Identification of a β1 integrin isoform with restricted tissue expression in a teleost fish

Publisher: CSIRO; Journal: RD:Reproduction, Fertility and Development Article Type: research-article; Volume: 23; Issue: 5; Article ID: RD10351

DOI: 10.1071/RD10351; TOC Head:

of 17

Identification of a β1 integrin isoform with restricted tissue expression in a teleost fish 1

Patricia Castillo-BriceñoA, Isabel CabasA, Marta ArizcunB, Jose MeseguerA, Victoriano MuleroA 2

and Alfonsa García-AyalaA,C 3

ADepartment of Cell Biology and Histology, University of Murcia, Murcia 30100, Spain. 4

BOceanographic Centre of Murcia, Spanish Oceanographic Institute (IEO), Puerto de Mazarrón, 5

30860 Murcia, Spain. 6

CCorresponding author. Email: [email protected] 7

The composition and organisation of extracellular matrix (ECM)-related molecules change during 8

development. These components interact with different cell surface receptors to modulate the transduction of 9

signals for cell growth, differentiation, migration, proliferation and apoptosis. Previous findings in the teleost 10

fish gilthead seabream (Sparus aurata L., Teleostei), a marine protandrous hermaphrodite fish, showed that 11

endocrine and immune stimuli are able to modulate the expression of ECM-related molecules, as well as 12

specific correlations between them. In the present study, quantitative reverse transcription–polymerase chain 13

reaction was used to examine the gene expression profile of β1 integrin isoform b (ITGB1b) and its possible 14

role in reproductive physiology, especially in relation to spermatogenesis. Expression profiles were analysed 15

in the context of the reproductive cycle (RC) and in relation with other ECM-related molecules, including 16

matrix metalloproteinase (MMP)-2, MMP-9, MMP-13, Tissue-specific inhibitor of metalloproteinase 17

(TIMP)-2a, TIMP-2b, collagen (COL1A1) and ITGB1a. Expression of ITGB1b was found in the testis and 18

brain and, to some extent, in endothelial cells. In contrast, ITGB1a was expressed ubiquitously. In the testis, 19

the ITGB1b expression peaked during spermatogenesis, whereas the expression of the other ECM-related 20

molecules is induced mainly during the post-spawning stage, when marked tissue remodelling occurs during 21

the first and second RC in males. In addition, in fish exposed to the endocrine disruptor 17α-22

ethynyloestradiol, ITGB1b expression in the testis was inhibited in a dose- and time-dependent manner and 23

was related to reduced serum levels of testosterone. Together, these results suggest a different functionality 24

for the two ITGB1 isoforms in the gilthead seabream, where ITGB1b is more specifically involved in 25

reproduction. This is the first report of an ITGB1 gene isoform whose expression is restricted to endocrine-26

related tissues in vertebrates. 27

Additional keywords: 17α-ethynyloestradiol, development, extracellular matrix, gene expression, 28

spermatogenesis, testis, testosterone. 29

Testis β1 integrin isoform in a teleost fish 30

P. Castillo-Briceño et al. 31

Introduction 32

After the discovery of integrins (ITGs) and other extracellular matrix (ECM) receptors, the ECM 33

became an interesting field for researchers not only as an intercellular, structural and tissue 34

scaffold, but also as a multifaceted extracellular environment indispensable for the study of a 35

Comentario [P1]: Publisher version in http://www.publish.csiro.au/index.cfm?paper=RD10351

Comentario [Q2]: Au: the

institute addresses provided

need to be reasonably full postal

addresses, including post code.

Please provide extra information

for both affiliations as

appropriate

Comentario [P3]: ADepartment of Cell Biology and Histology, Faculty of Biology, Campus Espinardo, University of Murcia, Murcia 30100, Spain.

Comentario [Q4]: Au:

ITGB1b – please note journal

style is to use italics for genes

and roman font for gene

products/proteins; pls check the

paper carefully to ensure that

the use of italics is correct

throughout (if you need to make

any changes, please highlight the

changed text in red)

Comentario [Q5]: Au: please

note that the gene names

presented in the tables do not

match the formatting used in the

text. Please pick one style for

consistency throughout.

Comentario [P6]: italics










Comentario [Q16]: Au: Is the text OK: whereas the expression

of the other ECM-related

molecules is induced mainly

during the post-spawning stage,

when marked tissue remodelling

occurs during the first and

second RC in males

Comentario [P17]: whereas the expression of the other ECM-related molecules is induced mainly during the post-spawning stage, both stages of marked tissue remodelling during the first and second RC in males.


exposed to the endocrine

disruptor 17α-ethynyloestradiol

– please specify the

concentration range tested and Comentario [P19]: fish exposed to the endocrine disruptor 17α-ethynyloestradiol (at 5 and 50 µg g–1 food during 7, 14 and 21

... [1]

... [2]


DOI: 10.1071/RD10351; TOC Head:

of 17

variety of cellular processes of wide-ranging functionality (Huxley-Jones et al. 2009; Rozario and 1

DeSimone 2010). The molecular composition and organisation of the extracellular compartment is 2

actively modulated from fertilisation and throughout development (Rozario and DeSimone 2010), 3

affecting the signalling pathways that regulate cell growth, differentiation, migration, proliferation, 4

polarisation and cell death (Hynes 1996; Tsang et al. 2010). 5

The interactions between the cells and structural components of the ECM are mediated by a 6

range of receptors, which, upon binding, may induce the activation of other molecules 7

indispensable for remodelling, inflammation, immune response and wound healing, including 8

matrikines, matrix metalloproteinases (MMPs), tissue-specific inhibitors of metalloproteinases 9

(TIMPs), cytokines and growth factors (Vogel 2001; Tran et al. 2004; Leitinger and Hohenester 10

2007; Schultz and Wysocki 2009). In that sense, ablation or misexpression of ECM cytoplasmic 11

receptors produces several developmental, structural and physiological disease-like phenotypes 12

(Hynes 1996), although some functions can be supplied by other related genes, as in the case of 13

overlapping functions for β1 ITG heterodimers (ITGB1s; Zweers et al. 2007). 14

The ITGs have been described as the main cell surface receptors in eukaryotic organisms (Hynes 15

2002; Delon and Brown 2007). This αβ heterodimer family is involved in numerous cellular 16

processes, from adhesion and invasion to fibrosis and disease immune responses (Sueoka et al. 17

1997; Hynes 2002; Delon and Brown 2007; Lathia et al. 2010), as well as in specific mechanisms 18

of reproductive physiology (Bowen and Hunt 2000). It is also known that modulation of ITG 19

expression patterns is a critical aspect of organogenesis and is extremely relevant in mechanisms 20

like ITG switching in gonadogenesis and adipogenesis (Meighan and Schwarzbauer 2008). 21

Specifically, binding of ITGs to collagen plays an important modulatory role during embryonic 22

development and organogenesis (Hynes 2002; Johnson et al. 2009), as well as in wound healing, 23

particularly related to MMP release and cellular adhesion (Pilcher et al. 1999; Grenache et al. 24

2006; Mócsai et al. 2006; Zhang et al. 2006; Zweers et al. 2007). The ITGs are also able to form 25

complexes with other molecules, such as MMPs, allowing them to bind to the cell surface, 26

modulate intracellular signalling and mediate cell motility by disrupting cell contacts with the ECM 27

(Stefanidakis and Koivunen 2006; Page-McCaw et al. 2007; Butler and Overall 2009). With regard 28

to ITGB1, it has been described as playing a relevant role in ectoplasmic specialisation in 29

mammals, participating in the adherent and tight junctions between germ and Sertoli cells during 30

spermatogenesis (Siu et al. 2003). Other ITGs are modulated at the transcriptional level by sexual 31

hormones. For example, progesterone increases ITGA4, ITGA5 and ITGB1 subunit expression, but 32

does not alter the expression of ITGAVB3, which is an ITG heterodimer implicated in implantation 33

and is inhibited in the presence of oestrogens (Bowen and Hunt 2000). 34

Comentario [dem051 20]: The in-text citation "Grenache et al. 2006" is not in the reference list. Please correct the citation, add the reference to the list, or delete the citation.

