Identification of the mammalian homolog of the splicing regulator Suppressor-of-white-apricot as a...

Ž .Molecular Brain Research 71 1999 332–340www.elsevier.comrlocaterbres

Research report

Identification of the mammalian homolog of the splicing regulatorSuppressor-of-white-apricot as a thyroid hormone regulated gene

Ana Cuadrado, Juan Bernal, Alberto Munoz )˜Instituto de InÕestigaciones Biomedicas ‘‘ Alberto Sols’’, Consejo Superior de InÕestigaciones Cientıficas, UniÕersidad Autonoma de Madrid, Arturo´ ´ ´

Duperier 4, 28029, Madrid, Spain

Accepted 22 June 1999

Abstract

Mammalian brain development is controlled by thyroid hormone through the regulation of target genes. In this study, we describe forthe first time that a splicing regulator gene is under thyroid hormone control in the rat brain during the critical period of neuronaldifferentiation. By differential display, we have identified the mammalian homolog of the Drosophila splicing regulator Suppressor-of-

Ž .white-apricot SWAP as a thyroid hormone-regulated gene in an immortal line of rat neuroblasts, E18 cells. Using Northern blotting andin situ hybridization, we found that expression of SWAP is under thyroid control in the developing rat brain. SWAP gene expression is

Ž .highest during the first 10 days of life P0–P10 , preferentially in cerebral cortex, cerebellum, subventricular epithelium, pirifom cortex,Ž .hippocampus, amygdala, and caudate putamen. At later stages P15–P30 SWAP expression decreases, being detectable only in the

cerebellum, hippocampus, and layers IIrIII of cerebral and piriform cortexes. We found that hypothyroidism causes an abnormal highlevel of SWAP RNA expression at P5–P15 throughout the brain except the cerebellum. Significantly, thyroid hormone treatment in vivoof hypothyroid animals led to a normalization of SWAP RNA expression. Furthermore, similar hormone treatment caused a decrease inSWAP expression in control rats. By modulating the expression of SWAP and perhaps other splicing regulators thyroid hormone mayexert wide regulatory effects on multiple genes. The regulation of SWAP gene defines a novel mechanism of action of thyroid hormonewhich can be important for its effects in the developing brain. q 1999 Elsevier Science B.V. All rights reserved.

Keywords: Thyroid hormone; Gene regulation; Differential display; SWAP gene; Splicing

1. Introduction

Ž XThyroid hormone the active form 3, 5, 3 -triiodothy-.ronine or T3, and the pro-hormone thyroxine or T4 plays

w xa crucial role during brain maturation 16,27,38 . ThyroidŽ .deficiency causes abnormal central nervous system CNS

development resulting in neurologic deficits and severew xmental retardation 12 . The vast array of processes af-

fected by hypothyroidism include neuronal axonogenesisand dendritic arborization, synaptogenesis, cell migrationand cerebral cortex lamination, myelination, and otherswhich are thought to be the consequence of the regulatoryaction of T3 on gene expression. In the last years, anumber of genes have been described by us and others to

Ž w x .be under thyroid control in the CNS Refs. 4,5,7 reviews .However, the complexity of T3 action in this organ makes

) Corresponding author. Fax: q34-91-5854587; E-mail:[email protected]

it likely that additional, still unidentified T3-target genesexist.

The classical mechanism of action of T3 is the regula-tion of gene transcription through the binding to specific

Ž .nuclear receptors TRa1, TRb1, and TRb2 isoformsŽwhich interact with specific nucleotide sequences T3REs:

.thyroid response elements present in target genes usuallyin the form of heterodimers with the RXR 9-cis retinoic

w xacid receptor 17,26,32,36,49 . There are at least threeŽ .ways through which T3 can regulate gene transcription: a

Ž .activation via positive T3REs; b repression via negativeŽ .T3REs; and c transcriptional interference via interaction

with other transcription factors. In addition, several studieshave recently indicated post-transcriptional regulatory ef-fects of T3 on mRNA stabilization, processing, and trans-

wlation, or on post-translational mechanisms 3,11,17,x19,25,35,39,47,48 . These results are in agreement with the

fact that no T3REs have been found in a subset of regu-w xlated genes 4 .

