IL-32, a Novel Proinflammatory Cytokine in Chronic Obstructive Pulmonary Disease

IL-32, A NOVEL PROINFLAMMATORY CYTOKINE IN CHRONIC OBSTRUCTIVE

PULMONARY DISEASE

Fiorella Calabrese1, Simonetta Baraldo2, Erica Bazzan2, Francesca Lunardi1, Federico Rea2, Piero

Maestrelli3, Graziella Turato2, Kim Lokar-Oliani2, Alberto Papi4, Renzo Zuin2, Paolo Sfriso5,

Elisabetta Balestro2, Charles A Dinarello6 and Marina Saetta2.

1Department of Medical Diagnostic Sciences and Special Therapies, University of Padova 2Department of Cardiac, Thoracic and Vascular Sciences, University of Padova and Padova City

Hospital 3Department of Environmental Medicine and Public Health, University of Padova 4Department of Clinical and Experimental Medicine, University of Ferrara 5Department of Clinical and Experimental Medicine, University of Padova 6University of Colorado Health Sciences Center, Denver, Colorado

Corresponding Author: Marina Saetta, M.D. Università degli Studi di Padova, Dipartimento di Scienze Cardiologiche, Toraciche e Vascolari, Unità Operativa di Pneumologia Via Giustiniani 3, 35128 PADOVA, Italy Tel ++ 39 049 8213710 Fax ++ 39 049 8213110 e-mail: [email protected]

Supported by University of Padova, Italian Ministry of University and Research and an

unrestricted grant from GlaxoSmithKline, UK.

Running head: IL-32 and immune responses in COPD

Descriptor number: 53

Word count for the body of the manuscript: 3334

AJRCCM Articles in Press. Published on August 14, 2008 as doi:10.1164/rccm.200804-646OC

Copyright (C) 2008 by the American Thoracic Society.

mailto:[email protected]

At a glance commentary:

Scientific knowledge on the subject

COPD is characterised by an exaggerated immune response, but the mechanisms of this response

are yet unknown. IL-32 has recently been proposed as a possible regulator of innate and adaptive

responses, particularly in inflammatory diseases.

What this study adds to the field

IL-32 protein and mRNA were increased in lungs of smokers with COPD compared with unaffected

subjects. IL-32 correlated with TNFα, CD8+ cells and phospho p38MAPK, suggesting that this

cytokine contributes to the characteristic immune response in COPD.

This article has Online Data Supplement, which is accessible from the issue’s table of content

online at www.atsjournals.org

http://www.atsjournals.org/

Calabrese et al., 1

ABSTRACT

Rationale: COPD is a chronic inflammatory disorder of the lung; yet the mechanisms that regulate

this immune-inflammatory response are not fully understood.

Objectives: We investigated whether IL-32, a newly discovered cytokine, was related to markers of

inflammation and clinical progression in COPD.

Methods: Using immunohistochemistry, expression of IL-32 was examined in surgically resected

specimens from 40 smokers with COPD (FEV1=39±4 % predicted), 11 smokers with normal lung

function and 9 non-smoking controls. IL-32 was quantified in alveolar macrophages, alveolar walls,

bronchioles and arterioles, and confirmed by molecular analysis. The levels of IL-32 were

correlated with the cellular infiltrates, markers of inflammation and clinical data.

Measurements and Main Results: Macrophage staining for IL-32 was increased in smokers with

COPD compared with control smokers and non-smokers (p=0.0014 and p<0.0001) and similar

differences were observed in alveolar walls (p=0.0004 and p=0.0005) and bronchiolar epithelium

(p=0.004 and p=0.0009). This increase was also detected at mRNA level (p=0.007 vs control

smokers and p=0.029 vs non-smokers) and was mainly due to non-α isoforms. Moreover, IL-32

expression was positively correlated with TNFα (p=0.004, rs=0.70), CD8+cells (p=0.02, rs=0.46),

phospho p38MAPK (p<0.01, rs=0.60) and negatively with FEV1 values (p=0.004, rs=-0.53).

Conclusions This is the first study to demonstrate increased expression of IL-32 in lung tissue of

patients with COPD, where it was co-localized with TNFα and correlated with the degree of airflow

obstruction. These results suggest that IL-32 is implicated in the characteristic immune response of

COPD, with a possible impact on disease progression.

Number of abstract words: 243

Key words: inflammatory cytokines, immune response, airflow limitation, cigarette smoking

Calabrese et al., 2

INTRODUCTION

COPD is a leading cause of morbidity and mortality worldwide. Estimates from the WHO

Global Burden of Disease indicate that in 2001 COPD was the fifth leading cause of death in high-

income countries and the sixth in nations of low and middle income, accounting for about 4% of

total deaths (1). It is generally agreed that COPD is a progressive disease due to an inflammatory

response to noxious particles or gases (2). COPD is a classic gene-by-environment disease with

various manifestations that reflect both the individual susceptibility and the degree of exposure to

irritants, of which cigarette smoke is the most frequent. A number of studies have demonstrated

that, in patients with COPD, a chronic inflammatory process is present throughout the airways, lung

parenchyma and pulmonary vasculature and extends even outside the lung (3-6). The inflammatory

response in the lung is characterized by infiltration of CD8+ T lymphocytes, which are polarized

towards a type 1 profile with production of interferon (IFN)-γ among other cytokines (7,8).

IL-32 is a recently described cytokine produced by T lymphocytes, natural killer (NK) cells,

monocytes and epithelial cell lines (9,10). IL-32 is prominently induced by IFN-γ in vitro (9) and,

conversely, its depletion reduces IFN-γ production (11), thus suggesting a regulatory feed-back

mechanism. The gene encoding IL-32, which is organized into eight exons, is located on human

chromosome 16p13.3; six splice variants have been described (IL-32α, IL-32β, IL-32γ, IL-32δ, ε

and ζ) (9,12), of which IL-32γ is the full-length isoform without any exonic deletions. IL-32

exhibits several properties typical of proinflammatory cytokines. For example, the cytokine induces

TNFα, IL-1β , IL-18 and chemokines through the activation of NF-κB and p38MAPK (9).

IL-32 has recently been proposed as a possible regulator of innate and adaptive immune

responses in vitro (10). In humans, only two in vivo studies have demonstrated upregulation of IL-

32, one in rheumatoid arthritis (13) and one in Crohn’s disease (14), both of which have a

pathogenetic autoimmune component. Whether this cytokine is implicated in the immune response

characteristic of COPD still remains to be investigated. To explore this issue, in the present study

Calabrese et al., 3

the levels of IL-32 protein and mRNA were determined in surgically resected specimens from the

following three groups of subjects: smokers with COPD, asymptomatic smokers with normal lung

function and non-smoking controls. Morphometric analysis was also applied to quantify the amount

of TNFα in the same lung specimens, and co-localization of IL-32 and TNFα was confirmed by

confocal microscopy. Moreover, the expression of IL-32 was correlated with phosphorylated

p38MAPK, with the number of neutrophils and CD8+ cells infiltrating the alveolar walls and with

the degree of airflow obstruction. Preliminary results of this study have been previously reported in

abstract form (15,16).

METHODS

Subject characteristics

To quantify the expression of IL-32 and TNFα, we collected peripheral lung tissue from 60 subjects

undergoing surgery for appropriate clinical indications: lung transplantation or Lung Volume

Reduction Surgery for severe emphysema and lung resection for solitary peripheral nodules (details

are included in the Online Data Supplement). The subjects were categorized into the following three

groups: smokers with COPD (GOLD stage I-IV; n=40); asymptomatic smokers with normal lung

function (control smokers; n=11) and asymptomatic non-smoking subjects with normal lung

function (non smokers; n=9). Moreover, to look into disease specificity, IL-32 expression was

evaluated in other inflammatory lung diseases of different etiologies. In particular, we examined

autoptic samples from 2 subjects with asthma and 2 subjects with either viral or fungal pneumonia

(cytomegalovirus or Aspergillus), as well as open lung biopsies from 2 subjects with collagen

diseases-associated NSIP pattern and 1 subject with pulmonary involvement of rheumatoid arthritis.