Comentario [P21]: Grenache et al. 2007;






DOI: 10.1071/RD10351; TOC Head:

of 17

The evolutionary history of ITGs is interesting because these receptors are widely present 1

throughout xxx, but with different degrees of conservation. Vertebrate ITGs probably originated 2

from homologous sequences and domains (in the first metazoans and existing within the protists 3

and prokaryotes) related to the large changes during chordate evolution (Johnson et al. 2009) and 4

probably as a result of ligand–receptor coevolution (Huhtala et al. 2005). For example, ITG 5

subunits that contain an I domain able to bind directly to collagen are present only in vertebrates; 6

whereas leucocyte-specific ITGs appears to be absent in Takifugu rubripes but are present in other 7

fish species (Huhtala et al. 2005). 8

Previous findings in the teleost fish gilthead seabream (Sparus aurata L., Actinopterygii, 9

Teleostei) indicated that MMP-9, MMP-13, TIMP2a and TIMP2b have specific expression patterns 10

throughout the first reproductive cycle (RC) and that 17β-oestradiol is able to increase gelatinase 11

activity in the testis (Chaves-Pozo et al. 2008a). In addition, we found constitutively lower 12

expression of MMP-2, MMP-9, MMP-13, TIMP-2a, TIMP-2b and collagen COL1A1, but higher 13

expression of ITGB1a, in the testis compared with other organs in adult fish (Castillo-Briceño et al. 14

2010). Recently, it has also been reported that there is a strong correlation between ECM-related 15

molecules and that they can be modulated in response to pathophysiological conditions such as 16

endometriosis (Salata et al. 2008) and myocardial damage (Ceauşu et al. 2009) in humans, and in 17

response to damage or pathogen-associated molecular patterns in fish (Castillo-Briceño et al. 18

2010). 19

In the present study, we analysed the expression profile of ITGB1b in the context of the ECM 20

environment during development (a period of very active growth), as well as in adult organs and 21

tissues with different immune, endocrine, physiological or structural functions. The results of these 22

studies prompted us to explore whether the ITGb1b isoform has a role that is different or additional 23

to that of the ubiquitously expressed ITGB1a in relation to the RC. Thus, we focused on the 24

expression profiles of ITGB1b and other ECM-related molecule in the testes during the first two 25

RCs, when specimens are male, and then after exposure to the endocrine disruptor 17α-26

ethynyloestradiol (EE2; Mortensen and Arukwe 2007) during spermatogenesis. 27

Materials and methods 28

Animals 29

Healthy specimens of gilthead seabream (Sparus aurata L.) were obtained following the natural 30

spawning of a captive broodstock in the hatchery facilities of the Spanish Oceanographic Institute 31

(IEO) of Murcia using the ‘green water’ larval culture technique and following previously 32

described general protocols for adult fish maintenance (Castillo-Briceño et al. 2009, 2010) and 33

larval growth (Mulero et al. 2007). Animals were fasted for 24 h before sampling. The experiments 34

described comply with the Guidelines of the European Union Council (86/609/EU) and the 35

Bioethical Committee of the University of Murcia (Spain) for the use of laboratory animals. 36


widely present throughout xxx –

please complete the sentence

Comentario [P27]: are widely present throughout metazoans, but with different degrees of conservation.

Comentario [P28]: Pls suprime




Comentario [P32]: ITGB1b




DOI: 10.1071/RD10351; TOC Head:

of 17

Sampling of larvae and adult (organs, tissues and cell fractions) specimens 1

Whole fry of gilthead seabream were sampled 1–131 days post-hatching (d.p.h.), whereas adult 2

gilthead seabream (mean weight 1150 g) were bled and dissected during their testicular involution 3

period to sample organs and components, according to their relevant immune (gills, thymus, 4

spleen, liver, head kidney, intestine (midgut), peritoneal exudate and blood), endocrine (brain, 5

pituitary, testis and ovary), physiological (kidney and heart (ventricle)) or structural (muscle, skin 6

and caudal fin) functions, as described previously (Castillo-Briceño et al. 2010). In addition, 7

purified fractions of head kidney and testis acidophilic granulocytes (hAGs and tAGs, respectively; 8

Sepulcre et al. 2002), head kidney macrophages (MCs; Roca et al. 2006) and endocardial 9

endothelial cells (EECs; Castillo-Briceño et al. 2010) were analysed. Testes were sampled in adult 10

animals during the first and second RC. In all the cases, samples were maintained in TRIzol 11

Reagent (Invitrogen, Carlsbad, CA, USA) at –80°C according to the manufacturer’s instructions 12

until they were processed for RNA extraction. 13

Fish exposure to EE2 and determination of serum testosterone 14

Male adult fish (408 ± 59 g total weight) were exposed to EE2 by oral ingestion, as described 15

previously (Angus et al. 2005; Castillo-Briceño et al. 2010), during the spermatogenesis stage. To 16

this end, fish food was sprayed with EE2 in ethanol at 5 and 50 µg g–1 food. Control food was 17

sprayed with ethanol only. Then, the food was allowed to dry before being stored at 4°C. Fish were 18

fed normally and testes were sampled after 7, 14 and 21 days. Serum levels of 11-ketotestosterone 19

(11KT) and testosterone (T) were determined in treated and control animals at all sampling times 20

by ELISA, as described previously (Chaves-Pozo et al. 2008c) using a commercially available kit 21

(XXX) and according to the manufacturer’s instructions. Steroids were extracted from 20 µL 22

plasma in 1.5 mL methanol (Panreac). All other reagents (i.e. standards for 11KT and T, mouse 23

anti-rabbit IgG monoclonal antibody, specific anti-steroid antibody, enzymatic tracer (steroid 24

acetylcholinesterase (AChE) conjugate: 11KT- and T-AChE) and Ellman’s reagent) were 25

purchased from Cayman Chemical (Ann Arbor, MI, USA) and the assays were performed in 26

ELISA microtitre plates (Nunc, Roskilde, Denmark). A standard curve was generated over the 27

concentration range (6.1 × 10−4 to 2.5 ng mL–1 XXX and samples were analysed in duplicate. The 28

lower limit of detection and interassay coefficients of variation were calculated to standardise the 29

measurements. 30

Analysis of gene expression 31

To analyse gene expression, RNA was extracted and then treated with amplification-grade DNaseI 32

(1 U µg–1 RNA; Invitrogen) according to the manufacturer’s instructions. The quantitative reverse 33

transcription–polymerase chain reaction (RT-PCR) was performed using a SuperScript III 34

ReverseTranscriptase Kit (Invitrogen) to synthesise first-strand cDNA from 1 µg total RNA and 35

Comentario [Q35]: Au: Is the text OK: Carlsbad, CA, USA

Comentario [P36]: Yes, it is

Comentario [P37]: ethanol absolute


ethanol – what was the

concentration of ethanol used?

Comentario [P39]: the same volume of only ethanol, and in all the cases was left to dry until total evaporation of ethanol.

Comentario [P40]: Pls suprime this phrase, reagents of kit are described in the following part.


commercially available kit

(XXX) – please provide details

(ie the name and address of the

manufacturer

Comentario [Q42]: Au: Please supply company details/address of Panreac

Comentario [P43]: Panreac, Spain)

Comentario [Q44]: Au: Is the text OK: Ann Arbor, MI, USA


Comentario [Q46]: Au: Is the text OK: Roskilde, Denmark


Comentario [P48]: 6.1 × 10−4 to 2.5 ng mL–1 for both 11KT and T)

Comentario [Q49]: Au: XXX

– please specify whether you are

referring to 11KT, T or both

Comentario [Q50]: Au: lower

limit of detection and interassay

coefficients of variation were

calculated – and what were they

for 11KT and T?

Comentario [P51]: For measure standardization it was calculated the inter-assay coefficient of variation (CV) at 90% of binding (16.23 % for 11KT and 27.16 % for T) and the intra-assay CV (0.21 % for 11KT and 12.61 % for T) In all the cases the lower limit of detection was below the standard curve minimal concentration (6.1 × 10−4 ng mL–1).