0169-328Xr99r$ - see front matter q 1999 Elsevier Science B.V. All rights reserved.Ž .PII: S0169-328X 99 00212-0

( )A. Cuadrado et al.rMolecular Brain Research 71 1999 332–340 333

Differential display PCR has been used in many sys-tems including rat brain to identify and clone differentially

w xexpressed genes 10,15,28,29 . Using this technique, anovel T3-regulated gene named THR was recently identi-

w xfied in the mature rat cerebrum 46 . We have used differ-ential display to search for genes abnormally expressed inthe hypothyroid rat brain during development. In order toreduce the number of false positives and also to circum-vent the heterogeneity of brain tissue, we used an in vitrocell system. This approach has the additional advantage ofallowing for rapid screening of selected clones. We usedan immortal line of embryonal rat neuroblasts, E18 cells,which were manipulated to express high number of thyroidreceptors by means of retrovirally mediated gene transferŽ .E18qTRa1 cells . Comparison of RNA populations ex-pressed by E18qTRa1 cells treated or not with T3

Ž .allowed the isolation of a cDNA clone 10A which wasdownregulated by hormone. By sequencing this clone wasidentified as the mammalian homolog to Drosophila splic-

Ž .ing regulator Suppressor-of-white-apricot DmSWAPgene. We studied the expression of SWAP gene in the ratbrain, and found that hypothyroidism does not change itsdevelopmental profile of expression but leads to a generalincrease in SWAP mRNA levels throughout the brainexcept the cerebellum. The negative regulation of SWAPgene by thyroid hormone was demonstrated by in vivotreatment with T4 of both, control and hypothyroid ani-mals.

2. Materials and methods

2.1. Cells

E18 cells were spontaneously immortalized from pri-mary cultures of total brains from 18-day-old rat embryos,

w xand expressed very low numbers of thyroid receptors 34 .Cells were routinely grown in HAM’S F12 medium sup-plemented with 10% fetal calf serum. E18qTRa1 cellsstably expressing high number of thyroid receptors weregenerated by infecting E18 cell cultures with a Moloney-based murine leukemia retrovirus encoding the chicken

r w xTRa1 gene and the neo gene basically as described 33 .Expression of functional thyroid receptors was checked byNorthern blotting and in vivo hormone binding assays

125 w xusing I-radiolabeled T3 also as described 33 .

2.2. Differential display

Total RNA was collected from E18qTRa1 cells fol-w xlowing standard methods 42 . Cells were cultured in 150

mm dishes and treated or not with 150 nM T3 for 12 hupon change to medium containing 1% T3- and T4-de-

w xpleted serum prepared as described 43 . Differential dis-play was performed using the Hieroglyph mRNA profile

Ž .kit a1 Genomix using combinations of a two-base-

Ž Xanchored primer 5 ACGACTCACTATAGGGC-X.TTTTTTTTTTTTCG 3 and three upstream arbitrary

Ž Xprimers for PCR 5 ACAATTTCACACAGGAGCTAG-CATGG 3X, 5XACAATTTCACACAGGAGACCATTGCA

X X X. 333 , 5 ACAATTTCACCAGGAGCTAGCAGAC 3 . P-ra-diolabeled PCR products were electrophoretically sepa-rated on 6% denaturing polyacrylamide gels and subjectedto autoradiography. Bands of interest were excised, ampli-fied by PCR, cloned in the pCR2.1 TA cloning plasmidŽ .Invitrogen , and sequenced.

2.3. RNA extraction and Northern analysis

Ž .qTo prepare Poly A RNA from E18 cells we used theŽ . w xaffinity chromatography oligo dT -cellulose method 42 .

Total RNA from tissues was obtained by the guanidiniumw xisothiocyanate–phenol–chloroform procedure 9 . RNAs

were fractionated in formaldehyde agarose gels and blottedw xonto nylon membranes following standard techniques 42 .

As controls for the amount and integrity of RNA presenton the filters, blots were stained in a 0.02% methyleneblue solution made in 0.3 M sodium acetate to visualizethe ribosomal RNA and rehybridized with a glyceralde-

Ž .hyde 3-phosphate dehydrogenase GAPDH cDNA probe.Radioactive probes were prepared by the random priming

w xprocedure 18 . The whole 267 bp fragment of clone 10Awas used.

Fig. 1. Northern blot analysis showing mRNA bands regulated by T3treatment in E18qTRa1 cells. Cells were treated for 1 or 24 h with 150

Ž . Ž .qnM T3 or vehicle y and 5 mg of poly A RNA was loaded in eachlane. The probe was the 267 bp clone 10A cDNA obtained by differentialdisplay. Numbers at the bottom show the fold-increase expression of eachof the two mRNA bands respect to those in untreated cells at 1 h time

Ž .point. Values were obtained separately for the pre mRNA 6.0 kb and forŽ .the mature mRNA 3.4 kb . For control of RNA loading, the membrane

was stripped of probe and then rehybridized with labeled glyceraldehyde-Ž .3-phosphate dehydrogenase GAPDH cDNA.

( )A. Cuadrado et al.rMolecular Brain Research 71 1999 332–340334

2.4. Sequencing

Sequencing was done using an Applied BiosystemsAutomatic DNA Sequencer 373A by the fluorescentdideoxynucleotides terminators method according to Sanger

w xet al. 44 .

