Identification and characterization of a T cell growth inhibitory factor produced by K562...

Copyright

by

Jennifer Andrea Mertz

2003

The Dissertation Committee for Jennifer Andrea Mertz Certifies that this is

the approved version of the following dissertation:

Identification and Characterization of the T-Cell-Specific

Enhancer of Type B Leukemogenic Virus

Committee:

Jaquelin P. Dudley, Supervisor

Henry R. Bose, Jr.

Jon M. Huibregtse

David G. Johnson

Philip W. Tucker



by

Jennifer Andrea Mertz, B.S.

Dissertation

Presented to the Faculty of the Graduate School of

The University of Texas at Austin

in Partial Fulfillment

of the Requirements

for the Degree of

Doctor of Philosophy

The University of Texas at Austin

December, 2003

Dedication

To my parents

v

Acknowledgements

I would like to thank my adviser, Dr. Jaquelin Dudley, for providing me

the opportunity to work in her laboratory and for her constant support and

encouragement. I would also like to thank the members of my dissertation

committee, Drs. Henry Bose, Jon Huibregtse, David Johnson and Philip Tucker

for their helpful comments and suggestions.

The members of the Bose, Payne and Gottlieb lab have been wonderful

colleagues and provided reagents, protocols, advice and friendship. I would

especially like to thank Andy Liss and Robert Sims for making graduate school a

more enjoyable experience.

I would not have been able to accomplish the things described in this

dissertation without the members of the Dudley lab, both past and present. Mary

Lozano has been indispensable in keeping the lab running smoothly. Melissa

Mann, Dana Broussard, Quan Zhu, Jinqi Liu, Farah Mustafa, Urmila Maitra,

Sanchita Bhadra, Jin Seo, Lakshmi Rajan, Hong Cui and Rachel Misquitta have

all been wonderful coworkers and provided support and friendship that are greatly

appreciated. I would like to especially thank Dana Broussard and Melissa Mann

for their friendship and many discussions of scientific schemes and hypotheses.

I would finally like to thank my parents, for providing me the

opportunities to succeed in my academic endeavors and for always supporting me

throughout my entire education.

vi



Publication No._____________

Jennifer Andrea Mertz, Ph.D.

The University of Texas at Austin, 2003

Supervisor: Jaquelin P. Dudley

Mouse mammary tumor virus (MMTV) is a retrovirus that causes

mammary adenocarcinomas and T-cell lymphomas. T-cell lymphomas induced

by MMTV have additional proviral integrations that invariably have alterations in

the long terminal repeats (LTRs). Type B leukemogenic virus (TBLV) is a

thymotropic strain of MMTV that induces rapidly appearing T-cell tumors in

mice. TBLV is highly related to MMTV except that TBLV LTRs have a deletion

of negative regulatory elements and a multimerization of sequences flanking the

deletion.

In this study, the multimerized sequences from the TBLV LTR were

identified as a novel T-cell-specific enhancer that can act on the TBLV promoter

as well as thymidine kinase and c-myc promoters. Substitution mutagenesis of the

enhancer identified a critical region that contains binding sites for RUNX1, NF-

κB and two unknown factors, NF-A and NF-B. RUNX1, NF-A and NF-B all

positively regulate TBLV enhancer activity. However, the role of NF-κB in

enhancer function is unclear since it does not appear to contribute to the activity

vii

of the TBLV LTR in T cells. Additionally, expression of NF-κB antagonizes the

positive effect of RUNX1 expression on the TBLV LTR in non-T cells. NF-A

appears to be the major contributor to enhancer function and is a lymphoid-

restricted factor. The TBLV enhancer also contains functional glucocorticoid

receptor (GR) binding sites; however GR binding is not necessary for enhancer

activity in T cells. A c-Myb binding site overlaps the GR binding site and

expression of c-Myb in non-T cells activates transcription from the LTR.

Characterization of TBLV enhancers in proviruses integrated near c-myc

revealed that the number of enhancer elements varied, but the most clonal tumors

had proviruses containing four enhancer elements. Reporter gene assays showed

that LTRs containing four enhancer elements were less effective at activating

transcription from either the TBLV or c-myc promoters. In vivo passage of tumor

cells in immunocompetent mice revealed a selection for proviral integrations near

c-myc with four enhancer elements. Since c-myc overexpression often leads to

apoptosis, these results suggested that selection for clonal growth occurred in

tumor cells that had modest c-myc overexpression after TBLV insertion to prevent

apoptosis.

viii

Table of Contents

List of Tables .......................................................................................................... xi

List of Figures........................................................................................................ xii

1. Introduction ......................................................................................................... 1

1.1 Mouse mammary tumor virus .................................................................. 1

1.1.1 History.......................................................................................... 1

1.1.2 MMTV classification.................................................................... 1

1.1.3 MMTV genome and virion structure............................................ 2

1.1.4 Viral proteins ................................................................................ 7

1.1.5 MMTV replication...................................................................... 12

1.1.6 The MMTV life cycle................................................................. 17

1.2 Transcriptional regulation and pathogenesis .......................................... 20

1.2.1 Transcriptional regulation of MMTV......................................... 20

1.2.2 Thymotropic variants of MMTV................................................ 24

1.2.3 Mechanism of tumor induction by MMTV................................ 27

1.2.4 Transcriptional regulation by other retroviral LTRs and enhancers .................................................................................... 32

1.3 Transcription factors that regulate T-cell-specific promoters and enhancers ............................................................................................. 35

1.3.1 Transcription factor RUNX1 ...................................................... 35

1.3.2 Transcriptional co-activator ALY .............................................. 40

1.3.3 NF-κB family of transcription factors ........................................ 43

1.3.4 Transcription factor c-Myb......................................................... 51

1.4 Rationale for this study........................................................................... 58

2. Materials and methods....................................................................................... 59

2.1 Cell lines ................................................................................................. 59

2.2 Transfections .......................................................................................... 59

ix

2.3 Nuclear extract preparation .................................................................... 61

2.4 Whole cell lysate preparation................................................................. 63

2.5 Reporter gene analysis............................................................................ 63

2.6 FACS analysis ........................................................................................ 64

2.7 Preparation of oligonucleotide probes .................................................... 65

2.8 EMSA..................................................................................................... 65

2.9 Plasmids.................................................................................................. 66

2.10 Preparation of plasmid DNA................................................................ 72

2.11 PCR analysis of tumor DNA................................................................ 74

2.12 Purification of ALY from Jurkat T cells .............................................. 75

2.13 SDS-PAGE and staining....................................................................... 76

2.14 Western blot analysis............................................................................ 77

2.15 UV DNA-protein crosslinking ............................................................. 77

3. Results ............................................................................................................... 78

3.1 Identification of a T-cell-specific enhancer in the TBLV LTR.............. 78

3.1.1 Unique cis-acting elements in the TBLV LTR confer T-cell-specific transcriptional activity................................................... 78

3.1.2 Determination of the TBLV triplication as a T-cell specific enhancer...................................................................................... 83

3.1.3 Determination of optimal numbers of 62 bp elements for enhancer activity in T cells ......................................................... 86

3.2 Characterization of TBLV enhancer-binding factors............................. 87

3.2.1 Mutagenesis of the TBLV enhancer ........................................... 87

3.2.1.2 Substitution mutations ............................................................. 90

3.2.2 Characterization of factors affected by the 548 and 556 mutations in the TBLV enhancer ............................................... 95

3.2.3 Characterization of factors affected by the 586 mutation in the TBLV enhancer .................................................................. 126

3.3 Effect of the TBLV LTR on c-myc activation...................................... 133

3.3.1 Characterization of TBLV enhancer elements in proviruses integrated near the c-myc gene. ................................................ 133

x

3.3.2 Selection for TBLV enhancer repeats during tumor passage ... 137

3.3.3 Construction of a genomic c-myc reporter gene vector ............ 140

3.3.4 Effect of enhancer repeats on c-myc promoter activity............ 143

3.3.5 The TBLV LTR confers glucocorticoid responsiveness to the c-myc promoters by enhancer activation.................................. 149

3.3.6 Contribution of point mutations in TBLV enhancer repeats to enhancement of c-myc promoters ............................................. 149

4. Discussion........................................................................................................ 153

4.1 Identification of a T-cell-specific enhancer in the TBLV LTR........... 153

4.1.1 Enhancer function of the TBLV LTR on c-myc promoters...... 154

4.1.2 Optimal number of enhancer elements for transcription in T cells ........................................................................................... 156

4.1.3 Significance of naturally-occurring point mutations in TBLV enhancers near c-myc promoters .............................................. 158

4.2 Evidence for modulation of c-myc overexpression by the TBLV enhancer............................................................................................. 159

4.3 Transcription factors binding to a critical region of the TBLV enhancer............................................................................................. 162

4.3.1 RUNX1 binding to the TBLV enhancer................................... 162

4.3.2 Importance of NF-A and NF-B for enhancer activity .............. 164

4.3.3 ALY enhancement of RUNX1 activity on the TBLV enhancer.................................................................................... 165

4.3.4 NF-κB binding to the TBLV enhancer..................................... 165

4.3.5 HMG and hnRNP roles in transcriptional regulation............... 166

4.4 Contribution of GR and c-Myb to TBLV enhancer function............... 168

4.5 Mechanism of retroviral enhancers active in T cells ............................ 169

Appendix A ......................................................................................................... 176

Appendix B.......................................................................................................... 179

References ........................................................................................................... 180

Vita .................................................................................................................... 226

xi

List of Tables

Table 2.1. Conditions for transfections using a BTX ECM600

electroporator ................................................................................. 62

Table 2.2. Plasmids provided by colleagues for studies of TBLV

enhancer .......................................................................................... 67

Table 3.1. Activities of MMTV and TBLV-LTR reporter gene

constructs in non-T-cell lines......................................................... 81

Table 3.2. Results of mass spectrophotometry analyses of affinity

purified proteins ........................................................................... 106

Table 3.3. Analysis of the enhancer elements in TBLV LTRs near the c-

myc gene ......................................................................................... 134

xii

List of Figures

Fig. 1.1. MMTV proviral structure and transcripts........................................... 4

Fig. 1.2. Generalized illustration of a retroviral partic le. ................................. 6

Fig. 1.3. Synthesis of proviral DNA by reverse transcriptase. ....................... 13

Fig. 1.4. Proviral integration into the host genome. ....................................... 15

Fig. 1.5. Life cycle of milk-borne MMTV virus. ........................................... 19

Fig. 1.6. Diagram of transcriptional control regions and transcription

factor binding sites within the MMTV LTR. ................................... 21

Fig. 1.7. Diagram comparing the MMTV and TBLV LTR structures. .......... 26

Fig. 1.8. Strategy for detection of integrated TBLV proviruses. .................... 30

Fig. 1.9. Locations of TBLV proviruses within the c-myc locus of virally-

induced lymphomas. ......................................................................... 31

Fig. 1.10. LTR enhancer structure of selected retroviruses. ............................. 34

Fig. 1.11. Diagram of the major splice variants of RUNX1. ............................ 36

Fig. 1.12. The Rel/NF-κB family of proteins. .................................................. 46

Fig. 1.13. Functional domains of the c-Myb protein. ....................................... 53

Fig. 3.1. Reporter gene constructs used in transient transfection assays. ....... 79

Fig. 3.2. Transcriptional activity of various TBLV LTRs in T cell lines. ...... 82

Fig. 3.3. Structures of plasmids containing the TBLV triplication in the

pRL-TK vector. ................................................................................ 84

Fig. 3.4. Activity of the TBLV LTR triplication on a heterologous TK

promoter in T cells............................................................................ 85

xiii

Fig. 3.5. Activity of the TBLV LTR triplication on a heterologous

promoter in XC rat fibroblast cells. .................................................. 86

Fig. 3.6. Enhancer activity of TBLV LTRs with different numbers of

enhancer repeats. .............................................................................. 88

Fig. 3.7. Activity of 5’ deletion enhancer mutants in transient transfection

assays of Jurkat T cells. .................................................................... 89

Fig. 3.8. Diagram of the TBLV LTR and positions of enhancer

substitution mutations....................................................................... 91

Fig. 3.9. Reporter gene activity of mutant enhancers in transient assays in

Jurkat (yellow) or RL? 1 (pink) T cells. ........................................... 93

Fig. 3.10. TRANSFAC search results for the TBLV enhancer element. ......... 94

Fig. 3.11. Comparison of the RUNX1 consensus sequence to that from

TBLV, MuLVs, and the T-cell receptor alpha chain (TCR ). ......... 96

Fig. 3.12. Supershift experiments show RUNX-specific binding to the

TBLV enhancer element................................................................... 97

Fig. 3.13. Identification of factors affected by the 548 and 556 TBLV

enhancer mutations. .......................................................................... 99

Fig. 3.14. Cell type specificity of factor binding to the 556WT probe........... 101

Fig. 3.15. Overexpression of RUNX1B in transient transfection assays using

HC11 cells. ..................................................................................... 103

Fig. 3.16. Overexpression of RUNX1B in transient transfection assays using

A20 murine B cells. ........................................................................ 104

xiv

Fig. 3.17. Flow-chart of steps taken to purify proteins that bind to the

TBLV enhancer at the critical region defined above (548-556

region)............................................................................................. 105

Fig. 3.18. Comparison of two methods to identify TBLV enhancer binding

proteins. .......................................................................................... 108

Fig. 3.19. Co-expression of RUNX1B and ALY in HC11 mammary

epithelial cells cooperatively activates the TBLV LTR. ................ 109

Fig. 3.20. Cooperation of ALY and RUNX1 in EL4b murine T cells............ 110

Fig. 3.21. Competition of the HIV LTR enhancer for proteins binding to

the 556WT TBLV enhancer sequence. .......................................... 112

Fig. 3.22. Oligonucleotide competition with NF-κB and NFAT consensus

binding sites. ................................................................................... 114

Fig. 3.23. Overexpression of NF-κB subunits differentially activates TBLV

LTR activity in transient transfection of HC11 cells...................... 116

Fig. 3.24. Overexpression of NF-κB2 with MMTV or TBLV LTR reporter

vectors............................................................................................. 117

Fig. 3.25. Effect of overexpression of RUNX1 and NF-κB2 on TBLV LTR

activity in HC11 mammary epithelial cells.................................... 120

Fig. 3.26. Effect of NF-κB and RUNX1B on TBLV enhancer in A20

murine B cells. ................................................................................ 122

Fig. 3.27. Oligonucleotide competition analysis of TBLV enhancer

complexes using 2 bp mutations..................................................... 123

Fig. 3.28. Effect of TBLV enhancer mutations in Jurkat T cells.................... 125

xv

Fig. 3.29. Activity of the GR binding site mutant 586M in transient

transfections of XC rat cells. .......................................................... 127

Fig. 3.30. Activity of the GR binding site mutant in transient transfection

assays of Jurkat T cells grown in the absence of exogenous

steroid hormones. ........................................................................... 129

Fig. 3.31. The 586 mutation in the TBLV enhancer abolishes the c-Myb

binding site. .................................................................................... 130

Fig. 3.32. RUNX1 and c-Myb cooperative to activate the TBLV LTR in

HC11 cells. ..................................................................................... 131

Fig. 3.33. PCR analysis of primary tumor DNAs to determine the number

of 62-bp repeats in the TBLV LTR enhancer................................. 136

Fig. 3.34. PCR analysis of primary and passage tumor DNAs to determine

the number of 62-bp element in the TBLV LTR enhancer. ........... 139

Fig. 3.35. Semi-quantitative PCR analysis to determine the relative

abundance of TBLV integrations near c-myc after tumor passage.141

Fig. 3.36. Strategy for detection of TBLV enhancer effects on c-myc

transcription. ................................................................................... 142

Fig. 3.37. Transcriptional activity of the c-myc reporter plasmids containing

TBLV LTRs with three-repeat enhancers in Jurkat T cells............ 144

Fig. 3.38. Transcriptional activity of the c-myc reporter plasmids containing

TBLV LTRs with three-repeat enhancers in RL? 1 cells. .............. 145

Fig. 3.39. Activity of the c-myc reporter plasmid after transient

transfections in XC fibroblast cells. ............................................... 146

xvi

Fig. 3.40. Comparison of the enhancer activity of LTRs containing three-

or four-element enhancers on the c-myc promoters. ...................... 147

Fig. 3.41. Comparison of TBLV LTR insertions with different numbers of

enhancer elements in transient transfections of Jurkat T cells. ...... 148

Fig. 3.42. Activity of the c-myc reporter plasmids after DEX induction of

transiently transfected XC fibroblast cells. .................................... 150

Fig. 3.43. Naturally occurring point mutations in enhancer elements do not

alter transcription from the TBLV LTR. ........................................ 151

Fig. 3.44. Comparison of the effect of TBLV LTR with or without

enhancer point mutations on c-myc promoter activity in Jurkat

cells. ................................................................................................ 152

Fig. 4.1. Diagram of TBLV enhancer-binding factors and activity of

corresponding substitution mutations. ............................................ 170

Fig. 4.2. Schematic representation of factors binding to the TBLV

enhancer and other retroviral enhancers active in T cells. ............. 173

Fig. 4.3. Phylogenetic analysis of retroviral enhancers active in lymphoid

cells. ................................................................................................ 174

1

1. Introduction

1.1 MOUSE MAMMARY TUMOR VIRUS

1.1.1 History

Mouse mammary tumor virus (MMTV) was first reported in 1933 by

Jackson Memorial Laboratory as an extra-chromosomal influence on the etiology

of mammary gland tumors in inbred laboratory mice (172). Later, Bittner showed

that this extra-chromosomal factor was transmitted from mothers to offspring via

maternal milk (31). He further stated that there are three co-factors for the

generation of mammary tumors in mice: inherited susceptibility, hormonal

influences associated with pregnancy and the extra-chromosomal factor

transmitted through the maternal milk (32). This factor later was identified as B–

type viral particles in the milk, that then were renamed as mouse mammary tumor

viruses.

1.1.2 MMTV classification

MMTV is a member of the family Retroviridae. This family of viruses is

divided into seven genera according to the Universal System of Virus Taxonomy

as approved by the International Committee on Virus Taxonomy (322). These

genera are: alpharetroviruses (e.g., avian leukosis virus), betaretroviruses (e.g.,

MMTV), gammaretroviruses (e.g., murine leukemia virus), deltaretroviruses (e.g.,

bovine leukemia virus), epsilonretroviruses (e.g., walleye dermal sarcoma virus),

2

lentiviruses (e.g., human immunodeficiency virus 1) and spumaviruses, (e.g.,

human spumavirus). Other members of the betaretrovirus group include

Jaagsietkte sheep retrovirus (109,304) as well as endogenous retroviruses found in

a variety of species, such as human endogenous retrovirus K (HERV-K) (395).

MMTVs that are stably integrated into the host genome and are transmitted

via the germline are referred to as endogenous proviruses (99). Many endogenous

proviruses (≥30) have been identified and characterized and are denoted as Mtv

and an Arabic number (e.g., Mtv6) (67). MMTVs that are transmitted through the

maternal milk to progeny are called milk-borne or exogenous viruses (99). At

least ten exogenous MMTVs have been described for inbred mouse strains, and

they are named according to the strain of mouse that carries them (e.g,.MMTV

(C3H) or C3H MMTV) (1,265).

1.1.3 MMTV genome and virion structure

MMTV has a diploid, positive-stranded RNA genome that is

approximately 8700 nt in length. The genome of MMTV is modified on the 5’

end by the addition of a m7G5’ppp5’Gmp cap, needed for translation (30). The 3’

end of the genome has a series of approximately 200 adenine residues, the polyA

tail, which is added post-transcriptionally by cellular enzymes (356). The

structure of the DNA intermediate of the viral genome, the provirus, is shown

(Fig. 1.1). The viral genes are encoded in the following order for MMTV: gag-

pro-pol-env-sag. MMTV does not encode an oncogene and is classified as a non-

acute retrovirus due to the long latency period for tumorigenesis (7-9 months)

compared to retroviruses that encode oncogenes (days to weeks).

3

MMTV transcripts are expressed in different reading frames. Transcripts

for gag and sag are expressed in one frame; pol is expressed +1 from gag and sag,

while pro and env are expressed +2 from gag and sag. The gag gene encodes the

precursor to the internal structural proteins: matrix (MA), capsid (CA) and

nucleocapsid (NC). The pol gene specifies the precursor for reverse transcriptase

(RT) as well as integrase (IN), whereas the pro gene encodes the viral protease

(PR). The env gene specifies the precursor to the surface glycoprotein (SU) and

the transmembrane protein (TM). Superantigen (Sag) is a type II transmembrane

protein encoded by the sag gene within the U3 region of the long terminal repeat

(LTR) (317).

In the MMTV provirus, the genes are flanked on either end by an LTR.

The LTR is ca. 1332 nt in length and is derived from the unique 3’ RNA

sequences (U3), the repeat (R) sequence found on both ends of the genomic RNA

and the unique 5’ RNA sequences (U5) (94). The LTR structure is generated by

RT, which transfers from one end of the template to the other via the R sequences.

The U3 region for MMTV is the longest found in the retroviruses, with the

exception of the spumaviruses. The MMTV U3 is ca. 1200 nt and contains most

of the transcriptional regulatory control elements, including promoters and

enhancers. The R region of MMTV is the smallest reported (ca. 10 nt) for all

retroviruses (189,404). The U5 region, which is ca. 120 nt long, is the first

sequence copied into DNA by reverse transcriptase and becomes the 3’ end of the

LTR. The 3’ end of U5 contains one of the att sites [also known as inverted

repeats (IR)], which are crucial for viral integration. The MMTV IRs are located

2 bp from the 3’ end of the U5 region (5’ GCGGCA 3’) and 2 bp from the 5’ end

of the U3 region (5’ UGCCGC 3’). These sequences provide recognition sites for

the viral integrase. Two bp are missing from the proviral ends in integrated

proviruses. The primer binding (PB) site is located just downstream of the U5

4

Fig. 1.1. MMTV proviral structure and transcripts.

The LTRs are shown as boxes at either end of the provirus in green. The black ovals represent reported MMTV promoters. The open reading frames are shown in thinner blue boxes. Below the proviral diagram are the transcripts made by the virus, indicated by dashed lines with arrows. Splice donor (SD) and splice acceptor (SA) sites are also shown. Introns are shown by V-shaped structures and represent where splicing occurs. (Adapted from Mustafa et al., 2000 (275)).

gag pol envsag

SDSD SA

MMTV promoters

Sag mRNAs fromU3 promoters

Sag mRNAs fromenv promoters

230+ 7255+ 584-

pro SA

Gag-pol mRNAfrom U3 promoter

Env mRNA fromU3 promoter

5

region; this sequence is an exact complement of the 18 nt from the 3’ end of

tRNA3lys (316) and is the site for initiation of minus-stranded DNA synthesis.