DOI: 10.1071/RD10351; TOC Head:

of 17

SYBR Green PCR Core Reagents (Applied Biosystems, Foster City, CA, USA) with an ABI 1

PRISM 7500 instrument (Applied Biosystems) as described by the manufacturer. For each mRNA, 2

gene expression was normalised against ribosomal protein S18 content in each sample using the 3

comparative Cq method (∆∆Cq). The primers used are given in Table 1. In all cases, each PCR was 4

performed in triplicate and repeated with at least two independent experiments, as described 5

previously (Castillo-Briceño et al. 2009, 2010). 6

Statistical analysis 7

Data for whole organs, tissues and cell fractions, testes sampled monthly during the two first RC 8

and testes of control and EE2-stimulated fish during spermatogenesis were analysed by one-way 9

analysis of variance (ANOVA) and Bonferroni’s post-test for grouped datasets to determine 10

significant differences. Correlations between ECM-related molecules and developmental progress 11

(d.p.h.), as well as between the ECM-related molecules themselves during development and then in 12

the testes during the two first RC, were assessed by Pearson’s correlation test. All analyses were 13

performed using Prism 5 for Windows version 5.00. P < 0.05 was considered significant. 14

Results 15

Correlation between expression of ECM-related molecules and developmental stage 16

The gene expression profiles of the ECM-related molecules studied showed that the expression of 17

MMP-2, MMP-9, TIMP-2a, TIMP-2b and COL1A1 increased with age (r > 0.70; P < 0.05) during 18

both the larval (1–90 d.p.h.) and juvenile (90–131 d.p.h.) developmental stages (Fig. 1). However, 19

the degree of correlation between those genes differed and only TIMP-2b was correlated with all of 20

them (r > 0.65; P < 0.05). Initial expression of MMP-2, TIMP-2a and COL1A1 was high and there 21

was a strong correlation between the three genes (r > 0.92; P < 0.001), but only MMP-2 and TIMP-22

2a expression tended to peak (at 47 d.p.h.). There was no significant correlation found for MMP-13 23

and ITGB1a expression and other gene analysed or the developmental stage (Fig. 1). These two 24

genes showed isolated peaks of expression at 12 and 1–4 d.p.h., respectively. 25

Localisation of ITGB1b gene expression 26

During development (1–131 d.p.h.), ITGB1b mRNA was not detected in whole fry. Furthermore, 27

analysis of different organs and tissues from adult specimens revealed that ITGB1b expression was 28

mainly restricted to the testis, with lower levels found in the brain. Expression of ITGB1b in other 29

organs (spleen, heart ventricle, skin, muscle, ovary and peritoneal exudate) was minimal and 30

always below that in isolated EECs (Fig. 2). Furthermore, ITGB1b was not detected in any other 31

organs and tissues (gills, thymus, liver, head kidney, intestine midgut, pituitary, kidney, caudal fin 32

and blood) or cell fractions (hAGs, tAGs and MCs) analysed. 33

Comentario [Q52]: Au: Is the text OK: Foster City, CA, USA


Comentario [Q54]: Au: Please supply company details/address of Prism 5 for Windows version

5.00

Comentario [P55]: (GraphPad Software, Inc., La Jolla, CA, USA)


DOI: 10.1071/RD10351; TOC Head:

of 17

Expression of ITGB1b throughout RC compared with that of other ECM-related molecules 1

In the testis, there were two groups of correlations between gene expression patterns of ECM-2

related molecules during the second RC. One showed a marked increase at the post-spawning 3

phase (Fig. 3; Table 2) and included MMP-2, MMP-9, MMP-13, TIMP-2a and COL1A1, which 4

were closely correlated (r > 0.71; P < 0.05). The other showed weaker peaks during 5

spermatogenesis (Fig. 3; Table 2) that included MMP-13, TIMP-2b, COL1A1 and ITGB1a (r > 6

0.67; P < 0.05). In the case of ITGB1b, expression peaked only at spermatogenesis and was 7

correlated only with ITGB1a (r = 0.75; P < 0.05; Fig. 3; Table 2). In the first RC, a peak for 8

ITGB1b expression during spermatogenesis was also found, but there was no correlation with any 9

of the other molecules. In contrast, ITGB1a was still correlated with other ECM-related molecules, 10

such as COL1A1 and MMP-2 (r > 0.75; P < 0.05), reaching their maximal levels at the beginning 11

of the spawning stage (data not shown). 12

Effect of EE2 on ITGb1b expression in the testis 13

Following treatment with EE2, ITGB1b expression in the testis was significantly modulated in a 14

dose- and time-dependent manner. The lower EE2 concentration (5 µg g–1 food) inhibited ITGB1b 15

expression after 21 days, whereas 50 µg g–1 EE2 inhibited ITGB1b expression after 14 days (Fig. 16

4). This inhibition was similar to that seen for 11KT at 14 and 21 days (r = 0.87; P < 0.05) and also 17

coincided with lower serum levels of T than in the control group (Table 3). Expression of ITGB1a 18

in EE2-treated fish was modulated in a similar manner to that of MMP-2 expression and both 19

differed to the ITGB1b profile and were not related to serum 11KT and T levels (Fig. 4). The final 20

weight of the fish did not differ between treatments (Table 3). 21

Discussion 22

The findings in the present study for a tendency for MMP-2, MMP-9, TIMP-2a, TIMP-2b and 23

COL1A1 expression to increase with advancing developmental stage and their initial high levels 24

just after hatching are in accordance with the reported expression of growth-related molecules in 25

gilthead seabream, such as insulin-like growth factor (IGF)-1 transcripts (Tiago et al. 2008), 26

osteonectin (OSN) (Estêvão et al. 2005), cortisol and the thyroid hormones tri-iodothyronine and 27

thyroxine (Szisch et al. 2005), and with the robust expression of innate immune genes (Mulero et 28

al. 2008). This suggests a well-coordinated interaction and regulation of ECM-related molecules 29

during seabream growth and organogenesis, which agrees with the general requirement for a fine 30

balance between MMPs and TIMPs for normal development in vertebrates (Zhang et al. 2003; 31

Crawford and Pilgrim 2005; Smith et al. 2006; Bednarek et al. 2009; Wyatt et al. 2009) and 32

activation of immune pathways (Mott and Werb 2004; Stevens et al. 2009). 33

In addition, the increased expression of ECM-related molecules observed around 47 d.p.h. in the 34

present study agrees with the reported increases in levels of IGF-1a and IGF-1c (Tiago et al. 2008), 35

Comentario [P56]: all of which reach their maximal levels


reaching their maximal levels –

what reached maximal levels at

the spawning stage?




DOI: 10.1071/RD10351; TOC Head:

of 17

cortisol (Szisch et al. 2005) and adaptive immunity genes (Mulero et al. 2008) for these species, as 1

well as with the process of ossification in skeletal structures (Estêvão et al. 2005), the accumulation 2

of erythrocytes in the spleen and the infiltration of AGs in the intestine (Mulero et al. 2007), a 3

scenario that implies strong remodelling and morphogenesis, probably related to the transition from 4

the larval to juvenile stages. The higher levels of ITGB1a observed 1 and 4 d.p.h. in the present 5

study coincide with the initiation of chondrogenesis in cephalic structures and pectoral fins 6

(Estêvão et al. 2005), whereas MMP-13 expression peaked at 12 d.p.h., coinciding with the final 7

stages of cartilage development and the increase of OSN that occurs before ossification of the same 8

structures (Estêvão et al. 2005). This expression profile points to a particular involvement of 9

ITGB1a and MMP-13 in the ossification process, similar to mammalian ITGB1 heterodimer 10

signalling during cartilage development and MMP-13 expression induced by collagen (Ivkovic et 11

al. 2003; Ronzière et al. 2005; Djouad et al. 2007; Krane and Inada 2008, Takaishi et al. 2008). It 12

seems, then, that MMP-13 and ITGB1a expression in gilthead seabream is relevant during larval 13

skeletal development, independent of the general coordination found between other ECM-related 14

molecules. 15

With regard to ITGB1b, its absence during non-adult development stages and its particular tissue 16

expression in adults could be related to sexual functionality, because in this fish species the testis 17

and ovarian areas do not start to develop until 180 d.p.h. and are completely differentiated at 210 18

d.p.h., when spermatogenesis starts (Chaves-Pozo et al. 2009). These specificities of ITGB1b 19

suggest a different role from that described for ITGB1a and other ECM-related molecules in tissue 20

remodelling and regeneration in gilthead seabream (Castillo-Briceño et al. 2010). It appears that 21

