Inhibition of glycosphingolipid synthesis ameliorates atherosclerosis and arterial stiffness in...

Dan Berkowitz and Mark RenehanSubroto Chatterjee, Djahida Bedja, Sumita Mishra, Christine Amuzie, Alberto Avolio, David Kass,

Apo E-/- Mice and Rabbits Fed a High Fat and Cholesterol DietInhibition of Glycosphingolipid Synthesis Ameliorates Atherosclerosis and Arterial Stiffness in

Print ISSN: 0009-7322. Online ISSN: 1524-4539 Copyright © 2014 American Heart Association, Inc. All rights reserved.

is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231Circulation published online April 7, 2014;Circulation.

http://circ.ahajournals.org/content/early/2014/04/07/CIRCULATIONAHA.113.007559World Wide Web at:

The online version of this article, along with updated information and services, is located on the

http://circ.ahajournals.org/content/suppl/2014/04/07/CIRCULATIONAHA.113.007559.DC1.htmlData Supplement (unedited) at:

http://circ.ahajournals.org//subscriptions/

is online at: Circulation Information about subscribing to Subscriptions:

http://www.lww.com/reprints Information about reprints can be found online at: Reprints:

document. Permissions and Rights Question and Answer available in the

Permissions in the middle column of the Web page under Services. Further information about this process isOnce the online version of the published article for which permission is being requested is located, click Request

can be obtained via RightsLink, a service of the Copyright Clearance Center, not the Editorial Office.Circulation Requests for permissions to reproduce figures, tables, or portions of articles originally published inPermissions:

at WELCH MED LIBR - JHU on September 22, 2014http://circ.ahajournals.org/Downloaded from at WELCH MED LIBR - JHU on September 22, 2014http://circ.ahajournals.org/Downloaded from at WELCH MED LIBR - JHU on September 22, 2014http://circ.ahajournals.org/Downloaded from at WELCH MED LIBR - JHU on September 22, 2014http://circ.ahajournals.org/Downloaded from at WELCH MED LIBR - JHU on September 22, 2014http://circ.ahajournals.org/Downloaded from

http://circ.ahajournals.org/content/early/2014/04/07/CIRCULATIONAHA.113.007559

http://circ.ahajournals.org/content/suppl/2014/04/07/CIRCULATIONAHA.113.007559.DC1.html

http://www.ahajournals.org/site/rights/

http://www.lww.com/reprints

http://circ.ahajournals.org//subscriptions/

http://circ.ahajournals.org/





DOI: 10.1161/CIRCULATIONAHA.113.007559

1

Inhibition of Glycosphingolipid Synthesis Ameliorates Atherosclerosis and

Arterial Stiffness in Apo E-/- Mice and Rabbits Fed a High Fat and

Cholesterol Diet

Running title: Chatterjee et al.; Glycosphingolipid inhibition ameliorates atherosclerosis

Subroto Chatterjee, PhD1; Djahida Bedja, MS2,3; Sumita Mishra, PhD1; Christine Amuzie, BS1;

Alberto Avolio, PhD3; David Kass, MD2; Dan Berkowitz, MBBCh4; Mark Renehan, BS1

1Dept of Pediatrics; 2Dept of Medicine; 4Dept of Anesthesiology and Critical Care Medicine,

Johns Hopkins University School of Medicine, Baltimore, MD; 3Australian School of Advanced

Medicine, Macquarie University, Sydney, Australia

Address for Correspondence:

Subroto Chatterjee, PhD

Johns Hopkins University Hospital

1383 Blalock Bldg.

600 N Wolfe St.

Baltimore, MD 21287

Tel: 410-614-2518

Fax: 410-955-3247

E-mail: [email protected]

Journal Subject Codes: Vascular biology:[96] Mechanism of atherosclerosis/growth factors, Atherosclerosis:[90] Lipid and lipoprotein metabolism, Treatment:[118] Cardiovascular pharmacology

Alberto Avolio, PhD3; David Kass, MD2; Dan Berkowitz, MBBCh4; Mark RRRenennehehehanann,, BSBSBS11

1DeDeDeptptpt ooof f f PePePediatatatririr ccs; 2Dept of Medicine; 4Depttt oooff f AnA esthesiologygy andndd CrCC itical Care Medicine,

JJJohhnhns Hopkkinins s UnUnUnivvveree sisiitytyty SSSchchchooool l ofofof MMMeededicicicinine, BBBaalltimomomorrere,, MDMDMD;; 3AuAuAustststrarar lliannn SSSchhchooooooll l ofofof AAAdvdvdvananancecc d

MMeMedidicicic nnene,, MaMaMacqcqquuauaririeee UUnUnivivvererrsisitytty,,, SySyydnnneyeyey,, AuAuAuststrraralilia a

AdAdddress ffor CCorrespo dndence:

at WELCH MED LIBR - JHU on September 22, 2014http://circ.ahajournals.org/Downloaded from



2

Abstract

Background—Glycosphingolipids are integral components of the cell membrane and have been

shown to serve as messengers, transducing growth factor initiated phenotypes. Here we have

examined whether inhibition of glycosphingolipid synthesis could ameliorate atherosclerosis and

arterial stiffness in transgenic mice and rabbits.

Methods and Results—Apolipoprotein E-/- mice (12 weeks of age, n = 6) were fed regular chow or

a western diet (1.25% cholesterol, 2% fat). Mice were fed 5mg/kg (mpk) or 10mpk of an inhibitor of

glycosphingolipid synthesis, D-threo-1-phenyl-2-decanoylamino-3-morpholino-1-propanol

(D-PDMP), solubilized in vehicle (5% Tween-80 in PBS) and the placebo group received vehicle

only. At 20 and 36 weeks of age, serial echocardiography was performed to measure aortic intima

medial thickening (IMT). Aortic pulse wave velocity (PWV) measured vascular stiffness. Feeding

mice a western diet markedly increased aortic PWV, IMT, oxidized LDL, Ca2+ deposits, and

glucosyl- and lactosylceramide synthase activity. These were dose-dependently decreased by

feeding D-PDMP. In liver, D-PDMP decreased cholesterol and triglyceride levels by raising the

expression of SREBP2, LDL-r, HMGCo-A reductase, and cholesterol efflux genes (e.g., ABCG5,

ABCG8). D-PDMP affected VLDL catabolism by increasing the gene expression for LPL and

VLDLr. Rabbits fed a western diet for 90 days had extensive atherosclerosis accompanied by a

17.5-fold increase in total cholesterol levels and a 3-fold increase in lactosylceramide levels. This

was completely prevented by feeding D-PDMP.

Conclusions—Inhibition of glycosphingolipid synthesis ameliorates atherosclerosis and arterial

stiffness in ApoE-/- mice and rabbits. Thus, inhibition of glycosphingolipid synthesis may be a

novel approach to ameliorate atherosclerosis and arterial stiffness.

Key words: APOE, atherosclerosis, imaging, glycosphingolipids, sphingolipids

medial thickening (IMT). Aortic pulse wave velocity (PWV) measured vascular stifffnesess.s Feeedidinng

mice a western diet markedly increased aortic PWV, IMT, oxidized LDL, Ca2+ deppeposssiitss,s, aandndnd

glucosyl- and lactosylceramide synthase activity. These were dose-dependently decreased by

feedinng g D-D PDPDMPP.. InIn liver, D-PDMP decreased cchoholelesterol and triglycereridide levels by raising the

exexxprprpreesessis onn ooof f f SRREBEBP2P2, , LDLDL-L r,r, HHMGMGCoC -AA rredducucttaassee, annd d chcholessteteterrol efefflfluxu ggeneneses ((e.g.g.,, ABA CGCG5,

AABCCCG8). D-PDPDMPMPMP aafffffececctetedd d VLVLVLDLDLL ccaattabbbolisssmmm byy innncreeeaasasiningg ththt e e geeene eeexpppreresssssiioion n fofofor r LPLPPL L L anandd d

VLVLVLDLDLDLr.r. RRababbbibib tsts ffeeded aa wwesesterrnrn dddieiet t fofofor 90900 ddayayayss hahaddd eexexteteennssiviveee aatatheheerorooscsclelerrorosisis s acacccocompmpmpaaanieieedd d byby a

17.55-ffolold inincreae se iin n tototal l chc ololesesteeror l levevelsls aandnd aa 3-folold d inincrcreaeases iin n lalactctosylyly ceeraramimidde lleve elels.s TThiiss

was comppleleteteelylyly ppprereveveentntedeed bbby y fefeededdiining g D-DD PDPDP MPMPMP.




3

Introduction

Atherosclerosis contributes to nearly one half of the mortality in the western world and is growing

in epidemic proportions in rapidly developing countries in Asia. High levels of blood cholesterol,

high blood pressure, obesity, diabetes, stress, and lifestyles including smoking are among the risk

factors contributing to this alarming increase in this disease. While several therapeutic modalities

including cholesterol synthesis inhibitors (family of statins), cholesterol absorption inhibitor

(ezetimibe), blood pressure lowering drugs, platelet adhesion inhibitors and many more are either

prescribed alone and/or in combination, there is a need for novel approaches to mitigate the

initiation and progression of atherosclerosis1. However, these therapeutic modalities do not

decrease atherosclerotic plaque burden. A relationship between high blood levels of cholesterol

and glycosphingolipids was suggested several decades ago2-7. Subsequently, a tighter correlation

between the load of LDL cholesterol and GSL/lactosylceramide shedding in urinary proximal

tubular cells in patients with the homozygous form of familial hypercholesterolemia was reported3.