The mature MMTV virion visualized by electron microscopy has an

eccentric electron-dense core, surrounded by a fine membrane- like structure. A

host cell-derived outer membrane envelope surrounds this structure. The mature

virion measures approximately 110 nm in diameter (see Fig. 1.2 for a diagram of

a generalized retroviral particle). Unlike type C virions, which assemble their

cores at the plasma membrane (77), MMTV virions assemble their core particles

in the cytoplasm, before transport to the plasma membrane (51). Immature

MMTV particles, also known as intracytoplasmic A-type particles (27,193), bud

from the host cell membrane, but do not completely mature until after budding.

These immature particles (approximately 70 nm in diameter) have 2 concentric

rings of electron-dense material (348,369,385). Once immature particles reach

the plasma membrane, they adhere to the inner surface, facilitating budding.

After budding, particles change in morphology, with the core contracting to

approximately 60 nm in diameter. The Pr34 Gag polyprotein is present in

released immature virions, and this protein is cleaved to CA and NC during post-

budding maturation.

Mature MMTV virions are composed of shells of individual Gag proteins

with MA forming the outer shell, which lies just beneath the cell-derived lipid

membrane. The MA protein interacts with this membrane via its myristylated N-

terminal portion (44,151,331). The TM protein protrudes from the lipid

membrane, while the internal portion of this protein interacts with MA through an

unknown mechanism. The external portion of TM interacts with SU. Interior to

the MA shell is the icosahedral CA shell that defines the outer layer of the virion

core. The center of the core is comprised of NC and the diploid RNA genome

and is associated with RT (~70/core) (305) and IN proteins. PR is also present

within the virions but its exact location is not well understood.

6

Fig. 1.2. Generalized illustration of a retroviral particle.

The outside of the particle is the host cell-derived envelope that is studded with SU and TM proteins. Under the lipid bilayer is the MA protein that is associated with the envelope proteins. Viral protease (PR) is contained interior to the MA proteins whereas CA proteins constitute the icosahedral capsid, the boundary of the viral core particle. The capsid contains the RNP, composed of NC and the diploid RNA, as well as RT and IN. (Figure is from http://www.ncbi.nlm.nih.gov/books/bv.fcgi?call=bv.View..ShowSection&rid=rv.figgrp.2495.)

7

1.1.4 Viral proteins

1.1.4.1 Gag proteins

Gag proteins are translated as polyprotein precursors (Pr77) that are

subsequently processed into a number of mature proteins by the viral protease

(PR) (159). The order of the proteins contained in the precursor is NH2-MA-

pp21-p3-p8-n-CA-NC-COOH, where “n” is a stretch of 17 amino acids predicted

by DNA sequence, but not identified among purified proteins and peptides (160).

The MA, CA and NC proteins are the internal structural components of virus

particles. Expression of Gag alone results in the assembly of particles resembling

immature virions that bud from the plasma membrane (382). Because proteolytic

cleavage of Gag into its mature proteins occurs late in assembly, during or after

budding, there are equimolar ratios of the three mature Gag proteins.

The MA protein (membrane-associated, matrix or p10) is myristylated co-

translationally by the host cell machinery (360). The myristate moiety is a 14-

carbon fatty acid that is added at the N-terminus of the protein, allowing it to

associate with the host cell membrane (151). This protein is the most

hydrophobic of the viral proteins and must interact with envelope proteins during

budding for successful release of virions (54,88). MA can account for as much as

10% of total virion protein (89), but is not detected at high levels in core

preparations.

CA protein (capsid or p27) contains a major homology region (MHR), a

20 amino acid stretch that is highly conserved among all retroviruses, except

spumaviruses. When this region is mutated, viral infectivity is greatly

diminished, probably due to an assembly defect (75). CA is one of the most

abundant proteins in both viral and infected cell preparations. This protein is the

8

major structural component, forming the shell around the ribonucleoprotein

complex (RNP) to generate the core (90,348).

The NC protein (nucleocapsid or p14) is a small, basic protein that is

tightly associated with the viral genome. The protein has two Cys-His motifs

(CCHC), or zinc coordinating motifs, as well as “assembly domains” necessary

for both packaging and budding of the virion particles (427). This CCHC motif is

crucial for the correct packaging of the viral genome into core particles. For this

reason, this motif may interact with the “packaging sequences” located near the 5’

end of the genome (26,222).

Several proteins of unknown function are also cleaved between MA and

CA (160). These include pp21, p3 and p8. The pp21 protein is a major viral

phosphoprotein, with at least five phosphorylation sites (286,350). It is

hydrophilic and acidic, with possible regulatory and structural roles. The p8

protein is a basic protein, while p3 is very acidic.

1.1.4.2 Pro and Pol proteins

During replication of proviruses, Gag precursor polyproteins are needed in

large numbers since they serve to generate the structural components of viral

particles. The RT, IN and PR enzymes are needed in smaller amounts since they

carry out catalytic functions. The Gag-Pro-Pol precursor (Pr160) is generated

using a strategy that bypasses the termination codon at the end of gag by a

mechanism known as ribosomal frameshifting (149). Ribosomes are able to

occasionally slip back one nucleotide (-1) to continue translating in another open

reading frame. For MMTV, production of these proteins involves two -1

frameshifts, one to generate a Gag-Pro fusion protein and an additional one

downstream to produce the full- length Gag-Pro-Pol fusion precursor protein

(171,266). These frameshifts occur relatively efficiently, with one fourth of

9

ribosomes shifting at the gag-pro junction and one tenth shifting at the pro-pol

junctions (171). Because of these frameshifts, PR, RT and IN are made at

reduced levels relative to Gag proteins.

The NC region of the gag gene and the N-terminal region of the pro gene

encode a trans-frame p30 protein (DU) that has dUTPase activity (25,191). This

coding sequence is found only in a few retroviruses, the non-primate lentiviruses

and beta- and delta-retroviruses. DU is present in retroviral virions, and degrades

deoxyuridine triphosphate (dUTP) to prevent incorporation into viral DNA, and is

dispensable during viral replication in dividing cells (392).

The pro transcript is produced using a –1 ribosomal frameshift to produce

the Gag-Pro polyprotein (Pr110 Gag-Pro). The viral protease (PR or p13) is

encoded within the C-terminus of this Gag-Pro polyprotein. PR functions late in

assembly and budding, or immediately after budding to process the immature

viral polyproteins Gag and Gag-Pol, thus causing the morphological changes

associated with maturation of viral particles and generation of infectious vir ions.

The pol transcript is produced using two –1 ribosomal frameshifts to

generate a Gag-Pro-Pol polyprotein (Pr160 Gag-Pro-Pol) which encodes RT and

IN. RT has both RNA-dependent DNA polymerase activity as well as RNAse H

activity (262). The natural primer for MMTV RT is tRNA3lys (316), and MMTV

RT processivity is enhanced in the presence of Mg2+ relative to Mn2+ (386).

The IN protein mediates the integration of proviral DNA into the host

genome (306). It recognizes the ends of the newly-formed double-stranded DNA

provirus and binds to the att sites, removes 2 nt from the 3’ end of each strand and

joins the proviral DNA ends to host DNA that have been cleaved by the viral

enzyme in a relatively random fashion. However, the randomness of integration

is still a contested subject in the field (323,359,416,431).

10

1.1.4.3 Env proteins

The env messenger RNA (mRNA) is a sub-genomic RNA that is

generated from a splice donor 5’ of the gag initiation site and a splice acceptor 5’

of the env initiation site (Fig. 1.1). This transcript encodes a signal peptide as

well as the SU (surface glycoprotein or gp52) and TM (transmembrane or gp36)

proteins. The signal peptide interacts with the cellular signal recognition particle

and then associates with the ER membrane, where translation of the transcript

causes the nascent polypeptide to extend into the ER lumen (10). The C-terminus

of the protein remains cytoplasmic. Once the leader sequence is cleaved, the

polyprotein traffics through the Golgi apparatus and is glycosylated in transit to

the plasma membrane. The SU protein has 3 N-linked glycosylation sites at amino

acids 127, 143 and 297 and is about 9% carbohydrate by weight. The TM protein

has 2 N-linked glycosylation sites at amino acids 498 and 557 (432). The Env

polyprotein is cleaved into SU and TM by a cellular protease while in the Golgi

apparatus. Even after cleavage, SU and TM associate with each other through

non-covalent interactions and can homo- and heterodimerize. The proteins are

incorporated into the budding virions at the plasma membrane, where the

cytoplasmic tail of TM remains inside the virion. Interaction between TM and

MA is maintained during budding and maturation.

Env proteins are important for adsorption of viral particles and for

penetration of the host cell membrane. These proteins are incorporated into the

host cell membrane and become part of the viral envelope during budding. Env

proteins are also the primary determinant of viral infection since they engage

specific cellular receptors. The primary MMTV receptor (MTVR1) has recently

been defined as the murine transferrin receptor 1 (mTfR1) (340), but another

lower affinity receptor (MTVR2) has been identified (135).

11

1.1.4.4 Superantigen

At least four reported sag transcripts have been reported (Fig. 1.1). Sag

transcripts can be initiated from two promoters in the 5’ U3 region and spliced to

the same splice donor used for env transcripts and a splice acceptor in the env

gene (143,266). Alternatively, sag mRNA can be initiated from an intragenic

promoter in env and spliced with a splice donor and acceptor within env

(105,254,345). An unspliced sag transcript also has been reported that initiates at

the start of the sag open reading frame (8).

Sag is a type II transmembrane protein of about 37 kDa (38,62,63)and is

required for efficient milk-borne transmission of MMTV from the gut of infected

mice to the mammary gland (2,132,133). There are five sites for N-linked

glycosylation at amino acids 79, 89, 93, 131 and 146 in the protein, at least some

of which are required for Sag transport to the cell surface (241). Cleavage by

cellular proteases results in an 18 kDa fragment that is presented on the surface of

infected B cells in association with major histocompatibility complex II protein

(MHC II) (308,429). Sag is capable of interacting with and activating entire

classes of T cells with specific T cell receptor (TCR) β chains, leading to T-cell

activation and/or proliferation (153,235). Release of cytokines allows recruitment

of B and T cells that are then infected by MMTV. The enlarged pool of infected

lymphocytes traffics through an unknown mechanism to the mammary gland

where infection of mammary epithelium ultimately leads to mammary tumors.

The prolonged activation of Sag-reactive T cells eventually leads to apoptosis (2).

12

1.1.5 MMTV replication

1.1.5.1 Entry

As mentioned previously, MMTV enters host cells via the murine

transferrin1 receptor (mTfR1), which is located on mouse chromosome 16 (340).

The SU protein appears to bind to mTfR1 on the cell surface, the viral particle is

then endocytosed. The endosome then traffics to an acidic endosome where viral

and cellular membrane fusion allows uncoating, thus releasing the viral core into

the cytoplasm.

Another potential receptor, MTVR2, has previously been mapped to

chromosome 19 by screening a cDNA expression library transfected into non-

permissive cells (135). However, this protein seems to either function as a low

affinity receptor or only allows binding of the virus to the cell. MTVR2 may

mediate low-level entry via a non-receptor-mediated pathway.

1.1.5.2 Proviral synthesis

After removal of the lipid membrane from the virus, the core is released

into the cytoplasm to initiate reverse transcription (Fig. 1.3) (128,423). A cellular

tRNAlys binds to the PB site located adjacent to the U5 region and primes RNA-

dependent DNA polymerization (316). DNA copies of the U5 and R region on

the 5’ end of the viral genome are made, and the RNase H activity of RT degrades

the viral U5 and R RNA to form minus-strand strong stop DNA. RT then

mediates the first of two template trans fers. The nascent DNA hybridizes to the

3’ R segment of viral RNA and polymerization continues. A DNA copy of the

rest of the genome proceeds after degradation of most of the RNA strand by the

RNase H activity of RT. The residual RNA or polypurine tract serves as the

13

Fig. 1.3. Synthesis of proviral DNA by reverse transcriptase.

See text for details. (Fig. from http://www.ncbi.nlm.nih.gov/books/bv.fcgi ?call=bv.View..ShowSection&rid=rv.figgrp.1063)

14

primer for the synthesis of the plus strand-strong stop DNA. RNase H removes

the remaining viral RNA and the tRNA, and the second strand transfer occurs

when the PB site of the plus strand hybridizes with the PB site of the minus

strand. Proviral DNA synthesis is completed by the extension of both DNA

strands to generate a double-stranded DNA copy of the viral genome with

identical LTRs on either end made up of U3, R and U5 regions.

1.1.5.3 Integration

After reverse transcription, the provirus exists in a specific

nucleoprotein complex known as the preintegration complex. This complex is

composed of the proviral DNA as well as a subset of viral proteins and probably

specific cellular proteins (49,209). Integration of the provirus occurs in three

steps (Fig. 1.4). The first step occurs in the cytoplasm, with two nucleotides

removed from the 3’ ends of each strand downstream of the conserved

dinucleotide, CA, by the viral IN protein. The complex enters the nucleus, and in

the second step, the new 3’ ends are joined to the host DNA in a concerted

cleavage- ligation step. This insertion into host cell DNA is not targeted to any

specific sequences but may be influenced by the chromosomal structure and/or

binding of cellular proteins to the DNA. Favored sites of integration have been

reported for “open” chromatin and DNase-hypersensitive regions in the genome

(355,409). The free 3’ OH groups generated by the removal of the two

nucleotides attack phosphodiester bonds on opposite strands of the host DNA at

positions staggered by six bases in the 5’ direction. DNA repair fills in the gaps

15

Fig. 1.4. Proviral integration into the host genome.

In the first step, two nucleotides are removed from the 3' ends of the viral DNA following a conserved dinucleotide, CA. In the second step, the new 3' ends are joined to host target DNA in a concerted cleavage- ligation reaction. The third step requires repair to fill in the gaps in host DNA that flank the provirus, removal of the two nucleotide overhang (2(pNpN)) at the 5' ends of the viral DNA, and ligation. IN = integrase. (Fig. from http://www.fccc.edu/research/reports/current/skalka.reportframe.html)

16

flanking the viral DNA and displaces the mismatched 5’ ends. Ligation of the

strands completes integration. Integration allows for the stable maintenance of

the viral genome, provides protection against degradation, and allows for efficient

transcription of new copies of the viral RNAs.

1.1.5.4 mRNA synthesis

Viral mRNA and genomic RNA are synthesized by DNA polymerase II.

Most transcriptional initiation starts from the 5’ LTR U3/R junction and

terminates at the R/U5 junction in the 3’ LTR, although sag transcripts have been

reported to initiate from at least three sites. Sag mRNAs may initiate from a

region approximately 500 bp upstream of the U3/R junction in the 5’ LTR or from

two intragenic env promoters (105,143,254). A polyadenylation signal is located

in both LTRs, but only the 3’ LTR signal is used for modification of transcripts

(200). Cellular enzymes add 5’ caps to viral transcripts in the nucleus prior to

export (118,184).

1.1.5.5 Assembly and budding

Gag, Gag-Pro and Gag-Pro-Pol proteins assemble in the cytoplasm of the

host cell into immature virions or procapsids that are approximately 70 nm in

diameter. When these proteins assemble, NC and RT proteins are sequestered

inside the capsid along with the diploid viral genome. PR then cleaves some of

the polyproteins into their mature forms (411). Mature MA interacts with the

cytoplasmic tail of TM, initiating budding of the procapsid. Maturation is

achieved after budding from the host membrane when PR completes processing

of viral proteins, yielding infectious virions.

17

1.1.6 The MMTV life cycle

1.1.6.1 Endogenous and exogenous MMTVs

MMTV can be transmitted horizontally through the maternal milk-borne

route (exogenous viruses) or vertically through the germline (endogenous

viruses). Endogenous proviruses are the result of rare infection and integration

into germ cells (70). Inbred laboratory mice have an average of 2 to 8 endogenous

viruses (192), while outbred wild mice can have from 0 to 14 (167,176,177,325).

Most endogenous retroviruses are defective and do not make infectious viral

particles due to the accumulation of point mutations or deletions in structural

genes or promoters. However, there are some exceptions, namely, Mtv-1, -2 and -

4 (2,192). In addition, most endogenous retroviruses maintain functional sag gene

sequences (2).

1.1.6.2 Life cycle

Mothers express maximal levels of viral RNAs and have very high levels

of MMTV viral particles in their milk. Infection is transmitted in the milk to the

offspring and the virus passes through the neutral stomach into the intestine (Fig.

1.5). In the intestine, MMTV passes through M cells to the gut-associated B and

T cells (136). Infected B cells express the viral Sag in association with MHC II

on the cell surface (3,235). Sag interacts with specific Vβ chains of T cell

receptors on the surface of certain T-cell subsets (153,235), leading to activation

and expansion of bystander B and T cells, which are infected to create a large

pool of infected cells (230). Both B and T cells are necessary for MMTV

transmission since knockout mice lacking either cell type are resistant to infection

via the milk-borne route (28,134). This infected cell reservoir is necessary until

18

the mouse reaches puberty when MMTV can traffic to the mammary gland and

infect actively dividing cells there. Integration of proviruses near proto-

oncogenes can lead to mammary adenocarcinomas (284).

1.1.6.3 Tissue tropism

The receptor for MMTV has been identified as mTfR1 (340), which is

ubiquitously expressed, and therefore, all cells expressing this receptor should be

susceptible to infection. However, not all cells in the host are infected with

exogenous MMTV, and other levels of control are utilized to ensure virus

replication in appropriate host cells. Each step of viral replication is subject to

cellular controls so that infection may not result in successful production of more

viral particles.

Much evidence suggests that MMTV transcription is a primary

determinant of viral cell-type specific expression. Studies examining the

transcription of endogenous MMTVs in mice from different genetic backgrounds

showed that the highest levels of expression are in lactating mammary gland.

High levels of transcription are detectable in non- lactating mammary gland as

well as salivary and prostate glands. Lower expression is also observed in

lymphoid tissues, lungs, kidney, brain, pancreas, stomach, bladder, uterus, testes

and seminal vesicles (152,166). A number of mice transgenic for genes driven by

the MMTV LTR also have been derived to determine the tissue tropism of the

virus (64,337,341,368). These studies are in agreement with expression of

endogenous MMTVs, with expression primarily found in ductal epithelial cells of

mammary and salivary glands, lungs, kidneys, testes, prostate gland and lymphoid

cells. Thus, the highest MMTV expression is observed at the primary site of

tumor formation. The high expression level in mammary gland (ca. 500-fold

19

Fig. 1.5. Life cycle of milk-borne MMTV virus.

MMTV virus is transmitted to the progeny through the milk of viremic mothers. The virus travels through the stomach of the pups to the small intestine, where specialized M cells take up the virus. Viral particles then infect B cells in the gut-associated lymphoid tissue. Infected B cells express viral Sag proteins on their surface in conjunction with MHC II molecules. Sag activates and expands infected B and T cells to form a pool of infected cells. These cells traffic to the mammary gland and the virus infects mammary epithelial cells. MMTV replication and virus production is up-regulated by hormones associated with pregnancy and lactation and viral particles are transmitted to pups in the mother’s milk. After multiple pregnancies and lactations, the high frequency of viral insertions increases the likelihood of a proviral insertion near an oncogene, resulting in a mammary tumor.

20

higher than other tissues) allows for more viral integrations and increases the

likelihood of upregulation of cellular oncogenes to cause cancer.

1.2 TRANSCRIPTIONAL REGULATION AND PATHOGENES IS

1.2.1 Transcriptional regulation of MMTV

MMTV has long been considered a model system for transcriptional

regulation, especially hormone- induced RNA expression (165,232,406). The cis-

acting regulatory regions contained with the U3 region of the 5’ LTR are

responsible for the regulation of both tissue-specific and hormonally-stimulated

transcription of viral genes. In addition to the TATA box and polyadenylation

signals contained in the U3 region, a number of other control elements have also

been mapped to this region (Fig. 1.6). These include the mammary gland-specific

enhancer, the negative regulatory elements (NREs) (37,163), the hormone

responsive element (HRE) (165,232), as well as Octamer-1 (OCT-1) (45) and NF-

1 binding sites (150). Variant strains of MMTV that have a preferred tropism for

T cells and cause thymic T-cell lymphomas invariably have a deletion of the

NREs and often have a multimerization of the sequences flanking the deletion

(16,210,434).

Stewart et al. first reported mammary cell-specific transcription from the

MMTV LTR (375). The mammary gland enhancer has been mapped to the

extreme 5’ end of the U3 region, but there is some controvery about its exact

location. One group mapped the region between nt -1166 and -987 (relative to the

transcriptional start site) using transgenic mice (264) whereas transient

transfection analyses mapped the enhancer between nt -1075 and -978 (243,436).

The enhancer functions in both lactating and non- lactating mammary glands as

21

Fig. 1.6. Diagram of transcriptional control regions and transcription factor binding sites within the MMTV LTR.

Different transcription factors are shown with ovals and circles. The maximum deletion observed in thymotropic strains of MMTV is shown by a red bar above the diagram. Numbers below the LTR show the number of bases from the transcriptional start site (+1). Abbreviations: MGE (mammary gland enhancer), NRE (negative regulatory element), HRE (hormone responsive element), TFIID (transcription factor IID), GR (glucocorticoid receptor), CDP (CCAAT displacement protein), SATB1 (special AT-rich binding protein 1).

T-cell-specific LTR deletions

-1166 -978 -645 -264 -190 -80 +1

NRE HRE

MP4, MP5 NF1, AP2, F5, F12, MGF, MAF C/EBP, NF1

GR GR NF1OCT-1 RNAP

CDP CDP SATB1

CDP SATB1

CDP TFIID

MGE

RU3 U5

GR GR

22

well as in salivary glands. These studies also showed that the mammary cell

enhancer interacts with the HRE of the LTR to stimulate steroid hormone- induced

transcription (436). A number of factors have been identified that bind to this

enhancer region, including MP4, MP5, AP-2, F2, F3/NF1, F12, MAF and MGF

(Stat5a) (211,243,255). Many of these factors are developmentally regulated in

the mammary gland. DNA binding of MAF, MGF and MP4 are all activated by

prolactin, epidermal growth factor or trans forming growth factor (TGF) α (147).