2.5. Rats

Wistar rats maintained in the animal facilities of ourInstituto de Investigaciones Biomedicas were used for the´studies reported here. All efforts were made to minimizeanimal suffering, to reduce the number of animals usedand to utilize alternatives to in vivo techniques. The main-tenance and handling of the animals were as recommendedby the European Communities Council Directive of

Ž .November 24th, 1986 86r609rEEC . To induce fetal andŽ .neonatal hypothyroidism E19, P0, P5 2-mercapto-1-

Ž .methylimidazole 0.02%, Sigma, St. Louis, MO was ad-ministered in the drinking water of the dams from the 9thday after conception and was continued until the animalswere killed. In addition, surgical thyroidectomy was per-

w xformed at P5 as previously described 2,41 . This protocolensures that the animals are hypothyroid during the entire

w xneonatal period 1 . P0 animals were killed 8–12 h afterbirth. T4 was used for the in vivo hormonal treatmentsbecause it crosses the blood–brain barrier more efficiently

w xthan T3, and is converted to T3 in the brain 14 . T4 wasadministered as single daily i.p. injections of 1.8 mgr100g b.wt. starting 4 days before death. Rats were killed 24 hafter the last T4 injection. Hypothyroid animals showed an

Ž .arrest of body weight growth 25% on P15 and lowcirculating levels of both, T4 and T3 measured by a

w xspecific radioimmunoassay 31 analogous to those re-w xported 2,41 . For in situ hybridization studies, at least

three animals were studied per experimental group toobtain representative values.

Ž .Fig. 2. Homology comparison between clone 10A and human and Drosophila SWAP genes. A The numbers indicate nucleotide positions in the humanSWAP cDNA. The 267 nucleotides of clone 10A correspond to part of intron 1, the complete exon 2, and part of intron 2 of SWAP genes. The homologybetween clone 10A and the corresponding sequences of human and Drosophila SWAP genes is of 85 and 45%, respectively. Homology is particularlyhigh in exon 2, although it is also considerable in introns 1 and 2, mainly with human SWAP. Dashes represent gaps introduced into the sequences to allow

Ž .maximal alignment. B Amino acid sequence homology between clone 10A and exon 2 of human SWAP. Numbers indicate amino acid positions of theŽ .latter. Identical matches are shown by a vertical line; non-identical amino acids with similar nonpolar side chains I, isoleucine and V, valine are marked

Ž .with a cross q .


2.6. In situ hybridization

In situ hybridization on floating sections was performedw xas adapted from the procedure of Gall and Isackson 20 .

Under profound pentobarbital anesthesia, normal and hy-pothyroid rats of different ages were perfused through theheart with cold 4% p-formaldehyde in 0.1 M sodium

Ž .phosphate pH 7.4 . The brains were removed quickly,postfixed in 4% p-formaldehyde in 0.1 M sodium phos-

Ž .phate pH 7.4 and cryoprotected in 4% p-formaldehydeŽ . Ž .q30% sucrose wrv in phosphate buffer saline PBS at

48C. Subsequently, 25 mm thick coronal sections were cutusing a cryostat. Sections were thawed, washed with PBSfor 5 min and treated for additional 10 min at roomtemperature under free-floating conditions with 0.1% Tri-

ton X-100, 0.2 M hydrochloric acid, 0.25% acetic anhy-dride in 0.1 M triethanolamine, and postfixed with 4%p-formaldehyde. They were then preincubated in hy-

Žbridization solution 0.6 M sodium chloride, 20 mM piper-X Ž . Ž .azine-N, N -bis 2-ethanesulfonic acid PIPES -sodium salt

Ž .pH 6.8, 10 mM ethylenediaminetetra–acetate EDTA 50%formamide, 0.2% sodium dodecylsulfate, 5= Denhardt’ssolution, 10% dextran sulfate, 50 mM dithiotreitol, 250mgrml of sheared salmon sperm DNA and 250 mgrml of

.yeast tRNA for 3–5 h at 558C, and then incubated in thesame solution containing the 35S-UTP-labeled riboprobeŽ 6 .16=10 c.p.m.rml overnight at 558C. Sections wereconsecutively washed once in 2= standard saline citrateŽSSC: 1= SSCs0.15 M sodium chloride, 0.015 M

.sodium citrate q10 mM b-mercaptoethanol at room tem-

Fig. 3. Northern blot analysis showing the developmental expression of rat SWAP gene and its regulation by T3 in rat cerebral cortex along the perinatalŽ . Ž .q Ž .period. A Six-microgram poly A RNA purified from pooled brain cortices eight in the case of E19 animals, seven for P5, and five for P10 and P15

Ž . Ž . Ž .of control C , hypothyroid H , or T4-treated hypothyroid HqT4 animals were loaded in each lane. T4 treatment of hypothyroid animals was asŽ . Ž . Ž . Ž .described in Section 2. B Quantitation of SWAP RNA levels in C squares , H solid circles , and HqT4 open circles rats. Values were calculated

Ž . Ž .separately for pre mRNA 6.0 kb; left and mature mRNA 3.4 kb; right bands. As loading control we used the methylene blue stained 28S ribosomalRNA.