Subjects with COPD did not experience any exacerbations or acute upper respiratory tract

infections during the month preceding surgery. Each patient underwent: interview,

electrocardiography, routine blood tests and pulmonary function tests, that were performed as

Calabrese et al., 4

previously described (17). The study conformed to the Declaration of Helsinki and was approved by

the Local Ethics Committee; informed written consent was obtained for each subject undergoing

surgery.

Immunohistochemistry and morphometric analysis

Lung tissue preparation and immunohistochemistry were performed as described in the

Online Data Supplement. Briefly, sections were treated for 60 min with primary antibodies (at a

concentration of 0.3 μg/mL): i.e. murine anti-human IL-32 (clones 09 and 07 produced as

previously described) (11,18) and anti-human TNFα (T6817 Sigma-Aldrich, St. Louis, MO). IL-32

and TNFα expression was quantified in alveolar macrophages and alveolar walls as described in the

Online Data Supplement. To standardize the results, cell counts were expressed as percentage of

positive macrophages over total macrophages examined and as number of positive cells per mm of

alveolar wall, respectively. Expression of IL-32 and TNFα was also evaluated in peripheral airways

(epithelium and smooth muscle) and pulmonary arterioles (tunica media) using a semi-quantitative

score (0: no staining; 1: weak staining; 2: moderate staining; 3: strong staining).

Confocal microscopy was applied to confirm the coexpression of IL-32/TNFα and IL-

32/CD8 already observed in subsequent serial sections (details are included in the Online Data

Supplement).

Moreover, to investigate potential correlations between IL-32 expression and other

inflammatory parameters known to be upregulated in COPD, we used immunohistochemical

quantification of CD8+ T lymphocytes, neutrophils and phospho p38+ cells obtained in previous

reports (4,19-22). Data for CD8+ T lymphocytes were available in 35 out of the 60 patients, while

data for neutrophils and phospho p38+ cells were available in 28 out of 60 patients (equally

represented among the different groups examined). Details are included in the Online Data

Supplement.

Molecular analysis for IL-32 mRNA detection

Calabrese et al., 5

Reverse transcriptase-polymerase chain reaction (RT-PCR) and semi-quantitative evaluation

of mRNA levels were performed in a representative population (nearly 50% of subjects included in

the immunohistochemical analysis, equally distributed among the three groups examined): 17

COPD patients, 7 control smokers and 6 non-smokers. All IL-32 PCR products were analyzed by

gene sequencing. Further details are reported in the Online Data Supplement.

Statistical Analysis

All cases were coded and the measurements were made without knowledge of clinical data.

Group data were expressed as mean and standard error (SEM), or as median and range when

appropriate. Differences between groups were analyzed using the following tests for multiple

comparisons: the analysis of variance (ANOVA) and the unpaired Student’ t-test for clinical data

and molecular findings, and the Kruskal-Wallis test and the Mann-Whitney U-test for

morphological data. IL-32 isoform frequencies were compared by Fisher's exact test. Correlation

coefficients were calculated using Spearman’s rank method and corrected for multiple comparison

using the Holm method (23,24).

RESULTS

Clinical characteristics of study subjects

The clinical characteristics of the subjects examined are shown in table 1. Demographic

analysis revealed that age was not significantly different in the three groups of subjects. Moreover,

smoking history was similar in smokers with COPD and control smokers. As expected from the

selection criteria, subjects with COPD had significantly lower values of FEV1 (% predicted) and

FEV1/FVC (%) as compared with control smokers and non-smokers. Among patients with COPD,

21 were in GOLD Stage IV, 7 were in GOLD Stage III, 10 were in GOLD Stage II, and 2 in GOLD

Stage I. In smokers with COPD, the values of PaO2 were significantly reduced and those of PaCO2

Calabrese et al., 6

were significantly increased compared with the other two groups of subjects examined. Smokers

with COPD had signs of lung hyperinflation (increased Residual Volume) and impaired carbon

monoxide diffusion capacity (decreased DLco) as compared with control smokers.

Smokers with mild/moderate COPD, asymptomatic smokers with normal lung function and

asymptomatic non-smoking subjects with normal lung function did not receive anti-inflammatory

therapy (e.g. oral or inhaled corticosteroids) or antibiotics within the month preceding surgery, or

bronchodilators within the previous 48 hours. All patients with very severe or severe COPD were

treated with inhaled anticholinergics and/or ß2-agonists/inhaled corticosteroids and ten of them with

oral steroids.

Immunohistochemical findings

IL-32 immunoreactivity was mainly observed in alveolar macrophages and alveolar walls

(Figure 1A, B, C). Positive staining was mostly detected at the cytoplasmic level with both diffuse

as well as granular patterns. Strong nuclear staining was also observed, particularly in cuboidal

alveolar cells (as characterized by anti-human cytokeratin, clone MNF116) of severe COPD

patients (Figure 1C, D). Extensive IL-32 immunoreactivity was also seen in peripheral airways

(Figure 1B), particularly in the epithelium (as cytoplasmic staining in ciliated cells and in marginal

areas of goblet cells) and in interstitial cells, including inflammatory cells, infiltrating the airway

wall. The same IL-32 immunoreactivity was observed in central airways of COPD patients, mainly

represented in the epithelial layer and in bronchial glands (See Online Data Supplement, Figure E2).

When quantitative analysis was performed, the percentage of IL-32+ macrophages was

increased in smokers with COPD compared with smoking (p=0.0014) and non-smoking controls

(p<0.0001) (Figures 2A and 1A, E, F). COPD patients were also grouped according to disease

severity. Subjects with severe COPD were clustered with a markedly high percentage of IL-32+

cells, whereas patients with mild/moderate COPD exhibited scattered values; a trend was present

for increased IL-32 expression in patients with severe COPD compared with those with

Calabrese et al., 7

mild/moderate disease (p=0.07). Moreover, the percentage of IL-32+ macrophages was increased in

smokers with normal lung function when compared with non-smoking controls (p=0.03) (Figure

2A).

In alveolar walls, increased IL-32 expression was observed in smokers with COPD

compared with both smoking and non-smoking controls (p=0.0004 and p=0.0005, respectively)

(Figure 2B). IL-32 expression was also increased in the bronchiolar epithelium of smokers with

COPD when compared with control smokers (p=0.004) and non-smokers (p=0.0009) (Table 2 and

Figure 1B).

No differences were found in IL-32 expression in smooth muscle of peripheral airways and

pulmonary arterioles (Table 2). Moreover, in none of the compartments examined was IL-32

expression different between current or ex-smokers.

TNFα immunostaining in alveolar macrophages was mainly observed in cytoplasm. The

percentage of TNFα+ macrophages was increased in both smokers with COPD and smokers with

normal lung function when compared with non-smokers (p<0.0001 and p=0.0005, respectively)

(Figure 2C). Moreover, in alveolar walls, increased TNFα expression was observed in smokers with

COPD compared with non-smoking controls (p=0.018) (Figure 2D). No differences were observed

in TNFα expression between smokers with severe COPD and those with mild/moderate disease.

No differences were found in TNFα expression in peripheral airway epithelium and smooth

muscle and in pulmonary arterioles (Table 2). In none of the compartments examined was

TNFα expression different between current or ex-smokers.