Two regions that negatively affect transcription from the MMTV LTR

have been mapped to -645 through -471 and -365 through -264 (163). These

regions are known as the distal and proximal NREs, respectively. At least two

transcriptional repressors bind to these elements, special AT-rich binding protein

1 (SATB1) and CCAAT displacement protein (CDP) (224,447). SATB1 is

expressed most abundantly in thymus, at lower levels in brain, spleen and other

tissues, but is absent in mammary gland (87). CDP is expressed in most

undifferentiated tissues, and its expression decreases upon differentiation of

several cell types (403,405). Functional studies in transgenic mice (224) and

transfection experiments (163) in cultured cells suggest that the distal and

proximal NREs are able to work independently, but that the distal NRE is a

stronger regulator of MMTV expression than the proximal NRE. To date, 9 CDP

binding sites have been mapped in the LTR, with 8 located in the NRE region and

one just downstream of the mammary enhancer (446) (Dr. Q. Zhu, personal

communication). Two SATB1 binding site have been localized to the proximal

NRE (224).

Glucocorticoid receptor (GR) has been shown to have at least six binding

sites upstream of the transcriptional start site of the MMTV LTR (encompassed

within -299 to -70) (112), although the HRE, originally designated from -190 to -

80, contains four GR binding sites (99,399). Glucocorticoids enter cells passively

23

and bind to receptors located in the cytoplasm (330). GR is held in the cytoplasm

by association with heat shock protein 90 (Hsp90) (164). Upon binding of the

glucocorticoid to its receptor, Hsp90 dissociates and the glucocorticoid/GR

complex translocates into the nucleus where it binds the HRE to upregulate

transcription up to 100-fold. This element is very important to the MMTV life

cycle since during pregnancy and lactation, GR is able to translocate to the

nucleus and upregulate MMTV transcription dramatically. This increases the

production of viral particles that are present in the maternal milk and, therefore,

increases the likelihood of transmitting the virus to progeny.

GR binding to the MMTV LTR of integrated proviruses also induces

chromatin remodeling around the HRE. This remodeling allows for other

transcription factors to bind to sites that were previously inaccessible, which

allows for higher transcription from the LTR (84). In the absence of hormones,

the NF1, OCT-1 and TBP sites adjacent to the HRE are masked by chromatin

(208). However, GR binding to the HRE recruits an ATP-dependent remodeling

complex known as SWI-SNF or BRG1-BAF that then remodels the chromatin in

the vicinity (although this is somewhat controversial, Dr. Cathy Smith, personal

communication) (117,273). Recent data show that GR is not associated in vivo

with the MMTV HRE, suggesting that MMTV uses a “hit and run” mechanism to

deliver the chromatin remodeling complex to the correct area on the promoter,

followed by rapid dissociation. This phenomenon has been elegantly shown using

photobleaching experiments in living cells (242). This “hit and run” mechanism

causes the temporary displacement of the linker histone H1 as well as the

remodeling of the core histones to allow access of transcription factors to the

DNA. The MMTV promoter is then in an open conformation, without altering

the nucleosomal positioning over the LTR. NF1 and the transcription initiation

complex subsequently bind and mediate transcription (7,84). Recently, it has been

determined that NF1 has a role in both transcription and chromatin remodeling,

24

based on studies using both transient and stable expression experiments (150).

NF1 participates in both the stabilization of the transient association between GR

and the HRE as well as the recruitment of the remodeling complex to the MMTV

promoter in vivo.

1.2.2 Thymotropic variants of MMTV

MMTV primarily causes mammary adenocarcinomas, but also induces

thymic T-cell lymphomas in mice harboring (GR and DBA/2) (210,252) or

lacking (BALB/c and C57BL/6 [B6]) (98) exogenous virus. As early as 1964,

Stuck et al. reported that ML (mammary leukemia) antigen was expressed in

DBA/2 mouse lymphoid leukemias as well as MMTV-induced mammary tumors

(379). Electron microscopy experiments in the 1970s also showed

intracytoplasmic A particles, the immature virions of MMTV, in mouse

lymphomas (50,401).

Newly-acquired proviruses in these lymphomas were investigated in a

number of strains of mice, including GR (251-253), DBA/2 (210,435), BALB/c

(98,163) and C57BL/6 (98,163,197). In most cases, these newly integrated

proviruses had site-specific rearrangements in the U3 region of the LTR,

including an invariant deletion and, often, a direct repeat element. The U3

deletion always truncates the sag open reading frame and, in some cases, deletes

the 5’ portion of the GRE (197,210,253). Further characterization has shown that

the rearranged LTRs from GR and DBA/2 mice have significantly elevated

transcriptional activity in T-cell lines compared to MMTV LTR activity

(388,435). However, most of the lymphomas that were analyzed failed to

produce any infectious viral particles due to failure of the viral polyproteins to

mature in virions (287,402). Because of this, early studies were unable to show

directly that this variant of MMTV was responsible for inducing T-cell

25

lymphomas in mice. However, in 1971, Ball and McCarter demonstrated that

carcinogen- induced thymomas from CFW/D mice produced a thymotropic type B

retrovirus, originally called DMBA-LV (dimethylbenz(α)anthracene

leukemogenic virus) and later, type B leukemogenic virus (TBLV) (17,271).

TBLV induced thymic lymphomas after a short latency (2 to 3 months) when

inoculated intrathymically into newborn mice (13,14). Mammary tumors were

not observed, presumably because mice died before mammary tumors normally

develop (83). TBLV LTRs had a deletion of the NREs as well as a triplication of

sequences flanking the deletion, similar to altered MMTV LTRs observed in other

lymphomas. The deletion spanned 443 bp, and was accompanied by triplication

of a 62 bp element that was composed of 18 bp from the 5’ flanking DNA and 44

bp from the 3’ flanking DNA (Fig. 1.7) (247). In addition to the LTR differences,

TBLV viruses also had unique gp52 and p28 proteins and unique restriction sites

compared to MMTV (14), suggeting point mutations throughout the genome.

An infectious MMTV provirus was constructed by Shackleford and

Varmus (365) in 1988, allowing tests of molecular recombinants between MMTV

and its thymotropic variants. Yanagawa et al. constructed chimeric MMTVs by

replacing the MMTV LTR in the 3’ end of the molecular clone with LTRs from

proviruses isolated from thymic lymphomas (434). Infection of mice with these

chimeric MMTVs produced only T-cell tumors, indicating that the determinants

for pathogenicity of these viruses lie within the LTRs (213,372). Also,

lymphomas were induced in both male and female mice, suggesting that

pregnancy-associated hormones were not necessary for lymphoma induction by

this virus.

Paquette and colleagues (307) generated transgenic mice using the TBLV

LTR as a promoter for either c-myc or CD4. Transgenes in these mice were

preferentially expressed in double-positive (CD4+CD8+) immature, thymic T cells

26

Fig. 1.7. Diagram comparing the MMTV and TBLV LTR structures.

The U3 region is shown in gray, with the NREs shown in pink. The sequences flanking the NREs are yellow on the 5’ flank and hatched black and white on the 3’ flank. These two flanking sequences are joined and multimerized to generate a predicted T-cell enhancer. The R region is shown as a white box and the U5 as a black box. The transcriptional start site is denoted by +1.

U3

U3

U5R

NREs

MMTV LTR

TBLV LTR

T cell enhancer

U5R

+1

+1

27

and their progenitors, whereas expression was downregulated in both single

positive (CD4+ or CD8+) mature T cells. Thus, the tissue-specific expression of

the TBLV or MMTV LTRs correlated with the type of tumor induced.

1.2.3 Mechanism of tumor induction by MMTV

1.2.3.1 Activation of proto-oncogenes in mammary tumorigenesis

MMTV has been associated not only with mammary adenocarcinomas,

but also with thymic lymphomas, and at a very low frequency, kidney (120,180)

and pituitary tumors (326,396). Since MMTV does not encode an oncogene, the

virus must rely on other mechanisms of tumorigenesis. Thus, the virus causes

insertional mutagenesis to induce cancer.

Using MMTV as a “molecular tag” (289), at least nine different loci have

been identified as common integration sites (CISs) in mammary cancer. These

integration loci can be categorized into five cellular gene families: Wingless

(Wnt) (207,288,289,336), fibroblast growth factor (Fgf) (91,228,315), Notch

(92,119,332,332,349), aromatase (92,102,349,387) and the gene encoding the p48

component of eukaryotic translation initiation factor 3 (eIF-3p48) (9,233).

Most MMTV integration sites share common characteristics. The

majority of the proviruses integrate outside of the coding region of the gene that is

affected. For this reason, the proteins produced from these loci are unmodified,

but expression levels are changed. Like other retroviruses, MMTV proviruses can

affect transcription of these genes over long distances (≥ 15 kb). Also, the gene

that is affected by the integration is not normally expressed in adult mammary

gland tissue and is often a developmentally regulated gene. Finally, the genes that

28

are common integration sites for MMTV appear to be evolutionarily conserved,

with many encoding growth factors or truncated growth factor receptors (99).

1.2.3.2 Mechanism of tumor induction in thymic lymphomagenesis

Unlike MMTV-induced mammary tumors, T-cell lymphoma induction by

MMTV has not been widely studied. However two loci, the Tblvi1 locus located

on mouse chromosome X (271) and the c-myc locus on chromosome 15 (328),

have been identified as CISs for TBLV-induced tumors. The Tblvi1 locus spans

approximately 53 kb of the X chromosome and appears to upregulate an mRNA

in this region. However, the identity of the gene(s) affected by TBLV integration

is currently unknown. A number of other thymotropic MMTV integration sites,

but not necessarily common integration sites, also have been mapped. These

include Pad4, Pad5, and Pad6, which are located on chromosomes 3, 5, and 15,

respectively (329).

c-myc as a common integration site

Previous studies have shown that a TBLV LTR-c-myc transgene is

sufficient to cause T-cell lymphomas that are CD4+CD8+ (307). This type of

tumor is similar to that induced by injection of TBLV particles intrathymically

into neonatal mice (13,14). Infection of TBLV-c-myc transgenic mice with

MuLV decreases the latency of tumor formation, suggesting that c-myc

expression is necessary but not sufficient for tumor progression (126). Integration

near c-myc has been documented for a number of other retroviruses that induce

lymphoid tumors, including Moloney and SL3-3 murine leukemia viruses, avian

leukosis virus and reticuloendothelial virus (100).

29

Based on this information, a panel of 30 TBLV-induced lymphomas was

analyzed for the presence of proviral integrations in the c-myc locus. Initial

screening by Southern blot analysis showed rearrangement of the c-myc locus in

only two tumors (328). Due to the polyclonal nature of the TBLV-induced

tumors, the number of cells with a particular integration may not be detected by

Southern analysis. Subsequently, a PCR-based screening strategy was used to

detect integrations in the c-myc locus (Fig. 1.8). This strategy used a number of

TBLV-specific and c-myc-specific primer sets to show that approximately 23% of

tumors screened had integrations in or near the c-myc coding region (Fig. 1.9)

(328). In addition, analysis of c-myc expression levels by Northern blot analysis

showed that almost all tumors screened had elevated levels of c-myc mRNA

relative to normal thymus (3 to 6-fold elevation) (328).

Not all tumors with elevated c-myc expression had integrations in the c-

myc locus detectable using this PCR-based method. This may be due to the

limitations of the PCR-based screening strategy, with detection limits of

approximately 5 kb. Integrations of other retroviruses affecting c-myc over long

distances (>300 kb) have been reported (204,400), and therefore, it is possible that

integrations outside of the region screened were responsible for elevation of c-

myc expression. Elevation of c-myc levels also may be indirect, perhaps due to

integration near another gene that regulates c-myc expression.

30

Fig. 1.8. Strategy for detection of integrated TBLV proviruses.

The forward and reverse arrows indicate the locations of the sense (+) and antisense (-) primers, respectively, used for PCRs. The positions of exons (Ex) are indicated.

31

Fig. 1.9. Locations of TBLV proviruses within the c-myc locus of virally-induced lymphomas.

The arrows indicate the approximate positions of proviral insertions and their transcriptional orientations with respect to that of c-myc. Only proviral integrations that could be confirmed by direct PCR product sequencing or by sequencing of the cloned PCR products have been included on this map. Only proviruses observed in primary TBLV-induced tumors are shown. Approximately 23% of tumors analyzed (11 of 47) had detectable integrations within the c-myc locus. The positions of some restriction enzyme sites are shown: EcoRV (RV), BamHI (B), XbaI (X), and HindIII (H). Numbers below the line indicate distance from the first base of c-myc exon 1 (Ex 1) in kilobases. The hatch marks indicate that the linear map is not to scale. The proviral insertions in tumors T16 and T17 could be detected by Southern blotting, whereas the other insertions could not. The non-translated exon 1 of c-myc is depicted as a white box, while the two coding exons (exons 2 and 3) are represented by the solid gray boxes.

RV XBB RV

RVX

-25 kb +6 +7.5 +23 kb

T16

T17

Ex 3Ex 2

c-myc Locus

0

Ex 1

T604T602

+10

T9

-3.8

T623B T15

-1

T623B

T5

T19

H

T623BT623B

HBH

T10

T700

32

1.2.4 Transcriptional regulation by other retroviral LTRs and enhancers

Retroviral enhancers are known to contribute to tissue tropism and disease

specificity (56,170,274,339). Enhancers are believed to be aggregates of

transcription factor binding sites that are known to together influence nearby

promoter activity. Most T-cell tropic murine leukemia enhancers have a Runt-

related transcription factor 1 (RUNX1) binding site, which is also present in the

feline leukemia virus enhancer (Fig. 1.10). Interestingly, the T-cell tropic HIV-1

enhancer does not contain a RUNX1 binding site. Moreover, the presence or

absence of this binding site alone does not always correlate with the pathogenicity

of the virus in which the enhancer element is contained, since the non-pathogenic

or weakly pathogenic Akv and the highly pathogenic SL3-3 both contain RUNX1

binding sites. Experiments have shown that mutation of the RUNX1 binding site

in the Moloney MuLV enhancer can change the disease specificity from T-cell

lymphomas to erythroleukemias (372). Also, the SL3-3 enhancer differs from the

Akv enhancer at several sites, including a single base in the RUNX1 binding site,

and alteration of this base in the SL3-3 enhancer significantly reduced the

leukemogenicity of the virus (236). Proviruses recovered from tumors induced by

this mutant SL3-3 virus often contained mutations that reverted the enhancer back

to the wild-type SL3-3 virus enhancer or suppressor mutations that increased the

transcriptional capacity back to wild-type levels. Other data have shown that

SL3-3 viruses containing a 3 bp transversion in the RUNX1 binding site still

induced T-cell lymphomas and that the mutation was maintained in proviruses

recovered from tumor DNA (4). These data suggest that factors other than

RUNX1 are critical for determining enhancer specificity and the type of tumor

induced.

Most of the murine leukemia viruses (and also feline leukemia virus)

enhancers also contain binding sites for the Ets transcription factors (Fig. 1.10).

33

Ets sites are located adjacent to the RUNX1 binding sites and are believed to be

important for modulating RUNX1 binding (125, 126). In addition to RUNX1 and

Ets binding sites, the SL3-3 enhancer also contains a c-Myb binding site located

between a RUNX1 binding site and the Ets binding site (Fig. 1.10). Whereas

mutation of the Ets binding site in MoMuLV enhancer has a dramatic effect on

leukemogenecity (372), the Ets binding site does not seem critical for enhancer

function in SL3-3 as it only slightly lowers the leukemogenic potential of the

virus (281). However, mutation of the c-Myb binding site in SL3-3 strongly

inhibits the pathogenicity of the virus. These data suggest that there is more than

a single combination of transcription factors that can create a T-cell-specific

enhancer.

The HIV enhancer is the smallest (27 bp) of the enhancers that have been

analyzed (Fig 1.10). This enhancer is different from other T-cell enhancer

examined since it is active in monocytes and macrophages in addition to T cells

(101,302). Comparison with other enhancers reveals two tandem binding sites for

NF-κB with adjacent Sp1 sites. Other factors shown to bind the enhancer include

Ets family members Ets-2 and PU.1, NFAT as well as AP-2 (Fig. 1.10) (311).

This combination of binding sites may result in expansion of HIV cell-type

specificity and the failure of this enhancer to induce T-cell lymphomas.

34

NF1

Ets Runx1bHLH GR

E-box c-Myb

MoMuLV (75 bp)2

FeLV (50 bp)2

Akv (99 bp)2

SL3-3 (72 bp)2

NF-kB

Sp-1

AP-2

HIV-1 (26 bp)

1

NFAT

Fig. 1.10. LTR enhancer structure of selected retroviruses.

Numbers outside the brackets indicate the number of enhancer elements commonly observed. Known transcription factor-binding sites that are shown. The numbers in parentheses refer to the length in base pairs of a single enhancer element.

35

1.3 TRANSCRIPTION FACTORS THAT REGULATE T-CELL-SPECIFIC PROMOTERS AND ENHANCERS

1.3.1 Transcription factor RUNX1

As mentioned in the previous section, RUNX1 is an important factor in

the function and specificity of T-cell-tropic viral enhancers. RUNX1 is a member

of the Runt domain (RD) family of proteins. Members of this family are

conserved transcriptional regulators, related to the Drosophila melanogaster

protein runt (178). RUNX1 is also known by many other names, including core

binding factor, α 2 subunit (CBF-α 2), Acute Myelogenous Leukemia 1 protein

(AML-1), polyomavirus enhancer binding protein 2 α B subunit (PEBP2-αB or

PEA2-αB), SL3-3 enhancer factor 1 αB subunit (SEF1-αB) or SL3/AKV core

binding factor αB subunit (S/A-CBF αB). Other members of this family include

RUNX3 (AML-2) and RUNX2 (AML-3), Drosophila Lozenge, Cs-runt in the

spider, Cupiennius salei, SpRunt in sea urchin, Xam1 in Xenopus, and runxa and

runxb in zebrafish (48,69,76,78,397).

Members of the RD family share a highly conserved runt homology

domain (rhd). This 128 amino acid domain is named for its high homology to the

Drosophila pair-rule protein, runt (178). Among mammalian runt domains, 92%

of the amino acids are identical, and 66% are identical to the Drosophila runt

protein . This domain mediates both DNA-binding activity as well as protein-

protein interactions with the binding partner for RUNX proteins, core binding

factor β (CBF-β) (415). The RUNX1 protein is expressed as a number of

alternatively spliced variants, ranging in size from approximately 27 kDa to 52

kDa. The largest isoform of the protein, RUNX1B, has a number of major

functional domains, including the runt homology domain (rhd) located near the N-

terminus of the protein (Fig. 1.11). A 33 amino acid nuclear matrix targeting

signal is located closer to the C-terminus, and this signal functions as a

36

transactivation domain as well as in targeting RUNX1 to sites of active

transcription (440). The main transactivation domain is located in the C-terminus,

whereas the extreme C-terminus specifies a WRPY motif, which mediates

interactions with the co-repressors Groucho or transducin- like enhancer of split 1

(TLE1) (215). Also present in the protein is an autoinhibitory domain (ca. 240

amino acids) located C-terminal to the runt domain (141). These sequences are

responsible for inhibiting RUNX1 DNA binding as well as interaction with

CBFβ . The inhibition of DNA binding can be overcome by interaction with

either CBFβ or Ets-1 proteins (141).

rhdRUNX1a

RUNX1b

RUNX1B rhd WRPY

rhd WRPY

1

1

1

1

rhd WRPYRUNX∆N348

480

453

250

Fig. 1.11. Diagram of the major splice variants of RUNX1.

The runt homology domain (rhd) is denoted by a gray box. The number of amino acids in each protein are shown.

37

1.3.1.1 Gene Structure of RUNX1

The human RUNX1 gene, located on chromosome 21, covers

approximately 260 kb (214), whereas the murine homologue is located on

chromosome 16 and spans approximately 91 kb. Both genomic loci encode 8

exons, have two promoters, and three polyadenylation signals (124,260). The

RUNX1 gene has at least 12 transcripts, ranging from 2 to 8 kb that can result in

at least 4 proteins (Fig. 1.11) (260). The difference in sizes of transcripts is due to

alternative splicing and differential use of promoters and polyadenylation signals.

RUNX1B and RUNX1b are the major protein isoforms, and they are identical

except that RUNX1b has an N-terminal deletion of 27 amino acids due to

differential promoter usage (124). These proteins both possess a full- length rhd,

the C-terminal WRPY domain and the transactivation domain C-terminal to the

rhd. RUNX1A is a splice variant that lacks the transactivation domain and uses a

separate polyadenylation signal than that used for RUNX1B or RUNX1b (260).

The RUNX 1A isoform acts as a competitive inhibitor of RUNX1B or RUNX1b

(259). RUNX1∆N is an N-terminally truncated version of RUNX1B that lacks a

portion of the rhd (442). It is incapable of binding DNA or the CBFβ subunit, but

interferes with the transactivation potential of RUNX1B.

1.3.1.2 DNA binding and heterodimerization of RUNX1

The RUNX1 transcription factor is comprised of two subunits, the DNA

binding and transactivating α subunit and the non-DNA binding CBFβ subunit.

The runt domain is important for DNA binding activity of the α subunit to the

consensus TGT/cGGT as well as for dimerization of the α subunit with the β

subunit (178,248,297). In Drosophila, two proteins can heterodimerize with runt,

38

Brother and Big-brother. The β subunit proteins are unable to bind DNA

themselves, but instead stabilize the binding of runt or RUNX1 to DNA (296).

The murine homolog of RUNX1, CBFα, was first identified by a number

of groups based on its ability to bind to the enhancers of two murine viruses,

polyomavirus and murine leukemia virus (MuLV). RUNX1 was initially

described by two groups, Piette and Yaniv (318), and Satake et al. (351,433), as a

factor that binds to the α, or A, enhancer of polyomavirus. The first group named

the protein polyoma enhancer A binding factor 2 (PEA2) whereas the second

group referred to the same factor as polyoma enhancer binding protein 2

(PEBP2). CBF also was independently identified as a factor that binds to the

“core” site in MuLV enhancers (419) by a number of other groups. The first

notation of a CBF was described by Speck and Baltimore in work characterizing

the Moloney MuLV enhancer (371). Two groups working on another MuLV

enhancer, SL3-3, also identified the same factor. However, one group referred to

SL3-3 enhancer factor 1 (SEF1) (390) while the other referred to SL3-3 and AKV

core-binding factor (S/A-CBF) (34) based on the factor binding to both AKV and

SL3-3 enhancer cores. Subsequently, the current RUNX nomenclature was

established (227,240).