D-PDMP is an analog of glucosylceramide and was synthesized to inhibit glucosylceramide

synthesis in patients with Gaucher’s disease. However, we observed that this compound could

directly inhibit the activity of purified lactosylceramide synthase7. D-PDMP is a small molecular

weight compound and is well tolerated by experimental animals e.g. mice, rats, rabbits up to 10

times the effective dose. In mice, the effective dose of D-PDMP is 10 mg per kg (mpk) body

weight when given orally compared to the use of 100mpk of various adamanate derivatives used

by other investigators8, 9. Since D-PDMP turnover time is a short ~52 min in mice10, it is rapidly

detoxified and excreted with little or no side effects. Delivery of D-PDMP by oral gavage, or

intraperitoneal injection, has no effect on appetite and overall wellbeing of the experimental

animals. We report here that feeding a western diet to ApoE-/- mouse and normal rabbits leads to

decrease atherosclerotic plaque burden. A relationship between high blood levellsss ofoff chohoholelelestststerere ool

and glycosphingolipids was suggested several decades ago2-7. Subsequently, a tighter correlation

beetwtwweeeeeenn thththe e e lloloaddd ooof f LDL cholesterol and GSL/laaacctc ooosylceramide sshehh ddddininingg in urinary proximal

uubuuulal r cells inn ppatatieientntts s wiwiwiththth ttthehhe hhomomomoozzyyggouus ffformmm oof ffafammimililiialall hhyyypeererchchholoo eesesteteeroroolelemimimia a wawawas rrerepopoortrtrted

D-D-PDPDPDMPMPM iisss aanan aananaalologg g ofoff ggluuccoc sysysylclclceereramammididideee ananandd d wwwasss sysyyntntthehehessizezezed d tooo iiinhnhnhibibitit ggglulul cococ sysysylclclcerramamamidide ee

ynthesis in pppatatatieiei ntntnts s s wiwiw ththt GGGauauauchhhererer’sss ddisisseaeaeasesese.. HoHoHowewewevevev r, wwwee e obobobssserererveveed d d thththatatat ttthihihis s cococompmpmpououound could




4

extensive atherosclerosis, vascular wall thickness and stiffness and increase in the arterial levels of

glucosylceramide and lactosylceramide. Feeding these animals D-PDMP dose-dependently

ameliorates atherosclerosis and vascular stiffness.

Materials and Methods

Animals and Treatments

Apolipoprotein E-deficient (ApoE-/-) male mice aged 11 weeks (Jackson Labs, Bar Harbor, Me)

were purchased and baseline physiological parameters were measured prior to further

experimentation. At the age of 12 weeks, the ApoE-/- mice were started on a high fat and high

cholesterol diet (HFHC) of 4.5kcal/g, 2.0% fat, and 1.25% cholesterol (D12108C, Research Diet

Inc., New Brunswick, NJ) for 20 to 36 weeks with and without treatment of D-PDMP (5mpk, 10

mpk) and compared to control mice fed only chow diet and placebo fed HFHC plus vehicle. Food

was rationed once a week to estimate the weekly growth rate and food intake. Physiological

studies were performed at around 12, 20 and 36 weeks. Tissues were harvested at 12, 20 and 36

weeks of age for molecular and histopathological studies.

D-PDMP was purchased from Matreya LLC (Pleasant Gap, PA). All other chemicals were

purchased from Sigma-Aldrich (St. Louis, MO) unless mentioned otherwise. Animals were

subject to anthropometric measurements (body weight, percent body fat) and physiological

measurements [blood pressure; ultrasound to measure aortic intima-media thickening (AoIMT);

pulse wave velocity (PWV), a measure of arterial stiffening and arteriosclerosis)]. A group of mice

(n=5) were euthanized to obtain baseline values for aortic tissue and blood samples were collected.

The rest of the mice were divided into several groups. These were: Placebo (treated with vehicle

only 5%Tween-80 in phosphate buffered saline), 5mpk of D-PDMP solubilized in vehicle, and

cholesterol diet (HFHC) of 4.5kcal/g, 2.0% fat, and 1.25% cholesterol (D12108CCC,, ReReR sesesearararchchch DDiet

nc., New Brunswick, NJ) for 20 to 36 weeks with and without treatment of D-PDMP (5mpk, 10

mpmppk)k)k) aaandndnd cccomomompaaarereredd to control mice fed only chooow ww dddiet and placebobob fededd HHHFHC plus vehicle. Food

wwass s rar tioned ooncncce a wwweekekek ttto o esesestitimmamattete ttthhee weeeeekkkly ggrrrowwtwthhh raratete aandndd ffooood dd innntaakekeke.. PhPhyysysioioiololologigiicacal ll

ttudududieieesss wewererere ppererffoformrmr eeed aat t arrououo ndndnd 11122,2, 2220 00 anananddd 363636 wwweeeekkss.s TTTisisissusuuesese wwwererereee hhharrvvesesstetet dd d atatt 1112,2, 2220 0 ananddd 33636

weeks of agege fffororor mmmololo ecece uluu ararr aaandndnd hhhisisi tototopaaathththololologogogicicicalall ssstutuudid eseses.




5

10mpk of D-PDMP solubilized in vehicle. Vehicle and D-PDMP was delivered daily by oral

gavage. The physiological measurements were repeated at 20 and 36-week intervals and then the

mice were euthanized. New Zealand white male rabbits (7lbs) were fed rabbit chow supplemented

with 0.2% cholesterol and 14% coconut oil with and without 10mpk D-PDMP for 90 days. At 1, 2,

3 and 4 months, 5mL of blood was drawn from the ear vein. Serum was prepared and total

cholesterol levels were measured at each time point. Lactosylceramide levels were measured at 3

months. All experimental protocols were approved by the Committee for Animal Care and Use at

the Johns Hopkins University.

Glycosyltransferase Assays

Aortic tissue was homogenized in Tris buffer (pH 7.8) and centrifuged at 10,000 rpm for 10

minutes. The supernatant was used as a source for enzyme. [3H]UDP-Gal (American

Radiolabeled Chemicals, St. Louis, MO) served as the nucleotide sugar donor in LacCer synthase

assay and [3H] UDP-Glc served as the nucleotide sugar donor in GlcCer synthase assay. The

details of these assays have been described previously11, 12. All assays were conducted in triplicate

from 3 to 5 aortic samples from mice in each group.

Measurement of Atherosclerotic Lesions

Trans-thoracic echocardiography was performed in conscious mice using the 2100 Visualsonic

ultrasound device (Toronto, Ontario, Canada), equipped with a 40MHz linear transducer

respectively13, 14. The aorta was viewed in the two-dimensional (2D) mode and LV viewed along

the parasternal long axis. The intima-media thickness (IMT) was measured from the ascending

aortic wall and computed as the difference between external (Ao-ex) and internal (Ao-int)

diameters.

Inner ascending aortic diameter was measured from the inner-to-inner edge and the

Aortic tissue was homogenized in Tris buffer (pH 7.8) and centrifuged at 10,000 0 rprpm mm fofofor rr 101010

minutes. The supernatant was used as a source for enzyme. [3H]UDP-Gal (American

RaRadididiolololabababelelelededed Chehehemmmicals, St. Louis, MO) served d asaa tthe nucleotidee sus gagar rr dddonor in LacCer synthase

assaaay y and [3H]H] UUUDDPDP-G-G-Glclcc ssserererveveved d asasas ttthehee nnnucleleeootidee ssuugaaar r dodonononor r ininn GGlGlcCcCCerr ssynynynthththasaseee asasssasaay.. TTTheheh

dedetatatailillsss ofof tthehehesese aasssayayss hahaaveve bbbeeeennn dededescscririibebeedd d ppprevevevioiooussslyly11,11, 1212. . AlAllll l asasssasaaysysy wwweerere e ccocondndn ucucucteteted iinin ttririppplicccata e

from 3 to 5 aoaoortrtrticici sssamamamplplples fffroroom m m mimim cecece iin n n eaeaeachchch gggrororoupupup..




6

external was measured from the external edge to the external edge of the ascending aortic wall. All

measurements were performed according to the guidelines set by the American Society of

Echocardiography. For each mouse, three to five values for each measurement were obtained and

averaged for evaluation.

Blood pressure and Pulse wave velocity measurements

Systolic, diastolic and mean arterial blood pressure and heart rate were measured non-invasively in

conscious mice using the CODA tail cuff blood pressure system (Kent Scientific Corporation

USA). Data were recorded for later analysis.

Pulse wave velocity (PWV) measurement was performed non-invasively using the high

frequency and high-resolution Doppler spectrum analyzer (DSPW). Mice were placed supine on a

temperature and ECG controlled (Indus Instruments) plate and under anesthesia with 1.5%

isoflurane. Core temperature was maintained at 37 °C. A 10-MHz Doppler probe was used to

measure blood flow velocity signals at the thoracic and abdominal aorta sequentially. PWV was

calculated by the thoracic-abdominal distance divided by the pulse transit time between flow

pulses recorded at the thoracic and abdominal aortic sites. Pulse transit time was determined by the

time delay between the foot of the proximal and distal aortic flow waves in reference to the R wave

of the ECG. The sequential flow measurements in the aorta were taken a short time apart and there

was no detectable difference in physiological parameters (e.g. heart rate) between the two

measurements. Heart rate was maintained at a normal physiologic heart rate of approximately 500

(b/min)15-17. Estimated effect of mean pressure (MP (mmHg) on aortic PWV (PWVp, m/sec) was

calculated using the following equation (Avolio A et al, unpublished observations):

PWVp = 0.0006(MP)2 - 0.0564MP+3.9711

This relationship was used to correct for changes in PWV due to mean pressure between the

frequency and high-resolution Doppler spectrum analyzer (DSPW). Mice were pplalalaceceed d sususupipipinenene oon a

emperature and ECG controlled (Indus Instruments) plate and under anesthesia with 1.5%

ssofofflululurararanenee.. CoCoCoree ttteememperature was maintained at 33377 °°C. A 10-MHzHzz Dopoppplplplere probe was used to t

mmeaasasure blood d flflflowww vvele oococititity y y sisisigngnaaalslss aattt tthhe ththhoooraciiic anddd aaabdbddommmininnall aoaortrtta sesequququenentitialala lylyly. PWPWPWVV wwwas

caalclclculululatata eded bbby yy ththeee ththhororacacicici --abdbdbdomomminininaalal dddissstatatanncnce e didid vvviddededd d bybyy ttthhehe pppulullseee tttrarar nnnsiitit ttimimimeee bebeetwtwtweeeenn flflf owoww

pulses recordedeed d d atatt tttheheh ttthohoh raaaciciciccc ananand d d abababdooomimiminananalll aoaoortrtrticicc sssiti esess.. PuPuPulslslse e e trtrtrannnsisisitt t tititimememe wwwasasa dddetetetererermim ned by thhhe




7

treated and control groups.

Histopathology

Masson trichrome staining was performed on 5μm thin slices of the ascending aorta from mice 36

weeks after treatment and HFHC diet. These samples were photographed using a Nikon 80I

Eclipse equipped with Nikon DS-EI1 camera and the NIS-Elements software (Nikon, Japan) was

used for image analysis.