Confocal microscopy analysis showed co-expression of IL-32 and TNFα in many

macrophage-like cells and metaplastic epithelial cells (Figure 3A, B, C). CD8+ T-lymphocytes,

which are the predominant cells infiltrating the alveolar walls in COPD, also co-expressed IL-32

(Figure 3D, E, F).

Calabrese et al., 8

IL-32 evaluation in other inflammatory disorders of the lung revealed strong reactivity in the

patient with rheumatoid arthritis and in those with collagen disease associated-NSIP particularly in

alveolar macrophages and, to a lesser extent, in alveolar walls (Figure 4 A, B). By contrast, rare

immunoreactivity for IL-32 was present in subjects with asthma and in those with pulmonary

infections, whose samples were nearly negative (Figure 4C, D).

Since most of the patients included in this study (either in COPD or in control groups) had

lung cancer, there is concern that the concomitant presence of lung cancer may have influenced the

results. However, among patients with lung cancer, those with COPD had an increase expression of

IL-32 compared with those without COPD (p=0.02 for IL-32+ macrophages and p=0.007 for IL-32+

cells/mm). In addition, among patients with COPD, those with severe disease (the majority of

which did not have lung cancer) showed a trend for increased IL-32 expression when compared

with those with mild/moderate COPD (who had concomitant lung cancer).

Molecular findings

The intensity of the band coding for glyceraldehyde-3-phosphate dehydrogenase (GAPDH)

in each sample did not differ significantly within the study groups. A significant increase of IL-32

mRNA was observed in smokers with COPD compared with both smoking and non-smoking

controls (4.0-fold, p=0.007 and 2.8-fold, p=0.03, respectively). No significant differences were

detected between smoking and non-smoking controls (Figure 5).

The greater proportion of IL-32 mRNA was detected as a 307 base pair (bp) amplicon,

corresponding to IL-32 non-α (β, γ and δ). A well visible 136 bp PCR product, corresponding to IL-

32α, was seen in 54% of control cases (7/13) and in only 6% of COPD patients (1/17) (p=0.009).

Sequence analysis of all the amplicons showed a high homology (100%) with the expected IL-32

non-α (β, γ and δ) isoforms (accession numbers: NM004221, NM001012718, NM001012631,

NM001012632, NM001012634, NM001012635, NM001012636) and IL-32α (accession number:

NM001012633).

Calabrese et al., 9

Correlations

When all patients were considered together, several statistically significant correlations were

observed relating the different morphometric measurements to each other and also to functional

parameters. All details of this analysis are reported in the Online Data Supplement including figures

(Figures E3A and E3B). In particular, IL-32 expression was negatively correlated with lung

function parameters (FEV1 and FEV1/FVC) and positively correlated with TNFα expression, with

the number of CD8+ cells infiltrating the alveolar walls and with the phosphorylation state of p38

MAPK. The correlations between IL-32 expression and FEV1, FEV1/FVC, TNFα and p38 MAPK

remained significant when nonsmoking subjects were excluded from the analysis.

DISCUSSION

To our knowledge, this is the first study that demonstrates increased IL-32 protein levels in

lung samples from smokers with COPD compared with unaffected subjects. Elevated steady-state

mRNA was consistent with the increased in IL-32 by immunohistochemistry. Moreover, IL-32

protein significantly correlated with the presence of TNFα, with the number of CD8+ cells and with

the levels of phospho p38MAPK.

It is now widely accepted that activation of an immune-inflammatory response plays a key

role in the pathogenesis of COPD. An inflammatory response is present in virtually all smokers

(25,26) and this is thought to represent a normal non-specific response to injury (innate response)

(27). However, not all smokers develop COPD, suggesting that the disease requires both exposure

to cigarette smoke and individual susceptibility. It has been hypothesized that susceptibility to

COPD may occur from a shift in the non-specific innate response towards an adaptive immune

response (28). Although the source of the specific antigen is still matter of ongoing debate, it has

been proposed that autoimmune mechanisms could be operational in COPD (29). Indeed, some

Calabrese et al., 10

recent studies reported the presence of autoimmunity in smoking-induced emphysema by

conventional criteria, demonstrating both cellular and humoral responses against self antigens,

particularly elastin peptides (30,31).

To date, overexpression of IL-32 has been described in inflammatory disorders associated to

an autoimmune component, but information on activation of this pathway in vivo is indeed limited.

Upregulation of IL-32 is present in synovial tissue of patients with rheumatoid arthritis (13), where

it is correlated with the expression of proinflammatory cytokines such as IL-1β, IL-18 and TNFα

and with markers of clinical severity. Moreover, epithelial expression of IL-32 is enhanced in the

inflamed mucosa of patients with Crohn’s disease (14). Of interest, in our study we observed

intense IL-32 immunoreactivity, besides COPD, in the patient with rheumatoid arthritis and in those

with collagen diseases-associated NSIP, but not in the subjects with asthma or infective pneumonia.

These observations suggest that IL-32, rather than a general signal which becomes activated in each

inflammatory state, could be more specifically associated to autoimmune responses.

In the study, we observed a prominent cytoplasmic staining in alveolar macrophages where

IL-32 induces the production of several cytokines thought to be important in COPD, such as IL-1β,

TNFα, IL-6 and IL-18 (9). Of interest, downregulation of these inflammatory mediators has been

described using specific small inhibitory RNA (siRNA) against IL-32 in human peripheral blood

mononuclear cells (11). In addition siRNA inhibiting IL-32 also suppresses nuclear binding of NF-

κB and activator protein-1 (AP-1) (11). Notably, IL-32 expression was positively correlated with

both the phosphorylation of p38MAPK and TNFα levels. These correlations, together with reports

that NF-κB is activated in COPD (32), support the hypothesis that IL-32/TNFα pathway plays a

key role in the amplification of the immune response.

The major known sources of IL-32 are inflammatory cells, particularly macrophages, which

have been shown to produce this cytokine in vitro (10,33). We demonstrated for the first time an


active IL-32 transcription in human lung tissue, confirmed by gene sequencing. The non-α IL-32

isoforms were abundant in COPD patients. By contrast, the α isoform, which was prevalent in

unaffected subjects, was hardly detectable in patients with COPD (only one out of 17 subjects). The

functions of the different IL-32 isoforms are unknown; however, as with other cytokines, it is

possible that the different splice variants may function as antagonists (34,35). In line with these

observations, in the present study, overexpression of the non-α isoforms in COPD is associated

with depletion of the α isoform, even if it remains to be established whether the lack of the α

isoform is detrimental.

In addition to alveolar macrophages, a prominent immunostaining was observed in the

alveolar walls, particularly in cuboidal alveolar cells of patients with severe COPD. These cells

exhibited marked cytoplasmic staining, in some cases associated to nuclear positivity. The

significance of nuclear positivity in this cytokine, thought to be largely produced at cytoplasmic

level, is unknown. However, it is possible that nuclear translocation could influence the

transcription of other cytokines and growth factors, as could be the specific case for TNFα.

