraction collection for capillary electrophoresis. Biotechniques 14, 50-56.

200 D . E . B r e n n e m a n et al.

15. Chomczynski P. and Sacchi N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol- chloroform extraction. Analyt. Biochem. 162, 156-159.

16. Colotta F., Re F., Muzio M., Bertini R., Polentarutti N., Sironi M., Girl J. G., Dower S. K., Sims J. E. and Mantovani A. (1993) Interleukin-1 type II receptor: a decoy target for IL-1 that is regulated by IL-4. Science 26L 472-475.

17. daCunha A., Jefferson J. J., Tyor W. R., Glass J. D., Jannotta F. S. and Vitkovic L. (1993) Control of astrocytosis by interleukin-1 and transforming growth factor-beta 1 in human brain. Brain Res. 63L 39-45.

17a. Danielson P. E., Forss-Petter S., Brow M. A., Calavetta L., Douglass J., Milner R. J. and Sutcliff J. G. (1988) A cDNA clone of the rat mRNA encoding cyclophilin. DNA 7, 261-267.

18. Dinarello C. A. (1984) Interleukin-1. Rev. infect. Dis. 6, 51-95. 19. Giulian D., Baker T. J., Shih L. N. and Lachman L. B. (1986) Interleukin-1 of the central nervous system is produced

by ameboid microglia. J. exp. Med. 164, 594-604. 20. Giulian D., Woodward J., Young D. G., Krebs J. F. and Lachman L. B. (1988) Interleukin-1 injected into mammalian

brain stimulates astrogliosis and neovascularization. J. Neurosci. 8, 2485-2490. 21. Gottsehall P. E., Tatsuno I. and Arimura A. (1994) Regulation of interleukin-6 (IL-6) secretion in primary cultured rat

astrocytes: synergism of interleukin-1 (IL-1) and pituitary adenylate cyclase activating polypeptide (PACAP). Brain Res. 637, 197-203.

22. Gozes I., McCune S. K., Jacobson L., Warren D,, Mody T. W., Fridkin M. and Brenneman D. E. (1991) An antagonist to vasoactive intestinal peptide affects cellular functions in the central nervous system. J. Pharmacol. exp. Ther. 257, 959-966.

22a. Gressens P., Hill J. M., Gozes I., Fridkin M. and Brenneman D. E. (1993) Growth factor function of vasoactive intestinal peptide in whole cultured mouse embryos. Nature 362, 155-158.

23. Kawasaki E. S. and Wang A. M. (1989) Detection of gene expression. In PCR Technology: Principles and Applications of DNA Amplifications (ed. Erlich H. A.), pp. 8%97. Stockton Press Inc., New York.

24. Kushima Y., Hama T. and Hatanaka H. (1992) Interleukin-6 as a neurotrophic factor for promoting the survival of cultured catecholaminergic neurons in a chemically defined medium from fetal and postnatal rat midbrains. Neurosci. Res. 13, 267-280.

25. Lee S. C., Liu W., Dickson D. W., Brosnan C. F. and Berman J. W. (1993) Cytokine production by human fetal microglia and astrocytes. Differential induction by lipopolysaccharide and IL-1 beta. J. Immunol. 1511, 265%2667.

26. Lomedico P. T., Killan P. L., Gubler U., Stern A. S. and Chizzonite R. (1986) Molecular biology of interleukin-1. Cold Spring Harb. Syrup. quant. Biol. 5L 631-635.

27. Lomedico P. T., Gubler U., Hellman C. P., Dukovich M., Giri J. G., Pan Y. E., Collier K., Seminow R., Chua A. O. and Mizel S. B. (1984) Cloning and expression of murine interleukin-1 cDNA in Escherichia coli. Nature 315, 641-647.

28. McCarthy K. D. and de Vellis J. (1980) Preparation of separate astroglial and oligodendroglial cell cultures from rat cerebral tissue. J. Cell Biol. 85, 890-898.

29. Nashabeh W. and El Rassi Z. (1991) Capillary zone electrophoresis of alpha 1-acid glycoprotein fragment from trypsin and endoglycosidase digestions. J. Chromatogr. 536, 31-42.

30. Nishida T., Nishino N., Takano M., Sekiguchi Y., Kawai K., Mizuno K., Nakai S., Masui Y. and Hirai Y. (1989) Molecular cloning and expression of rat interleukin-1 alpha cDNA. J. Biochem. 105, 351-357.