1.3.1.3 Function of RUNX1 in hematopoietic differentiation and

leukemia

Knockout (KO) mice for both RUNX1 and CBFβ have been described

(282,299,413,414). In mice that have RUNX1 gene disruption, heterozygous

mice appear normal compared to wild-type littermates, but homozygous knockout

mice for RUNX1 are not viable, indicating a vital role for RUNX1 in

development. Homozygous KO embryos die between days E11.5 and E12.5 with

the appearance of massive hemorrhaging within the ventricle of the central

39

nervous system and vertebral canal, the ganglia of the cranial nerves and

extending into the third and lateral ventricles as well as the pericardial space and

peritoneal cavity (299). These data suggest a role for RUNX1 in vessel

formation. During normal murine embryonic development, the major site of

hematopoiesis shifts from the yolk sac (transitory, primitive hematopoiesis) to the

fetal liver (definitive hematopoiesis) at days E11.5–E12.5. The livers of RUNX1-

deficient embryos at day E11.5 show no fetal liver–derived hematopoiesis, and

only primitive, nucleated erythrocytes were seen within vascular channels and

hepatic sinusoids. Also, peripheral blood analysis of the RUNX1-deficient

embryos at both day E11.5 and E12.5 contained only nucleated large primitive

erythrocytes, consistent with a yolk sac origin, and had no identifiable platelets.

Thus, the disruption of the RUNX1 gene results in an intrinsic defect in stem cells

or multipotential progenitors responsible for establishing definitive hematopoiesis

or a defect in the yolk sac and fetal liver microenvironment that prevents normal

in vivo development of these cells. Also, cells isolated from embryonic yolk sacs

or fetal livers of KO mice were unable to differentiate in culture into definitive

erythroid, myeloid or mixed lineage colonies under conditions where littermate

cells were able to do so. Embryonic stem cells from KO mice were also unable to

contribute to normal hematopoietic development when injected into blastocysts to

generate chimeric mice, suggesting a role in definitive hematopoiesis at either the

level of hematopoietic stem cells or another multipotential cell (299).

Disruption of the CBFβ gene in mice is also a homozygous embryonic

lethal condition indistinguishable from that of RUNX1-deficient mice

(282,413,414). These mice die around day E12.5 due to massive hemorrhaging of

the central nervous system and show no hematopoiesis in the fetal liver. These

two gene knockout studies prove that the two subunits of RUNX1 are necessary

in vivo for definitive hematopoiesis in the mouse system.

40

RUNX1 was also identified in humans based on commonly identified

t(8;21) chromosomal translocation breakpoints in acute myeloid leukemia (AML)

(261). Subsequently, RUNX1 was also identified in (q22;q22), t(12;21),

(p13;q22) and t(3;21)(q26;q22) translocations in AML and acute lymphoblastic

leukemias (226,373). The CBFβ subunit is also a target of chromosomal

rearrangements in AML, [inv(16), (p13;q22), t(16;16) and del(16)(q22)] (373).

Alterations in the RUNX1 complex account for approximately 25% of all de novo

acute leukemias. Thus, these factors are the most frequently disrupted genes in

acute human leukemias (226).

1.3.2 Transcriptional co-activator ALY

ALY is a transcriptional coactivator that interacts with RUNX proteins

and lymphoid enhancer binding factor 1 (LEF-1) on the TCR α enhancer (43).

There have been no previous reports of ALY interacting with RUNX1 or any

other factors on viral enhancers. ALY was independently cloned by a number of

groups and is known by many names, including Basic region- leucine zipper

(bZIP) Enhancing Factor (BEF) (410), RNA and Export Factor (REF) (380) and,

in yeast, Yra1p (320). The different names are indicative of the diverse activities

that have been attributed to this protein. Both the mammalian and yeast homologs

of this protein were identified in 1997. ALY was cloned in a screen to identify

factors that interact and functionally collaborate with LEF-1 (43). BEF was

identified in a search for cellular regulators of DNA-binding activity for bZIP

proteins (410). Yra1p was identified as an essential nuclear protein with RNA

annealing activity and later determined to be involved in mRNA export from the

nucleus (320,380).

41

ALY belongs to a superfamily of RNA-binding proteins that contain

ribonucleoprotein (RNP)-type RNA-binding domains (RBD) (380). In addition to

the RBD, other distinguishing features of this family include two highly

conserved motifs in the N- and C-termini (REF-N and REF-C boxes) (46).

Between the conserved motifs and the RBD are regions of variable length (N-vr

and C-vr). These family members contain elements that are similar to the

arginine-glycine-glycine (RGG) boxes in many heterogeneous RNPs (hn-RNPs).

There are three mammalian REFs (REF1-3) that differ in their variable regions

due to deletions or amino acid substitutions. The proteins are extremely

conserved, with 98% identity in the RBD and 100% identity in the conserved

boxes. REF1 (ALY) is expressed in two forms, REF1-I and REF1-II. REF1-I is

the full- length form of the protein, and REF1-II is a splice variant that lacks the

N-terminal variable region (380).

ALY is a ubiquitously expressed, nuclear protein that specifically interacts

with the activation domains of LEF-1 as well as RUNX1, both of which bind to

the TCRα enhancer (43). ALY acts by increasing the DNA-binding activity of

LEF-1 and RUNX proteins and has been shown to stimulate the activity of the

TCR α enhancer complex when reconstituted in non-T cells. In addition, down-

regulation of ALY expression by anti-sense oligonucleotides drastically reduces

TCRα enhancer activity in T cells (43). However, when artificially tethered to a

heterologous DNA-binding domain, ALY is unable to stimulate transcription,

suggesting that it acts in a context-dependent fashion to increase the

transcriptional activity of the TCR α complex. ALY is a member of the TREX

complex (transcription/export) that is specifically recruited to activated genes

during transcription (378). This complex travels the entire length of the gene with

RNA polymerase II and remains associated with the resulting mRNA throughout

its processing and export from the nucleus (212).

42

Another group isolated the human form of this protein (referred to as BEF)

in 1999 (410). BEF was identified in a search for proteins that regulate the

dimerization or stabilization of bZIP proteins. BEF recognizes the leucine zipper

motif of bZIP proteins to stimulate dimerization that then promotes DNA binding.

BEF is a novel nuclear chaperone, unlike any other family of chaperones

identified thus far, which does not require ATP for function.

The other role that has been attributed to this protein is in mRNA nuclear

export (380). Yra1p was originally identified in yeast as an essential, nuclear

RNP-motif-RNA binding protein with similarities to hnRNPs (320) and has since

been determined to interact with Mex67p (yeast homolog of tip associating

protein, TAP) and function in export of bulk polyA+ RNA from the nucleus.

Thus, REF proteins participate in multiple steps of mRNA biogenesis, including

transcription and transport.

In vitro splicing experiments with human REF has shown that it associates

with mRNAs in a splicing-dependent manner (205,445). These data suggested

that REFs interact with the cellular splicing machinery. Three pieces of evidence

support this hypothesis: co-purification of REF with spliceosomes (278), REF

localization to nuclear speckles (425,445), which are sites of enrichment of

splicing factors (256), and REF is a component of the 335 kDa complex that is

deposited by the spliceosome 20-24 nt upstream of exon-exon splice junctions

(205,206).

A current model suggests that Yra1p/REF recruits Mex67p to the mRNP

complex. Mex67p proteins associate with the nuclear pore complex, so that the

mRNPs are then transported out of the nucleus. Sub2p, the yeast homolog of

UAP56, is a DEAD box helicase involved in splicing and mRNA export which

recruits Yra1p to mRNA (377). Subsequently, Sub2p/UAP56 is displaced from

Yra1p by the binding of Mex67p, allowing transport of the mRNA through

nuclear pores. Yra1p was the first RNA-binding protein shown to bridge

43

Mex67p, an exporter protein, to intranuclear mRNA transport cargoes

(376,380,441).

1.3.3 NF-κB family of transcription factors

Although NF-κB proteins have not been implicated in regulation of T-cell-

tropic MuLV enhancers, a critical role for NF-κB has been established for the

activity of the HIV-1 enhancer in T cells for viral expression and replication

(58,198). NF-κB is a eukaryotic transcription factor that was first identified in

1986 as a nuclear factor required for immunoglobulin kappa light chain

transcription in B cells (362). NF-κB is a dimer of two members of the Rel

family of proteins, and some form of this factor exists in virtually all cell types.

The prototypical NF-κB, and the first one isolated, is a dimer of RelA and NF-

κB1 (363). In most cells that are not activated or stimulated, the NF-κB dimer is

held in the cytoplasm by an inhibitor protein, IκB (21,258,424). Upon signaling,

the IκB molecule is phosphorylated and targeted by ubiquitination for degradation

by the proteasome (42). After release from IκB, NF-κB translocates to the

nucleus where it binds to κB binding sites in a number of promoters to activate

transcription.

There are five mammalian members of the Rel/NF-κB family of proteins,

including NF-κB1 (p105/p50), NF-κB2 (p100/p52), RelA, RelB and c-Rel (Fig.

1.12) (258,366). Nuclear factor of activated T cells (NFAT) shares homology to

the Rel homology domain and is sometimes considered a member of the Rel

44

family (283). The v-rel protein, an oncogenic variant of chicken c-rel transduced

by the reticuloendotheliosis virus strain T (Rev-T), is also a Rel family member

(335). v-Rel has a C-terminal truncation and addition of Rev-T sequences on

either end compared to c-Rel (Fig. 1.12) (125). The NF-κB proteins are

evolutionarily conserved, with three members of this family found in Drosophila

melanogaster, Dorsal, Dif and Relish (103,169,374). Dorsal is a dorsal/ventral

morphogen that determines polarity in embryos by activating genes on one side of

the embryo while repressing them on the other side. Dorsal is retained in the

cytoplasm by an inhibitor protein known as Cactus. However, Dif is more similar

in function to NF-κB since its activity upregulates insect immunity genes. The

Dif protein exists as an inactive pool in the fat body of flies (which is believed to

be the fly equivalent of the liver) and is activated by infection, suggesting a role in

the primitive innate immune response. Relish is a homolog of NF-κB1 and NF-

κB2, and its activity is highly induced by bacterial infection.

All NF-κB molecules are dimers of Rel family members (123,408)and all

family members contain an N-terminal 300 amino acid Rel homology domain

(RHD), which mediates DNA binding, dimerization and interaction with IκB

(139). Additionally, all Rel proteins have a nuclear localization signal (NLS)

contained within the RHD. The two Re l family members that make up a dimer

each possess half of a DNA-binding site. Since different members can dimerize

with each other, this allows for slight variations in the binding preferences of

these dimers to the κB site, although the consensus site for NF-κB is 5’

GGGYNNCCY3’ (196). In addition to the differences in binding site preference,

45

the transactivating potential of different NF-κB molecules also can vary

considerably (195). This is due to the presence or absence of a variable C-

terminal transactivation domain in the protein monomers. Most dimers are

transcriptionally active, such as NF-κB1/RelA, NF-κB1/c-Rel, RelA/RelA, and

RelA/c-Rel (41,145,146,181). RelA, RelB and c-Rel all contain potent

transactivation domains. However, homodimers of NF-κB1 or NF-κB2 have

largely been reported to be repressors as they lack a strong C-terminal

transactivation domain (41,181,319). There is evidence that translocation of NF-

κB to the nucleus is necessary but not sufficient for transcriptional activation by

these proteins. In support of this, it has been shown that RelA is phosphorylated

in both a constitutive and an inducible manner (6,412,444). This phosphorylation

enhances DNA binding and provides additional interaction sites for CREB-

binding protein (CBP/p300) (443). Unphosphorylated RelA has been reported to

have a conformation in which the C-terminus interacts with the RHD to interfere

with DNA binding and, therefore, transcriptional activity of the factor (6). NF-

κB1 and NF-κB2 are proteins that are processed from larger precursor proteins,

p105 and p100, respectively. These proteins contain ankyrin repeats in their C-

terminal portions that act to retain these proteins in the cytoplasm. Ankyrin

repeats are protein-protein interaction motifs that are found in all IκB molecules

(361). The exact mechanism and regulation of the processing of NF-κB1 and NF-

κB2 to produce the mature, transcriptionally active forms is not completely

resolved. These NF-κB proteins are ubiquitinated, which can target them for

degradation by the proteasome, yet this degradation is reported to be partial,

46

Fig. 1.12. The Rel/NF-κB family of proteins.

Structures of the members of mammalian NF-κB/Rel family of transcription factors. The positions of the Rel homology domain (RHD), containing the DNA binding domain (DBD) and nuclear localization signal (NLS) are shown. Also depicted are the glycine rich repeats (GRR) and ankyrin repeats found in NF-κB1 and NF-κB2.

c-Rel

v-Rel

RelA

RelB

NF-κB1(p105)

NF-κB1(p50)

NF-κB2(p100)

NF-κB2(p52)

RHD

DBD NLS

GRR Ankyrin repeats

47

leaving the N-terminal portion while removing the inhibitory ankyrin repeats.

Conflicting reports suggest that processing is constitutive or regulated by an

activating signal and may be co-translational or post-translational

(157,219,229,383). The mechanism appears to be somewhat clearer for NF-κB2

than for NF-κB1, with evidence that CD40 signaling can stimulate the ubiquitin-

dependent degradation of the C-terminal domains of the p100 protein (72). There

is also evidence that the glycine-rich region found in these proteins is necessary

for mediating this proteasome-dependent partial degradation (221,301) and that

p100 can serve as an IκB and as a specific heterodimeric partner with RelB (220).

Thus, when p100 is processed, the resulting heterodimer of NF-κB2/RelB can

translocate to the nucleus.

There are also several members of the IκB family of proteins as well.

This family includes IκB α, β , γ, and ε, Bcl-3, and the Drosophila protein, Cactus

(123,223). All members function by interacting with NF-κB proteins to sequester

them in the cytoplasm of unactivated cells by masking their NLS. Family

members all have multiple ankyrin repeats that mediate their interactions with

other proteins, and there is a correlation between the number of ankyrin repeats

and the specificity of the NF-κB dimer with which IκB protein pairs. The first

family member cloned and characterized was IκB α (81,148). This protein is 37

kDa in mass and, like other family members, contains three major domains (173).

The N-terminal domain is phosphorylated in response to signaling, which targets

it for degradation. The central region contains the ankyrin repeats whereas the C-

terminal region contains PEST sequences that are involved in the basal turnover

48

of the protein. The IκB proteins mediate the rapid induction of NF-κB activity by

allowing its translocation to the nucleus to bind κB sites in target promoters.

Most IκB proteins are autoregulated since an increase in NF-κB activity leads to

increased IκB transcription due to the presence of κB sites in IκB promoters (61).

This ensures that the NF-κB activation is short- lived.

IκB α and β are the proteins that are responsible for retaining the majority

of NF-κB1/RelA and NF-κB1/c-rel dimers in the cytoplasm. However, IκB β

differs from IκB α by its failure to be upregulated by NF-κB activity; levels of

IκB β remain low until after the transient upregulation of NF-κB activity (389).

The IκB γ protein is an alternatively spliced product of the NF-κB1 precursor,

which is only detected in lymphoid cells and plays a more limited role in

inhibiting NF-κB (168). The Bcl-3 protein was identified by cloning of a t(14;19)

chromosomal breakpoint from a B-cell chronic lymphocytic leukemia (298).

Unlike other IκB family members, Bcl-3 is a nuclear protein that binds NF-κB1

and NF-κB2 .Bcl-3 may function to remove the NF-κB1 or NF-κB2 from κB

sites, thus allowing transcriptional activating forms of NF-κB to bind (114,115).

Alternatively, Bcl-3 may bind to κB sites with NF-κB1 or NF-κB2 and facilitate

transcriptional activation (36,114).

NF-κB proteins regulate a large number of genes that are involved in the

innate and adaptive immune responses. These genes encode cytokines (IL-2, IL-

1, IL-6, IL-12, TNFα, LTα and β , GM-CSF), chemokines (IL-8, MIP1α, MCP1,

RANTES, eotaxin), adhesion molecules (ICAM, VCAM, E-selectin), acute phase

proteins (SAA), inducible effector enzymes (iNOS, COX-2), anti-microbial

49

peptides (β-defensins), MHC proteins, costimulatory molecules (B7.1), and

regulators of apoptosis and proliferation (c-IAP-1, c-IAP-2, A1 (Bfl1), Bcl-XL,

Fas ligand, c-myc and cyclin D1) (12,183,303). In mature B cells, plasma cells,

macrophages, and some neurons, NF-κB is constitutively active in the nucleus

(179,225,363). Thus, NF-κB may have a role in maintaining the differentiated

state of these cells. Moreover, it is clear that NF-κB has a major role in the

regulation of the host immune response to a number of different external signals.

NF-κB has also been determined to have a critical role in HIV-1 expression since

the HIV enhancer contains tandem NF-κB sites that are critical for proviral gene

expression in response to cellular stimuli (276).

1.3.3.1 NF-κB knockout mice studies

Knockout (KO) studies have been performed with most Rel family

members to determine the contributions of individual proteins or protein

combinations to development or immune responses. The phenotypes vary

considerably from greater susceptibility to bacterial infection (NF-κB1 KO) or

developmental lethality (RelA KO).

The NF-κB1 KO mice develop normally and have normal levels of B cells

as well as a normal ratio of κ and λ light chains (364). Interestingly, B cells from

these mice do not differentiate in response to LPS, but antibody crosslinkage of

surface IgM does induce NF-κB activity and proliferation of these B cells. These

50

mice have a greater susceptibility to bacterial infections and enhanced resistance

to viral infection, presumably due to upregulation of IFN β .

Gene disruption of c-Rel results in normal murine development (190).

The major phenotype of these mice is that the responses of B and T cells to

mitogens are decreased dramatically. IL-2, IL-3, IL-12, IFN γ and GM-CSF

production are also decreased, and the level of RelA protein detected in the

nucleus is increased. The increase in nuclear RelA levels may be an attempt at

compensation, but is not effective as the mice still have defects in lymphocyte

activation.

Knockout of RelA gene expression is developmentally lethal, with

embryos dying at day E16 due from high levels of apoptosis in the liver (23,93).

Examination of NF-κB1/RelA double KO mice gave, not surprisingly, embryonic

lethality, with death due to massive apoptosis (161). These mice do not survive

past embryonic day 12, in contrast to RelA KO mice, which survive to day E16.

Further analyses of these embryos suggested that expression of RelA is required

for the formation of secondary lymphoid organs.

Disruption of RelB gene expression is not lethal; however mice are only

healthy for approximately ten days (47,417). At this time, they develop thymic

atrophy, splenomegaly, bone marrow hyperplasia, abnormal immune response

and sometimes death. Lymphoid development is normal in these mice.

RelB/NF-κB1 double KO mice have an exaggerated phenotype, with death by

four weeks of age (418). These data and the reduced ability to mount a delayed

51

type hypersensitivity response suggest that RelB may be crucial for T-cell-

mediated immunity.

IκB α KO mice have no developmental defects, but die within nine days

of birth due to degeneration of spleen and thymus (22,187). These mice are born

severely runted and have skin abnormalities. NF-κB activity is greatly increased

in hematopoietic organs, and this constitutive activity is believed to be the cause

of neonatal lethality.

1.3.4 Transcription factor c-Myb

As mentioned previously, c-Myb binding is crucial for enhancer activity

of SL3-3 in cooperation with RUNX1 binding (281,437). There are three

members of the family of Myb proteins: A-Myb, B-Myb and c-Myb. All

members of this family are nuclear proteins that function as transcriptional

transactivators. The protein structure reveals three functional domains, an N-

terminal DNA-binding domain, a central transactivation domain and a C-terminal

regulatory domain (343) (shown for c-Myb in Fig. 1.13). The N-terminal domain

contains 3 imperfect tandem repeats of 50-52 amino acids each, termed R1, R2

and R3. The R1 repeat is dispensable for DNA binding, but functions to stabilize

the complex formed between the DNA and the R2R3 repeats (162). Part of R2

and all of R3 are required for DNA binding (291,293-295). In the case of A- and

c-Myb, the C-terminal domain acts as a negative regulator of transactivation,

whereas the B-Myb C-terminal domain is a positive regulator. Family members

52

have highly-conserved DNA-binding domains, and it appears that these proteins

bind to DNA with overlapping sequence specificities. The transactivation

potential of these proteins depends on the cell type and context of the responsive

promoter, suggesting that the Myb proteins rely on interactions with other cell-

type specific co-factors for transactivation.

The predominant c-Myb proto-oncogene is a 75 kDa (636 amino acid)

protein that is expressed in most hematopoietic tissues, but an alternatively

spliced 89 kDa protein is also expressed (97). The c-Myb protein is constitutively

expressed in immature hematopoietic cells, but in other cell types, such as mature

T cells, the expression is regulated and only detected at the G1/S phase of the cell

cycle. Expression of c-Myb at this transition point is required for T cells to

proceed with the cell cycle (121). The c-Myb proteins are short-lived since they

are rapidly degraded by the proteasome-ubiquitin pathway (29). A-Myb encodes

a 95 kDa (751 amino acid protein) expressed in male germ cells, breast epithelial

cells in pregnant mice, ovaries, developing brain and B cells in splenic germinal

centers (129). B-Myb is a 93 kDa (704 amino acid) ubiquitous protein expressed

in late G1/S following the entry of quiescent cells in to the cell cycle (344).

The c-Myb consensus binding site, also known as the Myb responsive

element (MRE), was defined as YAACKGHH (H= A, C, T and K= G, T and Y=

C, T) (422). The MRE is a bipartite binding site, composed of YAAC and

KGHH. The YAAC half-site is absolutely required for DNA binding, while the

second half-site is quite flexible and mediates the half- life of the DNA-protein

complex. Recent work has extended the MRE to 15 nt in length

53

(NNCNTAACGGTTTTT) using a yeast-based in vivo binding site selection assay

(24). As noted from this new consensus sequence, the sequences 5’ from the

AACGGT core are not well- conserved, suggesting that the sequence has minor

importance. The new consensus sequence also revealed a preference for A-T rich

sequences downstream stream of the hexamer core for optimal binding and

activation.

1 636

R1 R2 R3

DBD TAD LZ

NRD

Fig. 1.13. Functional domains of the c-Myb protein.