Measurement of Triglyceride and Cholesterol Levels

The serum level of triglycerides, LDL cholesterol and HDL cholesterol were measured using

commercially available kits from Wako Chemicals (Richmond, VA). Liver levels of these lipids

were quantified by HPTLC followed by densitometric scanning of charred plates.

Measurement of oxidized LDL Levels

The serum level of oxidized LDL (oxLDL) was measured using an ELISA assay and monoclonal

antibody against human oxLDL (Avanti Polar Lipids, Alabaster, AL). The ApoE-/- mouse serum

was plated in a 96-well microtitration plate at a 1:100 dilution in PBS containing 0.27 mM EDTA

and 20uM BHT overnight at 4 C. The oxLDL antibody was added after washing at a concentration

of 5ug/mL in a solution of 0.27 mM EDTA, 0.02% sodium azide in PBS and incubated overnight

at 4 C. The binding of the secondary antibody of goat anti-mouse IgM conjugated to alkaline

phosphatase (Sigma-Aldrich, St. Louis, MO) was quantified using the chemiluminescent substrate

pNPP (New England Biolabs, Ipswich, MA). Following a 4-hour incubation with the secondary

antibody, the reaction was stopped with NaOH and the plate was read at 495 nm on a microplate

reader (Bio-Rad Laboratories, Hercules, CA).

HPLC Analysis of Glycosphingolipid Levels in Liver Tissue in ApoE (-/-) Mice

Approximately 10 mg of liver tissue was homogenized in chloroform-methanol (2:1, v/v) and

were quantified by HPTLC followed by densitometric scanning of charred plateses..

Measurement of oxidized LDL Levels

Thhe e e seseerrurum mm lelelevvvel l ofofof ooxidized LDL (oxLDL) was mmmeeasured using ananan ELILILISSASA assay and monoclona

anntiiibbody againnststt hhumumaanan ooxLxLxLDLDLDL ((AvAvAvananntii Polllarrr Lipppidds, AlAlA ababbasssteterr,, AAAL)L)). Thhhe e ApApApoEoE-/-/- - momomousususee ssserrrum

wawaass s plplplatata eded iiin nn a a 99696--w-weelll mimim crcrototo itittrararatititioonon ppplalaatetete aaat aa a 1:1::10000 didilululutititiononn iinn n PBPBBS S S ccocontntn aiaiainininingngng 000 2.2.27 mMmMmM EEEDDTDTA

and 20uM BHTHTHT oovevevernrnrnigigighth aaatt t 4 44 C.C.C. TTThehehe oooxLxLxLDLDLDL aaantntn iiibobob dydyd wwwasasas aaadddddededed aaaftftftererer wwwasasashihih ngngng aaat tt aa a cococ ncentratioonn




8

lipids were extracted according to the Bligh and Dyer method18. The total lipid extracts were dried

in nitrogen and subject to deacylation using sphingosine ceramide N-deacylation19. Following

deacylation, lipids underwent o-phthalaldehyde derivatization and quantification of the levels of

glucosylceramide and lactosylceramide by reverse-phase high performance liquid

chromatography (RP-HPLC). A C18 column was used with an isocratic organic mobile phase

(methanol-water, 88:12, v/v) and calibrated with standard glycosphingolipids of known chemical

structure and column affinity. All samples were analyzed in triplicate and a representative quantity

(n = 3) of liver tissue samples was used for each treatment from control, placebo, 5mpk and 10mpk

D-PDMP–treated ApoE-/- mice.

Analysis of gene expression by Quantitative Real-Time PCR

A 50-mg piece of liver tissue was homogenized from each subject and total RNA was isolated

using TRIzol reagent according to the manufacturer’s instruction (Invitrogen, Camarillo, CA).

Two micrograms of RNA were reverse-transcribed with SuperScript II using random primers.

Real-time PCR was performed using SYBR Green PCR Master Mix (Applied Biosystems, Foster

City, CA, USA) in an Applied Biosystems Step one Real time PCR system with the following

thermal cycling conditions: 10 min at 95 °C, followed by 40 cycles of 95 °C for 15 s and 60 °C for

1 min for denaturation, annealing and elongation. Relative mRNA levels were calculated by the

method of 2-DDCt. Data were normalized to GAPDH mRNA levels. To determine the speci city of

ampli cation, melting curve analysis was applied to all nal PCR products. All samples were

performed in triplicate. Primers used in the present study (Supplemental Table S1) were

synthesized by Integrated DNA Technologies (Coralville, USA). Expression suite software

(Applied Biosystems) was used to analyze the data.

Western blot analysis

Approximately 90–100 mg of frozen liver tissue from each animal was homogenized in 1 mL of

Analysis of gene expression by Quantitative Real-Time PCR

A 50-mg piece of liver tissue was homogenized from each subject and total RNA was isolated

ussininngg g TRTRTRIzIzIzoolol reaaagegegentn according to the manufactutuurerer rr’s instructionn (((Inviviitrtrtrooogen, Camarillo, CA).

TTwoo o micrograamsmss ooof f RNRNR A AA wewewerrere rreveveveeersrse-e-ttrannscscribeeedd wiiththth SSuuupererSSccrriiptpt III II uuusininngg rarandnddomomm pppriiimmemerrrs..

ReRealala -t-ttimimi ee PCPCPCR R wawawas s pepeperfrfforormemeed d usususinining g SYSYSYBRBRBR GGGrerer eenen PCPCCR RR MMaMaststterere MMMixixix ((ApApApplplp ieieied dd BiBiosososyysysteteemmsms, , FoFoFostste

City, CA, USSA)A)A) iin n n anana AAAppppplililiededed BBBioioosysysysttemememsss StStStepepep ooonenen RReaeaal ll tititimememe PPPCRCRCR ssysysystetetemmm wiwiiththth ttthehehe fffolo lowing




9

buffer (50 mM Tris, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.5% sodium deoxycholate,

0.1% SDS, pH 7.4) containing protease inhibitor cocktail (Roche). After protein quantitation using

Bradford protein assay reagent (PIERCE), equal amount of homogenate proteins were resolved by

SDS-PAGE. Respective proteins were detected by immunoblotting. Immunoreactive bands of

predicted molecular mass were visualized using an ECL plus kit (GE Healthcare Life Sciences)

and quantified with the KODAK Molecular Imaging Software (Kodak, New Haven, CT). GAPDH

was used as a loading control. The data represent the mean ± SD of three independent experiments.

Statistical Analysis

All values are expressed as dot plots alongside mean± SEM. Comparison between groups was

performed with Kruskal-Wallis test and Dunn’s multiple comparison post-test. For repeated

measures in mice and rabbits, a two-way repeated measures ANOVA (RM-ANOVA) was

performed with Bonferroni’s multiple comparison test for comparisons between groups. * p 0.05,

** p 0.01, *** p 0.001, **** p 0.001. GraphPad PRISM and Excel statistical software were

used.

Results

Aortic wall thickness, vascular stiffness and remodeling with and without treatment

Ultrasound studies revealed that, as compared to control mouse aorta (Fig 1A), feeding a western

diet to mice from age 12 weeks to 20 weeks contributed to a marked increase in aortic wall

thickening (indicated by arrows) (Fig 1B) in placebo mice. This was not observed in mice fed

HFHC diet plus 10mpk of D-PDMP (Fig 1C). At 36 weeks of age the control mice show some

Ca2+ deposit, perhaps due to aging (Fig 1D). However, extensive Ca2+ deposits were noted in

placebo mice (Fig 1E) and this was prevented by treatment with 10mpk of D-PDMP (Fig 1F).

performed with Kruskal-Wallis test and Dunn’s multiple comparison post-test. Foor rer pepeatateded

measures in mice and rabbits, a two-way repeated measures ANOVA (RM-ANOVA) was

perfforormmedd wiwith BBoonferroni’s multiple comparisonon teest for comparisisons bebetween groups. * p 0.05

** pp 0.01, **** p 00.000101, ******* pp 00.0001. GGraphPhPadd PPRISMSM andnd Exccell staatisisticaal sos ftf wwaree wwere

useded.




10

Further quantitative analysis revealed that aortic intima thickening progressed rapidly in

placebo mice fed HFHC diet from 12 weeks to 36 weeks of age as compared to control mice.

However, D-PDMP exerted a dose-dependent decrease in aortic intima thickening. In fact, the use

of 10mpk of D-PDMP maintained the aortic intima-media thickening in HFHC fed mice

comparable to control mice (Fig 1G). Likewise, pulse wave velocity measurement revealed a

similar pattern, i.e., suggesting that the thickening of the aortic wall was associated with arterial

stiffening. This was lowered to control levels upon treatment with 5 and 10mpk D-PDMP in a

dose-dependent manner (Fig 1H). Since blood pressure did not change significantly with

treatment, the increase in arterial stiffness is largely independent of blood pressure.

Body weight for baseline (29.4±0.93 g) the control (31.13±1.61 g) and the placebo

(34.5±0.88 g) groups were not significantly different. At 36 weeks, the 5 and 10 mpk plus HFHC

diet fed mice showed a dose -dependent increase in body weight (36.53 ±1.77 g and 41.03±0.55 g)

compared to other groups. This was mainly because of an increase in bone mass density and

muscle mass. These mice were also physically active and less aggressive than the placebo group

on HFHC diet plus vehicle only. The latter instead showed an increase in percent body fat and

were fragile. This suggests that HCHF may have an association with bone loss and calcified aortic

wall shown in Fig 1E and no association with obesity.

Assessment of Atherosclerosis

Masson trichrome staining of 5μm thin slices of the aorta in control mice revealed normal aortic

wall thickness with no fibrosis (Fig 2A). In contrast, 36-week-old placebo mice fed HFHC diet

alone and daily dose of vehicle exhibited narrowed lumen volume, occupied largely by plaques

loaded with cholesteryl esters (needle-like white crystals), amorphous Ca2+ deposits within the

plaque and extensive fibrosis (Fig 2B).