ITGB1a has a more constitutive role in gilthead seabream, because it is expressed ubiquitously 22

during development (Fig. 1) and in all organs of the adult specimens (Castillo-Briceño et al. 2010), 23

reflecting the expression profile of zebrafish (Danio rerio) ITGB1 paralogues, which are all 24

expressed 24 h after fertilisation and in all adult organs (Mould et al. 2006). In that sense, it is 25

interesting that gilthead seabream ITGB1b has a restricted expression profile that does not 26

correspond to any of the zebrafish ITGB1 paralogues described (Mould et al. 2006). These 27

differences also suggest that ITGB1a and ITGB1b may be forming heterodimers with different 28

ITGa subunits that modulate their ligand affinity, a hypothesis that deserves further investigation 29

because fish ITGs have a very diverse and complex phylogeny and functionality (Huhtala et al. 30

2005). However, ITGB1a would appear to share the functions of the single ITGB1 subunit found in 31

higher vertebrates, as suggested for zebrafish ITGB1a and ITGB1b (Mould et al. 2006), whereas 32

ITGB1b may have more specialised or novel roles. 33

The expression of ITGB1b in the EECs of gilthead seabream could be part of a refinement 34

and/or complement of ITGB1a signalling to fulfil the multifaceted roles of the single ITGB1 in the 35

mammalian endothelium (Sueoka et al. 1997; Bowen and Hunt 2000; Lathia et al. 2010), where it 36

Comentario [Q60]: Au: for

these species – which ones?

Comentario [P61]: for seabream


Comentario [P63]: the development of


Comentario [Q65]: Au: Is the text OK: to develop







Comentario [P72]: ITG α-

subunits

Comentario [Q73]: Au: ITGa

subunits – what is the ‘a’ in this?

Should it be “ITG α-subunts”?






DOI: 10.1071/RD10351; TOC Head:

of 17

is involved in processes such as the adhesion of leucocytes to endothelial cells (Kuijpers et al. 1

1990), as well as having important pleiotropic functionality during the development of the 2

vasculature in key steps such as endothelial cell maturation, migration and elongation (Malan et al. 3

2010). In that sense, the minimal expression of ITGB1b in the spleen, heart, ovary, muscle, skin 4

and peritoneal exudate may correspond to the endothelium in these organs. In mouse brain, ITGB1 5

expression has been described only in blood vessels, where it plays a pivotal role in neurovascular 6

remodelling (Lathia et al. 2010). In rats, ITGB1 expression was also detected in neurons and glia 7

(Pinkstaff et al. 1998; Gall et al. 2003). In fish, the localisation of ITGB1 isoforms has not been 8

described in the brain. However, the higher expression of ITGB1b in the brain compared with 9

isolated EECs strongly suggests, as in the testes, that the EECs may not be the only source of 10

ITGB1b in this organ. 11

The expression dynamics between the ECM-related molecules in the testis appear to be part of 12

the marked changes occurring during the RC and are in agreement with the suggested fine-tuning 13

of these molecules in tissue remodelling and other physiological processes in vertebrates (Stevens 14

et al. 2009; Castillo-Briceño et al. 2010). The increase in MMPs, TIMPs and COL1A1 during the 15

post-spawning phase in the second RC reflects the expression profile of these TIMPs during the 16

first RC in gilthead seabream, but not the higher expression of MMP-9 and MMP-13 before 17

spawning in the first RC (Chaves-Pozo et al. 2008a). This difference could be explained by 18

complex tissue remodelling after the second RC that leads to testicular involution, which includes: 19

(1) a diminished gonadosomatic index (Liarte et al. 2007; Chaves-Pozo et al. 2008c); (2) elevated 20

expression of several inflammatory related molecules, such as interleukin-8, tumour necrosis 21

factor-α and transforming growth factor-β1 (Chaves-Pozo et al. 2008b); and (3) the infiltration of 22

AGs, probably favoured by an overexpression of MMPs (Chaves-Pozo et al. 2005; Liarte et al. 23

2007). In addition, the slight increase in MMP-13 and TIMP-2b during spermatogenesis agrees 24

with their described behaviour in the first RC (Chaves-Pozo et al. 2008a), coinciding with germ 25

and Sertoli cell proliferation (Chaves-Pozo et al. 2005). 26

The regulation of ITG gene expression affects their repertoire and proportion at the cellular 27

surface, acting as an ITG switch for the refinement of cell rearrangements during tissue 28

morphogenesis and remodelling, as well as involving the regulation of other ECM-related 29

molecules (Meighan and Schwarzbauer 2008). In the testis, the expression of ITGB1a and its 30

correlation with the ECM-related molecules, especially COL1A1 in the first two RCs, suggest a 31

role for this isoform more related to general tissue remodelling. At the same time, ITGB1b appears 32

to be more involved in specific processes related to spermatogenesis, when its expression is 33

increased specifically and serum 11KT and T levels reach their maximum (Chaves-Pozo et al. 34

2008c). Thus, it is tempting to speculate that this isoform could be making a specific contribution 35

to the endocrine and reproductive pathways in a refinement of ITGB1a functions. This would agree 36


Comentario [P79]: endothelial tissue

Comentario [Q80]: Au: Is the text OK: correspond to the

endothelium in these organs


Comentario [Q82]: Au: was

also detected – please clarify

meaning. Do you mean that it

was detected in neurons and glia

in addition to blood vessels or

that, simply, in rats it was found

in neurons and glia?

Comentario [P83]: However in rats, ITGB1 expression was detected in neurons and glia.


Comentario [P85]: isoforms nor their products have

Comentario [P86]: Italics, and text is OK

Comentario [Q87]: Au: Is the text OK: ITGB1b





Comentario [P92]: TIMP-2a and TIMP-2b

Comentario [Q93]: Au: these

TIMPs – which ones?









DOI: 10.1071/RD10351; TOC Head:

of 17

with the role of ITGB1 during spermatogenesis in mammals, in which it is involved in the adherent 1

and tight junction formation of Sertoli and developing germ cells required for ectoplasmic 2

specialisation (Siu et al. 2003), as well as its well-known and relevant role in several other 3

processes of mammalian reproduction (Sueoka et al. 1997; Bowen and Hunt 2000; Siu et al. 2003; 4

Johnson et al. 2009). This hypothesis is also supported by: (1) minimal or null ITGB1b expression 5

in the other organs; (2) the lack of any correlation between ITGB1b expression and the expression 6

of other ECM-related molecules; and, in particular, (3) its strong inhibition, along with low serum 7

levels of 11KT and T, following exposure to EE2, a well-known endocrine disruptor in fish and 8

other vertebrates, the mechanisms of action of which likely involve an indirect pathway connected 9

to the hypothalamus–pituitary–gonadal–liver axis (Mortensen and Arukwe 2007). This effect of 10

EE2 agrees is similar to the effect of 17β-oestradiol (E2) injection in gilthead seabream (Chaves-11

Pozo et al. 2007), which results in low testosterone levels and an induction of final 12

spermatogenesis events while also triggering post-spawning processes accompanied by important 13

reorganisation of the testicular structure, possibly mediated by ITGB1s. 14

To summarise, we propose that the ITGB1 isoforms detected in gilthead seabream have different 15

activities: ITGB1a acts mainly as a constitutive receptor in the context of the ECM environment 16

and structural dynamics, whereas ITGB1b has a specialised role that could be modulated by sex 17

steroid hormones during the RC. Whatever the case, this is the first report of an ITGB1 gene whose 18

expression is restricted to endocrine-related tissues in vertebrates. 19

Acknowledgements 20

This work was supported by the Spanish Ministry of Science and Innovation (grants AGL2008-04575-CO2-21

01 to AG-A and CSD2007-00002 to VM; fellowship AP2005-5007 to PC-B), Fundación Séneca, CARM 22

(grant 04538/GERM/06 to AG-A), and Fundación Marcelino Botín (grant to VM). The authors thank Sonia 23

Águila-Martínez for her invaluable sample processing assistance, Inma Fuentes for her efficient technical 24

assistance, Valentina Frau for assisting with the sample analysis and the ‘Servicio de Apoyo a la 25

Investigación’ (University of Murcia) for assistance with cell culture and biomolecular analysis. 26

References 27

<jrn>Angus, R. A., Stanko, J., Jenkins, R. L., and Watson, R. D. (2005). Effects of 17alpha-ethynylestradiol 28

on sexual development of male western mosquitofish, Gambusia affinis. Comp. Biochem. Physiol. C 29