Žperature for 30 min, once in 5= TEN 50 mM Tris pH.7.5, 5 mM EDTA, 0.5 M NaCl supplemented with 4

mgrml RNAse at 378C for 1 h, twice in 0.5= SSCq50%formamideq10 mM b-mercaptoethanol at 558C for 1 h,once in 0.1= SSCq10 mM b-mercaptoethanol at 688Cfor 1 h, and finally twice in PBS at room temperature for 5min. Sections were mounted onto slides, dehydrated by

Ž .ethanol series containing 0.3 M ammonium acetate , ex-Ž .posed for 21 days to Hyperfilm b-MAX films Amersham ,

developed with Kodak D19 and fixed. For anatomicalabbreviations we followed those in Paxinos and Watsonw x37 .

3. Results

3.1. Identification of SWAP gene as a thyroid hormoneregulated gene in cultured neuroblasts by differential dis-play

One cDNA band was identified using differential dis-play that was consistently down-regulated in E18qTRa1cells after 24 h treatment with T3 in two independentexperiments. The band was excised from the gel andreamplified by PCR using the same primer set, and the

Ž . Ž .Fig. 4. Pattern of developmental expression of SWAP gene in the rat brain. Regional expression of SWAP was analyzed in P0 A and B , P15 C–F , andŽ . 35P30 G–I animals by in situ hybridization of coronal sections using a S-UTP-labeled antisense RNA probe corresponding to the whole A10 mRNA

Ž . Ž . Ž . Ž .clone. Regions showing highest SWAP expression are indicated: cortex Cx , caudate putamen CPu , piriform cortex Pir , hippocampus H , amygdalaŽ . Ž . Ž . Ž . Ž .A , thalamus Th , subventricular epithelium SvE , and external and internal granular layers of the cerebellum EGL, IGL . E High magnification of the

Ž . Ž . Ž . Ž . Ž . Ž . Ž . Ž .piriform cortex in D the strongly labeled layer IIrIII is indicated . Scale bar: A and B , 270 mm; C , D , and F–I 200 mm; E 120 mm.


resulting DNAs were cloned into the pCR2.1 plasmid.Individual cDNAs were then used to probe Northern blots

Ž .qcontaining 5 mg poly A RNA from E18qTRa1 cellstreated or not with 150 nM T3. Hybridization with one

Ž .cDNA clone 10A identified two major bands of 6.0 kband 3.4 kb which were spontaneously induced upon trans-

Ž .fer of the cells to low serum medium Fig. 1 . T3 caused aŽdramatic inhibition of the induction of 6.0 kb band which

.is, in fact, a doublet of two very similar RNAs , whilehaving basically no effect on the 3.4 kb band.

Sequencing of the T3-regulated 10A cDNA allowed itsidentification as a fragment encompassing part of intron 1,the complete exon 2, and part of intron 2 of the vertebrate

w x Ž .homolog to the DmSWAP gene 13 Fig. 2A . Compari-son of the deduced amino acid sequence of clone 10A

Ž .exon 2 with that of the human SWAP HsSWAP geneŽ .showed near complete identity Fig. 2B . The HsSWAP

protein regulates alternative mRNA splicing of severalgenes including CD45 and fibronectin, and also regulates

w xsplicing of its own pre-mRNA 45 . The 3.4 kb mRNAdetected in E18qTRa1 cells corresponds to the majorHsSWAP mRNA expressed preferentially in human brain,

w xplacenta, and heart tissue 13 . The higher 6.0 kb most

probably corresponds to the unspliced immature mRNAcontaining two retained introns which has been described

w xin human cells 13 .

3.2. Thyroid hormone regulation of SWAP expression inthe deÕeloping rat brain

The effect of T3 on SWAP expression in vivo wasinvestigated during rat brain development. To this, a

Ž .qNorthern blot containing 6 mg of poly A RNA isolatedfrom the cerebral cortex of control and hypothyroid rats atdifferent developmental stages was hybridized with the10A cDNA probe. As shown in Fig. 3A, rat SWAP RNA

Ž .expression is very low on embryonal day 19 E19 , in-Ž .creases drastically on postnatal day 5 P5 and peaks on

P10, and then declines already on P15. Thus, the period ofSWAP expression is coincident with that of maximumneuronal differentiation. It is worth noting that while on P5the 6.0 kb mRNA is predominant over the 3.4 kb form,this ratio is inverse at P10. Hypothyroidism did not changethe developmental profile of SWAP mRNAs expressionŽ .Fig. 3A,B . However, on P5 and P10 the levels of bothSWAP mRNAs were clearly higher in hypothyroid than in

Fig. 5. Effect of thyroid hormone deprivation and administration on SWAP expression in the rat brain. In situ hybridization showing the regional pattern ofŽ . Ž . Ž . Ž .SWAP expression in anterior upper panels and more posterior lower panels coronal sections of P5 control C , hypothyroid Hypo , T4-treated control

Ž . Ž .CqT4 and T4-treated hypothyroid HqT4 rats. Regions showing highest SWAP expression are indicated as in legend to Fig. 4. Scale bar: 160 mm.