The DNA-binding domain (DBD) is made up of three imperfect tandem repeats (R1, R2 and R3). The transcriptional activation domain (TAD) is shown in green. The negative regulatory domain (NRD) is located in the C-terminal region of the protein and contains a leucine zipper (LZ).

c-Myb proteins play a critical role in regulating normal hematopoiesis

since antisense oligonucleotides impeded in vitro hematopoiesis dramatically

(5,122). An essential role for c-Myb in development has also been demonstrated

with the generation of KO mice, as these mice die in utero due to severe anemia

and drastic defects in all hematopoietic cell lineages except for megakaryocytes

(270). These mice appear to have a defect in the switch from primitive to

definitive hematopoiesis. Animals develop normally until embryonic day 13.5,

54

but die by day 15, coinciding perfectly with the switch in hematopoiesis. Myb

seems to block terminal differentiation of hematopoietic cells since the level of c-

Myb expression is down-regulated as stem cells develop into mature cells

(137,421) and overexpression of c-Myb prevents the differentiation of cells (394).

The major function of c-Myb may be to coordinate the proliferation and

maturation of hematopoietic cells.

Myb was originally identified as the transforming gene of the defective

avian myeloblastosis virus (AMV), which induces acute myeloid leukemia (269).

Another replication-defective retrovirus, E26, also contains a transduced Myb

gene and induces erythroid and myeloid leukemias (327). Both viruses encode

different forms of an N- and C-terminally truncated c-Myb protein. The v-

MybAMV protein is 45 kDa and contains 6 amino acids from the viral Gag protein

and 371 amino acids from the cellular c-Myb protein. The v-MybE26 protein is

considerably larger at 135 kDa and is a fusion of viral Gag, c-Myb and Ets-1

(277). Both proteins lack the full C-terminal negative regulatory domain.

c-Myb is highly conserved and present in all vertebrates and some

invertebrate species. The human c-Myb gene locus on chromosome 6 has 15

exons and spans a region of 40 kb, encoding an mRNA of 3.8 kb (231). The c-

Myb promoter does not contain the canonical TATA box, and transcription

initiates from multiple sites in a GC-rich region of the promoter (370).

55

1.3.4.1 Cellular targets of c-Myb

A number of cellular promoters, including a number of myeloid-specific

genes (elastase, Myb-induced myeloid protein 1(mim-1) and myeloperoxidase

(MPO)) as well as T-cell-specific genes (TCRγ and δ, CD4) are functionally

activated by c-Myb binding (407). The c-Myb promoter is negatively

autoregulated in T cells (142), and c-Myb positively regulates c-myc expression

(108). The TCRγ promoter also contains a RUNX1 binding site adjacent to the c-

Myb binding site that is necessary but not sufficient for transcriptional activation.

Functional cooperation has been demonstrated between RUNX1 and c-Myb for

the enhancer contained within the TCRγ promoter (154-156). The MPO gene is

specifically expressed in myeloid cells (384,393), serving as an early marker of

both the granulocytic and monocytic lineages (113,324). Similar to the TCRγ

promoter, the MPO promoter contains two c-Myb binding sites as well as a

RUNX1 binding site. RUNX1 and c-Myb have been shown to synergistically

activate the MPO promoter (39), but they do not bind DNA cooperatively

(155,437).

1.3.4.2 c-Myb and retroviral promoters

A number of retroviral promoters have been shown to bind c-Myb

proteins, including SL3-3 MuLV (281,437), human endogenous retrovirus H (82),

human T- lymphotropic virus-1 (HTLV-1) (35,79) and human immunodeficiency

56

virus-1 (HIV-1) (65,80,312). c-Myb is highly expressed in myeloid cells and

mitogen- and/or antigen-stimulated T cells, which are the targets of infection and

replication for these viruses.

A number of c-Myb binding sites have been mapped in the HTLV-1 LTR

(35,79). In one study, six specific c-Myb binding sites were identified by DNase I

footprinting, five of which were located in the U3 region and one in the R region

of the LTR. The binding site located in the R region was unable to confer c-Myb

responsiveness to CAT reporter constructs alone. Three of the six binding sites in

the U3 region functionally bound c-Myb and transactivated reporter constructs in

transient transfection analyses with a c-Myb expression vector. These analyses

showed that c-Myb could bind the HTLV-1 LTR in the absence of the viral

protein Tax1. More recent studies have shown that Tax1 and c-Myb reciprocally

antagonize the transcriptional activity of each other by competing for a binding

site on another transcription factor, CBP (71). This antagonism may be

responsible for the upset of homeostasis in HTLV-1-infected cells that eventually

causes malignancy. Another report states that Tax1 is able to repress Myb-

mediated transcription via activation of the NF-κB pathway, leading to

sequestration of CBP by RelA (279).

At least fifteen putative c-Myb binding sites have been identified in the

HIV-1 LTR (80). Evidence of actual binding and functional significance of

binding has only been shown for one high affinity Myb binding site and at least

two low affinity Myb binding sites. The high affinity Myb binding site maps to

the modulatory portion of the U3 region in the HIV LTR. Fine mapping of the

57

low affinity Myb binding sites has not been performed, but there may be binding

sites in the U5, R and U3 regions.

c-Myb also binds to the MuLV SL3-3 enhancer (281,437). This enhancer

has two RUNX1 binding sites (named core I and core II), an Ets binding site and

a Myb site positioned between the core II and the Ets sites (Fig. 1.10). As

previously mentions, the Myb and the core I site mutations had far greater effects

on pathogenicity than did the core II or Ets site mutations (281).

Myb binding site mutations also greatly reduced the ability of the SL3-3

LTR enhancer to activate c-myc transcription when inserted upstream in the

opposite orientation of the major c-myc promoters (268). Ets binding site

mutations in the enhancer had a modest effect on c-myc gene expression (281).

Proviruses containing the mutations were not inserted near c-myc, but an

insufficient number of tumors were examined since SL3-3 normally integrates

near c-myc in approximately 15% of tumors (268).

In transient transfection experiments in which c-Myb was overexpressed to

determine the effect on SL3-3 LTR-mediated transcription, no change in

transcription levels was observed with or without c-Myb expression (437).

However, if RUNX1 was also overexpressed, transcription was higher than that

seen with RUNX1 overexpression alone. This dependence on RUNX1 for c-Myb-

mediated transactivation was not based on synergistic DNA binding since both

factors bind to the DNA independently (437). Thus, these factors stimulate

transcription synergistically following DNA binding. Also, when multimerized

RUNX1 binding sites were linked with a basal LTR promoter, the promoter was

58

inactive in T cells. However, if Ets and Myb binding sites were multimerized in

the presence of RUNX1 sites, enhancer activity in T cells was reconstituted (437).

Thus, RUNX1 alone is a poor transactivator alone, but instead serves to help

organize enhancer-binding proteins to potentiate higher transcription levels in T

cells.

1.4 RATIONALE FOR THIS STUDY

Thymotropic strains of MMTV have alterations in the LTRs that cause a

change in tissue tropism and pathogenicity of the virus from mammary

adenocarcinomas to thymic lymphomas. The thymotropic strain TBLV has a

deletion of NREs accompanied by the multimerization of sequences flanking this

deletion which has been proposed to form an enhancer (16). However, most

previous work has focused on negative regulation of MMTV rather than

regulation of the thymotropic strains. In this study, the multimerized sequences in

the TBLV LTR were characterized and defined as a T-cell specific enhancer

(247). The novel enhancer was mapped by mutagenesis and assays for function in

two T-cell lines. Critical binding sites were defined and some of the transcription

factors that bind to the TBLV enhancer were identified by reconstitution of the

activity in non-T cells. Also, TBLV proviral integrations in or near the c-myc

locus were characterized with respect to their enhancer structure (40).

59

2. Materials and methods

2.1 CELL LINES

Jurkat human T lymphoma cells (420) were obtained from American Type

Culture Collection (ATCC) (Manassas, VA) and were maintained in RPMI

medium (Gibco, Carlsbad, CA) supplemented with 7.5% fetal calf serum (FCS)

(Gibco), gentamicin sulfate (50 µg/ml), streptomycin (50 µg/ml) and penicillin

(100 U/ml). RL?1 murine T cells (353), A20 murine B cells (185), LBB.11

murine B cells (263) (obtained from Dr. Bridget Huber, Tufts University, Boston,

MA) and EL4b murine T cells (138) (obtained from Dr. James Allison, University

of California, Berkeley, CA) were maintained in RPMI medium supplemented

with 10% FCS, gentamicin sulfate (50 µg/ml), streptomycin (50 µg/ml), penicillin

(100 U/ml), and 5 × 10-5 M 2-mercaptoethanol. XC rat fibroblast cells (188) were

grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 5%

FCS, gentamicin sulfate (50 µg/ml), streptomycin (50 µg/ml), and penicillin

(100 U/ml). HC11 normal murine mammary epithelial cells from BALB/c mice

(18) were obtained from Dr. Jeff Rosen (Baylor College of Medicine, Houston,

TX) and passaged in RPMI medium supplemented with 10% FCS, gentamicin

sulfate (50 µg/ml), streptomycin (50 µg/ml), penicillin (100 U/ml), insulin (0.5

µg/ml), and epidermal growth factor (0.5 µg/ml). All cells were grown in a

humidified atmosphere containing 7.5% CO2 at 37ºC.

2.2 TRANSFECTIONS

Jurkat T cells were transfected using SuperFect reagent (Qiagen, Inc.,

Valencia, CA) as specified by the manufacturer. One day prior to transfection,

cells were plated at 5 x 105 cells/ml in complete medium. Cells (2.5 x 106) were

60

plated in six-well plates in a volume of 2.5 ml of complete medium on the day of

transfection. In some cases, cells were cultured in 7.5% charcoal-stripped FCS

and/or phenol red-free RPMI. Charcoal-stripped FCS was prepared by mixing 2 g

activated charcoal (Sigma, St. Louis, MO) per 100 ml FCS, followed by a 2 h

incubation with stirring at 4ºC. The mixture was then centrifuged at 4ºC for 30

min at 72,000 x g in an SW28 rotor (Beckman Coulter, Fullerton, CA) to remove

the charcoal. Plasmids pC3H-LUC or one of the substitution mutants (2 µg) and

pRL-TK (0.25 µg) were mixed with 75 µl of RPMI medium with no additives,

and then incubated with SuperFect (10 µl) for 10 min at room temperature (RT).

The solution then was added dropwise to the cells and mixed thoroughly. Cells

were harvested 48 h after transfection and analyzed for reporter gene activity.

XC cells were plated at 4 x 105 cells/well of a 6-well plate one day prior to

transfection. The wild-type or substitution mutants in the TBLV LTR-luciferase

reporter plasmids and pRL-TK were transfected using DMRIE-C transfection

reagent (Invitrogen, Carlsbad, CA). On the day of transfection, cells were washed

twice with RPMI. Luciferase reporter (5µg) and pRL-TK (0.5 µg) plasmids were

mixed with 0.5 ml DMEM. DMRIE-C (10 µl) was mixed with 0.5 ml DMEM

and incubated at RT for 30 to 45 min. The two mixtures were then combined and

incubated for 15 min at RT before addition to cells. Transfection complexes were

incubated on the cells for 6 to 9 h before addition of 1 ml complete medium.

Cells were harvested 48 h after transfection and analyzed for reporter gene

activity.

LBB.11. B cells were transfected using a Zapper electroporation unit

(University of Wisconsin electronics lab, Madison, WI). One day prior to

transfection, cells were plated at a density of 6 x 105 cells/ml in complete

medium. On the day of transfection, the cells were counted and resuspended at a

density of 2 x 107 cells/550 µl complete medium containing the appropriate DNA.

Electroporations were carried out in a 1 cm gap cuvette placed in an ice water

61

bath. The machine was set to the minimum rise time, maximum fall time,

maximum capacitance and 2000 volts. Cells were plated in 10 ml complete

medium and harvested at 24 h for analysis of reporter gene activity.

All other electroporations were performed using a BTX ECM600

electroporator (San Diego, CA). The conditions for each cell line are detailed in

Table 2.1. One day prior to transfection, Jurkat cells were plated at 5 x 105

cells/ml while RL? 1, A20 and EL4b cells were seeded at a density of 6 x 105

cells/ml. HC11 cells were passaged to achieve 85 to 90% confluence on the day

of transfection (usually 1:3). All samples were incubated at RT for 10 min before

electroporation. Samples were plated in 5 ml of the appropriate medium in 60

mm dishes after transfection. A20 cell transfections were harvested 24 h post-

transfection and analyzed for reporter gene activity. All other cells were

harvested at 48 h post-transfection.

2.3 NUCLEAR EXTRACT PREPARATION

Small scale preparation of nuclear extracts was performed according to the

method of Olnes and Kurl (300), with some modifications. Cells from a confluent

plate (approximately 107 cells) were washed twice in PBS (137 mM NaCl, 2.68

mM KCl, 8 mM dibasic sodium phosphate, 1.76 mM monobasic potassium

phosphate, pH 7.4) and resuspended in 400 µl Buffer I (10 mM HEPES, pH 7.9,

10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, 0.5 mM

phenylmethylsulfonyl fluoride [PMSF][Sigma] and 0.2 µg/ml pepstatin A

[Sigma]), transferred to an Eppendorf tube and incubated on ice for 15 min prior

to lysis with 0.6% (v/v) Nonidet P-40 detergent, diluted in Buffer I. The lysate

62

Table 2.1. Conditions for transfections using a BTX ECM600 electroporator

Cell

Line

Cell

density

Cuv.

Size a Vol. V µF Ohms

Post-

incub.b

Jurkat 2x107/ml 4 mm 400µl

medium 260 1050 720

10’

RT

RL? 1 5x107/ml 2 mm 200µl

medium 140 1900 72

10’

RT

A20 3.8x107/ml 4 mm 400µl

RPMI 280 975 72

10’

ice

EL4b 4x107/ml 2 mm 200µl

RPMI 125 2300 48

10’

RT

HC11 5x107/ml 2 mm 200µl

RPMI 140 1750 72

10’

RT

a Cuvette size: refers to gap size for cuvette.

b Post-incubation time: refers to time and temperature at which cells were incubated before plating them in medium.

63

was centrifuged at 200 x g for 5 min at RT and the nuclear pellet was washed with

400 µl Buffer I to remove residual detergent. After centrifugation, the pellet was

resuspended in 100 µl Buffer II (20 mM HEPES [pH 7.9], 0.4 M NaCl, 1 mM

EDTA, 1 mM EGTA, 10% glycerol, 1 mM DTT, 1 mM PMSF and 0.2 µg/ml

pepstatin A) using a wide-bore pipette tip. After centrifugation at 13,000 x g for

10 min at 4ºC, the nuclear extract supernatant was aliquoted and snap frozen in

liquid nitrogen prior to storage at -80ºC.

2.4 WHOLE CELL LYSATE PREPARATION

Whole cell lysates for electrophoretic mobility shift assays (EMSAs) were

prepared by pelleting tissue culture cells at 1500 rpm (450 x g) in an IEC CentraR

(Needham Heights, MA) for 5 min at 4ºC. Cells were washed once with Tris-

buffered saline (10 mM Tris-HCl [pH 7.4], 150 mM NaCl) prior to sonication on

ice in microextraction buffer (20 mM HEPES [pH 7.4], 450 mM NaCl, 0.2 mM

EDTA, 0.5 mM dithiothreitol, 25% glycerol) supplemented with 1.25 mM PMSF

and 0.2 µg/ml pepstatin A (Sigma). After sonication, the lysates were clarified by

centrifugation at 13,000 × g at 4°C, and protein concentrations were determined

using the Bio-Rad protein assay reagent as described by the manufacturer (Bio-

Rad, Hercules, CA). Alternatively, whole-cell extracts were prepared by washing

cells with Tris-buffered saline prior to disruption with glass beads (Sigma).

2.5 REPORTER GENE ANALYSIS

Assays were performed either using the Dual-Luciferase reporter assay

system (Promega, Madison, WI) that independently measures Renilla and firefly

luciferase activities, or measuring the firefly luciferase activity and quantitating

GFP-positive cells by fluorescence-activated cell sorter (FACS) analysis to

64

normalize for DNA uptake (367). Briefly, cells were rinsed once with phosphate-

buffered saline (PBS) and subsequently disrupted using passive lysis buffer

(Promega) followed by two to three freeze-thaw cycles in a dry ice-ethanol bath.

The lysates then were clarified by centrifugation at 13,000 × g for 5 min at 4°C.

Luciferase activity was determined according to the manufacturer's instructions

using a Turner TD-20e luminometer (Turner Designs, Inc., Sunnyvale, CA) after

assays for protein concentration. Samples were normalized for DNA uptake using

luciferase values obtained from the co-transfected pRL-TK or firefly luciferase

vectors, or using the percentage of GFP-positive cells.

2.6 FACS ANALYSIS

To assess the transfection efficiency in some experiments, cells were

collected prior to reporter gene analysis and centrifugation at 450 x g for 5 min at

4ºC in an IEC CentraR refrigerated centrifuge. Cells were washed once in PBS,

pH 7.4. Approximately 105 cells were centrifuged in Eppendorf tubes at 1000 x g

in a Beckman Coulter Microcentrifuge 18 centrifuge at RT for 5 min, washed

once in PBS, pH 7.4, and resuspended in 200 µl PBS, pH 7.4. Cells were then

transferred to 2052 Falcon polypropylene FACS tubes (Becton Dickenson,

Franklin Lakes, NJ) and analyzed for GFP using a FACSort flow cytometer and

CELLQuest software. Cell populations were selected based on forward and side

scatter, and the selected cell population was analyzed for GFP fluorescence.

Approximately 10,000 selected cells were analyzed for each sample and the

percentage of GFP-positive cells was used to normalize reporter gene data.

65

2.7 PREPARATION OF OLIGONUCLEOTIDE PROBES

Probes for EMSAs were prepared by annealing the appropriate

oligonucleotides and end labeling with Sequenase version 2.0 (Amersham

Pharmacia Biotech, Piscataway, NJ). Briefly, annealed complementary

oligonucleotides with 5’ GG overhangs were labeled using the following 10 µl

reaction: 5 µg double-stranded oligonucleotide, 10 mM DTT, 0.2mM dGTP, 25

or 50 µCi 32P dCTP (Perkin Elmer, Boston, MA), and 3.25 U Sequenase version

2.0 in Sequenase buffer. Reactions were incubated for 1 h at 37ºC. The reaction

was extracted once with buffered phenol:chloroform (1:1) and purified using a

Micro Bio-Spin P30 Tris chromatography column (Bio-Rad) followed by ethanol

precipitation. The probe was resuspended in T.E. (10:0.1) (10 mM Tris-HCl, pH

7.4 and 0.1 mM EDTA) and radioactive incorporation was measured using a

Beckman LS3801 scintillation counter.

2.8 EMSA

DNA binding reactions (10 to 20 µl) were performed on ice in a buffer

containing 20 mM HEPES (pH 7.9), 1 mM MgCl2, 0.1 mM EGTA, 0.4 mM

dithiothreitol, 200 mM KCl, 12 µg of salmon sperm DNA/ml, and 4 µg of

poly(dl-dC) (Amersham Pharmacia). Radiolabeled probe was added to each DNA

binding reaction (4 X 104 cpm) and incubated for 10 min on ice. Reactions were

analyzed using 4% non-denaturing polyacrylamide gels and 0.25X TBE running

buffer (22.3 mM Tris base, 22.3 mM boric acid, 0.5 mM EDTA) prior to

autoradiography of the dried gel.

66

2.8.1 Antibody supershift or ablation

Supershift experiments were performed with rabbit antiserum against the

RUNX1 peptide Arg- lle-Pro-Val-Asp-Ala-Ser-Thr-Ser-Arg-Arg-Phe-Thr-Pro-

Pro-Ser as described previously (248). To verify the specificity of supershift

experiments, the peptide used for antisera preparation (4 µg) was pre-incubated

with antibody before addition to EMSAs.

2.8.2 Oligonucleotide or DNA competition assays

To assess the specificity of radiolabeled probe-protein complexes formed

in EMSAs, either unlabeled oligonucleotides or PCR products were used in the

DNA binding reactions. To perform competition, a molar excess of the DNA was

added to the DNA binding reaction prior to the addition of the radiolabeled probe

and then incubated on ice for 10 min. The EMSA then proceeded as described

above.

2.9 PLASMIDS

Plasmid pRL-TK (Promega) contains the HSV TK promoter upstream of

the sea pansy (Renilla reniformis) luciferase gene. The vectors pGEMT-Easy

(Promega) and pBluescript II SK(-) (Stratagene) were obtained commercially. A

number of expression vectors were generously provided by colleagues and are

listed in Table 2.1.

67

Table 2.2. Plasmids provided by colleagues for studies of TBLV enhancer

Plasmid Protein

expressed Donor Location

pLDCMV-

NFATc NFATc

Dr. Nancy

Rice

National Cancer Institute (NCI),

Frederick, MD

pCMV-NFATp NFATp “ “

pCMV399 NF-κB1 “ “

pCMVp52 NF-κB2 “ “

pRC/CMV-hc-Rel c-Rel “ “

pcRelB RelB “ “

pCMV65IN RelA “ “

pCMV5-AML1B AML-1B

(RUNX1)

Dr. Shari

Meyers

Louisiana State University

Medical Center, Shreveport, LA

pCMV5-AML3 AML3

(RUNX2) “ “

pCDNA3.1-

FLMyb c-Myb

Dr. Linda

Wolff NCI

pMEIκB67J Dominant

negative Iκ-Bα

Dr. Nancy

Colburn NCI

pCMV-ALY ALY Dr. Rudolph

Grosschedl University of Munich, Germany

68

The plasmid pC3H-LUC previously described as pLC-LUC (37), was

modified by the destruction of the SstI site in the polylinker; this construct

contains the MMTV C3H LTR upstream of the firefly luciferase gene. Plasmid

pTBLV-LUC was engineered by replacement of the ca. 760-bp ClaI-to-SstI

fragment of the C3H MMTV LTR in pC3H-LUC with the ca. 440-bp ClaI-to-SstI

fragment of the TBLV LTR; this region of the TBLV LTR includes the triplicated

enhancer sequence as well as the 443-bp deletion of the NREs (16) (figure 1.7).