Body weight for baseline (29.4±0.93 g) the control (31.13±1.61 g) and thheee plplp acccebebebooo

34.5±0.88 g) groups were not significantly different. At 36 weeks, the 5 and 10 mpk plus HFHC

diietett fffededed mmmicicicee showowowede a dose -dependent increaseee iiin n bbody weight (3(336.53533 ±±±1.1 77 g and 41.03±0.55 g

coommpmpared to ototheheher r grroououppsps. ThThThisiis wwasasas mmmaiainnly beeecauuusee off f aanan iiincnccrereaaaseee inin bbbonne e mamamassss dddenennsisiittyty aaandndnd

mumuuscscs lelele mmasasass.ss. TThhehessese mmmiccce e weweererr aaalslslso oo phphhysysysicicicaalallyyy aaccttivvve aaandndnd llleess ss agagggrgrresesessisiivevee tthahahan n ththt ee e plpplaccebebboo grgrgrououupp

on HFHC dietett pppluluusss vevevehihihiclc e e e onononlyyy.. ThThThe ee laaattttt ererer iiinsnsnsteteteadadad ssshohoh wewewed d d ananan iiinnncrcc eaeaeasesese iiin n n pepepercrccenenent t bobobodydd fat and




11

Treatment with 5mpk of D-PDMP significantly improved lumen volume; cholesteryl

esters were expunged from the plaque (Fig 2C) compared to placebo (Fig 2B), reduced fibrosis,

and elastin fragmentation. The most unexpected result was the observation that treatment with

10mpk of D-PDMP completely prevented atherosclerosis in these mice at age 36 weeks (Fig 2D).

Notably, coronary artery disease, the principle cause of morbidity and mortality due to

atherosclerosis, was drastically prevented by the treatment. A clear lumen was observed at 36

weeks for control mice, while a narrowed lumen volume was observed for placebo mice fed HFHC

diet (Fig 2E). This was mitigated by treatment with 5mpk and 10mpk D-PDMP (Fig 2E).

Histopathological analysis of the left coronary artery and quantification of lumen area revealed

that D-DPMP reduces obstruction and plaque deposition in apoE-/- mice (Supp. Fig. 1).

Treatment with D-PDMP dose-dependently decreases the activity of glycosyltransferases in

the aorta in ApoE-/- mice

High activity of glucosylceramide synthase and lactosylceramide synthase in the aorta in ApoE-/-

mice was observed in 20-week-old mice fed HCHF diet (Fig 3A, 3B). When these mice were

given a daily supply of D-PDMP by oral gavage during this period (at age 20 weeks) it dose

-dependently decreased the activity of these enzymes. We noted a 10-fold increase in the activity

of LacCer synthase in 36-week-old mice ApoE-/- mice fed the western diet (Fig 3C). However, up

to the age of 36 weeks did not exhibit any further increase in the activity of GlcCer synthase

compared to 20-week-old mice (Fig 3D). Notwithstanding these observations, some of this

increase may be attributed to effects of aging. D-PDMP dose-dependently decreased the activity of

both GlcCer synthase and LacCer synthase in 36 week old mice, as indicated by the mass of

LacCer (Fig 3E) and GlcCer (Fig 3F).

Treatment with D-PDMP ameliorates hyperlipidemia in ApoE-/- mice

Feeding a high fat and cholesterol diet markedly increased the serum level of oxidized LDL

hat D-DPMP reduces obstruction and plaque deposition in apoE-/- mice (Supp. . FiFiFig.gg 11).).).

Treatment with D-PDMP dose-dependently decreases the activity of glycosyltransferases in

hhe e aoaoaortrtrtaa ininin AAApopooEE-E-/- mice

HHigghgh activity ofoff gglluucocosysyylclclceereramamamidide e e sysysynntthhaase annnd laacacttosylylylcecerarammimiddee ssynynthththaasse e ininin tthehe aaaororrtata in n n ApApApoEoEE-/

mimiicecec wwwasas ooobsbsbserervvvedd d inin 200-0-weweekekek-o-o-oldldld mmicicce ee fefefeddd HCHCHCHFHFHF diieiet t (((FiFiFig g 3A3A3A,, 3B3B3B).). WWWhehenn n thththesessee e mmmiccce wwererre

given a daily y y sususupppppplylyly ooof f f D-D-D PDPDPDMPMPMP bby y y ororralala gggavavavaaagegege dddurururinini g g g thththisisis ppperererioioiod d (a(a(att t agagage e e 20202 wwweeeeeeksksks) ) ) it dose




12

measured using an ELISA assay. In contrast, feeding the glycosyltransferase inhibitor

dose-dependently decreased the serum levels of ox-LDL level to below baseline levels in the

ApoE-/- mice serum (Fig 4A). Similarly, the serum level of LDLc (Fig 4B) and triglycerides (Fig

4C) were increased in western diet fed mice serum. This was also decreased to baseline values in

mice fed D-PDMP. Interesting, although feeding the western diet decreased the serum levels of

HDLc (Fig 4D), treatment with D-PDMP raised HDLc level in the serum. Thus D-PDMP may be

cardioprotective.

Effect of D-PDMP on the expression of genes involved in LDL metabolism

As shown in Fig 5A, treatment with 10mpk D-PDMP increased the mRNA levels of

3-hydroxy-3-methylglutaryl-Coenzyme A reductase and sterol regulatory element binding

transcription factor 2 up to approximate 5.2-fold (P < 0.0001) and 3.6-fold (P < 0.0001),

respectively. The mRNA level of Low density lipoprotein receptor was also elevated by D-PDMP

respectively.

Effect of D-PDMP on the expression of transporter genes involved in cholesterol efflux, bile

synthesis and triglyceride metabolism

Real time PCR showed that the expression level of CD36, SRB-1 and ABCA1 genes were

significantly upregulated by D-PDMP treatment (Fig 5B). These transporters play a major role in

cholesterol efflux from peripheral tissues. As shown in Fig 5C, treatment with D-PDMP dose

dependently increased the mRNA levels of lipoprotein lipase and very low-density lipoprotein

receptor to approximate 4.8-fold (P < 0.0001) and 2.4-fold (P < 0.0001) in liver samples of drug

treated mice. The level of Cyp7A1 was also significantly up regulated by the drug treatment (Fig

5D), indicating cholesterol catabolism and bile acid synthesis upon drug treatment.

Effect of D-PDMP on the expression of proteins involved in LDL metabolism

Western immune-blot assays revealed that placebo mice liver tissue had significantly lower

3-hydroxy-3-methylglutaryl-Coenzyme A reductase and sterol regulatory elemeennnt bbbinindididingngng

ranscription factor 2 up to approximate 5.2-fold (P < 0.0001) and 3.6-fold (P < 0.0001),

eespsppececectititiveveelylyly. ThThe e e mmRmRNA level of Low density lipipipopopprotein receptoor rrf waasss aalalso elevated by D-PDMP

eespppece tively.

EfEfffefefectctct oooff D-D-D-PDPPDMPMPMP oonnn tththee exexxprprpresesessisisiononn oooff f trtrtrannnspspsporororttet rrr gegegenenenes s inininvvovolvlvlvededed innn chchholololesese teteterrorol eefeffflfluxuxx, bbibile

ynthesis annd d d trtrtrigigglylyyceceerirr deee mmmetttabababolololisi mmm




13

expression of SREBP2 protein as well as LDL receptor protein mass (Fig 6A,B). In contrast,

treatment with D-PDMP markedly increased the expression of these proteins. These findings are

in tandem with the gene expression data above, suggesting that drug treatment prevented

atherosclerosis by increasing cholesterol metabolism via the LDL receptor pathway.

Treatment with D-PDMP ameliorates atherosclerosis in normal rabbits fed a western diet

Treatment with the glycosphingolipid glycosyltransferase inhibitor D-PDMP prevented

atherosclerosis in New Zealand white rabbits. Rabbits fed HFHC diet showed a marked increase in

aortic lactosylceramide levels (Fig 7A) accompanied by extensive atherosclerosis and a 17-fold

increase in serum cholesterol (Fig 7B). In contrast to rabbits fed HFHC diet alone, rabbits treated

with D-PDMP showed a prevention of atherosclerosis as measured by lactosylceramide and

cholesterol levels which were similar to the control (Fig 7).

Discussion

The following major findings emerged from the present study. D-PDMP, an inhibitor of

glucosylceramide synthase and Lactosylceramide synthase dramatically and dose-dependently

ameliorated atherosclerosis in ApoE-/- mice and normal rabbits fed a western diet. In mice this

was accompanied with complete reversal of aortic intima-media thickening, and pulse wave

velocity, an index of vascular stiffness. Our mechanistic studies revealed that D-PDMP decreased

serum levels of cholesterol by way of regulating the expression of genes implicated in the

biosynthesis, egress, and conversion of cholesterol to bile acids. The triglyceride levels were also

dramatically reduced in the D-PDMP -treated mice by an increase in VLDL receptor and

lipoprotein lipase gene expression.

A close association between glycosphingolipids and atherosclerosis was suggested by us3,

with D-PDMP showed a prevention of atherosclerosis as measured by lactosylcererrammmidddee e ananand d d

cholesterol levels which were similar to the control (Fig 7).

DDisccscussion

ThThhe ee fofofolllll owowwinining g mmmajojoorr fffinndndiningsgss eemememergrgrgededd fffrororommm ththhe e e pppreeseseennt t stststuuudy.y.y. DDD-PPPDMDMDMPPP, , , anann iinhnhn ibibbitittoor ooof f

glucosylceraamimim deded sssynynynthththasa e e e ananand LaLaLactcttoso ylylylcececerararamimimidedede sssynynynthhhasasa ee e drdrd amamamata icicicalalallylyly aaandndnd dddososose-e-e dededepepp ndently




14

7 and others2, 20, 21. However, few attempts have been made to examine the effects of

inhibiting/depleting the level of GSLs in atherosclerosis in experimental animal models. Recently,

Bietrix et al. used an iminosugar, N-5--adamatane -1 '-ul-methoxy)-pentyl1- deoxynojirimycin

(AMP-DNM), an inhibitor of glucosylceramide synthase, which markedly reduced plasma

cholesterol and inhibited atherosclerosis development in ApoE*3 Leiden and LDL receptor -/-

mice. Additional studies have made use of this inhibitor in enhancing insulin responsiveness in a

rat model of diabetes22 and in liver steatosis23. Another inhibitor of GlcCer synthase, Zavesca (1,5-

butylimino) 1,5-dideoxy-D- glucitol and Genz-112638 / miglustat is already in use for substrate

inhibition therapy24 in patients with Gaucher's disease. D-PDMP inhibits both GlcCer synthase

and LacCer synthase activity in cultured mammalian cells and can directly inhibit the activity of

pure LacCer synthase7. Our in vivo studies have shown its efficacy in mitigating

VEGF/FGF-induced angiogenesis, restenosis in rabbits following balloon angioplasty25 and

lowering renal tumor volume by 50%26. Since arteriosclerosis is a multi-factorial disease, we

hypothesized that a compound such as D-PDMP could be efficacious in lowering the GSL load

and the phenotypes above.