31. Phillips T. M. and Kimmell P. L. (1994) High-performance capillary electrophretic analysis of inflammatory cytokines in human biopsies. J. Chromatogr. 656, 25%266.

32. Phillips T. M. (1993) Measurement of tissue cytokines by high-performance capillary electrophoresis. LC-GC1L 36-42. 33. Ransom B., Neale E. A., Henkart M., Bullock P. N. and Nelson P. G. (1977) Mouse spinal cord in cell culture. I.

Morphology and intrinsic neuronal electrophysiological properties. J. Neurophysiol. 40, 1132-1150. 34. Relton J. K. and Rothwell N. J. (1992) Interleukin-1 receptor antagonist inhibits ischemic and excitotoxic neuronal

damage in the rat. Brain Res. Bull. 29, 243-246. 35. Robertson S. A. and Seamark R. F. (1992) Granulocyte-macrophage colony stimulating factor (GM-CSF): one of a

family of epithelial cell-derived cytokines in the pre-implantation uterus. Reprod. Fertil. Dev. 4, 435-448. 36. Romijn H. J., Habets A. M. M. C.,Mud M. T. and Wolters P. S. (1982) Nerve outgrowth, synaptogenesis and bioelectrical

activity in rat cerebral cortex tissue cultured in serum-free chemically defined medium. Devl Brain Res. 2, 140-146. 37. Rothwell N. J. and Luheshi G. (1994) Pharmacology of interleukin-1 actions in the brain. Adv. Pharmacol. 25, 1-20. 38. Rothwell N. J. and Relton J. K. (1993) Involvement of interleukin-1 and lipocortin-1 in ischemic brain damage.

Cerebrovasc. Brain Metab. Rev. 5, 178-198. 39. Schaap A. P., Akhavan H. and Romano L. J. (1989) Chemiluminescent substrate for alkaline phosphatase: application

to ultrasensitive enzyme-linked immunoassays and DNA probes. Clin. Chem. 35, 1863-1864. 40. Schmechel D., Marangos P. J. and Brightman M. (1978) Neuron specific enolase is a molecular marker for peripheral

central neuroendocrine cells. Nature 276, 834~36. 41. Schultzberg M., Svenson S. B., Unden A. and Bartfai T. (1987) Interleukin-l-like immunoreactivity in peripheral tissues.

J. Neurosci. Res. 18, 184-189. 42. Sheth K. V., Roca G. L., Sedairy S. T., Parhar R. S., Hamilton C. J. and al-Abdul-Jabbar F. (1991) Prediction of successful

embryo implantation by measuring interleukin-l-alpha and immunosuppressive factor(s) in preimplantation embryo culture fluid. Fertil. Steril. 55, 952-957.

43. Sims J. E., March C. J., Cosman D., Widmer M. B., MacDonald H. R., McMahan C. J., Gmbin C. E., Wignall J. M., Jackson J. L., Call S. M,, Friend D., Alpert A. R., Gillis S., Urdal D. L. and Dower S. K. (1988) cDNA expression cloning of the IL-1 receptor, a member of the immunoglobulin superfamily. Science 241, 585-589.

44. Wang A. M., Doyle M. V. and Mark D. F. (1989) Quantitation of mRNA by the polymerase chain reaction. Proc. natn. Acad. Sci. U.S.A. 86, 9717-9721.

45. Wang A. M. and Mark D. F. (1990) Quantitative PCR. PCR protocols. A Guide to Methods and Applications (eds Innis M. A., Gelfand D. H., Sninsky J. J, and White T. J.), pp. 70-75). Academic Press, San Diego.

46. Watkins B. A., Dora H. H., Kelly W. B., Armstrong C., Potts B., Michaels F., Kufta C. V. and Dubois-Dalcq M. (1990) Specific tropism of HIV-1 for microglial cells in primary human brain cultures. Science 249, 549-553.

47. Zolti M., Ben-Raphael Z., Meirom R., Shemesh M., Bidor D., Mashiach S. and Apte R. N. (1991) Cytokine involvement in oocytes and early embryos. Fertil. Steril. 56, 265-272.

Interleukin-1 alpha and vasoactive interstinal peptide: Enigmatic regulation of neuronal survival

Documents

Transcript of Interleukin-1 alpha and vasoactive interstinal peptide: Enigmatic regulation of neuronal survival