Moreover, other possible sources of IL-32 in the alveolar walls could be represented by

CD8+ T-lymphocytes that have the potential to produce IL-32 in vitro (12). In our study we were

able to demonstrate co-localization of IL-32 and CD8 by confocal microscopy, an observation that

is further supported by the positive correlation observed between IL-32 expression and CD8+ cells

in alveolar walls. Of interest, CD8+ T lymphocytes, that infiltrate the alveolar walls in patients with

COPD (4,21,36), may promote apoptosis of epithelial cells through different mechanisms that may

also require IL-32 (14). Indeed, extensive alveolar epithelial apoptosis, not counterbalanced by

effective proliferation, has been proposed to be responsible for lung alveolar loss in both clinical

and experimental studies (21,36,37). Although we are well aware that correlations do not imply a

cause-effect relationship, the association between expression of IL-32 and degree of airflow

limitation in our study supports the concept that the cytokine may be particularly relevant for the


progression of the disease, regulating both inflammatory and apoptotic processes. Accumulating

evidence points out that inflammation and apoptosis are indeed amplified in patients with advanced

COPD (21,38,39), where one would expect only destructive lesions, thus setting the stage for the

possibility of therapeutic interventions even in end-stage disease.

We should acknowledge that ours is an observational study, and that we could not perform

alternative methods to quantify IL-32 and TNFα expression, such as ELISA or Western Blot, nor a

precise quantitative real time PCR. Nevertheless, we believe that studies of this kind are important

since they have the potential to provide the clinical framework for proper functional investigations.

Another potential bias in this study is that only a small number of subjects were examined in the

control groups, but this is a common limitation because of the scarcity of patients without COPD

who undergo a comprehensive clinical and functional characterization pre-surgically. Finally, a

great proportion of subjects (either in COPD or in control groups) had lung cancer and the presence

of cancer itself may have influenced the results by enhancing inflammation (40). However, smokers

with severe COPD, who did not have lung cancer, had the greatest levels of IL-32 expression.

Therefore, if a bias due to cancer was present, this was in the opposite direction and the

upregulation of IL-32 in COPD would be even greater if compared with better matched control

groups.

In conclusion this study demonstrated over-expression of IL-32 in the lung periphery of

smokers with COPD that was correlated with the presence of TNFα and with the degree of airflow

obstruction. Since increased levels of IL-32 were most prominent in alveolar macrophages, it may

be worthwhile to investigate whether IL-32 is detectable with less invasive tools such as

bronchoalveolar lavage (BAL) and induced sputum. If this is proven to be true, then IL-32 could be

considered not solely as a therapeutic target in COPD but also as a valid biomarker for disease

progression.


ACKNOWLEDGEMENTS

The Authors thank Christina A. Drace for assistance in editing the manuscript.


REFERENCES

1. Lopez AD, Shibuya K, Rao C, Mathers CD, Hansell AL, Held LS, Schmid V, Buist S.

Chronic obstructive pulmonary disease: current burden and future projections. Eur Respir J.

2006;27:397-412.

2. Rabe KF, Hurd S, Anzueto A, Barnes PJ, Buist SA, Calverley P, Fukuchi Y, Jenkins C,

Rodriguez-Roisin R, van Weel C, Zielinski J; Global Initiative for Chronic Obstructive

Lung Disease. Global strategy for the diagnosis, management, and prevention of chronic

obstructive pulmonary disease: GOLD executive summary. Am J Respir Crit Care Med.

2007;176:532-55.

3. Saetta M, Di Stefano A, Turato G, Facchini FM, Corbino L, Mapp CE, Maestrelli P, Ciaccia

A, Fabbri LM. CD8+ T lymphocytes in peripheral airways of smokers with chronic

obstructive pulmonary disease. Am J Respir Crit Care Med. 1998;157:822-6.

4. Saetta M, Baraldo S, Corbino L, Turato G, Braccioni F, Rea F, Cavallesco G, Tropeano G,

Mapp CE, Maestrelli P, Ciaccia A, Fabbri LM. CD8+ve cells in the lungs of smokers with

chronic obstructive pulmonary disease. Am J Respir Crit Care Med. 1999;160:711-7.

5. Saetta M, Baraldo S, Turato G, Beghé B, Casoni GL, Bellettato CM, Rea F, Zuin R, Fabbri

LM, Papi A. Increased proportion of CD8+ T-lymphocytes in the paratracheal lymph nodes

of smokers with mild COPD. Sarcoidosis Vasc Diffuse Lung Dis. 2003;20:28-32.


6. Gan WQ, Man SF, Senthilselvan A, Sin DD. Association between chronic obstructive

pulmonary disease and systemic inflammation: a systematic review and a meta-analysis.

Thorax. 2004;59:574-80.

7. Saetta M, Mariani M, Panina-Bordignon P, Turato G, Buonsanti C, Baraldo S, Bellettato

CM, Papi A, Corbetta L, Zuin R, Sinigaglia F, Fabbri LM. Increased expression of the

chemokine receptor CXCR3 and its ligand CXCL10 in peripheral airways of smokers with


8. Grumelli S, Corry DB, Song LZ, Song L, Green L, Huh J, Hacken J, Espada R, Bag R,

Lewis DE, Kheradmand F. An immune basis for lung parenchymal destruction in chronic

obstructive pulmonary disease and emphysema. PLoS Med. 2004;1:e8.

9. Kim SH, Han SY, Azam T, Yoon DY, Dinarello CA. Interleukin-32: a cytokine and inducer

of TNFalpha. Immunity. 2005;22:131-42.

10. Dinarello CA, Kim SH. IL-32, a novel cytokine with a possible role in disease. Ann Rheum

Dis. 2006;65:iii61-4.

11. Nold MF, Nold-Petry CA, Pott GB, Zepp JA, Saavedra MT, Kim SH, Dinarello CA.

Endogenous interleukin 32 controls Cytokine and HIV-1 production. J. Immunol. 2008;

181: 557-65.

12. Goda C, Kanaji T, Kanaji S, Tanaka G, Arima K, Ohno S, Izuhara K. Involvement of IL-32

in activation-induced cell death in T cells. Int Immunol. 2006;18:233-40.


13. Joosten LA, Netea MG, Kim SH, Yoon DY, Oppers-Walgreen B, Radstake TR, Barrera P,

van de Loo FA, Dinarello CA, van den Berg WB. IL-32, a proinflammatory cytokine in

rheumatoid arthritis. Proc Natl Acad Sci USA. 2006;103:3298-303.

14. Shioya M, Nishida A, Yagi Y, Ogawa A, Tsujikawa T, Kim-Mitsuyama S, Takayanagi A,

Shimizu N, Fujiyama Y, Andoh A. Epithelial overexpression of interleukin-32alpha in

inflammatory bowel disease. Clin Exp Immunol. 2007;149:480-6.

15. Calabrese F, Baraldo S, Bazzan E, Lunardi F, Sfriso P, Dinarello CA, Papi A, Zuin R,

Saetta M. Overexpression of IL-32 in lung tissue from smokers with COPD. Am J Respir

Crit Care Med. 2007;175:A655.

16. Calabrese F, Baraldo S, Bazzan E, Lunardi F, Turato G, Lokar-Oliani K, Sfriso P, Rea F,

Maestrelli P, Papi A, Zuin R, Dinarello CA, Saetta M. IL-32, an emerging cytokine in

Chronic Obstructive Pulmonary Disease. Am J Respir Crit Care Med. 2008;177:A875.

17. Saetta M, Di Stefano A, Maestrelli P, Turato G, Ruggieri MP, Roggeri A, Calcagni P, Mapp

CE, Ciaccia A, Fabbri LM. Airway eosinophilia in chronic bronchitis during exacerbations.

Am. J. Respir. Crit. Care Med. 1994;150:1646-1652.

18. Kim KH, Shim JH, Seo EH, Cho MC, Kang JW, Kim SH, Yu DY, Song EY, Lee HG, Sohn

JH, Kim J, Dinarello CA, Yoon DY. Interleukin-32 monoclonal antibodies for

immunohistochemistry, Western Blot and ELISA. J Immunol Methods 2008; 20:38-50.