Toxicol. Pharmacol. 140, 330–339. doi:10.1016/j.cca.2005.03.008</jrn> 30

<jrn>Bednarek, N., Clément, Y., Lelièvre, V., Olivier, P., Loron, G., Garnotel, R., and Gressens, P. (2009). 31

Ontogeny of MMPs and TIMPs in the murine neocortex. Pediatr. Res. 65, 296–300. 32

doi:10.1203/PDR.0b013e3181973aee</jrn> 33

<jrn>Bowen, J. A., and Hunt, J. S. (2000). The role of integrins in reproduction. Proc. Soc. Exp. Biol. Med. 34

223, 331–343. doi:10.1046/j.1525-1373.2000.22348.x</jrn> 35






DOI: 10.1071/RD10351; TOC Head:

of 17

<jrn>Butler, G. S., and Overall, C. M. (2009). Updated biological roles for matrix metalloproteinases and 1

new ‘intracellular’ substrates revealed by degradomics. Biochemistry 48, 10 830–10 845. 2

doi:10.1021/bi901656f</jrn> 3

<jrn>Castillo-Briceño, P., Sepulcre, M. P., Chaves-Pozo, E., Meseguer, J., García-Ayala, A., and Mulero, V. 4

(2009). Collagen regulates the activation of professional phagocytes of the teleost fish gilthead seabream. 5

Mol. Immunol. 46, 1409–1415. doi:10.1016/j.molimm.2008.12.005</jrn> 6

<jrn>Castillo-Briceño, P., Arizcun-Arizcun, M., Meseguer, J., Mulero, V., and García-Ayala, A. (2010). 7

Correlated expression profile of extracellular matrix-related molecules during the inflammatory response 8

of the teleost fish gilthead seabream. Dev. Comp. Immunol. 34, 1051–1058. 9

doi:10.1016/j.dci.2010.05.007</jrn> 10

<jrn>Ceauşu, M., Curcă, C., Dermengiu, D., and Ardeleanu, C. (2009). Simultaneous immunophenotypical 11

assessment of troponin and extracellular matrix molecules in myocardium of patients with sudden cardiac 12

death. Rom. J. Morphol. Embryol. 50, 103–106.</jrn> 13

<jrn>Chaves-Pozo, E., Mulero, V., Meseguer, J., and García Ayala, A. (2005). An overview of cell renewal 14

in the testis throughout the reproductive cycle of a seasonal breeding teleost, the gilthead seabream 15

(Sparus aurata L). Biol. Reprod. 72, 593–601. doi:10.1095/biolreprod.104.036103</jrn> 16

<jrn>Chaves-Pozo, E., Liarte, S., Vargas-Chacoff, L., García-López, A., Mulero, V., Meseguer, J., Mancera, 17

J. M., and García-Ayala, A. (2007). 17Beta-estradiol triggers postspawning in spermatogenically active 18

gilthead seabream (Sparus aurata L.) males. Biol. Reprod. 76, 142–148. 19

doi:10.1095/biolreprod.106.056036</jrn> 20

<jrn>Chaves-Pozo, E., Castillo-Briceño, P., García-Alcázar, A., Meseguer, J., Mulero, V., and García-Ayala, 21

A. (2008a). A role for matrix metalloproteinases in granulocyte infiltration and testicular remodelation in 22

a seasonal breeding teleost. Mol. Immunol. 45, 2820–2830. doi:10.1016/j.molimm.2008.01.031</jrn> 23

<jrn>Chaves-Pozo, E., Liarte, S., Fernández-Alacid, L., Abellán, E., Meseguer, J., Mulero, V., and García-24

Ayala, A. (2008b). Pattern of expression of immune-relevant genes in the gonad of a teleost, the gilthead 25

seabream (Sparus aurata L.). Mol. Immunol. 45, 2998–3011. doi:10.1016/j.molimm.2008.01.018</jrn> 26

<jrn>Chaves-Pozo, E., Arjona, F. J., García-López, A., García-Alcázar, A., Meseguer, J., and García-Ayala, 27

A. (2008c). Sex steroids and metabolic parameter levels in a seasonal breeding fish (Sparus aurata L.). 28

Gen. Comp. Endocrinol. 156, 531–536. doi:10.1016/j.ygcen.2008.03.004</jrn> 29

<jrn>Chaves-Pozo, E., Liarte, S., Mulero, I., Abellán, E., Meseguer, J., and García-Ayala, A. (2009). Early 30

presence of immune cells in the developing gonad of the gilthead seabream (Sparus aurata Linnaeus 31

1758). J. Reprod. Dev. 55, 440–445. doi:10.1262/jrd.20203</jrn> 32

<jrn>Crawford, B. D., and Pilgrim, D. B. (2005). Ontogeny and regulation of matrix metalloproteinase 33

activity in the zebrafish embryo by in vitro and in vivo zymography. Dev. Biol. 286, 405–414. 34

doi:10.1016/j.ydbio.2005.06.035</jrn> 35

Comentario [Q105]: Au: is

this article in English?



DOI: 10.1071/RD10351; TOC Head:

of 17

<jrn>Delon, I., and Brown, N. H. (2007). Integrins and the actin cytoskeleton. Curr. Opin. Cell Biol. 19, 43–1

50. doi:10.1016/j.ceb.2006.12.013</jrn> 2

<jrn>Djouad, F., Delorme, B., Maurice, M., Bony, C., Apparailly, F., Louis-Plence, P., Canovas, F., 3

Charbord, P., Noël, D., and Jorgensen, C. (2007). Microenvironmental changes during differentiation of 4

mesenchymal stem cells towards chondrocytes. Arthritis Res. Ther. 9, R33. doi:10.1186/ar2153</jrn> 5

<jrn>Estêvão, M. D., Redruello, B., Canario, A. V., and Power, D. M. (2005). Ontogeny of osteonectin 6

expression in embryos and larvae of sea bream (Sparus auratus L.). Gen. Comp. Endocrinol. 142, 155–7

162. doi:10.1016/j.ygcen.2004.11.018</jrn> 8

<jrn>Gall, C. M., Pinkstaff, J. K., Lauterborn, J. C., Xie, Y., and Lynch, G. (2003). Integrins regulate 9

neuronal neurotrophin gene expression through effects on voltage-sensitive calcium channels. 10

Neuroscience 118, 925–940. doi:10.1016/S0306-4522(02)00990-9</jrn> 11

<jrn>Grenache, D. G., Zhang, Z., Wells, L. E., Santoro, S. A., Davidson, J. M., and Zutter, M. M. (2007). 12

Wound healing in the α2β1 integrin-deficient mouse: altered keratinocyte biology and dysregulated matrix 13

metalloproteinase expression. J. Invest. Dermatol. 127, 455–466. doi:10.1038/sj.jid.5700611</jrn> 14

<jrn>Huhtala, M., Heino, J., Casciari, D., de Luise, A., and Johnson, M. S. (2005). Integrin evolution: 15

insights from ascidian and teleost fish genomes. Matrix Biol. 24, 83–95. 16

doi:10.1016/j.matbio.2005.01.003</jrn> 17

<jrn>Huxley-Jones, J., Pinney, J. W., Archer, J., Robertson, D. L., and Boot-Handford, R. P. (2009). Back to 18

basics: how the evolution of the extracellular matrix underpinned vertebrate evolution. Int. J. Exp. Pathol. 19

90, 95–100. doi:10.1111/j.1365-2613.2008.00637.x</jrn> 20

<jrn>Hynes, R. O. (1996). Targeted mutations in cell adhesion genes: What have we learned from them? 21

Dev. Biol. 180, 402–412. doi:10.1006/dbio.1996.0314</jrn> 22

<jrn>Hynes, R. O. (2002). Integrins: bidirectional, allosteric signaling machines. Cell 110, 673–687. 23

doi:10.1016/S0092-8674(02)00971-6</jrn> 24

<jrn>Ivkovic, S., Yoon, B. S., Popoff, S. N., Safadi, F. F., Libuda, D. E., Stephenson, R. C., Daluiski, A., and 25

Lyons, K. M. (2003). Connective tissue growth factor coordinates chondrogenesis and angiogenesis 26

during skeletal development. Development 130, 2779–2791. doi:10.1242/dev.00505</jrn> 27

<jrn>Johnson, M. S., Lu, N., Denessiouk, K., Heino, J., and Gullberg, D. (2009). Integrins during evolution: 28

evolutionary trees and model organisms. Biochim. Biophys. Acta 1788, 779–789. 29

doi:10.1016/j.bbamem.2008.12.013</jrn> 30

<jrn>Krane, S. M., and Inada, M. (2008). Matrix metalloproteinases and bone. Bone 43, 7–18. 31

doi:10.1016/j.bone.2008.03.020</jrn> 32

<jrn>Kuijpers, T. W., Hakkert, B. C., van Mourik, J. A., and Roos, D. (1990). Distinct adhesive properties of 33

granulocytes and monocytes to endothelial cells under static and stirred conditions. J. Immunol. 145, 34

2588–2594.</jrn> 35

Comentario [Q107]: Au: R33

- please provide page range of

entire article (or is this an

abstract?)