An anticipated observation in this study was the remarkable filling of the lumen with

atherosclerotic plaques in ApoE -/- mice fed high fat and cholesterol diet which progressively

worsened from 20 weeks to 36 weeks of age. This was accompanied with extensive arterial wall

thickening and an associated increase in the arterial wall stiffness measured by ultrasound.

Consequently, pulse wave velocity also increased. This was ameliorated upon treatment with

D-PDMP. An unexpected observation was that from week 12 to week 20 there were no visible Ca

2+ deposits in the arterial wall. However, at 36 weeks of age, even mice fed mice chow alone had a

few Ca2+ deposits. Whereas, mice fed HFHC diet had extensive Ca2+ deposits, and this was

and LacCer synthase activity in cultured mammalian cells and can directly inhibbititit tthehh aaactctctivivivititity y of

pure LacCer synthase7. Our in vivo studies have shown its efficacy in mitigating

VEVEGFGFGF/F/F/FGFGFGF i-i-indnducucuceeded angiogenesis, restenosis inn rrrababbbits followinggg bballoloooonon angioplasty25 and

oowwewering renalal ttumumumoror vvolololumummeee bbyby 5550%0%%2262 . Sinncceee artteerriiossclclclereroosiiss iis s aa mumultltl i--fafactctctoororiaial l dididiseses aaase,e,e, wwwe e

hyhypopopothththesesizizzededed tthahaat aa a cocoompmpmpoounndnd sssucucuch h h asas DDD-P-P-PDMDMDMP P P cccoouulddd bbbeee eeeffifificacac cicic ouououss iiin llowowwererrinini g g g ththhe GSGSGSL L lolooaadad

and the phennotototypypypeseses aaabobob vevv ..




15

prevented by treatment with D-PDMP. These observations were made using 5 and 10mpk of

D-PDMP in a dose- dependent manner. Not only are these drug concentrations 10 -fold lower than

a previous report8, but also these mice did not accumulate subcutaneous fat. There was also a

higher bone density27 as compared to the placebo over the 36-week study, and no overt obesity was

observed. As expected, D-PDMP treatment not only decreased the activity of GlcCer synthase but

also LacCer synthase in the aorta in these mice. This was accompanied by a decrease in the level of

GlcCer, LacCer as well as ceramide in the liver tissue. D-PDMP also decreased the level of serum

cholesterol and triglycerides via recruiting multiple genes/pathways in lipid metabolism. For

example, we noted that D-PDMP increased LDL receptor and SREBP2 gene expression and

decreased HMG-CoA reductase gene expression. These findings are suggestive of inhibition of

cholesterol biosynthesis and increased LDL uptake. It also increased the expression of genes

responsible for cholesterol efflux by way of increasing the expression of ABCA1 and increased

expression of ABCG 5, ABCG 8 proteins responsible for pumping cholesterol out from liver

and intestine for excretion. In a previous study it was shown that GSL accumulation in particular

lactosylceramide in cultured cells can inhibit the efflux of cholesterol via the

ABCA1/Apolipoprotien A-1 pathway. In contrast, D-PDMP was found to serve as a cholesterol

efflux accelerator by inducing the expression of these genes. Our findings are in agreement and

expand these observations to an animal model of atherosclerosis.

A 7-hydroxylase enzyme, coded by the gene Cyp7A1, can convert cholesterol to bile acid.

The expression of this gene was increased in mice treated with D-PDMP. This gene plays a pivotal

role in the expression of an enzyme required for the conversion of cholesterol to bile acids. In a

previous study the iminosugar N sugar AMP- DNM was also shown to increase the expression of

this gene in liver tissue in ApoE*3 Leiden mice and facilitate the lowering of cholesterol load by

decreased HMG-CoA reductase gene expression. These findings are suggestive ooof f inininhhihibibibitititiononon oof

cholesterol biosynthesis and increased LDL uptake. It also increased the expression of genes

eespspponononsisisiblblblee e fofofor chchhoololesterol efflux by way of incrrreaeae ssing the expresssssion n ofofof AABCA1 and increased fff

exxprprese sion of ABABABCGCGCG 55, ABABABCGCGCG 88 prprprooto eeeinnns reeesppponsssibbble fffooror pppumummppiinnggg chchhoolo eesteteerororoll ouout tt frfrfromomm llliviivereer

anndd d ininntetet ststininne ee fofor r exxxcrcreeetioioon.n. IInn n a a prprprevevevioioususus ssstututudyyy iit t wawawas shshshowowownn thththatatt GSGSGSL L accccucumumumulalal titiiononon innn papapartrtiiccuululara

actosylceramimimideded iiin n n cucucultltturu ededed cccellllslsls ccanana inininhihihibibibit t thththe e efefefflflfluxux ooof f f chchcholololesesesteterororol l l vivivia a a thththee




16

conversion to bile acids and their subsequent excretion8. Moreover, in our study HDL cholesterol

was increased about 2-fold in the serum of D-PDMP treated mice. Thus a combination of genes

implicated in the lipid and lipoprotein metabolic pathways contributed to the complete reversal of

a marked increase in cholesterol level and atherosclerosis in the ApoE-/- mice fed HFHC diet.

Previous studies have shown that an enzyme lipoprotein lipase plays a crucial role in

linking up VLDL, the major triglyceride carrying lipoprotein to VLDL receptors28. We observed

that the liver tissue in D-PDMP treated mice had increased expression of gene required for the

expression of lipoprotein lipase1 as well as VLDL receptors. Such observations could explain why

treatment with D-PDMP could reduce the markedly increased serum levels of triglycerides in

ApoE-/- mice a HFHC diet for 36 weeks (Fig 4C).

We have previously shown that oxidized LDL can dose- dependently increase the activity

of LacCer synthase in cultured human arterial smooth muscle cells by phosphorylating the serine,

threonine and tyrosine residues in this enzyme. This was mitigated by pre- treatment of cells with

D-PDMP29. The activation of this enzyme generated LacCer that, in turn, activated a signaling

cascade involving ROS generation, p44MAPK activation, nuclear transcription factor c-Fos and

cyclin A to induce cell proliferation29. In the present study we show that feeding a western diet

significantly increases the level of Ox-LDL in the serum of ApoE-/- mice. This may have

contributed to the activation of LacCer synthase in the arterial wall, thus contributing to an

increase in the levels of LacCer. In contrast, in mice fed western diet plus D-PDMP the level of

Ox-LDL was decreased to basal levels (Fig 4A). This reduction in LacCer level might have

contributed to the resumption of cholesterol efflux at the normal level (Fig 8). An important

observation made in our present study is that fibrosis contributes greatly towards arterial wall

thickness in our western diet fed model of atherosclerosis and this too was prevented in mice fed

ApoE-/- mice a HFHC diet for 36 weeks (Fig 4C).

We have previously shown that oxidized LDL can dose- dependently increase the activity

off LLLacacacCeCeCerrr sysys nnnthahaasesese in cultured human arterial smmomooooth muscle celllslsl by y phphphoso phorylating the serine

hhhreeeono ine and d tytyroror ssinenee rreesesidididueueuess ininn tthhihiss ennnzymememe. Thhhiiss wwwasass mmmittigigi atattededd bbyy prpre-e- tttrereeatatmememenntnt oof ccecelllllsss wwwith

D-D-PDPDPDMPMPM 2929.. ThTThee accctitivavatitiionon oof f f ththhisisis eeennznzymymymee e gggeneneneraraatetedd LLaLacCcCcCeeer ttthahah tt,t iiinn n tutuurnrn,,, acacctitivavav teteed d d a ssiigngnnalaliininggg

cascade invoolvlvvininng g g ROROROSS gegenenenerarr titiiononon,, p4p4p 4M4M4MAPAPAPK K K acacctititivavavatit ononon,,, nununuclclcleaeaear trtrtranananscscscririr ptptp ioioon n n fafafactctctororo c-Fos andd




17

D-PDMP.

In sum, we conclude that there is a tight relationship between glycosphingolipid

metabolism, and lipoprotein metabolism, which heavily impacts upon aortic intima media

thickening via fibrosis and lipid deposition. Such multigeneic changes bring about arteriosclerosis

and its pathological sequelae. Herein, we demonstrate that several genes responsible for the

biosynthesis of cholesterol, its efflux, absorption, bile acid production, and excretion were

improved upon treatment with a glycosphingolipid glycosyltransferase inhibitor. Additionally,

genes responsible for triglyceride metabolism were also improved due to treatment resulting in

decreased triglyceride levels in apoE-/- mice. An important observation was the increased

expression of genes responsible for apoA1, the major protein in HDL, thus contributing to an

increase in the plasma levels of HDL in treated mice.

Limitations

The glycosphingolipid inhibitor used in this study inhibits the synthesis of glucosylceramide

synthase as well as lactosylceramide synthase and therefore is not specific for a particular enzyme

in the biosynthetic pathway. However, this compound is not toxic to animals when given for the

duration of this study -6 months. Clearly, further studies are required using relatively more specific

inhibitors in the near future. PWV depends on arterial pressure, but in these experiments PWV was

measured using external Doppler transducers so it was not possible to obtain PWV-pressure

relationships by altering pressure with vasoactive agents. However, the changes in pressure

between the groups was not large as assessed by tail-cuff measurements, and when there was a

change the PWV values were adjusted for pressure differences using relationships obtained in

mice from other studies. Results showed that pressure adjustments did not produce any major

alterations, hence this is not considered to be a significant limitation in these studies.

expression of genes responsible for apoA1, the major protein in HDL, thus contrtriibibututu innng gg tototo aaan n na

ncrease in the plasma levels of HDL in treated mice.