The pC3H∆NRE-LUC vector was created by digestion of pC3H-LUC with AflII,

filling the ends, digestion with StuI, and religation. The vector pC3H3R∆NRE-

LUC was made by substitution of a ca. 240-bp StuI-to-SstI fragment from the

TBLV LTR (generated by PCR using a 5' primer with a Stul site) for the ca. 531-

bp StuI-to-SstI fragment of the C3H MMTV LTR. Plasmid pC3H3R-LUC was

engineered by insertion of the StuI-to-SstI fragment of pC3H3∆RNRE-LUC into

the StuI site of the pC3H-LUC vector. The vector pTBLV-4R-LUC was prepared

by PCR amplification of a TBLV LTR containing four copies of the enhancer

element from T16 tumor DNA. The PCR product was digested with ClaI and SstI

and substituted for the corresponding region in pLC-LUC.

The pd6 parental vector for substitution mutations was prepared using a

recombinant PCR strategy (158). Using pLC-LUC as a template, two separate

PCRs were performed, one using LTR 329+ (5' CCG CAT CGA TTT TGT CCT

TCA 3') and LTR 523- (5' CGT TTT AGG CCT TTG AGG TTG AGC GTC

TCT TTC T 3') and the other using LTR 1024+ (5' CCT CAA AGG CCT AAA

ACG AGG ATG TGA GAC AAG T 3') and LTR1068- (5' CTC AGA GCT CAG

ATC AGA ACC TTT GAT 3'). (The added StuI site is shown in bold.) The

products were purified by polyacrylamide gel electrophoresis, and equimolar

amounts of the two PCRs were combined. Using LTR 329+ and LTR 1068-, the

final product was amplified, resulting in the deletion of the LTR sequence from

positions 523 to 1024 and the creation of a StuI site. Plasmid pC3H-LUC was

69

partially digested with ClaI and completely digested with SstI, and the ClaI-to-

SstI fragment from the C3H LTR was removed by gel purification using Prep-A-

Gene matrix (Bio-Rad). The TBLV PCR product also was digested with ClaI and

SstI and ligated into the digested vector to generate pd6. This clone was verified

by sequencing. The wild-type 62-bp enhancer element was cloned into the vector

pGEM-TEasy (Promega), and the resulting plasmid (pGEM-62) was used to

generate single copies of the substitution mutants by a modification of the

QuikChangeTM site-directed mutagenesis method described by Stratagene.

Briefly, the plasmid vector was mixed with complementary primers containing 6-

to 8-bp mutations (including a BglII site) in the enhancer element; each mutation

was flanked by 16 to 22 bp of the pGEM-62 sequence. After PCR using PfuTurbo

(Stratagene), a mutant enhancer plasmid with staggered nicks was generated and

the reaction was digested with DpnI, thus cleaving the methylated parental wild-

type DNA. The undigested mutant plasmids then were recovered by

transformation of Escherichia coli DH5α and screened for the presence of an

appropriate BglII site. The mutations were verified by sequencing and then

amplified by PCR using primers that had been treated with T4 polynucleotide

kinase. The PCR products then were concatemerized, and the triplicated product

was purified and cloned into the pd6 vector that had been linearized with StuI.

Clones containing the triplication in the correct orientation were verified by

sequencing.

The pRL-TK vectors containing the TBLV triplication in various locations

were cloned by digestion with either BamHI, BglII, or HindIII to linearize the

plasmid. Following digestion, blunt ends were generated by treatment of the

linear vectors with Klenow enzyme (New England Biolabs, Beverly, MA), and 5'

phosphates were removed using calf intestinal phosphatase (Roche Molecular

Biochemicals, Mannheim, Germany). The triplicated enhancer region of the

TBLV LTR was amplified by PCR using a positive-strand primer (5' AAT AGA

70

AAG AGA CTC TCA ACC TC 3'), a negative-strand primer (5' AAC CAC TTG

TCT CAC ATC CTC G 3'), and pTBLV-LUC as the template. The PCR products

were treated with T4 polynucleotide kinase prior to ligation with the vector.

Individual clones were verified by sequencing.

The vector containing the Renilla luciferase gene, pc-mycRluc, and

derivatives containing the TBLV LTR or Moloney MuLV LTR that were inserted

upstream or downstream of c-myc were constructed in several steps. The plasmid

pc-mycRluc includes c-myc exon 1, intron 1, bp 1 to 15 of exon 2, bp 61 to 897 of

exon 3, and upstream and downstream flanking regions. The Renilla luciferase

gene was inserted at the c-myc start codon and replaced all but 15 bp of exon 2

and intron 2. All PCR primers used to construct pc-mycRluc have restriction

endonuclease sites (underlined) that were engineered in the 5’ end for cloning

purposes. The Renilla luciferase gene [including the stop codon and simian virus

40 polyadenylation (SV40 polyA) signal] from pRL-TK was amplified using the

sense primer (5’ GTC GAC ATG ACT TCG AAA GTT TAT GAT CC 3’) and

the antisense primer (5’ AGA TCT TAC CAC ATT TGT AGA GG 3’) and

cloned into the pGEMT-Easy vector. Plasmid DNA from a clone containing the

PCR product was digested with SalI and BglII, and the ~1.2-kb fragment was

purified by agarose gel electrophoresis prior to ligation. Most of c-myc exon 3 (bp

61 to 897) and 4.7 kb of the downstream flanking region were amplified from

BALB/c genomic DNA using the sense primer (5’ AGA TCT CTG CCA AGA

GGT CGG AGT CGG 3’) and the antisense primer (5’ GAA TTC GCT TCT

ACT CAA CCC TTA CTC 3’) and cloned into the pGEMT-Easy vector as

described above. Plasmid DNA from a clone containing the PCR product was

digested with BglII and EcoRI, and the ca. 5.5-kb fragment was purified by

agarose gel electrophoresis. The 1.2-kb Rluc/poly(A) fragment, the 5.5-kb

fragment containing c-myc exon 3 and downstream region, and linearized

pBluescript II SK(-) vector (digested with SalI and EcoRI and treated with CIP)

71

were ligated into a 9.7-kb intermediate construct, pPB. Subsequently, ca. 5.1 kb

of DNA was amplified from BALB/c genomic DNA using the sense primer (5’

GGT ACC CGT GAC CTG ATC TCT AGC TTC TCC 3’) and the antisense

primer (5’ GTC GAC CGT CGT GGC TGT CTG CTG GAG GG 3’) and cloned

into pGEMT-Easy vector as described above. This PCR fragment includes 2.9 kb

upstream of c-myc, exon 1, intron 1, and 15 bp of exon 2. Plasmid DNA from a

clone containing the PCR product was digested with KpnI and SalI, and the ca.

5.1-kb fragment was purified by agarose gel electrophoresis. The intermediate

construct, pPB, was linearized by partial digestion with KpnI and complete

digestion with SalI, treated with CIP, and ligated to the 5.1-kb fragment to make

the parental vector, pc-mycRluc. Plasmid constructs were verified by restriction

fragment analysis and direct sequencing. The pc-mycRluc vector was modified by

digestion with an enzyme that cuts only in the 3’ flanking region (AatII and StuI)

or by linearization with an enzyme that cuts once in both the 5’ and 3’ flanking

regions (KpnI and AfeI). In addition, a unique NcoI site was generated ca. 1.5 kb

upstream of c-myc exon 1 by site-directed mutagenesis as described previously

(247) using the sense primer (5’ AAT AAA TCT AGA ACC ATG GCA CAG

AGC AAA AGA C 3’) and the antisense primer (5’ GTC TTT TGC TCT GTG

CCA TGG TTC TAG ATT TAT T 3’). Linear pc-mycRluc was dephosphorylated

and ligated to the 1.2-kb HindIII fragment of pTBLV-LUC (247), the 1.26-kb

HindIII fragment from pTBLV4R-LUC, the 1.2-kb HindIII fragment from

pTBLV-WT-LUC, or the 700 bp HindIII fragment containing the Moloney

MuLV LTR from pLX3. The Klenow fragment of DNA polymerase or T4 DNA

polymerase was used to generate blunt ends after digestion with enzymes that left

overhanging 5’ or 3’ ends. Clones containing the LTR HindIII cassettes in both

forward and reverse orientations were isolated and verified by restriction enzyme

analysis and sequencing.

72

2.10 PREPARATION OF PLASMID DNA

2.10.1 Small scale plasmid preparations

Mini-preparations of plasmid DNA from bacteria were obtained

essentially as described by Sambrook et a. (346). Cultures from bacterial colonies

were grown overnight in 2 ml of LB supplemented with the appropriate antibiotic.

The culture was transferred to an Eppendorf tube and centrifuged to pellet

bacteria. The pellet was resuspended thoroughly in 250 µl Solution I (50 mM

Tris-HCl [pH 8], 10 mM EDTA [pH 8], 50 mM glucose). Cells were then lysed

by addition of 250 µl Solution II (1% SDS, 0.2 M NaOH). After complete lysis,

350 µl Solution III (3 M potassium acetate, 2 M acetic acid) was added and mixed

thoroughly. Precipitated material was pelleted by centrifugation at 13,000 x g for

10 min in a microcentrifuge at RT. The supernatant was then transferred to a new

Eppendorf tube and 600 µl isopropanol was added to precipitate the DNA. After

mixing the solution, DNA was pelleted by centrifugation at 13,000 x g for 10 min

in a microcentrifuge at RT. The pellet was washed once with 1 ml 70% ethanol

and centrifuged for 5 min at 13,000 x g in a microcentrifuge at RT. The pellet

was then allowed to air dry for 5 min before suspension in 30 µl T.E. (10:0.1)

supplemented with 50 µg/ml RNAse A.

2.10.2 Large scale plasmid preparations

Large scale preparations of plasmid DNA was obtained using alkaline

lysis and cesium chloride gradient centrifugation. Cultures were prepared in one

of two ways. For plasmids that required chloramphenicol treatment, 25 ml of LB

supplemented with the appropriate antibiotic was inoculated with either a single

colony of the bacteria or a stab of a glycerol stock containing the plasmid of

73

interest and incubated with shaking overnight at 37ºC. Subsequently, 20 ml of the

overnight culture was added into 500 ml LB supplemented with the appropriate

antibiotic and grown until the A600 was 1 to 1.2. Chloramphenicol (dissolved in

100% ethanol) was added to the culture to a final concentration of 0.17 mg/ml and

incubated overnight with shaking at 37ºC. Alternatively, for cultures that did not

require chloramphenicol treatment, 500 ml LB supplemented with the appropriate

antibiotic was inoculated with either a single colony, a stab of a glycerol stock or

2 ml of an 8 h culture and incubated overnight at 37ºC with shaking. The culture

was pelleted by centrifugation at 6000 x g in a JA10 rotor (Beckman) for 10 min

at 4ºC. The pellet was resuspended in 8 ml cold Solution I containing 2 mg/ml

lysozyme. The bacterial cells were lysed by addition of 16 ml freshly-made

Solution II, followed by thorough mixing and inversion. After 10 min incubation

at RT, 12 ml of Solution III was added. After thorough mixing, precipitation was

allowed to reach completion by incubation on ice for 10 min. The precipitated

materials were pelleted by centrifugation for 30 min at 4ºC at 2850 x g (3800

rpm) in an IEC CentraR centrifuge. The resulting supernatant was transferred to a

new 50 ml conical tube, adjusted to 50 ml total volume with isopropanol and

mixed by inversion. The precipitation was allowed to proceed at RT for 15 min

before centrifugation for 30 min at 2850 x g in an IEC CentraR at 4ºC. The pellet

was resuspended in 3.5 ml T.E.(10:10) (10 mM Tris-HCl [pH 7.4] and 10 mM

EDTA), followed by the addition of 4.8 g CsCl. Ethidium bromide (5 mg/ml)

was added to the resulting solution (680 µl) and insoluble materials were pelleted

by centrifugation at 2850 x g for 10 min at RT. The supernatant was added to

Beckman OptisealTM ultracentrifuge tubes, and subjected to centrifugation at

50,000 rpm (250,000 x g) in an NVT65.2 ult racentrifuge rotor for 16-18 h at 20ºC

in an L7-65 Beckman ultracentrifuge. Plasmid bands were removed from the

gradient with an 18 gauge needle and ethidium bromide was extracted from the

solution with N-butanol saturated with G-50 buffer (10 mM Tris-HCl [pH 7.4],

74

0.1 M NaCl and 2 mM EDTA). Plasmid was then ethanol precipitated and

resuspended in 2 ml T.E. (10:10). Any RNA present in the DNA solution was

removed by treatment for 30 min at 37ºC with 100 ug/ml RNAse A and 100 U/ml

RNAse T1. The solution was then treated for 30 min at 37ºC with 100 µg/ml

proteinase K and 0.5% SDS. Extraction with phenol:chloroform (1:1) removed

any protein contamination and the solution was then dialyzed against 1000

volumes T.E.(10:1) (10 mM Tris-HCl [pH 7.4] and 1 mM EDTA) with 2 changes

of the buffer. Dialyzed DNA was ethanol precipitated, washed with 70% ethanol

and resuspended in T.E. (10:0.1). Quantitation of the DNA was assessed by UV

spectrophotometric analysis at an absorbance of 260 nm.

2.11 PCR ANALYSIS OF TUMOR DNA

The Expand Long-Template PCR System (Roche Molecular

Biochemicals) was used to detect TBLV integrations. Amplification conditions

for TBLV insertion sites within and flanking the c-myc gene included incubation

at 94°C, followed by 30 cycles of PCR, with one cycle consisting of 20 s at 94°C,

30 s at 57.5°C, and 4 min at 68°C. The reaction mixture was then incubated at

68°C for 8 min. Semi-quantitative PCR analysis was performed as described

above, except serial threefold dilutions of tumor DNA were used as indicated in

figure legends. DNA concentrations were determined by absorbance readings at

260 nm and were confirmed by Hoechst staining and fluorimetry. Semi-nested

PCR products were obtained in two steps. First, PCR was performed as described

above using a c-myc-specific primer and a primer specific for the TBLV LTR.

The products were purified using a Qiaquick nucleotide removal kit (Qiagen),

diluted, and then used in a second PCR with TBLV-specific LTR primers that

flank the enhancer repeat region.

75

2.12 PURIFICATION OF ALY FROM JURKAT T CELLS

Whole cell lysates were prepared from large-scale cultures of Jurkat T

cells (4 to 6 liters) grown in spinner flasks. All purification steps were carried out

at 4ºC, except as noted. Cells were pelleted by centrifugation at 450 x g in a JA10

rotor using a Beckman Avanti JE centrifuge for 15 min. Cells were washed once

with PBS, pH 7.4, and centrifuged again for 15 min. Lysates were prepared as

described above using sonication and centrifuged at 39,000 x g in a JA20 rotor for

30 min to pellet cell debris. The resulting supernatant was then loaded onto a 1.5

cm X 50 cm BIO-RAD glass column containing Sephacryl S200-HR resin that

had been previously equilibrated with TM + 0.1M KCl buffer (50 mM Tris-HCl,

[pH 7.9], 100 mM KCl, 12.5 mM MgCl2, 1 mM EDTA, 10% glycerol) containing

2 mM DTT, 0.1 mM PMSF and 0.4 ug/ml pepstatin A. After the sample had

entered the column, the resin was washed with the TM + 0.1 M KCl buffer and 1

ml fractions were collected after the void volume had been eluted. Samples were

analyzed for DNA binding proteins using a TBLV enhancer probe (556WT26)

and EMSA as described above. Samples containing NF-A and NF-B binding

activity were pooled and heat-treated. For NF-A-containing samples, the pooled

fractions were treated at 40ºC for 10 min. For NF-B-containing samples, the

pooled fractions were treated at 45ºC for 10 min. After heat-treatment,

precipitated proteins were pelleted by centrifugation at 13,000 x g for 10 min.

Heat-treated samples were then loaded onto a double-stranded DNA-cellulose

column that had been equilibrated with N100 buffer (0.1 M NaCl, 5 mM MgCl2,

0.1 mM EDTA, 20 mM HEPES [pH 7.9], 0.05% Brij-35, 20% glycerol, 1 mM

DTT, 0.5 mM PMSF, 0.2 ug/ml pepstatin A). After the sample had entered the

resin, the column was washed with N100 buffer until flow-through fractions

absorbance (A280) readings returned to background levels. Bound proteins were

eluted by E250 buffer (20 mM HEPES [pH 7.9], 250 mM ammonium sulfate, 5

76

mM MgCl2, 0.1 mM EDTA, 0.05% Brij-35, 20% glycerol, 1 mM DTT, 0.5 mM

PMSF and 0.2 ug/ml pepstatin A) and 1 ml fractions were collected until A280

readings again reached background levels. Protein-containing fractions were

analysed for NF-A and NF-B binding activity by EMSA. Those fractions

containing NF-A or NF-B activity were pooled and these proteins were affinity

purified using magnetic beads conjugated to a 556WT oligonucleotide

concatamer. Bound proteins were washed extensively with EMSA binding buffer

containing poly (dAdT) as a non-specific competitor. Proteins were eluted with

EMSA binding buffer containing 2M NaCl and dialyzed against EMSA binding

buffer prior to SDS-PAGE. Eluted protein bands were then analyzed by MALDI-

MS and MS/MS by Dr. Ryuji Kobayashi (M.D. Anderson Cancer Center,

Houston, TX).

2.13 SDS-PAGE AND STAINING

Proteins were resolved by sodium dodecyl sulfate-polyacrylamide gel

electrophoresis (SDS-PAGE) as described by Sambrook et al. (346). Gels were

then stained by either Coomassie Brilliant Blue or silver nitrate solution. For

Coomassie staining, gels were incubated in fixing solution (50% (v/v) methanol,

10% (v/v) acetic acid, 40% (v/v) water) for two h with agitation at RT. After

fixation, gels were stained with Coomassie staining solution (50% (v/v) methanol,

0.05% (v/v) Coomassie brilliant blue R-250, 10% (v/v) acetic acid, 40% (v/v)

water) for 1 h. Gels were then incubated in destaining solution (5% (v/v)

methanol, 7% (v/v) acetic acid, 88% (v/v) water) with changes of the solution

until the minimal background was achieved. Gels were silver stained using Bio-

Rad Silver Stain Plus kit (Bio-Rad) as described by the manufacturer. Gels were

scanned or photographed and dried using a gel dryer at 55ºC for 2-3 h on

Whatman filter paper.

77

2.14 WESTERN BLOT ANALYSIS

After resolution by SDS-PAGE, proteins were transferred to nitrocellulose

(NC) membranes (Schleicher & Schuell, Keene, N.H.) in Western transfer buffer

(39 mM glycine, 48 mM Tris base, 1% SDS, 20% (v/v) methanol) overnight at

150 mA at 4ºC. NC membranes were then blocked by incubation for 1 h at RT

with shaking in TBST (20 mM Tris [pH 7.6], 137 mM NaCl, 0.1% Tween 20)

containing 5% nonfat milk. Primary antibody was then diluted in TBST

containing 1% nonfat milk and the NC membrane was then incubated in primary

antibody for 1 h with shaking at RT. Blots were washed three times for 10 min

each in TBST. Horseradish peroxidase (HRP)-conjugated secondary antibody

was diluted in TBST containing 1% nonfat milk and added to the blot. After a 30

to 60 min incubation at RT with shaking in secondary antibody, the blot was once

again washed three times for 10 min each in TBST. Antibody binding was

detected by Western Lightning enhanced chemiluminescent (ECL) reagent

(Perkin Elmer) as described by the manufacturer.

2.15 UV DNA-PROTEIN CROSSLINKING

To determine the sizes of proteins that bound the 556WT probe, DNA

binding reactions were performed as described previously, but were crosslinked

for 30 to 60 min at 120 mJ/cm2 on ice in a Fisher Scientific UV crosslinker

(Pittsburgh, PA). After crosslinking, samples were resolved on a 10% SDS-

PAGE gel prior to drying and exposure to X-ray film.

78

3. Results

3.1 IDENTIFICATION OF A T-CELL-SPECIFIC ENHANCER IN THE TBLV LTR

3.1.1 Unique cis-acting elements in the TBLV LTR confer T-cell-specific transcriptional activity

Previous experiments using TBLV LTR reporter genes in transgenic mice

suggested that TBLV has a unique transcriptional control region that is

preferentially active in CD4+ CD8+ T cells (307). Examination of the TBLV LTR

sequence shows that there is a deletion of 443 bp of the U3 region and triplication

of 62 bp flanking the deletion relative to the MMTV LTR (Fig. 1.7) (16). Our lab

has previously reported the presence of several NREs within the MMTV LTR that

inhibit transcription in lymphoid tissues (37,163). Therefore, the contributions of

the NREs and the triplication to TBLV-mediated transcription were determined.

The transcriptional activity of the wild-type C3H MMTV LTR (pC3H-LUC) was

compared with that of an LTR containing an NRE deletion between the StuI and

AflII sites (pC3H∆NRE-LUC), an LTR with an insertion of the triplicated region

from TBLV into the StuI site (pC3H3R-LUC), or a C3H LTR containing either a

substitution of the TBLV LTR region between the ClaI and SstI sites (pTBLV-

LUC) or between the StuI and SstI sites (pC3H3R∆NRE-LUC) (Fig. 3.1).

Transient transfections of these constructs into Jurkat T cells showed that

elimination of the NREs between the C3H MMTV StuI and AflII sites

(pC3H∆NRE-LUC) elevated reporter gene expression threefold compared to

pC3H-LUC (Fig. 3.2A). Inclusion of the TBLV triplication in the NRE-minus

LTR (either pTBLV-LUC or pC3H3R∆NRE-LUC) increased expression

approximately 700- to 800-fold over that observed with pC3H-LUC, whereas the

79

Fig. 3.1. Reporter gene constructs used in transient transfection assays.

The positions of relevant restriction enzyme sites within the U3 region that were used for cloning are shown. The pC3H∆NRE-LUC construct was prepared by removing the StuI-to-AflII fragment from the C3H-LUC vector. The pC3H3R-LUC vector was prepared by insertion of the StuI-to-SstI fragment from TBLV LTR into the StuI site of pC3H-LUC. The construct pTBLV-LUC was prepared by substituting the ClaI-to-SstI fragment of TBLV for the ClaI-to-SstI fragment of pC3H-LUC. The construct pC3H3R∆NRE-LUC was made by substitution of a StuI-to-SstI fragment from the TBLV LTR for the StuI-to-SstI fragment of pC3H-LUC.