Comentario [P108]: R33 correspond to the complete paper, that journal don’t use page number.

Comentario [dem051 109]: Reference "Grenache, Zhang, Wells, Santoro, Davidson, Zutter, 2007" is not cited in the text. Please add an in-text citation or delete the reference.

Comentario [P110]: Cite corrected in the text.


DOI: 10.1071/RD10351; TOC Head:

of 17

<jrn>Lathia, J. D., Chigurupati, S., Thundyil, J., Selvaraj, P. K., Mughal, M. R., Woodruff, T. M., Chan, S. 1

L., Karamyan, V. T., Mattson, M. P., and Arumugam, T. V. (2010). Pivotal role for beta-1 integrin in 2

neurovascular remodelling after ischemic stroke. Exp. Neurol. 221, 107–114. 3

doi:10.1016/j.expneurol.2009.10.007</jrn> 4

<jrn>Leitinger, B., and Hohenester, E. (2007). Mammalian collagen receptors. Matrix Biol. 26, 146–155. 5

doi:10.1016/j.matbio.2006.10.007</jrn> 6

<jrn>Liarte, S., Chaves-Pozo, E., García-Alcazar, A., Mulero, V., Meseguer, J., and García-Ayala, A. (2007). 7

Testicular involution prior to sex change in gilthead seabream is characterized by a decrease in DMRT1 8

gene expression and by massive leukocyte infiltration. Reprod. Biol. Endocrinol. 5, 20–35. 9

doi:10.1186/1477-7827-5-20</jrn> 10

<jrn>Malan, D., Wenzel, D., Schmidt, A., Geisen, C., Raible, A., Bölck, B., Fleischmann, B. K. and Bloch, 11

W. (2010). Endothelial beta1 integrins regulate sprouting and network formation during vascular 12

development. Development 137, 993–1002. </jrn> 13

<jrn>Meighan, C. M., and Schwarzbauer, J. E. (2008). Temporal and spatial regulation of integrins during 14

development. Curr. Opin. Cell Biol. 20, 520–524. doi:10.1016/j.ceb.2008.05.010</jrn> 15

<jrn>Mócsai, A., Abram, C. L., Jakus, Z., Hu, Y., Lanier, L. L., and Lowell, C. A. (2006). Integrin signaling 16

in neutrophils and macrophages uses adaptors containing immunoreceptor tyrosine-based activation 17

motifs. Nat. Immunol. 7, 1326–1333. doi:10.1038/ni1407</jrn> 18

<jrn>Mortensen, A. S., and Arukwe, A. (2007). Effects of 17alpha-ethynylestradiol on hormonal responses 19

and xenobiotic biotransformation system of Atlantic salmon (Salmo salar). Aquat. Toxicol. 85, 113–123. 20

doi:10.1016/j.aquatox.2007.08.004</jrn> 21

<jrn>Mott, J. D., and Werb, Z. (2004). Regulation of matrix biology by matrix metalloproteinases. Curr. 22

Opin. Cell Biol. 16, 558–564. doi:10.1016/j.ceb.2004.07.010</jrn> 23

<jrn>Mould, A. P., McLeish, J. A., Huxley-Jones, J., Goonesinghe, A. C., Hurlstone, A. F., Boot-Handford, 24

R. P., and Humphries, M. J. (2006). Identification of multiple integrin beta1 homologs in zebrafish (Danio 25

rerio). BMC Cell Biol. 20, 7–24.</jrn> 26

<jrn>Mulero, I., Chaves-Pozo, E., García-Alcázar, A., Meseguer, J., Mulero, V., and García-Ayala, A. 27

(2007). Distribution of the professional phagocytic granulocytes of the bony fish gilthead seabream Sparus 28

aurata L. during the ontogeny of lymphomyeloid organs and pathogen entry sites. Dev. Comp. Immunol. 29

31, 1024–1033. doi:10.1016/j.dci.2006.11.011</jrn> 30

<jrn>Mulero, I., Sepulcre, M. P., Fuentes, I., García-Alcázar, A., Meseguer, J., García-Ayala, A., and 31

Mulero, V. (2008). Vaccination of larvae of the bony fish gilthead seabream reveals a lack of correlation 32

between lymphocyte development and adaptive immunocompetence. Mol. Immunol. 45, 2981–2989. 33

doi:10.1016/j.molimm.2008.01.017</jrn> 34

<jrn>Page-McCaw, A., Ewald, A. J., and Werb, Z. (2007). Matrix metalloproteinases and the regulation of 35

tissue remodelling. Nat. Rev. Mol. Cell Biol. 8, 221–233. doi:10.1038/nrm2125</jrn> 36


DOI: 10.1071/RD10351; TOC Head:

of 17

<jrn>Pilcher, B. K., Wang, M., Qin, X. J., Parks, W. C., Senior, R. M., and Welgus, H. G. (1999). Role of 1

matrix metalloproteinases and their inhibition in cutaneous wound healing and allergic contact 2

hypersensitivity. Ann. N. Y. Acad. Sci. 878, 12–24. doi:10.1111/j.1749-6632.1999.tb07671.x</jrn> 3

<jrn>Pinkstaff, J. K., Lynch, G., and Gall, C. M. (1998). Localization and seizure-regulation of integrin beta 4

1 mRNA in adult rat brain. Brain Res. Mol. Brain Res. 55, 265–276. doi:10.1016/S0169-328X(98)00007-5

2</jrn> 6

<jrn>Roca, F. J., Sepulcre, M. A., López-Castejón, G., Meseguer, J., and Mulero, V. (2006). The colony-7

stimulating factor-1 receptor is a specific marker of macrophages from the bony fish gilthead seabream. 8

Mol. Immunol. 43, 1418–1423. doi:10.1016/j.molimm.2005.07.028</jrn> 9

<jrn>Ronzière, M. C., Aubert-Foucher, E., Gouttenoire, J., Bernaud, J., Herbage, D., and Mallein-Gerin, F. 10

(2005). Integrin alpha1beta1 mediates collagen induction of MMP-13 expression in MC615 chondrocytes. 11

Biochim. Biophys. Acta 1746, 55–64. doi:10.1016/j.bbamcr.2005.08.003</jrn> 12

<jrn>Rozario, T., and DeSimone, D. W. (2010). The extracellular matrix in development and morphogenesis: 13

A dynamic view. Dev. Biol. 341, 126–140. doi:10.1016/j.ydbio.2009.10.026</jrn> 14

<jrn>Salata, I. M., Stojanovic, N., Cajdler-Łuba, A., Lewandowski, K. C., and Lewiński, A. (2008). 15

Gelatinase A (MM-2), gelatinase B (MMP-9) and their inhibitors (TIMP 1, TIMP-2) in serum of women 16

with endometriosis: significant correlation between MMP-2, MMP-9 and their inhibitors without 17

difference in levels of matrix metalloproteinases and tissue inhibitors of metalloproteinases in relation to 18

the severity of endometriosis. Gynecol. Endocrinol. 24, 326–330. doi:10.1080/09513590802090325</jrn> 19

<jrn>Schultz, G. S., and Wysocki, A. (2009). Interactions between extracellular matrix and growth factors in 20

wound healing. Wound Repair Regen. 17, 153–162. doi:10.1111/j.1524-475X.2009.00466.x</jrn> 21