LLiLimmimitationss

ThThhe glgg ycycosphphphinini ggogolllipipiddd iinnhiibbiitooor r ususededed iinn ththisis stttududyyy iinnhihiibibiitsts tttheee syynyntthesiis ofof gggluuucocosysyylcccerramammidideee

yyyntntnthahahasesese aaasss wewewellllll aaasss lalalactctctosososylylylcececerararamimimidedede sssynynynthththasasaseee anananddd thththerererefefeforororeee isisis nnnototot ssspepepecicicififificcc fofoforrr aaa papapartrtrticiciculululararar eeenznznzymymyme




18

Acknowledgments: We thank Sara Kimiko Suzuki, Maya Hernandez, Fraulein Li, Bryan

Brensinger and Jennifer Hou for assistance during various phases of this research.

Funding Sources: This study was funded by NIH grant’s P01HL107153 and

3PO1HL107153-03S1 (SC).

Conflict of Interest Disclosures: None.

References:

1. Kwiterovich P. The johns hopkins textbook of dyslipidemia. Philadelphia: Wolters Kluwer Health/Lippincott Williams & Wilkins; 2010. 2. Dawson G, Kruski AW, Scanu AM. Distribution of glycosphingolipids in the serum lipoproteins of normal human subjects and patients with hypo- and hyperlipidemias. J Lipid Res. 1976;17:125-131. 3. Chatterjee S, Kwiterovich PO. Glycosphingolipids of human plasma lipoproteins. Lipids. 1976;11:462-466. 4. Bhunia AK, Arai T, Bulkley G, Chatterjee S. Lactosylceramide mediates tumor necrosis factor-alpha-induced intercellular adhesion molecule-1 (icam-1) expression and the adhesion of neutrophil in human umbilical vein endothelial cells. J Biol Chem. 1998;273:34349-34357. 5. Gong N, Wei H, Chowdhury SH, Chatterjee S. Lactosylceramide recruits pkc / and phospholipase a2 to stimulate pecam-1 expression in human monocytes and adhesion to endothelial cells. Proc Natl Acad Sci U S A. 2004;101:6490-6495. 6. Glaros EN, Kim WS, Quinn CM, Wong J, Gelissen I, Jessup W, Garner B. Glycosphingolipid accumulation inhibits cholesterol efflux via the abca1/apolipoprotein a-i pathway: 1-phenyl-2-decanoylamino-3-morpholino-1-propanol is a novel cholesterol efflux accelerator. The J Biol Chem. 2005;280:24515-24523. 7. Chatterjee S, Ghosh N. Oxidized low density lipoprotein stimulates aortic smooth muscle cell proliferation. Glycobiology. 1996;6:303-311. 8. Bietrix F, Lombardo E, van Roomen CP, Ottenhoff R, Vos M, Rensen PC, Verhoeven AJ, Aerts JM, Groen AK. Inhibition of glycosphingolipid synthesis induces a profound reduction of plasma cholesterol and inhibits atherosclerosis development in apoe* 3 leiden and low-density lipoprotein receptor / mice. Arterioscler Thromb Vasc Biol. 2010;30:931-937. 9. Kamani M, Mylvaganam M, Tian R, Rigat B, Binnington B, Lingwood C. Adamantyl glycosphingolipids provide a new approach to the selective regulation of cellular

2. Dawson G, Kruski AW, Scanu AM. Distribution of glycosphingolipids in the seeruum mipoproteins of normal human subjects and patients with hypo- and hyperlipidemimiiasasas.. J J J LiLiLipipipid d d ReReR s.

1976;17:125-131.

3. Chatterjee S, Kwiterovich PO. Glycosphingolipids of human plasma lipoproteins. Lipids.1976766;1;1;11:1:1:4646462-2-2-46466.6.6.

44.. BBBhuh nia AKAK, , ArAAraaai TTT,, BuBuBulklkkleleey y y G,G,G CCChahahatttererjejejee e S.S. LLLacctosysysylclclcerere amamamididide e mememeddidiaaatess tttumumumororo nnnecececroror sisisisssfaafactttoro -alpha-inducucuced iintntterceceellluuular adadheheessiion mmmoolecccuulle-11 (i(i(icacacammm-1)) eexxpreessssiionnn aaand thhhe aaddhheeesionnn ooof neneeututu roror phphill iinn n huhuh mamaman n umummbibiliiccacall vveieinn n enendodooththeeleliaaal l ceceelllss. JJJ BBBioiolll CChCheemm.. 19199998;2;277373:3:334343494949--344435757..

555. GGGonongg NNN, WWW ieiei HHH, , ChChChowowdhdhdhururyy SHSHSH,, ChChCh tatatttete jrjrjeeee SSS. LLaLa tctctosos lylylcecerara imimiddede rrececruruitititss kpkpkcc /// aa dndnd php osphp olippasasse e e a2a2a2 ttto o ststtimimmulullatatate e pepecacac mm-11 exeexprpresessisiionoon iiin nn huhumamam nn n momononocycytetetes s anand d adaddheheessisionoon to




19

glycosphingolipid metabolism. J Biol Chem. 2011;286:21413-21426. 10. Radin NS, Shayman J, Inokuchi J-I. Metabolic effects of inhibiting glucosylceramide synthesis with pdmp and other substances. Adv Lipid Res. 1993;26:183. 11. Chatterjee S. Assay of lactosylceramide synthase and comments on its potential role in signal transduction. Meth Enzymol. 2000;311:73-81. 12. Basu M, De T, Das KK, Kyle JW, Chon HC, Schaeper RJ, Basu S. Glycolipids. Meth Enzymol. 1987;138:575-607.

13. Habashi JP, Holm TM, Doyle JJ, Aziz H, Bedja D, Dietz HC. At2 signaling is a positive prognostic and therapeutic modifier of marfan syndrome: Lessons on the inequality of acei and arbs. Circulation. 2009;120:S963-S963. 14. Olson LE, Bedja D, Alvey SJ, Cardounel A, Gabrielson KL, Reeves RH. Protection from doxorubicin-induced cardiac toxicity in mice with a null allele of carbonyl reductase 1. Cancer Res. 2003;63:6602-6606.

15. Jun J, Reinke C, Bedja D, Berkowitz D, Bevans-Fonti S, Li J, Barouch LA, Gabrielson K, Polotsky VY. Effect of intermittent hypoxia on atherosclerosis in apolipoprotein e-deficient mice. Atherosclerosis. 2010;209:381-386. 16. Sussan TE, Jun J, Thimmulappa R, Bedja D, Antero M, Gabrielson KL, Polotsky VY, Biswal S. Disruption of nrf2, a key inducer of antioxidant defenses, attenuates apoe-mediated atherosclerosis in mice. PLoS One. 2008;3. 17. Sussan TE, Rangasamy T, Blake DJ, Malhotra D, El-Haddad H, Bedja D, Yates MS, Kombairaju P, Yamamoto M, Liby KT, Sporn MB, Gabrielson KL, Champion HC, Tuder RM, Kensler TW, Biswal S. Targeting nrf2 with the triterpenoid cddo-imidazolide attenuates cigarette smoke-induced emphysema and cardiac dysfunction in mice. Proc Natl Acad Sci U S A. 2009;106:250-255. 18. Bligh EG, Dyer WJ. A rapid method of total lipid extraction and purification. Can J Biochem. 1959;37:911-917. 19. Zama K, Hayashi Y, Ito S, Hirabayashi Y, Inoue T, Ohno K, Okino N, Ito M. Simultaneous quantification of glucosylceramide and galactosylceramide by normal-phase hplc using o-phtalaldehyde derivatives prepared with sphingolipid ceramide n-deacylase. Glycobiology. 2009;19:767-775. 20. Garner B, Priestman DA, Stocker R, Harvey DJ, Butters TD, Platt FM. Increased glycosphingolipid levels in serum and aortae of apolipoprotein e gene knockout mice. J Lipid Res. 2002;43:205-214. 21. Glaros EN, Kim WS, Quinn CM, Jessup W, Rye K-A, Garner B. Myriocin slows the

2003;63:6602-6606.

15. Jun J, Reinke C, Bedja D, Berkowitz D, Bevans-Fonti S, Li J, Barouch LA, GaGaabrbrbrieielslslsononon KKK, Polotsky VY. Effect of intermittent hypoxia on atherosclerosis in apolipoprotein e-deficient miceAtherosclerosis. 2010;209:381-386.

16166. SSuSussan TTTEEE, JJununun JJ, , ThThThimimmmumum lalaappppppa a R,R,, BBededjajaj DD, , AAnAntteroo MMM,,, GaGG brbrrieieiellslsonon KKKL,LL PPololotototsksks y y VYVYY,, BiBiiswswswala SDDisrrsrupu tion of nrnrff2f ,, a a kekek y y y ininindududuccecer r oofof aaantnttioooxiddaannnt deefeeenseeess,s, aatttttennnuauateess apapoooe-m-mededediiaiatetedd d atatatheheheroooscsclelelerroosinnn mmmici e. PLoSoS OOnenee. 20000088;33.

17. SuSussanan TTE,E RRanangagasamymy TT, BlBlakake DJJ, MaMalhlhototrar DD, ElEl-H-Hadaddad d d H,H, BBede jaa DD, YaYatet s MSM ,,Kombairaju PPP, , , YaYaYamamam momomotoo MMM,,, LiLiLibybyb KKKT,T,T, SSSpopopornrnrn MBMBMB,, GaGaG brbrbrieieelslssononn KKKL,L,L, CCChahahampmpmpioion nn HCHCHC,,, TuTT der RM,KeKensnslelerr TWTW BiBiswswalal SS TaTargrgetetiningg nrnrf2f2 wwitithh ththee trtrititererpepenonoidid ccddddoo-imimididazazololididee atattetenunuatateses ccigigararetetttee




20

progression of established atherosclerotic lesions in apolipoprotein e gene knockout mice. J Lipid Res. 2008;49:324-331.

22. Aerts JM, Ottenhoff R, Powlson AS, Grefhorst A, van Eijk M, Dubbelhuis PF, Aten J, Kuipers F, Serlie MJ, Wennekes T. Pharmacological inhibition of glucosylceramide synthase enhances insulin sensitivity. Diabetes. 2007;56:1341-1349.

23. Bijl N, Sokolovi M, Vrins C, Langeveld M, Moerland PD, Ottenhoff R, van Roomen CP, Claessen N, Boot RG, Aten J. Modulation of glycosphingolipid metabolism significantly improves hepatic insulin sensitivity and reverses hepatic steatosis in mice. Hepatology. 2009;50:1431-1441.