Rluciferase

U5

ClaI

U3

pC3H3R-LUC

AflII SstI

U3

pC3H∆NRE-LUCluciferaseluciferaseU5R

U3 RU5

pC3H-LUC

U3

SstIClaI

pTBLV-LUC or

pC3H3R∆NRE-LUC

luciferaseluciferase

StuI AflII

ClaI SstI

luciferaseluciferase

ClaI SstI

RU5

NREs

NREs

80

triplication alone (pC3H3R-LUC) elevated expression approximately 250-fold

above the activity of the C3H MMTV LTR. These assays revealed that the

combined effects of the deletion and triplication were sufficient to account for the

differences in the transcriptional activities of the MMTV and TBLV LTRs in

Jurkat cells.

Transient transfections with MMTV and TBLV LTR constructs also were

performed in RL? 1 T cells and other cell types. Results for RL? 1 cells (CD4+

CD8+) were similar to those obtained with Jurkat cells except that the basal

activity of the MMTV promoter was not detectable in RL?1 cells (probably due

to lower transfection efficiencies) (Fig. 3.2B). In contrast to results obtained with

T-cell lines, there was little difference in the transcriptional activity of the C3H

MMTV LTR relative to the TBLV LTR in HC11 mouse mammary cells, XC rat

fibroblasts, or LBB.11 mouse B cells (Table 3.1). Together, these experiments

showed that loss of the NREs and acquisition of the triplicated region allowed

higher transcriptional activity of the MMTV LTR in T cells but not other cell

types, including B cells.

81

Table 3.1. Activities of MMTV and TBLV-LTR reporter gene constructs in non-T-cell lines

Cell Line LTR Promoter Relative luciferase

activitya

C3H MMTV 1.0 ±0.1 HC11 mammary epithelial cells

TBLV 0.5±.01

C3H MMTV 1.0±0.2 XC rat fibroblast cells

TBLV 1.0±0.1

C3H MMTV 1.0±0.1 LBB.11 B cells

TBLV 1.8±0.3

a Luciferase activity in light units/100 µg of protein extract was determined. Values for

pTBLV-LUC then were calculated relative to a value of 1.0 for pC3H-LUC.

82

Fig. 3.2. Transcriptional activity of various TBLV LTRs in T cell lines.

(A) Activities of reporter gene constructs in Jurkat cells. LUC activity is given in light units/100 µg of protein normalized for DNA uptake as measured by cotransfection with the pRL-TK plasmid. LUC activity is reported relative to that of pC3H-LUC, assigned a value of 1; standard deviations from the means of triplicate assays are shown. (B) Activities of reporter gene constructs in RL? 1 cells. Luciferase activity is reported relative to pC3H∆NRE-LUC (assigned a value of 1) since the activity of pC3H-LUC was not detected in these assays.

0

200

400

600

800

1000R

elat

ive

LU

C v

alu

e

pC3H-LUC pC3H∆NRE-LUC

pC3H3R-LUC

pC3H3R∆NRE-LUC

pTBLV-LUC


pC3H3R-LUC

pC3H3R∆NRE-LUC

pTBLV-LUC

1 3

256

779 675

A


pC3H3R-LUC

pC3H3R∆NRE-LUC

pTBLV-LUC

0

50

100

150

Rel

ativ

e LU

C v

alue

LTR-Reporter Constructs

0 120

66

82

B

0

200

400

600

800

1000R

elat

ive

LU

C v

alu

e


pC3H3R-LUC

pC3H3R∆NRE-LUC

pTBLV-LUC


pC3H3R-LUC

pC3H3R∆NRE-LUC

pTBLV-LUC

1 3

256

779 675

A


pC3H3R-LUC

pC3H3R∆NRE-LUC

pTBLV-LUC

0

50

100

150

Rel

ativ

e LU

C v

alue


0 120

66

82

B

83

3.1.2 Determination of the TBLV triplication as a T-cell specific enhancer

Because the TBLV triplication is reminiscent of other retroviral enhancer

regions that have been shown to be important for viral disease specificity

(56,86,213,339), the TBLV LTR triplication was tested to determine if it could act

as an enhancer on a heterologous promoter. To do this, the entire triplicated

region (three copies of the 62 bp element) was amplified using PCR and inserted

in both orientations at three positions, one upstream and two downstream, relative

to the HSV TK promoter in the pRL-TK reporter gene plasmid (Fig. 3.3). The

resulting constructs then were used in transient transfections of Jurkat T cells.

Insertions of the TBLV LTR triplication upstream or downstream of the promoter

showed 9- to 89-fold elevation of Renilla luciferase expression from the TK

promoter and expression was relatively orientation independent (Fig. 3.4A). The

highest level of expression was observed when the triplication was downstream of

the reporter gene in the sense orientation. These results were consistent with the

ability of the TBLV LTR triplication to act as a transcriptional enhancer

(20,116,201,267).

To determine if the LTR enhancer activity was cell type dependent, the

pRL-TK plasmids containing the TBLV triplication were used for transient

transfections in a second T-cell line, RL? 1. Such experiments showed

orientation- independent enhancement of TK promoter activity (Fig. 3.4B). The

same constructs were also used in transient transfection assays in XC rat

fibroblast cells (Fig. 3.5). In these experiments, the TBLV triplication did not

enhance transcription from the TK promoter; instead, the presence of the

triplication inhibited (up to five-fold) transcriptional activity of the promoter.

Similarly, no enhancement was observed when transient transfections were

performed with HC11 mammary cells (data not shown). Together with previous

84

results, these experiments suggest that the TBLV enhancer is active only in

specific cell types, particularly T cells.

Fig. 3.3. Structures of plasmids containing the TBLV triplication in the pRL-TK vector.

The transcriptional orientations of the Renilla luciferase (R-LUC) and ampicillin resistance (Ampr) genes are shown by arrows above the plasmid construct. The TBLV triplication was inserted in three positions within the TK promoter- luciferase vector at the BglII, HindIII, and BamHI sites. The forward (F) and reverse (R) orientations of the triplication inserts are shown by arrows below the plasmid construct.

BglII HindIII BamHI

HSV-TK promoter R-LUCSV40 Late

PolyA Ampr

FR

FR

FR

85

Fig. 3.4. Activity of the TBLV LTR triplication on a heterologous TK promoter in T cells.

(A) Transient transfections in Jurkat human T cells with plasmids diagrammed in Fig. 3.3. (B) Transient transfections in RL? 1 mouse T cells. Standard deviations from the means of triplicate assays are shown. Luciferase activity is reported as described in the legend to Fig. 3.2 except that values are relative to that for the pRL-TK plasmid without the TBLV enhancer (assigned a value of 1). DNA uptake was normalized using the activity of the co-transfected pTBLV-LUC plasmid.

020406080

100120

TK Bam-F Bam-R Bgl-F Bgl-R Hind-F Hind-R

Rel

ativ

e R

-LU

C v

alu

e

020406080

100120140160180

TK Bam-F Bam-R Bgl-F Bgl-R Hind-F Hind-R

Construct

Rel

ativ

e R

-LU

C v

alu

eA

B

86

Fig. 3.5. Activity of the TBLV LTR triplication on a heterologous promoter in XC rat fibroblast cells.

Renilla luciferase activity is reported as described in Fig. 3.4.

3.1.3 Determination of optimal numbers of 62 bp elements for enhancer activity in T cells

To determine how many 62 bp enhancer elements gave the optimal

transcriptional activity in the context of the TBLV LTR, a series of luciferase

reporter plasmids were constructed in the pd6 vector. This vector, based on the

structure of the TBLV LTR, has an NRE deletion accompanied by deletion of the

flanking sequences that generate the enhancer elements. In addition, a StuI site

was substituted for the deleted sequences. Reporter plasmids were constructed

StuI digestion of pd6 followed by ligation to 1 to 4 copies of the wild-type 62 bp

TBLV enhancer element. Constructs with the correct number of repeats in the

forward orientation were verified by DNA sequencing. These plasmids were then

00.20.40.60.8

11.2

TK Bam-F Bam-R Bgl-RBgl-F Hind-F Hind-R

Construct

Rel

ativ

e R

-LU

C v

alue

87

transiently transfected into Jurkat human T cells and analyzed for reporter gene

activity. The optimal number of TBLV enhancer elements in CD4+ Jurkat cells

was determined to be three (Fig. 3.6A). Since TBLV induces tumors in immature

thymocytes (307), these constructs were also tested in the RL? 1 CD4+ CD8+ cell

line (Fig. 3.6B). Results showed that two- and three-repeat enhancers gave

greater expression than those with one or four repeats. Therefore, these

experiments indicated that the TBLV enhancers with four repeats of the 62 bp

element were less effective in promoting TBLV transcription in mature or

immature transformed T cells than enhancers with two or three copies of this

sequence.

3.2 CHARACTERIZATION OF TBLV ENHANCER-BINDING FACTORS

3.2.1 Mutagenesis of the TBLV enhancer

3.2.1.1 Deletion mutations

To analyze the contribution of specific enhancer sequences, deletions of

the 62 bp element were constructed. One construct lacks the first 15 bp of the

repeat element (pTBLV47-LUC), which is derived from the 5’ flanking sequence,

and another construct lacks a potential RUNX1 binding site in addition to the first

15 bp (pTBLV47∆RUNX-LUC). These mutant repeat elements were triplicated

and inserted into the StuI site in the reconstituted TBLV LTR (pd6). Transient

transfection analyses were performed in Jurkat T cells and analyzed for reporter

gene expression levels. The pTBLV47-LUC construct only had 4% of the

reporter gene expression of wild-type pTBLV-LUC (Fig. 3.7). The larger

88

0

50

100

150

200

250

300

350

pC3H-LUC

0R 1R 2R 3R 4R


0

1

2

3

4

1R 2R 3R 4R


Rel

ativ

e LU

C V

alue

A B

Rel

ativ

e L

UC

Val

ue

Fig. 3.6. Enhancer activity of TBLV LTRs with different numbers of enhancer repeats.

(A)Transient transfection assays with luciferase reporter plasmids containing TBLV LTRs with different numbers of enhancer repeats (from zero [0R] to four [4R]) in Jurkat T cells. (B) Transient transfection assays with luciferase reporter plasmids containing TBLV LTRs with different numbers of enhancer repeats in RL? 1 T cells. Relative luciferase activity was determined after normalization for DNA uptake by cotransfection with the pRL-TK plasmid. Luciferase activity was determined in Jurkat cells relative to the activity of the C3H LTR-luciferase reporter plasmid that contains the NREs (pC3H-LUC). For transfections of RL? 1 cells, luciferase activity was determined relative to the activity of the pTBLV-1R-LUC plasmid, since pC3H-LUC activity was undetectable in these cells. The C3H LTR-luciferase reporter was engineered to delete the NREs including the sequences that constitute the 62-bp repeat (pd6 or 0R) or retain one, two, three, or four copies of the repeat (1R, 2R, 3R, and 4R, respectively). There was no difference between the values obtained for the engineered pTBLV-3R-luciferase plasmid and a reporter plasmid containing the naturally occurring alteration from the TBLV LTR (pTBLV-LUC) (data not shown). The means of triplicate assays (± standard deviations) are shown.

89

Fig. 3.7. Activity of 5’ deletion enhancer mutants in transient transfection assays of Jurkat T cells.

The sequences of the elements contained in the constructs tested are shown above. Luciferase activity was determined as described in the legend to Fig. 3.2. Means of triplicate assays with standard deviations are shown.

WT: cagttgaagaacaggtgcggttcccaaggcttaagtaagtttatggttacaaactgttcttaTBLV47: tgcggttcccaaggcttaagtaagtttatggttacaaactgttctta

TBLV47dRUNX1: tcccaaggcttaagtaagtttatggttacaaactgttctta

RUNX1

0200400600800

10001200

pC3H-LUC pTBLV-LUC pTBLV47-LUC

pTBLV47-dRUNX1

-LUC

DNA transfected

Rel

ativ

e LU

C v

alue

90

deletion in pTBLV47∆RUNX1-LUC, further reduced expression, with only 1.2%

of wild-type levels. This suggests that the joining of the two flanking DNA

sequences juxtaposes binding sites for transcription factors that are able to

cooperate and form an enhancer. However, it is also possible that these deletions

resulted in a change in the spacing or architecture of the LTR that artificially

changed reporter gene levels.

3.2.1.2 Substitution mutations

To determine the specific sequences required for T-cell enhancer activity,

a reporter gene construct was prepared that replicated the TBLV LTR changes in

the context of the C3H MMTV LTR. A 62-bp enhancer monomer from the TBLV

LTR was synthesized, triplicated, and inserted into the StuI site of the pd6 vector

to generate pTBLV-WT-LUC. Transient transfections comparing the

transcriptional activities of pTBLV-WT-LUC and pTBLV-LUC revealed no

significant differences (Fig. 3.43). Subsequently, 6- to 8-bp substitution mutations

containing a BglII site were introduced by site-directed mutagenesis across the

length of the enhancer monomer. These mutant elements were triplicated and

inserted into the StuI site as indicated for pTBLV-WT-LUC (Fig. 3.8).

Transient transfection experiments were performed in two different T-cell

lines (Jurkat and RL?1) to compare the reporter gene activity of the wild-type

construct to that of the mutants. In Jurkat cells, the 540, 564, and 572 mutations

reduced transcriptional activity less than twofold, whereas the mutations at

positions 548, 578, and 594 suppressed enhancer activity approximately two- to

three-fold (Fig. 3.9). On the other hand, mutations at positions 556 and

586 affected reporter gene expression 20-fold or more. Interestingly, results from

91

Fig. 3.8. Diagram of the TBLV LTR and positions of enhancer substitution mutations.

The reporter gene plasmid used as the backbone for preparation of the substitution mutations (pd6) was prepared as described in Materials and Methods. After the NREs were removed and replaced with a StuI site, triplicated regions containing the wild-type (WT) or mutant (M) sequences were inserted.

WT cagttgaagaacaggtgcggttcccaaggcttaagtaagtttatggttacaaactgttctta

540M acagatct------------------------------------------------------

548M --------t-gatctc----------------------------------------------

556M ----------------taa-a--t--------------------------------------

564M ------------------------at--atc-------------------------------

572M ----------------------------------a-ct------------------------

578M --------------------------------------tgag--ct----------------

586M ----------------------------------------------gagatcta--------

594M ------------------------------------------------------gagatc-t

StuI

505 bp deletionU3 RU5

insert triplication

92

the CD4+ Jurkat line were not identical to those from RL? 1 cells (CD4+ CD8+).

In RL?1 cells, mutations at positions 540, 572, and 578 had wild-type activity,

the 564, 586, and 594 mutations had less than a 2-fold effect on promoter

function, and mutation at position 548 gave a 10- to 20-fold loss of reporter gene

activity assayed in this cell type (Fig. 3.9). Since the mutation at 556 decreased

reporter gene activity at least 20-fold in both CD4+ and CD4+ CD8+ T cells, these

results suggested that the 556 mutation compromised one or more transcription

factor binding sites that are critical for the T-cell enhancer activity of the TBLV

LTR. Neither the 548 nor 556 mutations compromised LTR reporter gene activity

in HC11 mammary cells (data not shown), suggesting that the effect of these

mutations is cell type specific.

The TRANSFAC software program (428) was also used to identify

putative transcription factor binding sites within the enhancer. Potential binding

sites for RUNX1 (AML-1) and GR were observed. Interestingly, the 556

mutation overlapped the RUNX1 site, whereas the 586 mutation overlapped the

GR site (Fig. 3.10).

93

Fig. 3.9. Reporter gene activity of mutant enhancers in transient assays in Jurkat (yellow) or RL? 1 (pink) T cells.

Mean values of triplicate assays with standard deviations are shown. Luciferase activity was determined as described in the legend to Fig. 3.2 except that values are relative to that of the pTBLV-WT-LUC vector (assigned a value of 100).

0

50

100

150

200

WT54

0M54

8M55

6M56

4M57

2M57

8M58

6M59

4M

Rel

ativ

e L

UC

val

ue

Jurkat (CD4+)

RL1 (CD4+ CD8+)


94

Database: TRANSFAC MATRIX TABLE, Rel.3.3 06-01-1998 Query: TBLV 62 (62 bases) Taxonomy: Vertebrate Threshold: 85.0 point TFMATRIX entries with High-scoring: 1 CAGTTGAAGA ACAGGTGCGG TTCCCAAGGC TTAAGTAAGT TTATGGTTAC entry score ----- M00205 GR 95.0 ------> M00271 RUNX1 92.0 -------> M00100 CdxA 91.0 ------------> M00001 MyoD 90.7 ------- M00192 GR 88.6 <------- M00040 CRE-BP 87.9 -------> M00101 CdxA 87.1 -------> M00040 CRE-BP 86.7 ------> M00240 Nkx-2. 86.0 <------------ M00087 Ik-2 85.5 <------- M00148 SRY 85.5 51 AAACTGTTCT TA entry score -----------> M00205 GR 95.0 ------------> M00192 GR 88.6 Total 11 high-scoring sites found. Max score: 95.0 point, Min score: 85.5 point

Fig. 3.10. TRANSFAC search results for the TBLV enhancer element.

Parameters were set to look only in vertebrate databases at the default threshold of 85. Predicted binding sites and their respective scores are shown on the right.

95

3.2.2 Characterization of factors affected by the 548 and 556 mutations in the TBLV enhancer

3.2.2.1 RUNX1 binding to the TBLV enhancer

Critical sequences for TBLV enhancer function occur within the 556

mutation, and the TRANSFAC software program (428) identified a putative

RUNX1 binding site spanning this mutation. The TBLV RUNX1 sequence

closely matched a consensus RUNX1 site (244) as well as a high-affinity RUNX1

site in the MuLV LTR described by Thornell et al. (391) (Fig. 3.11). To

determine if this TBLV region contains a RUNX1 binding site, a 26-bp

oligonucleotide based on the wild-type TBLV LTR (556WT) sequence was

synthesized. The oligonucleotide was end- labeled and used in a gel shift assay

with whole-cell extracts from Jurkat T cells (Fig. 3.12, lanes 1 to 6). As a control,

a labeled oligonucleotide containing a consensus RUNX1 binding site was also

used (lanes 7 to 12) (19). Results of this experiment showed that the TBLV LTR

probe bound at least two complexes with mobilities similar to those obtained with

the RUNX1 probe (compare lanes 2 and 8). Only the slower-migrating complex

was specific, as judged by competion with homologous oligonucleotide, and it

contained RUNX1 as confirmed by supershifts for RUNX1 (lane 4; supershifted

band co-migrates with NF-A) (248). This supershift was abolished by pre-

incubation of the reaction with the peptide used to generate the antibody (lane 5).

At least two other complexes that were not observed with the RUNX1 probe

(named NF-A and NF-B) also appeared to be specific, as judged by competition

with homologous oligonucleotide (lane 6). The NF-A complex was resolved into

at least three bands in later experiments (see Fig. 3.22).

96

Fig. 3.11. Comparison of the RUNX1 consensus sequence to that from TBLV, MuLVs, and the T-cell receptor alpha chain (TCR ).

Transient transfection experiments in RL? 1 (CD4+CD8+) T cells showed

that two adjacent mutations starting at positions 548 and 556 resulted in dramatic

reductions in TBLV enhancer activity (Fig. 3.9). Comparisons of the mutations to

the consensus sequence indicated that the RUNX1 binding site spanned these two

mutations. However, the effect of the 548 mutation was more dramatic in RL? 1

cells than in Jurkat (CD4+) T cells. To determine if the effect of both mutations in

T cells was due to a decrease in RUNX1 binding to the TBLV enhancer, gel shift

assays were performed with Jurkat cell extracts to measure competition of various

oligonucleotides for RUNX1 binding to the 556WT oligonucleotide from the

TBLV enhancer (Fig. 3.13A). Oligonucleotides containing a known RUNX1

binding site (Fig. 3.13B, lanes 3 and 4) or the TBLV LTR oligonucleotides

548WT and 556WT (lanes 5, 6, 9, and 10) competed for RUNX1 binding. The

548M oligonucleotide also showed competition, suggesting that this mutation did

not significantly affect RUNX1 binding (lanes 7 and 8). As expected from

previous results, the RUNX1-specific oligonucleotide did not compete for binding

of NF-A and NF-B (lanes 3 and 4, see arrows). The NF-A complex was competed

NYGYGGTNN RUNX 1 Consensus

GTGCGGTTC TBLV

TTGCGGTTT/A RUNX 1 High Affinity

CTGTGGTAA Moloney MLV

ATGTGGCTT TCR α

97

RUNX1

Jurkat WCE

Rabbit IgG

RUNX1 Ab

RUNX1 peptide

556WT oligo

+

-

-

-

+

+

-

+

+

-

+

-

+

-

-

+

+

-

-

-

+

-

-

-

-

-

-

-

-

-

RUNX1 supershift

TBLV Enhancer Probe RUNX1 probe+

-

-

-

+

+

-

+

+

-

+

-

+

-

-

+

+

-

-

-

+

-

-

-

-

-

-

-

-

-

NF-A

NF-B

1 2 3 54 6 7 8 9 121110

* *

Fig. 3.12. Supershift experiments show RUNX-specific binding to the TBLV enhancer element.

The TBLV enhancer probe (556WT) was used for EMSA with whole-cell Jurkat extracts in lanes 1 to 6, whereas a known RUNX1 binding site probe was used in lanes 7 to 12. Probe sequences are shown in Fig. 3.13A. The NF-A complex (arrow) and the RUNX1 supershifted complex (asterisk) migrate similarly on the gel. Normal rabbit immunoglobulin G (IgG) was used as a negative control in lanes 3 and 9.

98

with the 548WT and 556WT oligonucleotides but showed poor competition with

the 556M oligonucleotide, whereas the 548M sequence did not compete for this

complex. These results suggested that the NF-A binding site spans the 548 and

556 mutations. The NF-B complex was competed with 548WT, 556WT, and

548M sequences, but competition with the 556M oligonucleotide was minimal

(lanes 11 and 12). These assays suggested that the 556 mutation, but not the

548 mutation, affected binding of RUNX1, NF-A and NF-B binding. Together,

these experiments suggest that there are at least three complexes (NF-A, RUNX1,

and NF-B) that bind to the TBLV LTR in close proximity (within 16 bp) to

control enhancer activity. None of these complexes was competed by

oligonucleotides containing consensus binding sites for c-Myb, c-Ets-1, or Ets

family members (data not shown).