19. Maestrelli P, El Messlemani AH, De Fina O, Nowicki Y, Saetta M, Mapp C, Fabbri LM.

Increased expression of heme oxygenase (HO)-1 in alveolar spaces and HO-2 in alveolar

walls of smokers. Am J Respir Crit Care Med. 2001;164:1508-13.

20. Marian E, Baraldo S, Visentin A, Papi A, Saetta M, Fabbri LM, Maestrelli P. Up-regulated

membrane and nuclear leukotriene B4 receptors in COPD. Chest. 2006;129:1523-30.

21. Calabrese F, Giacometti C, Beghe B, Rea F, Loy M, Zuin R, Marulli G, Baraldo S, Saetta

M, Valente M. Marked alveolar apoptosis/proliferation imbalance in end-stage emphysema.

Respir Res. 2005;6:14.

22. Renda T, Baraldo S, Pelaia G, Bazzan E, Turato G, Papi A, Maestrelli P, Maselli R, Vatrella

A, Fabbri LM, Zuin R, Marsico SA, Saetta M. Increased activation of p38 MAPK in chronic

obstructive pulmonary disease. Eur Respir J. 2008;31:62-9.

23. Aickin M, Gensler H. Adjusting for multiple testing when reporting research results: the

Bonferroni vs Holm methods. Am J Public Health 1996;86.726-728.

24. Curtin F, Schulz P. Multiple correlations and Bonferroni's correction. Biol Psychiatry. 1998

15;44:775-7).

25. Niewoehner DE, Klienerman J, Rice D. Pathologic changes in the peripheral airways of

young cigarette smokers. N Engl J Med. 1974;291:755-758.

26. Cosio MG, Hale KA, Niewoehner DE. Morphologic and morphometric effects of prolonged

cigarette smoking on the small airways. Am Rev Respir Dis. 1980;122:265-21.


27. Cosio MG, Majo J, Cosio MG. Inflammation of the airways and lung parenchyma in COPD:

role of T cells. Chest. 2002;121:160S-165S.

28. Hogg JC, Chu F, Utokaparch S, Woods R, Elliott WM, Buzatu L, Cherniack RM, Rogers

RM, Sciurba FC, Coxson HO, Paré PD. The nature of small-airway obstruction in chronic

obstructive pulmonary disease. N Engl J Med. 2004;350:2645-53.

29. Agustí A, MacNee W, Donaldson K, Cosio M. Hypothesis: does COPD have an

autoimmune component? Thorax. 2003;58:832-4.

30. Lee SH, Goswami S, Grudo A, Song LZ, Bandi V, Goodnight-White S, Green L, Hacken-

Bitar J, Huh J, Bakaeen F, Coxson HO, Cogswell S, Storness-Bliss C, Corry DB,

Kheradmand F. Antielastin autoimmunity in tobacco smoking-induced emphysema. Nat

Med. 2007;13:567-9.

31. Feghali-Bostwick CA, Gadgil AS, Otterbein LE, Pilewski JM, Stoner MW, Csizmadia E,

Zhang Y, Sciurba FC, Duncan SR. Autoantibodies in patients with chronic obstructive

pulmonary disease. Am J Respir Crit Care Med 2008; 177:156-163.

32. Di Stefano A, Caramori G, Oates T, Capelli A, Lusuardi M, Gnemmi I, Ioli F, Chung KF,

Donner CF, Barnes PJ, Adcock IM. Increased expression of nuclear factor-kappaB in

bronchial biopsies from smokers and patients with COPD. Eur Respir J. 2002;20:556-63.

33. Netea MG, Azam T, Lewis EC, Joosten LA, Wang M, Langenberg D, Meng X, Chan ED,

Yoon DY, Ottenhoff T, Kim SH, Dinarello CA. Mycobacterium tuberculosis induces


interleukin-32 production through a caspase-1/IL-18/interferon-gamma-dependent

mechanism. PLoS Med 2006;3:e277.

34. Atamas SP. Alternative splice variants of cytokines: making a list. Life Sci. 1997;61:1105-

12.

35. Fletcher HA, Owiafe P, Jeffries D, Hill P, Rook GA, Zumla A, Doherty TM, Brookes RH;

Vacsel Study Group. Increased expression of mRNA encoding interleukin (IL)-4 and its

splice variant IL-4delta2 in cells from contacts of Mycobacterium tuberculosis, in the

absence of in vitro stimulation. Immunology. 2004;112:669-73.

36. Majo J, Ghezzo H, Cosio MG. Lymphocyte population and apoptosis in the lungs of

smokers and their relation to emphysema. Eur Respir J. 2001;17:946-53.

37. Kasahara Y, Tuder RM, Taraseviciene-Stewart L, Le Cras TD, Abman S, Hirth PK,

Waltenberger J, Voelkel NF. Inhibition of VEGF receptors causes lung cell apoptosis and

emphysema. J Clin Invest. 2000;106:1311-9.

38. Turato G, Zuin R, Miniati M, Baraldo S, Rea F, Beghé B, Monti S, Formichi B, Boschetto

P, Harari S, Papi A, Maestrelli P, Fabbri LM, Saetta M. Airway inflammation in severe

chronic obstructive pulmonary disease: relationship with lung function and radiologic

emphysema. Am J Respir Crit Care Med. 2002;166:105-10.

39. Retamales I, Elliott WM, Meshi B, Coxson HO, Pare PD, Sciurba FC, Rogers RM, Hayashi

S, Hogg JC. Amplification of inflammation in emphysema and its association with latent

adenoviral infection. Am J Respir Crit Care Med. 2001;164:469-73.


40. Balkwill F and Mantovani A. Inflammation and cancer: back to Virchow? Lancet

2001;357:539-45.

FIGURE LEGENDS

Figure 1

Immunohistochemistry for IL-32 in end-stage COPD (A-D). (A) Strong cytoplasmic positivity

was seen in all macrophages (arrows). (B) Immunoreactivity was also detected in bronchiolar

epithelial cells (arrowhead) and in interstitial inflammatory cells (arrowhead). (C) Strong

nuclear (arrow) and cytoplasmic staining in alveolar walls (well evident in bottom insert). (D)

Cytoplasmic positivity also detected in cuboidal alveolar cells (arrows).

Weakly positive alveolar macrophages can be observed in the smoking(E) and non smoking (F)

controls. Original magnification x200 (bottom insert x400).

Figure 2

Individual counts for: percentage of IL-32+ macrophages (A); number of IL-32+ cells in alveolar

walls (B); percentage of TNFα+ macrophages (C) and number of TNFα+ cells in alveolar walls

(D) in smokers with COPD, control smokers and non-smokers. Closed circles (●) represent

Mild/Moderate COPD, while open circles (○) represent Severe/Very Severe COPD. Horizontal

bars represent median values. The p values in figure represent Mann Whitney U-test analyses.

Overall comparison using Kruskal-Wallis test p<0.0001 (A,B,C) and p=0.05 (D).

Figure 3

Immunofluorescence laser scanning microscopy analysis showed the coexpression of IL-32 (A,

red) and TNFα (B, green) in the same macrophages. Panel C shows the overlay image of A and

B (arrows). Immunofluorescence laser scanning microscopy analysis also showed the presence

of IL-32 (D, red) on CD8+ T cells (E, green). Panel F shows the overlay image of D and E (scale

bars: 10μm).

Figure 4

IL-32 evaluation in other inflammatory lung diseases: strong immunostaining was observed in

rheumatoid arthritis (A) and collagen disease associated-NSIP fibrosis pattern (B). Weak

immunoreactivity, limited to alveolar macrophages, was present in asthma (C) and in viral

pneumonia (D).