24. McEachern KA, Fung J, Komarnitsky S, Siegel CS, Chuang W-L, Hutto E, Shayman JA, Grabowski GA, Aerts JM, Cheng SH. A specific and potent inhibitor of glucosylceramide synthase for substrate inhibition therapy of gaucher disease. Molec Genet Metab. 2007;91:259-267. 25. Chatterjee S. Methods for treatment of angiogenesis. US Patent application #20090202439. Issued Aug 13, 2009.

26. Chatterjee S, Alsaeedi N, Hou J, Bandaru VVR, Wu L, Halushka MK, Pili R, Ndikuyeze G, Haughey NJ. Use of a glycolipid inhibitor to ameliorate renal cancer in a mouse model. PLoS One. 2013;8:e63726. 27. Hyder JA, Allison MA, Barrett-Connor E, Detrano R, Wong ND, Sirlin C, Gapstur SM, Ouyang P, Carr JJ, Criqui MH. Bone mineral density and atherosclerosis: The multi-ethnic study of atherosclerosis, abdominal aortic calcium study. Atherosclerosis. 2010;209:283-289. 28. Takahashi S, Suzuki J, Kohno M, Oida K, Tamai T, Miyabo S, Yamamoto T, Nakai T. Enhancement of the binding of triglyceride-rich lipoproteins to the very low density lipoprotein receptor by apolipoprotein e and lipoprotein lipase. J Biol Chem. 1995;270:15747-15754. 29. Chatterjee S, Bhunia AK, Snowden A, Han H. Oxidized low density lipoproteins stimulate galactosyltransferase activity, ras activation, p44 mitogen activated protein kinase and c-fos expression in aortic smooth muscle cells. Glycobiology. 1997;7:703-710.

Figure Legends:

Figure 1. Aortic wall thickening and pulse wave velocity in atherosclerotic mice is ameliorated by

treatment with D-PDMP. Aortic ultrasound imaging: 2DB-mode ultrasound images of the aorta

from ApoE-/- mice fed mice chow. Top panel (A, B, C) shows 20 week old mice. Bottom panel (D,

25. Chatterjee S. Methods for treatment of angiogenesis. US Patent application #2000090202439. ssued Aug 13, 2009.

26. Chatterjee S, Alsaeedi N, Hou J, Bandaru VVR, Wu L, Halushka MK, Pili R, Ndikuyeze G, Haugghey y NJJ. Usse of a glycolipid inhibitor to ameliorate renal cancer in a mouse model. PLoS One200131313;8;8;8:e:e6363637272726.

2277. HHyder JA, AAlAlliiisoon nn MAMAMA, , BaBaBarrrretettt-t-CoCoConnnnor EE,,, Deetrtraanooo RR,R, WWWoononggg NNDND, SiSS rrrlininn CCC,, GaGaapspsstuturrr SMSMSM,OOOuyyayang P, CaCarr JJJJJ,, Crriiqquui MHMHMH. BoB nenen mmmiineraaal dennsiitty y ananand d d atata hhherooscclerossisss: TTThhee mmululltii-e-ettthnnnic ssstuuudyofff aaaththherere ososclclclereerososiiss, ababddodommiminanall l aoaoortrtrticicic ccaalalciciiumumum sstututudydydy. AtAtheheherororosscsclelelerororosisisss. . 202001000;2;209090 :2:2: 83833-2-2-28999.

28. Takahashhi i i S,S,S, SSSuzuzuzukukukiii J,J, KKKohoho nonono MMM, OiOiO dadada KKK,, TaTaTamamamaii i T,T,, MMMiyiyiyababbo o o S,S, YYYamamamamamamototo o o T,T,T, NNNakaka ai T.EnEnhahancncememenentt ofof tthehe bbinindidingng ooff trtrigiglylyceceriridede r-ricichh lilipopoprprototeieinsns ttoo ththee veveryry llowow ddenensisityty llipipopoproroteteinin




21

E, F) shows 36 week old mice. Control (A) ApoE-/- mice fed mice chow. ApoE-/- mouse fed high

fat, high cholesterol (HFHC) diet plus vehicle (B), HFHC plus 10mpk of D-PDMP (C). Thirty six

week old control ApoE-/-mice fed mice chow (D); placebo fed HFHC chow (E) and HFHC fed

mice treated with 10mpk D-PDMP (F). Note the arrows indicate marked increase in aortic wall

thickening in HFHC plus vehicle fed; placebo (B mice) mice at 20 weeks of age. This was

followed by a marked increase in Ca2+ deposits at 36 weeks of age (marked by asterisk) in this

group of mice as compared to control mice. This was prevented by feeding D-PDMP (F). Aortic

wall thickness and aortic wall stiffness in atherosclerotic mice is ameliorated by treatment with

D-PDMP shown in graphs (G) and (H). Quantitation of intima-media thickness (AoIMT) (G) and

pulse wave velocity (PWV) respectively (H), in ApoE-/- mouse on a mice chow diet (control 0.63

± 0.04 mm/4.37±0.26 m/s), HFHC diet plus vehicle (Placebo 1.21 ± 0.06 mm/6.38±0.89 m/s) (H),

HFHC diet plus treatment with 5 and 10mpk of D-DPMP (1.04 ± 0.04mm/6.07±0.5 m/s and 0.73 ±

0.04 mm/4.24±0.15 m/s). Note that both AoIMT and PWV increase continuously in placebo mice

from 12 weeks to 36 weeks and this was ameliorated upon treatment with D-PDMP in a

dose-dependent manner. A two-way RM ANOVA using the Bonferroni multiplo comparisons

post-test was performed.. * p 0.05, ** p 0.01, *** p 0.001; n = 3-5.

Figure 2. D-PDMP treatment ameliorates atherosclerotic plaque buildup and lumen volume in

ApoE-/- mice fed a western diet. Masson Trichrome stained ascending aortic rings of ApoE-/-

mouse: Control mice fed regular mice chow (A), mice fed high fat, high cholesterol (HFHC) diet

consisting of 2% fat and 1.25 cholesterol plus vehicle (Placebo) (B), HFHC plus 5mpk,

D-PDMP(C), and HFHC plus 10mpk, D-PDMP (D). Bar = 50 μm. Elastin fibers (E) decreased

following treatment with D-PDMP. Quantification of lumen area (F) reveals a decrease in lumen

pulse wave velocity (PWV) respectively (H), in ApoE-/- mouse on a mice chow dddieett t (cccononontrtrtrololol 00.63

± 0.04 mm/4.37±0.26 m/s), HFHC diet plus vehicle (Placebo 1.21 ± 0.06 mm/6.38±0.89 m/s) (H)

HFHFHCHCHC dddieieiett t plplpluus tttrerereata ment with 5 and 10mpk of DDD-D-D-DPMP (1.04 ± 0.0.0 04mmmmmm/6/ .07±0.5 m/s and 0.73 ±

00..0444 mm/4.244±0±00.15 mm/m s)s)). NoNoNotetee tthahaatt bobothth AooIIMMMT aaannnd PPPWVWVWV inncncrereeassse cocontntininuuououususlyly iin nn plpllacaccebebebo oo mmmice

frromomom 111222 weweeekekekss totoo 3336 6 weweweekeks aananddd thththisisis wwasasas aaammmelililiororo aaateeded uuupopoonn n trtreaeaeatmtmmenenent t t wwwiththh DDD-P-P-PDMDMDMPP P innn a

dose-dependedentntnt mmmanananneneer.r.r AAA tttwowow -w-wwayayy RRM M M ANANANOVOVOVA A A usususining g g ththhe e e BoBoBonfnn ererrrororoninini mmmululu titiplplplo oo cococompmm arisons




22

volume in the mice fed HFHC. Lumen area is significantly reduced due to increased plaque

accumulation in placebo mice aorta (Black arrow, B). Treatment with D-PDMP significantly

reduced and/or delayed medial thickening, elastin fibers, and plaque accumulation fragmentation

in a dose-dependent manner. A nonparametric one-way ANOVA using the Kruskal-Wallis test

and Dunn’s multiple comparison post-test were performed. * p 0.05, ** p 0.01, *** p 0.001;

n = 3-5.

Figure 3. Glycosphingolipid glycosyltransferase activity in ApoE-/- mice fed high fat and high

cholesterol diet with and without D-PDMP. Freshly harvested aorta tissue was stored in Tris HCl

buffer supplemented with a protease inhibitor cocktail, homogenized and the activity of

glucosylceramide synthase and lactosylceramide synthase were measured. Lactosylceramide

synthase activity significantly decreased at 20 weeks (A) and 36 weeks (C) following treatment

with D-PDMP. A significant change in glucosylceramide synthase activity was also observed at 20

weeks (B) and 36 weeks (D). In (E) and (F), treatment with D-PDMP decreases the mass of

glycosphingolipids in the liver of ApoE-/- mice fed a western diet. Glycosphingolipids were

extracted from 10 mg of harvested liver tissue and homogenized in CHCl3-MeOH, 2:1).

Following treatment with the enzyme SCDase and derivatization by OPA, mass was calculated via

liquid chromatography and tandem mass spectrometry against glucosylceramide and

lactosylceramide standards. A significant decrease from the placebo in the mass of

glucosylceramide was seen in the 5mpk treated and 10mpk treated mice fed the HFHC diet. A

nonparametric one-way ANOVA using the Kruskal-Wallis test and Dunn’s multiple comparison

post-test were performed. * p 0.05, ** p 0.01, *** p 0.001; n = 3.

buffer supplemented with a protease inhibitor cocktail, homogenized and the actitiivivvitytyt ooof f f

glucosylceramide synthase and lactosylceramide synthase were measured. Lactosylceramide

yyntntnthahahassese aaactctctivivivity y y sisisigng ificantly decreased at 20 wwweeeee kkks (A) and 36 weww ekksss ((C(C) following treatment

wwithhh D-PDMP.P AAA sssiggninin fifiicacacantntnt ccchhahangnggee e ininn gglucooosyyylceeraaamiidedede ssyyynththt asasse acctitiivivv ttyy wwwaass alalsososo ooobsbsbserrrvvevedd d aatat 20

weweeekekeksss (B(B( )) ) ananandd 3366 wwweeeeekskss ((D)D).. InInn (E(E(E))) anannd d (F(F(F)),), ttrerereatattmemem ntntt wwwititithh h D-D-D-PDPDDMPMPMP dddeeccrereasasa esese tthehehe mmaaasss s ofoff

glycosphingogolililipipipidsdsds iiin n thththe lililivevever ooof f f ApApApoEEE-/-//-- mimimicecece fffededed aaa wwwesesesteteterrrr n nn dididietee . GlGlGlycycycosososphphp innngogogolililipipipidsdd were




23

Figure 4. Plasma levels of oxidized LDL, cholesterol, triglycerides, and HDL-c in ApoE-/- mice

fed a high fat and high cholesterol diet with and without D-PDMP. Serum extracted from ApoE-/-

mice was analyzed for the presence of oxLDL (A), LDLc (B), triglycerides (C), and HDLc (D) on

microtiter plates. Serum concentrations of oxLDL were determined using an

immunohistochemical ELISA assay with an antibody against oxLDL. Concentrations of LDLc

triglycerides and HDLc concentrations were taken from microtiter readings following Wako kit

assays. Values are means ± SEM. * p 0.05, ** p 0.01, *** p 0.001; n = 3.