<jrn>Sepulcre, M. P., Pelegrín, P., Mulero, V., and Meseguer, J. (2002). Characterisation of gilthead 22

seabream acidophilic granulocytes by a monoclonal antibody unequivocally points to their involvement in 23

fish phagocytic response. Cell Tissue Res. 308, 97–102. doi:10.1007/s00441-002-0531-1</jrn> 24

<jrn>Siu, M. K., Mruk, D. D., Lee, W. M., and Cheng, C. Y. (2003). Adhering junction dynamics in the 25

testis are regulated by an interplay of beta 1-integrin and focal adhesion complex-associated proteins. 26

Endocrinology 144, 2141–2163. doi:10.1210/en.2002-221035</jrn> 27

<jrn>Smith, V. A., Matthews, F. J., Majid, M. A., and Cook, S. D. (2006). Keratoconus: matrix 28

metalloproteinase-2 activation and TIMP modulation. Biochim. Biophys. Acta 1762, 431–439.</jrn> 29

<jrn>Stefanidakis, M., and Koivunen, E. (2006). Cell-surface association between matrix metalloproteinases 30

and integrins: role of the complexes in leukocyte migration and cancer progression. Blood 108, 1441–31

1450. doi:10.1182/blood-2006-02-005363</jrn> 32

<jrn>Stevens, A. L., Wishnok, J. S., White, F. M., Grodzinsky, A. J., and Tannenbaum, S. R. (2009). 33

Mechanical injury and cytokines cause loss of cartilage integrity and upregulate proteins associated with 34

catabolism, immunity, inflammation, and repair. Mol. Cell. Proteomics 8, 1475–1489. 35

doi:10.1074/mcp.M800181-MCP200</jrn> 36


DOI: 10.1071/RD10351; TOC Head:

of 17

<jrn>Sueoka, K., Shiokawa, S., Miyazaki, T., Kuji, N., Tanaka, M., and Yoshimura, Y. (1997). Integrins and 1

reproductive physiology: expression and modulation in fertilization, embryogenesis, and implantation. 2

Fertil. Steril. 67, 799–811. doi:10.1016/S0015-0282(97)81388-X</jrn> 3

<jrn>Szisch, V., Papandroulakis, N., Fanouraki, E., and Pavlidis, M. (2005). Ontogeny of the thyroid 4

hormones and cortisol in the gilthead sea bream, Sparus aurata. Gen. Comp. Endocrinol. 142, 186–192. 5

doi:10.1016/j.ygcen.2004.12.013</jrn> 6

<jrn>Takaishi, H., Kimura, T., Dalal, S., Okada, Y., and D’Armiento, J. (2008). Joint diseases and matrix 7

metalloproteinases: a role for MMP-13. Curr. Pharm. Biotechnol. 9, 47–54. 8

doi:10.2174/138920108783497659</jrn> 9

<jrn>Tiago, D. M., Laizé, V., and Cancela, M. L. (2008). Alternatively spliced transcripts of Sparus aurata 10

insulin-like growth factor 1 are differentially expressed in adult tissues and during early development. 11

Gen. Comp. Endocrinol. 157, 107–115. doi:10.1016/j.ygcen.2008.04.006</jrn> 12

<jrn>Tran, K. T., Griffith, L., and Wells, A. (2004). Extracellular matrix signaling through growth factor 13

receptors during wound healing. Wound Repair Regen. 12, 262–268. doi:10.1111/j.1067-14

1927.2004.012302.x</jrn> 15

<jrn>Tsang, K. Y., Cheung, M. C. H., Chan, D., and Cheah, K. S. E. (2010). The developmental roles of the 16

extracellular matrix: beyond structure to regulation. Cell Tissue Res. 339, 93–110. doi:10.1007/s00441-17

009-0893-8</jrn> 18

<jrn>Vogel, W. F. (2001). Collagen-receptor signaling in health and disease. Eur. J. Dermatol. 11, 506–19

514.</jrn> 20

<jrn>Wyatt, R. A., Keow, J. Y., Harris, N. D., Haché, C. A., Li, D. H., and Crawford, B. D. (2009). The 21

zebrafish embryo: a powerful model system for investigating matrix remodeling. Zebrafish 6, 347–354. 22

doi:10.1089/zeb.2009.0609</jrn> 23

<jrn>Zhang, J., Bai, S., Zhang, X., Nagase, H., and Sarras, M. P., Jr (2003). The expression of gelatinase A 24

(MMP-2) is required for normal development of zebrafish embryos. Dev. Genes Evol. 213, 456–463. 25

doi:10.1007/s00427-003-0346-4</jrn> 26

<jrn>Zhang, Z. G., Bothe, I., Hirche, F., Zweers, M., Gullberg, D., Pfitzer, G., Krieg, T., Eckes, B., and 27

Aumailley, M. (2006). Interactions of primary fibroblasts and keratinocytes with extracellular matrix 28

proteins: contribution of α2β1 integrin. J. Cell Sci. 119, 1886–1895. doi:10.1242/jcs.02921</jrn> 29

<jrn>Zweers, M. C., Davidson, J. M., Pozzi, A., Hallinger, R., Janz, K., Quondamatteo, F., Leutgeb, B., 30

Krieg, T., and Eckes, B. (2007). Integrin α2β1 is required for regulation of murine wound angiogenesis 31

but is dispensable for reepithelialization. J. Invest. Dermatol. 127, 467–478. 32

doi:10.1038/sj.jid.5700546</jrn> 33

Manuscript received 31 December 2010, accepted 12 January 2011 34


DOI: 10.1071/RD10351; TOC Head:

of 17

Fig. 1. Gene expression pattern of extracellular matrix (ECM)-related molecules is correlated with 1

developmental stage in gilthead seabream larvae and juveniles. The mRNA levels of the ECM-related genes 2

indicated were determined by quantitative reverse transcription–polymerase chain reaction of amplification 3

products obtained from pools of at least six whole fish. Gene expression is normalised against that of 4

ribosomal protein S18 (rps18). Data are the mean ± s.e.m. of triplicate analyses during successive stages of 5

development, given as days post hatching (d.p.h.). All genes, except MMP-13 and ITGB1a, were 6

significantly correlated with increasing d.p.h. according to Pearson’s test (P < 0.05). 7

Fig. 2. Expression of ITGB1b is restricted mainly to the testis, brain and endothelial cells (EECs) in adult 8

specimens of gilthead seabream. The ITGB1b mRNA levels were determined by quantitative reverse 9

transcription–polymerase chain reaction of amplification products obtained from two pools of at least eight 10

fish each, sampled during the testicular involution stage of the reproductive cycle. Gene expression is 11

normalised against that of ribosomal protein S18 (rps18) and relative to that in the testis. Data are the mean ± 12

s.e.m. of triplicate analyses. Different letters denote significant differences between groups according to 13

Bonferroni’s test for one-way ANOVA (P < 0.05). hAG, head kidney acidophilic granulocytes; tAG, testis 14

acidophilic granulocytes; MC, macrophages. 15

Fig. 3. Gene expression patterns of extracellular matrix (ECM)-related molecules show specific 16

correlations during the second reproductive cycle in the testis of adult gilthead seabream. Levels of mRNA 17

were determined by quantitative reverse transcription–polymerase chain reaction of amplification products 18

obtained from pools of whole testes of at least eight healthy fish at the indicated months and reproductive 19

stages. Gene expression is normalised against that of ribosomal protein S18 (rps18). Data are the mean ± 20

s.e.m. of triplicate analyses. Different letters denote statistically significant differences between groups 21

according to Bonferroni’s post-test for two-way ANOVA (P < 0.05). SG, spermatogenesis; S, spawning; PS, 22

post spawning; TI, testicular involution. 23

Fig. 4. 17α-Ethynyloestradiol (EE2) inhibits ITGb1b expression in the testis of adult gilthead seabream in a 24

dose- and time-dependent manner. Levels of ITGB1b, ITGB1a and MMP-2 mRNA were determined by 25

quantitative reverse transcription–polymerase chain reaction of amplification products obtained from pools of 26

whole testes of six healthy fish sampled independently at 7, 14 and 21 days after exposure to EE2. Gene 27

expression is normalised against that of ribosomal protein S18 (rps18) and is relative to control at 7 days. 28

Data are the mean ± s.e.m. of triplicate analyses. Different letters denote significant differences between the 29

groups according to Bonferroni’s post-test for two-way ANOVA (P < 0.05). 30

Table 1. Primer sequences used for gene expression analysis 31

The gene symbols follow the Zebrafish Nomenclature Guidelines (http://zfin.org/zf 32

info/nomen.html, accessed xx XXX 200x) 33

Gene Accession no. Primer name Sequence (5′→3′) rps18 AM490061 F AGGGTGTTGGCAGACGTTAC R CTTCTGCCTGTTGAGGAACC mmp2 FN649419 F1 ACTATGACCGCGACAAGTCC R1 GTAACCTTGGTCGGGACAGA mmp9 AM905938 F1 GGGGTACCCTCTGTCGATTT R1 CCTCCCCAGCAATATTCAGA


Comentario [P112]: MMP, matrix metalloproteases; TIMP, tissue inhibitors of MMPs; COL ,collagen; ITG, integrin.


please define all abbreviations

that appear on the figure in the

figure legend






figure legend

Comentario [P117]: ITG, integrin; ND, non-detected.





figure legend

Comentario [P120]: MMP, matrix metalloproteases; TIMP, tissue inhibitors of MMPs; COL ,collagen; ITG, integrin.




figure legend


accessed xx XXX 200x – please

provide the date on which you

accessed the website

Comentario [P123]: accessed September 1st, 2010



that appear in the table below.