Figure 5

(A) MetaPhor gel electrophoresis for RT-PCR of GAPDH and IL-32 non-α (β, γ and δ) mRNAs

in emblematic cases. GAPDH is detected as a 130 bp amplicon (lanes 2, 4, 6, 8); IL-32α as a

136 bp amplicon (lane 3) and IL-32 non-α as a 307 bp amplicon (lanes 3, 5, 7, 9). Lane 1: DNA

molecular weight marker. (B) Quantification of IL-32 non-α (β, γ and δ) mRNA expression in

the three groups of patients (17 COPD, 7 control smokers and 6 non smokers). Shown data are

the mean ± SEM and the p values in figure represent t-test analysis.

Table 1. Patient characteristics *

Smokers with COPD

(GOLD stage I to IV)

Control

Smokers

Non

Smokers

Subjects examined 31M:9F 11M:0F 2M:7F

Age, yrs 60±1 64±2 52±7

Smoking history, pk-yrs 45±5 47±7 -

Current/ex smokers 15/25 4/7 -

FEV1, % pred 39±4 † 102±3 108±6

FEV1/FVC, % 45±3 † 79±2 82±2

PaO2, mmHg 74±3 † 88±2 80±3

PaCO2, mmHg 46±2 † 37±1 37±2

RV, % pred 159±13 ‡ 91±13 -

DLco, % pred 46±6 ‡ 74±5 -

* Values are expressed as mean±SEM

Measurements of residual volume (RV) were performed in only 41 subjects (34 COPD and 7 control

smokers). Measurements of DLco were performed in only 33 subjects (28 COPD and 5 control smokers).

† Significantly different from Control Smokers and Non-Smokers (p<0.05)

‡ Significantly different from Control Smokers (p<0.05)

Table 2. Semiquantitative scores for IL-32 and TNFα*

COPD Control

Smokers

Non

Smokers

IL-32 bronchiolar epithelium score (%) 57 (0-100) † 0 (0-58) 0 (0-10)

IL-32 bronchiolar smooth muscle score (%) 0 (0-67) 0 (0-17) 0 (0-0)

IL-32 pulmonary arterioles score (%) 0 (0-57) 0 (0-0) 0 (0-0)

TNFα bronchiolar epithelium score (%) 0 (0-100) 0 (0-100) 0 (0-17)

TNFα bronchiolar smooth muscle score (%) 0 (0-25) 0 (0-33) 0 (0-0)

TNFα pulmonary arterioles score (%) 0 (0-0) 0 (0-75) 0 (0-0)

*Values are expressed as median (range).

Significantly different from Control Smokers and Non smokers † (p<0.005)

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

IL-32, A NOVEL PROINFLAMMATORY CYTOKINE IN CHRONIC OBSTRUCTIVE

PULMONARY DISEASE

Fiorella Calabrese, Simonetta Baraldo, Erica Bazzan, Francesca Lunardi, Federico Rea, Piero

Maestrelli, Graziella Turato, Kim Lokar-Oliani, Alberto Papi, Renzo Zuin, Paolo Sfriso, Elisabetta

Balestro, Charles A Dinarello and Marina Saetta.

Online Data Supplement

Calabrese et al., 1

METHODS and RESULTS

Sample analysis and immunohistochemistry

For the present study, lung tissue from 60 subjects undergoing surgery for appropriate

clinical indications were collected and categorized into the following three groups: smokers with

COPD (GOLD stage I-IV; n=40); asymptomatic smokers with normal lung function (control

smokers; n=11) and asymptomatic non-smoking subjects with normal lung function (non smokers;

n=9). All patients with severe/very severe COPD (GOLD stage III, IV) underwent lung

transplantation or LVRS, except for 2 subjects who underwent lobectomy for the concomitant

presence of lung cancer. Samples from subjects in the other groups (mild/moderate COPD, control

smokers and nonsmokers) were also obtained from subjects undergoing lobectomy for suspected

lung cancer. However, pathological examination revealed a benign tumour in 1 subject of each

group (mild COPD, control smokers and nonsmokers). Moreover, 2 subjects referred for lung

carcinoids and 1 explanted lung from a potential lung donor were also included among non smoking

controls.

In specimens obtained from explanted lungs (n=20), cold ischemic preservation lasted 60

and 120 min, respectively for single and double lung transplantation. The lungs were gently fixed in

10% phosphate-buffered formalin by airway perfusion. Samples were selected from specimens that

showed features of excellent tissue preservation and adequate lung inflation. In particular, large thin

blocks of 30x25 mm were cut from the subpleural areas of the apical anterior and lingular segments

of the upper lobes, as well as the apical and basal segments of the lower lobes. The right lung was

sampled in the same way, with the middle lobe being treated in the same way as the lingula.

In specimens obtained at surgery (LVRS or lobectomy), randomly selected tissue blocks

were taken from the subpleural parenchyma (avoiding areas affected by macroscopic pathological

process in patients who underwent lung resection for nodules). Samples were fixed in 10%

phosphate-buffered formalin (pH 7.2) for 24 hours.

Calabrese et al., 2

Samples were then processed for sectioning and, after dehydration, embedded in paraffin

wax. 5 μm-thick sections were cut and processed for immunohistochemical analysis of IL-32 and

TNFα. Briefly, after dewaxing and hydration, sections were incubated in citrate buffer 5 mM at pH

6.0 in a microwave oven for 30 minutes, for antigen retrieval. Afterwards, sections were treated

with rabbit serum (X0901, Dako, Glostrup, Denmark) and incubated for 60 min with the primary

monoclonal antibodies anti IL-32 (clones 09 and 07 produced as previously described) (E1) or anti

TNFα (T6817, Sigma-Aldrich, St. Louis, MO) at a concentration of 0.3 μg/mL. Sections were

subsequently incubated with streptavidin-biotin complex conjugated to alkaline phosphatase (Strept

AB complex/AP, K0391; Dako, Glostrup, Denmark) for 30 min. Immunoreactivity was visualized

with diamino benzidyne (DAB, Dako, Glostrup, Denmark). Finally, the sections were

counterstained with Mayer’s haematoxylin.

Negative controls for nonspecific binding were processed either omitting the primary

antibody or using isotype IgG (Figure E1) and revealed no signal. Moreover, synovial tissue from

patients with rheumatoid arthritis was included in the immunohistochemical rounds as a positive

control.

To quantify IL-32 and TNFα expression in alveolar macrophages, at least 20 non

consecutive high-power fields (HPF) and at least 100 macrophages inside the alveolar spaces were

evaluated for each patient; results were expressed as percentage of IL-32 positive macrophages over

the total number of macrophages examined (E2). Alveolar macrophages were defined as

mononuclear cells with well represented cytoplasm present in the alveolar spaces and not attached

to the alveolar walls. For evaluation of IL-32 and TNFα in alveolar walls, 10 non-consecutive high

power fields were evaluated for each subject. Positive cells within the alveolar walls were counted

and the results were expressed as the number of positive cells/mm of alveolar wall (E3).

Confocal microscopy was applied to confirm the coexpression of IL-32/TNFα and IL-

32/CD8 observed in subsequent serial sections. Paraffin sections were prepared for

immunofluorescent labelling. Briefly, primary antibodies against IL32, CD8 and TNF-α (dilution

Calabrese et al., 3

1:2000, 1:50 and 1:30 in phosphate buffered saline with 5 g/L bovine serum albumin and 1 g/L

gelatine, respectively) and secondary antibodies (goat anti-mouse IgG and goat anti-mouse IgG)

conjugated with ALEXA 488 and TEXAS red (Sigma) were used, respectively. Double labelling

using both antibodies on the same section was performed. Primary and secondary antibodies were

incubated for 1 h at room temperature. Slides were stored at 4°C and analysed within 24 h. As a

control, the primary antibody was omitted. Immunofluorescence was evaluated with a confocal

microscopy (Biorad 2100 Multiphoton; Hercules, CA), using an argon laser at 488 nm in

combination with a helium neon laser at 543 nm to excite the green (CD8 or TNFα) and red (IL-32)

fluorochromes simultaneously. Emitted fluorescence was detected with a 505–530 nm band pass

filter for the green signal and a 560 nm long pass filter for the red signal. Images were analyzed

using Adobe Photoshop 7.0.