Figure 5. Effect of D-PDMP on the expression of hepatic genes, which play roles in cholesterol

and lipid metabolism. Expression of hepatic genes involved in LDL metabolism;

3-hydroxy-3-methylglutaryl-Coenzyme A reductase (Hmgcr), Low density lipoprotein receptor

(Ldlr), Sterol regulatory element binding transcription factor 1(Srebf1) , Sterol regulatory element

binding transcription factor 2(Srebf2) (A) HDL metabolism; apolipoprotein A-I(Apoa1),

scavenger receptor class B (SRB-1), CD36 antigen (B) VLDL and Triglyceride metabolism;

lipoprotein lipase (Lpl), very low density lipoprotein receptor (Vldlr) (C) and Cholesterol efflux

and uptake; ATP-binding cassette sub-family ABCA1(Abca1), cholesterol 7

alpha-hydroxylase(Cyp7A1) (D) as assessed by quantitative real-time PCR . Expressions of these

genes were significantly up regulated in mice treated with D-PDMP in a dose dependent manner.

Values are means ± SEM. A nonparametric one-way ANOVA using the Kruskal-Wallis test and

Dunn’s multiple comparison post-test were performed. * p 0.05, ** p 0.01, **** p 0.0001; n

= 3.

Figure 6. Western blot analysis of liver Srebp-2, LDLR, ABCG5 and ABCG8 proteins. Western

and lipid metabolism. Expression of hepatic genes involved in LDL metabolismm;;

3-hydroxy-3-methylglutaryl-Coenzyme A reductase (Hmgcr), Low density lipoprotein receptor

LLdldldlr)r)r), , StStSterereroolol regggulululata ory element binding transcriririppptiion factor 1(Srrebee f11))) , , SStS erol regulatory elemen

bbiindddini g transccririippptiioon n faff cctctororor 222(S(S(Srerebfbfbf22)2 ((AAA(( ) HHDDLL mmmetttaboooliliismsmm; apapoololippopoprrootteeininn AAA-I-I(A(AApopooa1a1a1),,

ccavavavenenengegegerr rererecceceptpttorrr cclalaassss BB (SSSRBRBRB-1-1-1),),) CCCD3D3D3666 ananantititigegeen (((BBB)) ) VLVLVLDLDLDL aanndnd TTTririggglyycycererrididideee mememettatabobooliiismsm;;;

ipoprotein liipapapaseses (((LpLpLpl)l)l ,, veeeryryry llowoww dedeensnsititity y y lilil popopoprprprotototeieie n n n rerecececeptptptororo (((VlVlV dldllr)r)r) (((CCC) ) ) ananand d ChChCholololesesestet rol efflux CCC




24

blots illustrate D-PDMP induces the expression of Srebp-2 (A), LDL receptor (B), ABCG5 (C)

and ABCG8 (D) proteins in liver tissues. Values are means ± SEM. A nonparametric one-way

ANOVA using the Kruskal-Wallis test and Dunn’s multiple comparison post-test were performed.

* p 0.05, **** p 0.0001; n = 3.

Figure 7. Inhibiting glycosphingolipid synthesis inhibits atherosclerosis in rabbits. New Zealand

white rabbits (n=3) were fed a diet with and without cholesterol (2%) and fat (14%) and with and

without D-PDMP (10mpk) for three months. Marked increase in lactosylceramide levels in the

aorta tissue was observed (A) accompanied by extensive atherosclerosis and marked increase

(17-fold) in serum cholesterol levels (B) were found in rabbits fed the hyperlipidemic diet in

comparison to control and drug-treated rabbits at 3 months. This was prevented by treatment with

D-PDMP. Statistical analysis: In 7A, a nonparametric one-way ANOVA using the Kruskal-Wallis

test and Dunn’s multiple comparison post-test were performed. In 7B, a two-way repeated

measures ANOVA was performed with Bonferroni’s multiple comparisons post-test. * p 0.05,

**** p 0.0001; n = 3.

Figure 8. D-PDMP inhibits ox-LDL induced LCS activity and atherosclerosis development.

Oxidized LDL (ox-LDL) activates LacCer synthase (LCS) to produce large quantities of LacCer,

which stimulates the activity of NADPH oxidase. Concomitantly, there is an increase in the

generation of superoxide radicals (ROS). ROS mediates p44MAPK phosphorylation thereby

stimulating c-fos expression, promoting cell proliferation of vascular-smooth-muscle cells further

to angiogenesis and generation of atherosclerosis. D-PDMP, a potent inhibitor of LCS, impaired

ox-LDL mediated induction of LCS activity thereby inhibiting the above pathway.

17-fold) in serum cholesterol levels (B) were found in rabbits fed the hyperlipiddemememicic dddieieiet tt ininin

comparison to control and drug-treated rabbits at 3 months. This was prevented by treatment with

D-D-PDPDPDMPMPMP. StStStaaatisstititiccacal analysis: In 7A, a nonparamememetrrric one-way ANANNOVVVA A A uusing the Kruskal-Walli

eestt aand Dunn’n’ss mummultltipipipleee cccomomomppaparirisososonn n ppoposst-teeesttt weereee peererffoformrmmeeded. IInIn 77B,B a ttwowoo-w-wwayay repepepeaeaateeeddd

memeeasasa ururureses AAANONON VAVAVA wawwass peperfffororo mememed d d wiwiththt BBBoononfefeferrrrr onoonii’s mumumultltltiipiplelele cccomommpapap rrrissoonsnss pppososo t-t-tetetesst. ** pp p 00.0.005,5

**** p 0.000000001;1;1; nnn == 333..



GH

Figure 1

ControlPlacebo5mpk10 mpk

***

***

***

***

*** ******

***

**

***

***

******

***

*

***

***

*

GHH

CoCo tntrorollPl b

*****

****

***

****

*** ******

***

**

****

***

******

*****

*

***

*******

*



LumenLumen

E

Figure 2

*

*

*LLLLLLLumenLumenLumenLumenLumenLumenLumenLumenLumenLumenLumenLumenLumenLumenLumenLumenLumenLumenLumenLume

LLLLLLLLumenLumenLumenLumenLumenLumenLumenLumenLumenLumenLumenLumenLumenLumenLumenLumenLumenLumenLumenLumenLumenLumenLumenLumen

E

**



Figure 3

C E

FD

A

B FFFDDBBB



Figure 4

A B

C DCCC DDDDDD



Figure 5

A B

DC DDDCC



Figure 6

A

LDLr

GAPDH

LDLr

GAPDH

B

GAPDHH

LDLr

GAPDH



Figure 6, cont’d

ABCG5

GAPDH

ABCG5

GAPDH

C

ABCG8

GAPDH

ABCG8

GAPDH

D

ABCG5

GAPDH

GAPDH GAPDH

ABCG8

GAPDH



Figure 7

A BA B



Figure 8



SUPPLEMENTAL MATERIAL

Supplemental Table 1. Primers used in the present study.

Gene Forward primer (5′-3′) Reverse primer (5′-3′)

LDLR CAGACTGCAAGGACAAGTCA GAG CCA TCT GCA CAC TGG AA

VLDLR CCACAGCAGTATCAGAAGTC GCCATCACTAAGAGC AAGAG

LPL AGTGTTTGTGAAATGCCATGA CA CGGATGCTTTCTTCTCTTGTTTG

APOA1 GTGGCTCTGGTCTTCCTGAC ACGGTTGAACCCAGAGTGTC

CD36 GCC AAG CTA TTG CGA CAT GA AGA ATC TCA ATG TCC GAG ACT

SREBP1 CCG TGG GCT GAG GAA GGA TGT GTA CTT GCC CAT GGC A

SREBP2 CATCCCTTGGGCCAGAAGTT TCCTTGGCTGCTGACTTGATC

Abca1 AACAGTTTGTGGCCCTTTTG AGTTCCAGGCTGGGGTACTT

HMGR TCTGGCAGTCAGTGGGAACTATT CCTCGTCCTTCGATCCAATTT

CYP7A1 CAGTGAAGGTCATGCTGGAG CGCAATGAAGAAGGTGACAA

SR-BI TCCCTCATCAAGCAGCAGGT TTCCACATCCCGAAGGACA

Supplemental Figure 1.

Supplemental Figure 1. Histopathological analysis showing Masson’s Trichrome stained left

coronary artery (LCA) of control ApoE-/- mouse on a chow diet (A), Apo E-/- on high fat high

cholesterol (HFHC) diet plus vehicle (Placebo) (B), Apo E-/- on HFHC diet plus treatment with

5 (C )and 10mpk of D-DPMP (D) respectively. Quantification of the cross sectional area of LCA

(E). The placebo mice (E) show a significant increase in the cross sectional area (CSA), loss of

smooth muscle cells, perivascular fibrosis, damaged wall, thrombosis and occlusion as compared

to control and treated mice. The 5 and 10 mpk of D-DPMP treated mice show and dose

dependent decline in cross sectional area and not significantly different to control mice.

** **

** **

*** ***

***

E F

C D

Inhibition of glycosphingolipid synthesis ameliorates atherosclerosis and arterial stiffness in...

Documents

Transcript of Inhibition of glycosphingolipid synthesis ameliorates atherosclerosis and arterial stiffness in...