Ž .control animals Fig. 3B . This difference persisted at leastuntil P15 and was analogous for both mRNAs. Hormonalregulation of rat SWAP expression was further examinedby in vivo treatment with T4. Daily injections of hypothy-roid animals with 1.8 mgr100 g b.wt. T4 from day P1 toP4 led to a normalization of the levels of SWAP RNAsŽpartial for the 6.0 kb species and complete for 3.4 kb

. Žspecies on P5 see HqT4 lane in Fig. 3A, and open.circles in Fig. 3B .

Brain SWAP expression and the effect of T3 wereanalyzed in further detail by radioactive in situ hybridiza-tion using as probe the 10A clone. First, we analyzed thepattern of SWAP RNA expression in control animals at

Ž .different developmental stages. In newborn rats P0 ,SWAP RNA was expressed throughout the brain, withmaximal levels in the cerebral cortex, subventricular ep-ithelium, piriform cortex, hippocampus, amygdala, and

Ž .caudate putamen Fig. 4A,B . On P15, the overall expres-sion of SWAP RNA was much decreased, with highestlevel in the cerebellum and lower in cortical layers IIrIIIŽ .particularly in the piriform cortex , subventricular epithe-

Ž .lium, and hippocampus Fig. 4C–F . Finally, in youngŽ .adult P30 animals SWAP expression was lower than on

Ž .P15 but followed the same pattern Fig. 4G–I .In agreement also with the results obtained in Northern

blots, higher expression of rat SWAP was found in allŽbrain regions of P5 hypothyroid animals compare Hypo to

.C in Fig. 5 . Also, according to those results, T4 treatmentcaused a general downregulation of SWAP expression inall regions of both, control and hypothyroid rat brainsŽcompare CqT4 and HypoqT4 to C and Hypo, respec-

.tively, in Fig. 5 . On P15, the same higher level of SWAPRNA was found in all areas of the hypothyroid brain

Žexcept in the cerebellum, where remained unchanged not.shown . Together, these results demonstrate the regulation

of SWAP gene expression by thyroid hormone in vivo inthe developing rat brain.

4. Discussion

Thyroid hormone plays a crucial role during braindevelopment by regulating the expression of target genes.In this study, we have used differential display PCR toidentify the splicing regulator SWAP gene as regulated bythyroid hormone in the developing rat brain. To this end,we used an in vitro cell model system. We isolated a clonethat hybridized to two RNAs expressed in E18 neuroblas-tic cells. One RNA, of 6.0 kb in size, was downregulatedby T3 addition. The second, of 3.4 kb, corresponds to themature mammalian SWAP gene. The 6.0 kb RNA couldbe an immature form of the 3.4 kb RNA, although otherpossibilities may be considered such as alternative pro-moter usage, selective RNA degradation, or the existenceof SWAP-related genes in rat. In favor of the 6.0 kb RNAbeing an immature SWAP RNA is the parallel regulation

of both RNAs in brain and the existence of a largew xunspliced SWAP RNA form in human cells 13 . In line

with this result obtained in cultured cells, a higher expres-sion of SWAP was observed in the cerebral cortex ofhypothyroid rats on P5 and P10. By in situ hybridization,we showed that SWAP is preferentially expressed in somespecific brain areas during rat development. Remarkably,SWAP expression is abnormally elevated in all regions ofthe hypothyroid brain except the cerebellum. This resultagrees with the region-specific regulation by thyroid hor-mone of other brain genes. For instance, neurograninrRC3is regulated in discrete areas of the brain but not in othersw x23 . According to the higher expression in the hypothyroidstate, SWAP RNA levels were downregulated by hormonetreatment in vivo of both, control and hypothyroid rats.

This is the first description of the regulation by thyroidhormone of a brain gene encoding a splicing regulator. Theoverall regulation of SWAP expression throughout thebrain is in agreement with the widespread presence ofthyroid receptors, suggesting lack of modulation by localfactors. Post-transcriptional mechanisms have been pro-posed to explain the regulatory effects of T3 on a number

w xof its target genes 19,39,48 . Moreover, since T3 has beenfound to modulate the pattern of splicing of tau in the rat

w x w xbrain 3 , of tenascin-C in cultured glioma cells 1 , and ofw xb-amyloid gene in neuroblastoma cells 25 , the regulation

of SWAP and putatively of other genes involved in thecontrol of the splicing process may be of great importancefor T3 action in this organ. The pre-mRNA splicing reac-tion is an important control point in the regulation of gene

w xexpression 24,40 , and in particular the mammalian ner-vous system is specially rich in regulated splicing eventsso that many important gene transcripts are generated in