Moreover, to investigate potential correlations between IL-32 expression and other

inflammatory parameters known to be upregulated in COPD, we used immunohistochemical

quantification of CD8+ T lymphocytes, neutrophils and phospho p38+ cells obtained in previous

reports (E3-E6). Data for CD8+ T lymphocytes were available in 35 out of the 60 patients, while

data for neutrophils and phospho p38+ cells were available in 28 out of 60 patients ( equally

represented among the different groups examined). Briefly, mouse monoclonal antibodies were

used for quantification of neutrophils (anti-elastase M752, Dako, Glostrup, Denmark), CD8+ cells

(anti-CD8 M7103, Dako, Glostrup, Denmark) and phospho-p38 MAPK+ cells (Cell Signaling

Technologies Inc, USA) as previously described (E6-E8). The number of CD8+ cells infiltrating the

alveolar walls (but not the number of neutrophils) was significantly increased in smokers with

COPD when compared with control smokers and nonsmokers (Table E1). Moreover, the number of

phospho-p38+ alveolar macrophages and that of phospho-p38+ cells in the alveolar walls were

increased in smokers with COPD as compared with smoking and nonsmoking controls (Table E1).

The number of CD8+ cells, neutrophils, phospho-p38+ alveolar macrophages and phospho-p38+

Calabrese et al., 4

cells in the alveolar walls was similar in smokers with normal lung function and nonsmokers (Table

E1).

Correlations

When all patients were considered together, several statistically significant correlations were

observed relating the different morphometric measurements to each other and also to functional

parameters. In particular, positive correlations were observed between the expression of IL-32 in

alveolar macrophages and that in alveolar walls (p<0.004, rs=0.85), as well as between the

expression of TNFα in alveolar macrophages and that in alveolar walls (p<0.004, rs=0.50).

Moreover, IL-32 expression in both alveolar macrophages and alveolar walls was correlated

with TNFα+ alveolar macrophages (p<0.004, rs=0.70; p<0.004, rs=0.60 respectively) and with

TNFα+ cells in alveolar walls (p<0.004, rs=0.60; p=0.004, rs=0.50 respectively) (Figure E3 A). All

the above described correlations remained significant when non-smoking controls were excluded

from the analysis. We also estimated the level of agreement between IL-32 and TNFα expression in

alveolar macrophages. The associated Cohen’s kappa coefficient was 0.7 corresponding to a good

level of agreement.

IL-32 expression in alveolar macrophages and alveolar walls was correlated with the

number of phospho p38+ alveolar macrophages (p<0.01, rs=0.60 for both) and phospho p38+ cells in

alveolar walls (p=0.003, rs=0.62 for both). Moreover, IL-32 expression was correlated with the

number of CD8+ cells infiltrating the alveolar walls (p=0.02, rs=0.44). While correlations between

IL-32 and phospho p38 remained significant when non-smoking subjects were excluded from the

analysis, that with CD8+ cells did not.

When we examined lung function, IL-32 expression in both alveolar macrophages and

alveolar walls was negatively related to the values of FEV1 (% pred) (p<0.004, rs=-0.50 for both)

(Figure E3B), FEV1/FVC (%) (p<0.004, rs=-0.50 for both) and positively related to values of

PaCO2 mmHg (p=0.01, rs=0.30 for both). Moreover, the percentage of TNFα+ macrophages was

Calabrese et al., 5

negatively related to values of FEV1 (% pred) (p=0.002, rs=-0.46), FEV1/FVC (%) (p<0.004, rs=-

0.57) and positively related to values of PaCO2 mmHg (p=0.006, rs=0.40). Gas transfer was

measured in 33 subjects and was not related to alveolar expression of IL-32.

All these correlations remained significant when non-smoking controls were excluded from

the analysis, except for those between TNFα and FEV1 or FEV1/FVC.

Molecular Analysis on lung tissues

Molecular analysis for IL-32 isoform detection was performed in 30 cases (17 COPD

patients, 7 control smokers and 6 nonsmokers). Lung epithelial cell line A549 stimulated with IFN-

γ (Manassas, VA) was used as a positive control, since it was previously demonstrated that

stimulated A549 produce IL-32 (E9). Total RNA was extracted from the same formalin-fixed

paraffin-embedded lung tissues used for immunohistochemistry by a modified RNAzol method, as

previously described (E10). The RNA pellets were re-dissolved in 20 μl sterile DEPC-treated water

and incubated with 5U of deoxyribonuclease I (Sigma Aldrich, Milan, Italy) for 15 min at room

temperature. All samples were analyzed using glyceraldehyde-3-phosphate dehydrogenase

(GAPDH) primers to verify adequate nucleic acid extraction. Different sets of IL-32 primers were

used to discriminate IL-32 non-α (β, γ and δ) from IL-32 α isoforms on the basis of amplicon sizes

(307 and 136 bp, respectively). Previous studies had mainly focused on the detection of IL-32 α

expression suggesting a prevalent role of this isoform in different pathological conditions

(E11,E12). Thus, this justifies our decision to specifically discriminate this isoform from the others.

The sequences of primers for GAPDH and IL-32, annealing temperature conditions and amplicon

sizes are listed in Table E2. 1 μg of extracted total RNA was used for the first complementary DNA

(cDNA) synthesis and conventional RT-PCR was used. The PCR mix was made up to a volume of

50μl using 1X PCR Buffer II, 1mM MgCl2 solution, 200 μM each of dATP, dCTP, dGTP, dUTP,

400 nM of each primer, and 1.25 Units of AmpliTaq Gold. After the initial denaturation at 95°C for

10 min, the cDNA was amplified by 40 three-step cycles (30 sec at 95°C, 30 sec at annealing

Calabrese et al., 6

temperature, 1 min at 72°C). The appropriate number of cycles of PCR was determined so that the

amount of PCR product versus the intensity of the ethidium bromide-stained product on MetaPhor

gel were within a linear range. All samples were processed with simultaneous positive (RNA

extracted from A549 cell line) and negative controls (reaction mixture without RNA and cDNA

templates). Precautions were taken to avoid false positives as a result of contamination by PCR

product carry over, by strictly following the guidelines for the general handling of the PCR

procedure, such as separation of rooms, boards, and lab benches, (E13) (i.e. extraction of nucleic

acids, PCR amplification and gene sequencing performed in different rooms with separate

equipment and pipettes). Sensitivity of RT-PCR in our laboratory was previously reported (E14)

and the samples were considered true positive when the reproducibility of PCR analysis was

verified at least three times. Following PCR amplification, PCR products (15 μl) were subjected to

electrophoresis on 3% high resolution MetaPhor gel (Bio Spa, Italy) in 1X TAE buffer (Tris-acetate

0.04 M and EDTA 0.001 M) containing 0.03 μg/ml ethidium bromide. The gels were visualized by

UV transillumination and photographed with a Versa Doc Imaging System 1000 (Bio-Rad). The

optical density of each band was quantified by densitometry using Quantity One software (Bio-Rad)

and represented as the ratio of IL-32 mRNA to GAPDH mRNA.