In particular, what are F, R, F1,

R1, F2, R2?


DOI: 10.1071/RD10351; TOC Head:

of 17

mmp13 AM905935 F CGGTGATTCCTACCCATTTG R TGAGCGGAAAGTGAAGGTCT timp2a AM905937 F CAAAGGTGGTGGGAGAGAAA R TTGACGTCCAGGGTAACTCC timp2b AM905936 F ATGTCGTTATCAGGGCGAAG R AGAAGTGGGAGCGGTGTAGA col1a1 DQ324363 F2 GCTCTCAGCCAGAGGATGTC R2 TGTAGGCGATGCTGTTCTTG itgb1a FN649420 F2 AAGGGAGACGAGTTCAATCGGT R1 CACCAGCAGACGAGTCACAT itgb1b FN649421 F1 AACGGAAGCCTCTTCACAGA R1 CACCAGCAGACGAGTCACAT

Table 2. Gene expression correlations for extracellular matrix-related molecules in the 1 testis of adult gilthead seabream during the second reproductive cycle 2

Correlation coefficients (r) are bolded. P-values are two-tailed. Asterisks indicate significant r (P > 3

0.05) 4

mmp2 mmp9 mmp13 timp2a timp2b col1a1 itgb1a itgb1b

mmp2 0.98* 0.90* 0.88* 0.55 0.71* 0.40 0.01

mmp9 <0.001 0.87* 0.83* 0.54 0.72* 0.36 –0.06

mmp13 <0.001 0.001 0.76* 0.81* 0.74* 0.67* 0.34

timp2a 0.001 0.003 0.010 0.42 0.44 0.36 –0.09

timp2b 0.100 0.104 0.004 0.228 0.57 0.63* 0.47

col1a1 0.021 0.018 0.014 0.202 0.086 0.52 0.47

itgb1a 0.255 0.305 0.034 0.302 0.049 0.122 0.75*

itgb1b 0.968 0.860 0.333 0.815 0.174 0.166 0.012

Total correlated genes 4 4 6 3 2 3 3 1

Comentario [Q125]: Au: P >

0.05 – are you sure? Should this

be P < 0.05?

Comentario [P126]: P < 0.05

Pub

lish

er: C

SIR

O; J

ourn

al: R

D:R

epro

duct

ion,

Fer

tili

ty a

nd D

evel

opm

ent

Art

icle

Typ

e: r

esea

rch-

arti

cle;

Vol

ume:

23;

Iss

ue: 5

; Art

icle

ID

: RD

1035

1 D

OI:

10.

1071

/RD

1035

1; T

OC

Hea

d:

Pag

e 17

of

17

Ta

ble

3.

Seru

m 1

1-k

eto

test

ost

ero

ne a

nd

tes

tost

eron

e l

evels

an

d f

ina

l w

eig

ht

of

ad

ult

gil

thea

d s

eab

ream

exp

ose

d t

o 1

7α

-eth

yn

ylo

estr

ad

iol

du

rin

g t

he

1 sp

erm

ato

gen

esis

sta

ge

2

Dat

a ar

e th

e m

ean

± s

.d. c

orre

spon

ding

to s

ix a

dult

fis

h sa

mpl

ed a

fter

7, 1

4 an

d 21

day

s ex

posu

re to

17α

-eth

ynyl

oest

radi

ol. L

ette

rs d

enot

e si

gnif

ican

t 3

diff

eren

ces

diff

eren

t gro

ups,

whe

re ‘

a’ c

orre

spon

ds to

the

resp

ecti

ve c

ontr

ols.

11K

T, 1

1-ke

tote

stos

tero

ne; T

, tes

tost

eron

e 4

D

ays

afte

r ex

posu

re

7

14

21

W

eigh

t (g)

11

KT

(ng

m

L–1

) T

(ng

mL

–1)

Wei

ght (

g)

11K

T (

ng m

L–1

) T

(ng

mL

–1)

Wei

ght (

g)

11K

T (

ng m

L–1

) T

(ng

mL

–

1 ) C

ontr

ol

407

± 44

4.

8 ±

0.6

a 6.

3 ±

0.4

a 40

8 ±

59

2.8

± 2

.6a

22.3

± 7

.1a

415

± 3

7 6.

4 ±

1.5

a 17

.6 ±

2.1

a

EE

2 (µ

g g–1

)

5

392

± 41

4.

4 ±

0.3

a 22

.6 ±

1.9

b 44

8 ±

36

3.6

± 0

.5a

2.4

± 0

.2b

420

± 3

8 0.

1 ±

0.0

1b 2.

4 ±

0.9

b

50

38

4 ±

85

0.02

x ±

0.

003b

0.6

± 0

.1c

412

± 39

0.

01x

± 0

.001

b 0.

2 ±

0.1

c 40

6 ±

44

0.3x

± 0

.01b

0.7

± 0

.2c

5

Comentario [Q127]: A

u:

Lett

ers

den

ote

sig

nif

ican

t

dif

feren

ces

dif

fere

nt

grou

ps,

wh

ere ‘

a’

corresp

on

ds

to t

he

resp

ecti

ve c

on

trols

– p

lease

cla

rify

mean

ing. D

o d

iffe

ren

t

lett

ers

wit

hin

a r

ow

or

wit

hin

a

colu

mn

in

dic

ate

sig

nif

ican

tly

dif

feren

t valu

es?

If

you

are

ma

kin

g c

om

paris

on

s again

st

con

trol

grou

ps,

wh

y d

o t

he

con

trol

grou

ps

have a

sup

ersc

rip

t ‘a

’?

Comentario [P128]: L

ette

rs

deno

te s

igni

fica

nt d

iffe

rent

gro

ups

wit

hin

a co

lum

n.


u:

0.0

2x –

ple

ase

note

th

at

the

nu

mb

er o

f d

ecim

al

pla

ces

wit

hin

a m

ea

n±

SD

/SE

M p

air

mu

st b

e

the s

am

e (

eg 1

38 ±

6 a

nd

138.7

± 6

.5 a

re c

orrec

t, b

ut

138 ±

6.5

is

not)

; p

lease

provid

e

mea

n v

alu

e t

o e

xtr

a d

ecim

al

pla

ce h

ere

Comentario [P130]: 0

.022

±


u:

0.0

1x -

ple

ase

provid

e m

ean

valu

e t

o e

xtr

a d

ecim

al

pla

ce h

ere


.013

±


.32


u:

0.3

x

- p

lease

provid

e m

ean

valu

e t

o

extr

a d

ecim

al

pla

ce h

ere

[1] Comentario [Q18] Natalie Korszniak

Au: exposed to the endocrine disruptor 17α-ethynyloestradiol – please specify the

concentration range tested and the durations of exposure

Página 1: [2] Comentario [P19] PATRICIA 14/04/2011 15:36:00

fish exposed to the endocrine disruptor 17α-ethynyloestradiol (at 5 and 50 µg g–1 food

during 7, 14 and 21 days)

Identification of a β1 integrin isoform with restricted tissue expression in a teleost fish

Documents

Transcript of Identification of a β1 integrin isoform with restricted tissue expression in a teleost fish