w xneural-specific spliced forms 8 . Regulated alternativesplicing is thought to produce structural changes in pro-teins relevant for the biology of neurons and glial cellsw x22 . An emerging notion is that the RNA regulatoryregions that encompass the neuron-specific exon and adja-cent intron regions contain a complex arrangement of

w xsignals that allow for splicing control mechanisms 22 . Inview of the requirement of the process of RNA splicing inall cell types, the regulation of alternative splicing is likelyto involve specific splicing factors which are differentiallyactive in different cell types more than the RNA andprotein components of the ubiquitously expressed spliceo-some machinery. Given the lack of knowledge about thehigher order signals that regulate splicing events in thecentral nervous system, our results are of importance todemonstrate for the first time a role for a wide-acting agentsuch as thyroid hormone in this process by regulating theexpression of the SWAP gene. Supporting also this hy-pothesis, thyroid hormone has been found to increase theexpression of the SmN splicing regulator in cultured rat

w xheart cells 21 .The developmental pattern of SWAP expression is con-

sistent with a functional involvement of this gene in brain


maturational processes. In addition, it correlates with otherthyroid hormone-dependent processes and with the onto-genic pattern of thyroid receptors whose number increasesat the end of the embryonal period and is maximum by the

w xend of the second postnatal week 6,30 . It is, therefore,tempting to speculate that SWAP may mediate some of theeffects of T3 on developmentally crucial brain processessuch as neuronal differentiation.

The general pattern of SWAP mRNA distribution inmost brain regions is suggestive of a predominant neuronalexpression, although expression in glial cells cannot bediscarded at present. In agreement with this idea, we haveobserved that cultured glial cell lines such as rat C6 and

Ž .mouse B3.1 cells express SWAP RNA not shown . Inview of the suspected wide range of RNAs which areregulated by Drosophila and human SWAP, by modulat-ing SWAP expression T3 can in turn exert a regulatoryeffect on many brain genes. In line with this, the role ofthyroid hormone in the brain seems to be the synchroniza-tion of developmental events by ensuring the precise time-

Ž w xand region-dependent expression of genes Ref. 4 , re-.view . Clearly, more profound studies including analysis

of protein expression using specific antibodies and of theregulation of cloned promoter region which are not avail-able today are necessary to precisely define the regulationof SWAP expression by T3. Also, it will be of interest toinvestigate which cell populations in the brain, and puta-tively in other tissues, are target of this T3 action. Finally,the incoming elucidation of gene transcripts regulated bySWAP can also add information about the molecularmechanism of T3 action in the brain.

Acknowledgements

We acknowledge Margarita Gonzalez for her expert´technical assistance and to Fernando Nunez and Pablo´˜Senor for animal care. This research was supported by˜Grant SAF98-0060 from Comision Interministerial de´

Ž .Ciencia y Tecnologıa CICYT , Spain. A.C. was supported´by a pre-doctoral fellowship from CICYT, Plan Nacionalde Salud.

References

w x1 M. Alvarez-Dolado, J.M. Gonzalez-Sancho, J. Bernal, A. Munoz,´ ˜Developmental expression of tenascin-C is altered by hypothyroid-

Ž .ism in the rat brain, Neuroscience 84 1998 309–322.w x2 M. Alvarez-Dolado, T. Iglesias, A. Rodrıguez-Pena, J. Bernal, A.´ ˜

Munoz, Expression of neurotrophins and the trk family of neu-˜rotrophin receptors in normal and hypothyroid rat brain, Mol. Brain

Ž .Res. 27 1994 249–257.w x3 F. Aniello, D. Couchie, A.M. Bridoux, D. Gripois, J. Nunez,

Splicing of juvenile and adult tau m-RNA variants is regulated byŽ .thyroid hormone, Proc. Natl. Acad. Sci. U.S.A. 88 1991 4035–

4039.

w x4 J. Bernal, A. Guadano-Ferraz, Thyroid hormone and the develop-˜Ž .ment of the brain, Curr. Opin. Endocrinol. Diabetes 5 1998

296–304.w x5 J. Bernal, J. Nunez, Thyroid hormones and brain development, Eur.

Ž .J. Endocrinol. 133 1995 390–398.w x6 D.J. Bradley, H.C. Towle, W.S. Young III, Spatial and temporal

expression of a- and b-thyroid hormone receptor mRNA includingthe b2 subtype, in the developing mammalian nervous system, J.

Ž .Neurosci. 12 1992 2288–22302.w x7 G.A. Brent, The molecular basis of thyroid hormone action, New

Ž .Engl. J. Med. 331 1994 847–853.w x8 J.F. Burke, K.E. Bright, E. Kellet, P.R. Benjamin, S.E. Saunders,

Alternative mRNA splicing in the nervous system, Prog. Brain Res.Ž .92 1992 115–125.

w x9 P. Chomczynski, N. Sacchi, Single step method of RNA isolation byacid guanidinium tiocyanate–phenol–chloroform extraction, Anal.