All the IL-32 amplicons were analyzed by direct cycle sequencing of PCR products.

Nucleotide sequences were determined in each direction using an automated DNA sequencer (ABI

model 310 DNA sequencer, PE-Applied Biosystem) with fluorescent dideoxy-chain terminators as

previously described (E15). The sequences were analyzed using Sequence Analysis 2.1.2 software

and were compared with the published cDNA sequences reported in the Gene Bank data base.

REFERENCES

E1. Kim KH, Shim JH, Seo EH, Cho MC, Kang JW, Kim SH, Yu DY, Song EY, Lee HG,

Sohn JH, Kim JM, Dinarello CA and Yoon DY. IL-32 monoclonal antibodies for

Calabrese et al., 7

immunohistochemistry, Western Blotting and ELISA. Journal of Immunological methods

2008; 333:38-50.

E2. Maestrelli P, El Messlemani AH, De Fina O, Nowicki Y, Saetta M, Mapp C, Fabbri LM.

Increased expression of heme oxygenase (HO)-1 in alveolar spaces and HO-2 in alveolar

walls of smokers. Am J Respir Crit Care Med. 2001;164:1508-13.

E3. Saetta M, Baraldo S, Corbino L, Turato G, Braccioni F, Rea F, Cavallesco G, Tropeano G,

Mapp CE, Maestrelli P, Ciaccia A, Fabbri LM. CD8+ve cells in the lungs of smokers with


E4. Marian E, Baraldo S, Visentin A, Papi A, Saetta M, Fabbri LM, Maestrelli P. Up-

regulated membrane and nuclear leukotriene B4 receptors in COPD. Chest.

2006;129:1523-30.

E5. Calabrese F, Giacometti C, Beghe B, Rea F, Loy M, Zuin R, Marulli G, Baraldo S, Saetta

M, Valente M. Marked alveolar apoptosis/proliferation imbalance in end-stage

emphysema. Respir Res. 2005;6:14.

E6. Renda T, Baraldo S, Pelaia G, Bazzan E, Turato G, Papi A, Maestrelli P, Maselli R,

Vatrella A, Fabbri LM, Zuin R, Marsico SA, Saetta M. Increased activation of p38

MAPK in chronic obstructive pulmonary disease. Eur Respir J. 2008;31:62-9.

E7. Saetta M, Di Stefano A, Maestrelli P, Turato G, Ruggieri MP, Roggeri A, Calcagni P,

Mapp CE, Ciaccia A, Fabbri LM. Airway eosinophilia in chronic bronchitis during

exacerbations. Am. J. Respir. Crit. Care Med. 1994;150:1646-1652.

E8. Baraldo S, Turato G, Badin C, Bazzan E, Beghé B, Zuin R, Calabrese F, Casoni G,

Maestrelli P, Papi A, Fabbri LM, Saetta M.. Neutrophilic infiltration within the airway

smooth muscle in patients with COPD. Thorax. 2004;59:308-12.

E9. Kim SH, Han SY, Azam T, Yoon DY, Dinarello CA. Interleukin-32: a cytokine and

inducer of TNFalpha. Immunity 2005;22:131-42.

Calabrese et al., 8

E10. Chomczynski P, Sacchi N. The single-step method of RNA isolation by acid guanidinium

thiocyanate-phenol-chloroform extraction: twenty-something years on. Nat Protoc.

2006;1:581-5

E11. Shioya M, Nishida A, Yagi Y, Ogawa A, Tsujikawa T, Kim-Mitsuyama S, Takayanagi A,

Shimizu N, Fujiyama Y, Andoh A. Epithelial overexpression of interleukin-32alpha in

inflammatory bowel disease. Clin Exp Immunol. 2007;149:480-6.

E12. Novick D, Rubinstein M, Azam T, Rabinkov A, Dinarello CA, Kim SH. Proteinase 3 is an

IL-32 binding protein. Proc Natl Acad Sci U S A. 2006;103:3316-21.

E13. Kwok S, Higuchi R. Avoiding false positives with PCR. Nature. 1989;339:237-8

E14. Calabrese F, Angelini A, Thiene G, Basso C, Nava A, Valente M. No detection of

enteroviral genome in the myocardium of patients with arrhythmogenic right ventricular

cardiomyopathy. J Clin Pathol. 2000;53:382-7.

E15. Pontisso P, Calabrese F, Benvegnù L, Lise M, Belluco C, Ruvoletto MG, Marino M,

Valente M, Nitti D, Gatta A, Fassina G. Overexpression of squamous cell carcinoma

antigen variants in hepatocellular carcinoma. Br J Cancer. 2004;90:833-7.

Figure Legends

Figure E1: Negative controls for IL-32 immunohistochemistry in a severe COPD patient: with

omission of the primary antibody (A) and using an isotype IgG (B).

Figure E2: IL-32 immunoreactivity in central airways of COPD patients was mainly represented in

the epithelial layer and in bronchial glands.

Figure E3: (A) Relationship between percentage of IL-32+ macrophages and values of FEV1 (%

pred) and (B) relationship between percentage of IL-32+ macrophages and TNFα+ macrophages in

Calabrese et al., 9

all subjects included in the study. Open circles indicate smoking and nonsmoking controls subjects,

grey circles indicates mild/moderate COPD patients and closed circles indicate severe/very severe

COPD patients.

Table E1: Quantification of p38MAPK and inflammatory cells *

COPD Control

Smokers

Non

Smokers

CD8+ cells/mm of alveolar wall 7 (2-16) † 3 (1-7) 3 (1-4)

Neutrophils/mm of alveolar wall 4 (1-10) 8 (4-13) 10 (0-14)

p38MAPK positive macrophages (%) 33 (0-70) ‡ 3 (0-8.4) 4 (1-6)

p38MAPK cells/mm of alveolar wall 6 (0-17) ‡ 0 (0-0.2) 0 (0-0)

*Values are expressed as median (range).

Significantly different from Control Smokers and Non smokers † (p<0.005) and ‡ (p<0.05)

TABLE E2: Oligonucleotide sequences of primers used to amplify GAPDH (housekeeping) and

IL-32.

Primer Sequence 5’-3’ Annealing

temperature Amplicon size

GAPDH Fw GGGCTCTCCAGAACATCATCC

GAPDH Rv GTCCACCACTGACACGTTGG 60 130 bp

IL-32 Fw GGATGTTGAGGATCCCGCAA

IL-32 Rv GTCAGTATCTTCATTTTGAGGAT 60 307 and 136 bp

GAPDH: glyceraldehyde-3-phosphate dehydrogenase, Fw: Forward, Rv: reverse, bp: base pair


Figure E1

Figure E2


Figure E3A

0

20

40

60

80

100

120

140

160

0 20 40 60 80 100

IL-32+ macrophages (%)

FEV

1(%

pred

)

p<0.004 rs= - 0.57

0

20

40

60

80

100

120

140

160

0 20 40 60 80 100

IL-32+ macrophages (%)

FEV

1(%

pred

)

p<0.004 rs= - 0.57

Figure E3B

0

20

40

60

80

100

0 20 40 60 80 100

TNFα+ macrophages (%)

IL-3

2+ m

acro

phag

es(%

)

p<0.004 rs= 0.72

0

20

40

60

80

100

0 20 40 60 80 1000

20

40

60

80

100

0 20 40 60 80 100

TNFα+ macrophages (%)

IL-3

2+ m

acro

phag

es(%

)

p<0.004 rs= 0.72

IL-32, a Novel Proinflammatory Cytokine in Chronic Obstructive Pulmonary Disease

Documents

Transcript of IL-32, a Novel Proinflammatory Cytokine in Chronic Obstructive Pulmonary Disease