Ž .Biochem. 162 1987 156–159.w x10 S.S. Dalal, J. Welsh, A. Tkachenko, D. Ralph, E. DiCicco-Bloom,

L. Bordas, M. McClelland, K. Chada, Rapid isolation of tissue-´specific and developmentally regulated brain cDNAs using RNA

Ž . Ž .Arbitrarily Primed PCR RAP-PCR , J. Mol. Neurosci. 5 199493–104.

w x11 N. Davidson, R. Carlos, M. Drewek, T. Palmer, Apolipoprotein geneexpression in the rat is regulated in a tissue-specific manner by

Ž .thyroid hormone, J. Lipid Res. 29 1988 1511–1522.w x12 G.R. DeLong, The effect of iodine deficiency on neuromuscular

Ž .development, IID Newslett. 6 1990 1–12.w x13 F. Denhez, R. Lafyatis, Conservation of regulated alternative splic-

ing and identification of functional domains in vertebrate homologsto the Drosophila splicing regulator, Suppresor-of-white-apricot, J.

Ž .Biol. Chem. 269 1994 16170–16179.w x14 P.W. Dickson, A.R. Aldred, J.G.T. Menting, P.D. Marley, W.H.

Sawyer, G. Schreiber, Thyroxine transport in choroid plexus, J. Biol.Ž .Chem. 262 1987 13907–13915.

w x15 J. Douglass, A. McKinzie, P. Couceyro, PCR differential displayidentifies a rat brain mRNA that is transcriptionally regulated by

Ž .cocaine and amphetamine, J. Neurosci. 15 1995 2471–2481.w x16 J.H. Dussault, J. Ruel, Thyroid hormones and brain development,

Ž .Annu. Rev. Physiol. 49 1987 321–334.w x17 A. Farwell, J. Leonard, Dissociation of actin polymerization and

enzyme inactivation in the hormonal regulation of type II iodothyro-X Ž .nine 5 -deiodinase activity in astrocytes, Endocrinology 131 1992

721–728.w x18 P.A. Feinberg, B. Vogelstein, A technique for radiolabeling DNA

restriction endonuclease fragments to high specific activity, Anal.Ž .Biochem. 137 1983 266–267.

w x19 S. Fraboulet, F. Boudouresque, C. Delfino, F. Fina, C. Oliver, I.Ouafik, Effect of thyroid hormones on peptidylglycine alpha-amidat-ing monooxygenase gene expression in anterior pituitary gland:transcriptional studies and messenger ribonucleic acid stability, En-

Ž .docrinology 137 1996 5493–5501.w x20 C.M. Gall, P.J. Isackson, Limbic seizures increase neuronal produc-

Ž .tion of messenger RNA for nerve growth factor, Science 245 1989758–761.

w x21 D. Gerrelli, J.D. Huntriss, D.S. Latchman, Antagonistic effects ofretinoic acid and thyroid hormone on the expression of the tissue-specific splicing protein SmN in a clonal cell line derived from rat

Ž .heart, J. Mol. Cell. Cardiol. 26 1994 713–719.w x22 P.J. Grabowski, Splicing regulation in neurons: tinkering with cell-

Ž .specific control, Cell 92 1998 709–712.w x23 M.A. Iniguez, L. de Lecea, A. Guadano-Ferraz, B. Morte, D.˜ ˜

Gerendasy, J.G. Sutcliffe, J. Bernal, Cell-specific effects of thyroidhormone on RC3rneurogranin expression in rat brain, Endocrinol-

Ž .ogy 137 1996 1032–1041.w x Ž .24 A. Kramer, Pre-mRNA Processing, in: A.I. Lamond Ed. , R.G.

Landes, Austin, 1995, pp. 35–64.w x25 M.J. Latasa, B. Belandia, A. Pascual, Thyroid hormones regulates


b-amyloid gene splicing and protein secretion in neuroblastomaŽ .cells, Endocrinology 139 1998 2692–2697.

w x26 M.A. Lazar, Thyroid hormone receptors: multiple forms, multipleŽ .possibilities, Endocrinol. Rev. 14 1993 184–193.

w x27 J. Legrand, Effects of thyroid hormones on central nervous systemŽ .development, in: J.E. Yanai Ed. , Neurobehavioural Teratology,

Elsevier, Amsterdam, 1984, pp. 331–363.w x28 P. Liang, A.B. Pardee, Differential display of eukaryotic messenger

RNA by means of the polymerase chain reaction, Science 257Ž .1992 967–971.

w x29 M. McClelland, F. Mathieu-Daude, J. Welsh, RNA fingerprintingand differential display using arbitrarily primed PCR, Trends Genet.

Ž .11 1995 242–246.w x30 B. Mellstrom, J.R. Naranjo, A. Santos, A.M. Gonzalez, J. Bernal,¨ ´

Independent expression of the a and b c-erbA genes in developingŽ .rat brain, Mol. Endocrinol. 5 1991 1339–1350.

w x31 G. Morreale de Escobar, R. Pastor, M.J. Obregon, F. Escobar del´Rey, Effects of maternal hypothyroidism on the weight and thyroidhormone content of rat embryonic tissues, before and after onset of

Ž .fetal thyroid function, Endocrinology 117 1985 1890–1896.w x32 A. Munoz, J. Bernal, Biological activities of thyroid hormone recep-˜

Ž .tors, Eur. J. Endocrinol. 137 1997 433–445.w x33 A. Munoz, W. Hoppner, J. Sap, G. Brady, K. Nordstrom, H.J. Seitz,˜ ¨ ¨

B. Vennstrom, The chicken c-erbA product induces expression of¨thyroid hormone responsive genes in 3,5,5X-triiodothyronine receptor

Ž .deficient rat hepatoma cells, Mol. Endocrinol. 4 1990 312–320.w x34 A. Munoz, C. Wrighton, B. Seliger, J. Bernal, H. Beug, Thyroid˜

hormone receptorrc-erbA: control of commitment and differentia-tion in the neuronal chromaffin progenitor line PC12, J. Cell Biol.

Ž .121 1993 423–438.w x35 J. Nunez, Microtubules and brain development: the effect of thyroid

Ž .hormones, Neurochem. Int. 7 1985 959–968.w x36 J.H. Oppenheimer, H.L. Schwartz, K.A. Strait, Thyroid hormone

Ž .action 1994: the plot thickens, Eur. J. Endocrinol. 130 199415–24.

w x37 G. Paxinos, C. Watson, The Rat Brain in Stereotaxic Coordinates,4th edn., Academic Press, London, 1998.

w x38 S. Porterfield, C. Hendrich, The role of thyroid hormones in prenataland neonatal neurological development. Current perspectives, En-

Ž .docr. Rev. 14 1993 94–106.

w x39 J. Puymirat, P. Etongue-Mayer, J. Dussault, Thyroid hormonesstabilize acetylcholinesterase mRNA in neuro-2A cells that overex-

Ž .press the b1 thyroid receptor, J. Biol. Chem. 270 1995 30651–30656.

w x40 D.C. Rio, Splicing of pre-mRNA: mechanisms, regulation and roleŽ .in development, Curr. Opin. Genet. Dev. 3 1993 574–584.

w x41 A. Rodrıguez-Pena, N. Ibarrola, M.A. Iniguez, A. Munoz, J. Bernal,´ ˜ ˜ ˜Neonatal hypothyroidism affects the timely expression of myelin-as-

Ž .sociated glycoprotein in the rat brain, J. Clin. Invest. 91 1993812–818.

w x Ž .42 J. Sambrook, E.F. Fritsch, T. Maniatis Eds. , Molecular Cloning: ALaboratory Manual, 2nd edn., Cold Spring Harbor Laboratory, ColdSpring Harbor, New York, 1989.

w x X43 H.H. Samuels, F. Stanley, J. Casanova, Depletion of L-3,5,5 -tri-iodothyronine and L-thyroxine in euthyroid calf serum for use in cellculture studies of the action of thyroid hormone, J. Endocrinol. 105Ž .1979 80–85.

w x44 F. Sanger, S. Nicklen, A.R. Coulson, DNA sequencing with chainŽ .terminating inhibitors, Proc. Natl. Acad. Sci. U.S.A. 74 1977

5463–5467.w x45 M. Sarkissian, A. Winne, R. Lafyatis, The mammalian homolog of

Suppressor-of-white-apricot regulates alternative mRNA splicing ofŽ .CD45 exon 4 and fibronectin IIICS, J. Biol. Chem. 271 1996

31106–31114.w x46 G.N. Shah, J. Li, P. Schneiderjohn, A.D. Mooradian, Cloning and

characterization of a complementary DNA for a thyroid hormone-re-sponsive protein in mature rat cerebral tissue, Biochem. J. 327Ž .1997 617–623.

w x47 J.E. Silva, P. Rudas, Effects of congenital hypothyroidism on micro-tubule associated protein-2 expression in the cerebellum of the rat,

Ž .Endocrinology 126 1990 1276–1282.w x48 J. Staton, P. Leedman, Posttranscriptional regulation of thyrotropin

beta-subunit messenger ribonucleic acid by thyroid hormone inmurine thyrotrope tumor cells: a conserved mechanism across

Ž .species, Endocrinology 139 1998 1093–1100.w x49 P.M. Yen, W.W. Chin, New advances in understanding the molecu-

lar mechanisms of thyroid hormone action, Trends Endocrinol.Ž .Metab. 5 1994 65–72.

Identification of the mammalian homolog of the splicing regulator Suppressor-of-white-apricot as a...

Documents

Transcript of Identification of the mammalian homolog of the splicing regulator Suppressor-of-white-apricot as a...