The cell- type-specific distribution of these complexes also was determined

using gel shift assays with the 556WT probe. As anticipated from previously

published data (246,261,352), RUNX1 complexes were abundant as measured

using cellular extracts from Jurkat and RL? 1 cells (Fig. 3.14A, lanes 4, 5, 8, and

9). Small amounts of RUNX1 also were detectable in mammary cell extracts, but

a more abundant (and also unknown) complex, migrated slightly slower than that

determined to contain RUNX1 by supershift experiments (Fig. 3.14A lanes 2 and

3; Fig. 3.14B). Neither NMuMg mammary epithelial nor LBB.11 B-cell extracts

had detectable RUNX1 activity by gel shift assays (Fig. 3.14A, lanes 10 and 11)

99

2 3 10 11 124 5 6 7 8 91

RUNX1 548WT 548M 556WT 556M

20X 100X 20X 100X 20X 100X 20X 100X 20X 100X

RUNX1

Competitor:

Molar excess:

-

-

NF-A

NF-B

B

Fig. 3.13. Identification of factors affected by the 548 and 556 TBLV enhancer mutations.

(A) Nucleotide sequences of probes and competitors used for gel shift assays. Dashes indicate sequence identities with the 548WT and 556WT probes. The RUNX1 binding site is over- lined. (B) Binding specificity of NF-A, RUNX1 and NF-B complexes. The 556WT probe was labeled and used for EMSA with Jurkat whole cell lysates in the presence of 20- or 100-fold molar excess of unlabeled competitor oligonucleotides. The positions of specific complexes are shown with arrows. Lane 1 has no cell extract added.

A

548 WT 5’GGT TAC AGT TGA AGA ACA GGT GCG GTT CCC AA 3’548 M --- --- --- --- -T- GAT CTC --- --- --- --556 WT G G-- --- --- --- --- --- --G GCT T 556 M G G-- --- --- TAA –A- -T- --- --- -RUNX1 G GCG –GT AT- -T- --- AAT –C-

100

or by Western blotting (for LBB.11, data not shown). The NF-B complexes were

particularly abundant in HC11 extracts, but were easily detected in extracts from

the NMuMG mouse mammary cell line, the Jurkat and RL? 1 T-cell lines, and the

LBB.11 B-cell line. Complexes of NF-A were detected using Jurkat and RL? 1

cell extracts and B-cell extracts but were undetectable or in low amounts in

mammary cell extracts, suggesting NF-A is a lymphoid-restricted complex.

3.2.2.2 RUNX1 overexpression in non-T cells

Transient transfection experiments identified a critical region of the TBLV

enhancer for optimal transcriptional activity in both Jurkat and RL?1 cells (Fig.

3.9); this region was shown to bind RUNX1 (Fig. 3.12), a transcription factor that

also binds the MuLV enhancers (439). Because the TBLV and MMTV LTRs

have equivalent transcription levels in non-T-cell lines, it was determined whether

overexpression of the transcriptionally active splice variant of RUNX1 (RUNX1B)

(250) would enhance reporter gene activity from the TBLV LTR in non-T cells.

Plasmid pTBLV-LUC was transfected into HC11 mammary cells in the presence

of increasing amounts of a RUNX1B expression vector (250) (Fig. 3.15A). Co-

transfection with the RUNX1B expression plasmid gave approximately 30-fold

enhancement of reporter gene activity relative to transfections containing a control

plasmid lacking the RUNX1B cDNA. Activity of the TBLV LTR was dependent

on the amount of RUNX1B expression vector; doubling of the RUNX1B vector

amount resulted in twice as much reporter gene expression. This effect was

specific for RUNX1B since cotransfection of a RUNX2 expression construct did

not increase transcriptional activity from the TBLV LTR (data not shown).

Moreover, overexpression of RUNX1B failed to elevate expression of a TBLV

LTR reporter

101

Fig. 3.14. Cell type specificity of factor binding to the 556WT probe.

(A) Different amounts of whole-cell extracts from HC11 mammary cells (lanes 2 and 3), Jurkat T cells (lanes 4 and 5), NMuMG mammary cells (lanes 6 and 7), RL? 1 T cells (lanes 8 and 9), and LBB.11 B cells (lanes 10 and 11) were incubated with the TBLV enhancer probe. Lanes 10 and 11 were derived from a gel different from that shown for lanes 1 to 9. Lane 1 shows a reaction with no added cell extract. The positions of NF-A, RUNX1, and NF-B complexes are shown with arrows on the left. Gel shifts using A20 B-cell extract were similar to those shown for LBB.11 (data not shown). (B) HC11 cells contain a small amount of RUNX1. HC11 extract (5 µg) was incubated with the 556WT probe in the absence of added antibody (Ab; lane 1) or in the presence of rabbit immunoglobulin G (IgG; lane 2) or antibody specific for RUNX1B (lane 3). Note that a complex that migrates slightly slower than RUNX1 (larger amounts are seen in lanes 2 and 3 [asterisk in panel A]) is not RUNX1, as judged by its failure to supershift with specific antisera. The small amount of RUNX1 in HC11 cells is more apparent after the supershift.

102

construct that contained the 556 mutation, confirming that binding to the RUNX1

binding site defined by EMSA was responsible for the RUNX1B effect (Fig.

3.15B). Overexpression of RUNX1B in A20 murine B cells elevated TBLV-LUC

reporter gene levels five-fold over basal levels when 10 ug of expression construct

was transfected, and this elevation was dependent on an intact RUNX1 binding

site since RUNX1 overexpression did not activate the 556M-LUC reporter vector

(Fig. 3.16). The level of induction by RUNX1B observed in B cells may be lower

than that observed in mammary cells because of the higher endogenous RUNX1

in B cells. These results confirm that the RUNX1B effect on the TBLV enhancer

is not cell-type dependent.

103

Fig. 3.15. Overexpression of RUNX1B in transient transfection assays using HC11 cells.

Luciferase (LUC) activity was determined as described in the legend to Fig. 3.2 except that values are relative to that for pTBLV-LUC (A) or pTBLV-556M-LUC (B) without RUNX1B cotransfection (assigned a value of 1). Means of triplicate transfections with standard deviations are shown. The RUNX1B vector contains the transcriptionally active splice variant of RUNX1 with two additional exons, 7B and 8 (250). The amount of RUNX1B expression vector used is indicated. All transfections contained 22.5 µg of total DNA.

A

0

10

20

30

40

TBLV-LUC

0

TBLV-LUC

2.5

TBLV-LUC

5

TBLV-LUC

10


Rel

ativ

e L

UC

val

ue

0

0.5

1

1.5

556M-LUC 556M-LUC

B

Rel

ativ

e L

UC

val

ue


RUNX1B(µg)

10 RUNX1B(µg)

0

104

Fig. 3.16. Overexpression of RUNX1B in transient transfection assays using A20 murine B cells.

Luciferase activity was determined as described in Fig. 3.2 except that values are relative to pTBLV-LUC without RUNX1B overexpression (assigned a value of 1). Means of triplicate transfections with standard deviations are shown.

3.2.2.3 Purification of TBLV enhancer-interacting proteins from

Jurkat T cells

Biochemical purification of proteins that bind to the crucial TBLV

enhancer region was employed to identify factors important for enhancer activity.

Jurkat T cells were used for protein purification since they have the highest levels

of NF-A and NF-B proteins and are amenable to growth in spinner flasks. The

purification scheme was determined empirically (diagrammed in Fig. 3.17).

0

1

2

3

4

5

6

7

TBLV-LUC 556M-LUC

DNA transfected

Rel

ativ

e L

UC

val

ue

RUNX1B (µg): 0 10 0 10

105

Fig. 3.17. Flow-chart of steps taken to purify proteins that bind to the TBLV enhancer at the critical region defined above (548-556 region).

Whole cell lysates were initially fractionated on a Sephacryl S200-HR resin

column. Fractions were then analyzed by EMSA using a 556WT oligonucleotide

probe, and fractions containing NF-A and NF-B activity were pooled and heat-

treated. Optimal heat treatment was verified empirically by determining the

temperature that precipitated the most protein without decreasing the NF-A or

NF-B DNA binding activity. After heat treatment, the soluble portion of pooled

fractions was loaded onto a double-stranded DNA-cellulose column. Bound

proteins were washed extensively and eluted. Fractions were analyzed by EMSA

and those containing NF-A or NF-B DNA-binding activity were pooled and

affinity purified. Affinity purification was performed with concatamerized

556WT probe conjugated to magnetic beads. Mass spectrophotometry of the

purified protein bands obtained from the affinity purification step was performed

by Ryuji Kobayashi at M.D. Anderson Cancer Center (Houston, TX) and the

results are shown (Table 3.2).

Whole cell lysates from Jurkat T cells

Sephacryl S200-HR column

Heat treat 45°C

dsDNA-cellulose column

Magnetic affinity bead purification

MS/Sequencing of purified proteins

Whole cell lysates from Jurkat T cells

Sephacryl S200-HR column

Heat treat 45°C

dsDNA-cellulose column

Magnetic affinity bead purification

MS/Sequencing of purified proteins

106

The purified protein of most interest was ALY, which has been shown to

interact with RUNX1 on the TCR α enhancer (43). Since RUNX1 also binds to

the TBLV enhancer, further experiments were performed to determine if ALY

contributes to TBLV enhancer activity (described below). The other proteins

identified have not been tested for their contribution to TBLV enhancer activity.

Some of the proteins identified in the mass spectrophotometry analysis, such as

keratin or bovine serum albumin (BSA), appear to be contaminants. The

identification of HMG1/2 and hnRNP A1 may be relevant as they contribute to

transcriptional activation on multiple promoters (59,106,257).

FPLC of semi-purified fractions was also performed to purify NF-B

binding activity, but no data was obtained from samples analyzed this way. Also,

a Jurkat cDNA expression library was screened using a probe that contained the

critical enhancer region (556WT concatamer), but no positive clones were

identified.

Table 3.2. Results of mass spectrophotometry analyses of affinity purified proteins

MALDI-MS: ~72 kDa BSA (66 kDa) ~30 kDa apolipoprotein A-1 (30 kDa) ~28 kDa hnRNP A1 (36 kDa) ~22 kDa keratin 1 (67 kDa) ~20 kDa no match MS/MS: Albumin (66 kDa) keratin/d(TTAGGG)n-binding protein B39 typeE hnRNP A1/A2 (36 kDa) HMG 1/ALY(BEF, REF) (23 kDa/32 kDa) HMG 2 (21 kDa)

107

3.2.2.4 Further characterization of NF-A and NF-B by UV DNA-

protein crosslinking to the TBLV enhancer

To determine the approximate sizes of proteins that bind to the critical

region of the TBLV enhancer element, standard EMSA reactions containing the

556WT probe were exposed to ultraviolet light (UV) to allow protein-DNA cross-

linking and then resolved by SDS-PAGE. Gels were then dried and exposed to

film (Fig. 3.18A). This experiment was performed in the presence or absence of

bromodeoxyuridine to determine conditions for maximal crosslinking. Three

major proteins, ranging in size from approximately 22 kDa to 72 kDa, bound to

the enhancer. Proteins that were eluted from the magnetic affinity beads were

also resolved by SDS-PAGE and stained with Coomassie brilliant blue dye (Fig

3.18B). Comparison of the crosslinked proteins and those eluted from the affinity

beads revealed a similar pattern, suggesting that both methods identified the same

proteins.

3.2.2.5 ALY enhances RUNX1-mediated activation of pTBLV-LUC

activity

To determine if ALY was capable of enhancing transcriptional activation

mediated by RUNX1, transient transfection analysis was performed with

expression vectors for RUNX1 and ALY to examine the effect on pTBLV-LUC

reporter gene levels in non-T cells. When this experiment was performed in

HC11 cells, RUNX1 alone activated reporter gene levels by approximately 4-fold

when suboptimal levels of RUNX1 expression vector were transfected into the

cells. Expression of ALY with pTBLV-LUC has no effect on reporter gene levels

(data not shown), but a combination of both RUNX1 and ALY expression vectors

elevated reporter activity approximately ten-fold (Fig. 3.19).

108

Fig. 3.18. Comparison of two methods to identify TBLV enhancer binding proteins.

(A) UV DNA-protein crosslinking of whole cell extracts and 556WT probe. Jurkat whole cell lysates (10 µg) were mixed with a labeled 556WT probe (labeled with or without bromodeoxyuridine (BrdU) as described for EMSAs. Crosslinking was performed as described in Materials and Methods. Crosslinked proteins were resolved on a 10% polyacrylamide gel containing SDS, dried and exposed to X-ray film. (B) Coomassie brilliant blue staining of affinity purified proteins that bind to the 556WT probe. Proteins eluted from 556WT affinity beads were analysed by SDS-PAGE (10% gel) and stained with Coomassie brilliant blue. The high molecular weight band has been previously identified as nucleolin.

nucleolin

BrdU - +

~28 kDa

~22 kDa

~72 kDa

~28 kDa

~22 kDa

~72 kDa

A B

109

Fig. 3.19. Co-expression of RUNX1B and ALY in HC11 mammary epithelial cells cooperatively activates the TBLV LTR.

HC11 cells were transiently transfected with pTBLV-LUC and either RUNX1B or ALY expression vector alone or in combination. Luciferase levels are given as described in Fig. 3.2 except that pTBLV-LUC expression alone is given a value of 1.

0

5

10

15

DNA transfected

Rel

ativ

e L

UC

val

ue

RUNX1 (ug):ALY (ug):

00

50

100

102

104

110

Fig. 3.20. Cooperation of ALY and RUNX1 in EL4b murine T cells.

EL4b cells were transfected with pTBLV-LUC reporter gene and either a RUNX1B expression vector (10 µg) or an ALY expression vector (10 µg) or both. Luciferase values are given as described in Fig. 3.2 except that pTBLV-LUC transfected alone was assigned a value of 1.

0

2

4

6

8

10

DNA transfected

Rel

ativ

e L

UC

val

ue

ALY (µg):RUNX1 (µg):

--

-10

10-

1010

111

Previous work had shown that there was a relatively low level of ALY in

the murine T cell line EL4, whereas there was a high level of ALY in Jurkat T

cells (43). To ensure that the cooperation of ALY and RUNX1 on the TBLV

LTR was not a cell line-dependent phenomenon, a similar co-transfection

experiment was also performed in a subclone of EL4 cells, EL4b. Transient

transfection of either an ALY or RUNX1B expression vector alone with pTBLV-

LUC elevated reporter gene expression approximately 2.5-fold (Fig. 3.20),

whereas co-expression of ALY and RUNX1 increased reporter activity six-fold.

ALY expression alone was able to elevate pTBLV-LUC luciferase levels due to

the ability to enhance activity of the endogenous levels of RUNX1. Thus, ALY

and RUNX1 cooperate on the TBLV enhancer to activate transcription.

3.2.2.6 Competition analysis of other retroviral LTR sequences for

TBLV enhancer binding proteins

TRANSFAC software analysis and our results with RUNX1 suggested that there

may be common binding sites between the TBLV LTR enhancer and other

thymotropic LTRs or enhancers. To analyze this possibility, full- length LTRs as

well as LTR fragments were amplified from Moloney murine leukemia virus

(MoMLV), Gross murine leukemia virus (GMLV) and human immunodeficiency

virus-1 (HIV-1). These PCR products were then used to compete for binding

activity to the 556WT probe in EMSAs. Neither the MoMLV nor the GMLV

LTR PCR products were able to compete for NF-A or NF-B binding to the TBLV

LTR probe (data not shown). The HIV LTR, in particular the 3’ half of the LTR,

was able to compete for part of NF-A binding activity (Fig. 3.21). Smaller

fragments of the 3’ half of the HIV LTR were then used to compete for binding

activity to define the sequences that were responsible for the competition. The

112

Fig. 3.21. Competition of the HIV LTR enhancer for proteins binding to the 556WT TBLV enhancer sequence.

PCR products or oligonucleotides for HIV LTR sequences were used in competition assays for proteins that bind to the TBLV enhancer. Jurkat whole cell lysates (10 µg) were used in binding reactions with the 556WT probe. Lane 1 contains no cell lysate. Full- length HIV LTR and the 5’and 3’ halves of the HIV LTR were used as competitors at 40-, 200- or 1000-fold molar excess (lanes 3-11). The HIV enhancer was used in oligonucleotide competitions (lanes 13 and 14) at 20- and 100-fold molar excess.

1 7 8 9 10 114 5 62 3 12 13 14

-

Jurkat WCL 10 µg Jurkat WCL 10 µgFull-lengthHIV LTR 5’ HIV LTR 3’ HIV LTR

-

HIVEnhancer

NF-A

NF-B

RUNX1

113

HIV enhancer, which is 27 bp long (Fig. 1.10), was an effective competitor.

Interestingly, the HIV enhancer oligonucleotides competed for the lower portion

of NF-A as well as NF-B binding activity. This result suggest that the HIV

enhancer shares a subset of binding proteins with the TBLV enhancer and that

NF-A complexes represent binding of at least two different factors.

Proteins that have previously been determined to bind to the HIV enhancer

include NF-κB, nuclear factor of activated T cells (NFAT), c-Ets-1, C/EBP family

members and GABP a and β (311). To determine common binding factors for the

TBLV LTR and HIV LTR enhancers, oligonucleotide competitions were first

performed. Oligonucleotides containing binding sites for either c-Ets-1 or the Ets

family of transcription factors had previously been used in competition assays in

EMSAs and had no effect on 556WT probe-protein interactions (data not shown).

However, both NFAT and NF-κB binding site oligonucleotides competed for

binding of some of the NF-A complexes (the two lower bands) and for NF-B

binding activity (Fig. 3.22). Since NFAT and NF-κB binding sites share some

sequence homology (237,239), this result is not surprising. The core binding site

for NFAT proteins is GGAAA, while the NF-κB consensus binding site is

GGGACTTTCC. Thus, the 3’ end of the NF-κB site is identical to the core

binding site for NFAT. Both NFAT and NF-κB can bind to the HIV enhancer on

two distinct, but overlapping binding sites (186). Based on these data, further

experiments were necessary to determine if either protein binds to the TBLV

enhancer and has a functional effect on transcriptional activity.

114

Fig. 3.22. Oligonucleotide competition with NF-κB and NFAT consensus binding sites.

RL?1 whole cell lysates (10 µg) were used in binding reactions with the 556WT probe. Oligonucleotide competitors were added at 20- or 100-fold molar excess. Competition with NF-κB consensus binding site oligonucleotides in lanes 3 and 4, and NFAT consensus binding site oligonucleotides in lanes 5 and 6. NF-A, RUNX1 and NF-B complexes are indicated.

1 4 5 62 3

-

RL1 WCL 10 µg

20X100X20X 100X

NF-κB NF-AT

NF-A

NF-B

RUNX1

115

3.2.2.7 Effect of NFAT expression on pTBLV-LUC activity in non-T

cells

Since consensus oligonucleotides for the NFAT binding site competed for

proteins binding to the TBLV enhancer, NFAT proteins were overexpressed in

HC11 mammary epithelial cells to determine if reporter gene activity from the

pTBLV-LUC vector would be affected. Less than a two-fold effect was observed

after NFATp or NFATc overexpression (data not shown). One interpretation is

that NFAT does not transactivate the TBLV LTR activity because it does not bind

to the DNA. Another possibility is that NFAT needs other co-factors to activate

transcription that are absent from HC11 cells.

3.2.2.8 Effect of NF-κB expression on pTBLV-LUC activity in non-T

cells

To determine whether NF-κB can bind to and activate the TBLV LTR

enhancer region in non-T cells, a series of transient transfection experiments were

performed in HC11 mammary cells with expression vectors for NF-κB subunits

and pTBLV-LUC as the reporter vector (Fig. 3.23). Expression of NF-κB1 or

NF-κB2 alone or in combination enhanced transcription from pTBLV-LUC over

background levels. Also, when NF-κB1 or NF-κB2 was co-transfected with

RelB, elevation was also observed (data not shown). RelB cannot homodimerize

and bind DNA (342), and therefore, was unable to activate transcription from

pTBLV-LUC when transfected alone (data not shown). When either NF-κB1 or

NF-κB2 was co-transfected with RelA, no elevation in luciferase levels were

observed compared to the control. Instead, overexpression of RelA alone or with

either NF-κB1 or NF-κB2 repressed reporter activity from the TBLV promoter.

116

Expression of c-rel also had no effect on transcription from pTBLV-LUC. This

result is surprising since normally, NF-κB1 and NF-κB2 are considered to be

weak transactivators or repressors when they bind DNA as homodimers (319).

However, there are also reports of transcriptional activation mediated by these

homodimers (36,357,358). These results also indicated that RelA can antagonize

the activation of the TBLV enhancer mediated by NF-κB1 or NF-κB2.

02468

1012

NF-κB15 µg

RelA5 µg

NF-κB1/RelA5 µg

c-rel5 µg

NF-κB25 µg

NF-κB2/RelA5 µg

Rel

ativ

e L

UC

val

ue

-

Fig. 3.23. Overexpression of NF-κB subunits differentially activates TBLV LTR activity in transient transfection of HC11 cells.

HC11 cells were transfected with pTBLV-LUC and expression constructs for NF-κB proteins. When two proteins were transfected, 5 µg of each expression construct was used. Luciferase levels were determined as described in Fig. 3.2 except that they are relative to pTBLV-LUC levels (assigned a value of 1).

117

3.2.2.9 Identification of an NF-κB binding site in the TBLV enhancer

Since NF-κB can activate transcription from the TBLV LTR, transient

transfection analysis was performed to identify the location of the binding site.

As the primary TBLV enhancer activity was located in the 556 region and the

HIV enhancer (which binds NF-κB) oligonucleotides competed for binding to the

556WT probe, the first transfections with HC11 cells used wild-type and 556M

Fig. 3.24. Overexpression of NF-κB2 with MMTV or TBLV LTR reporter vectors.

HC11 mammary epithelial cells were transiently transfected with C3H-LUC, pd6-LUC, TBLV-LUC, 548M-LUC or 556M-LUC reporter gene constructs in the presence or absence of 10 µg of NF-κB2 expression vector. Total levels of DNA transfected were kept constant for each transfection. Luciferase levels are given as described in Fig. 3.2. All values are relative to the C3H-LUC vector, which was assigned a value of 1.

010203040

pC3H-LUC pd6-LUC pTBLV-LUC p548M-LUC p556M-LUC

DNA transfected

Rel

ativ

e L

UC

val

ue

NF-κ B2 (ug): 0 10 0 10 0 100 10 0 10

118

TBLV-LUC constructs. As expected, overexpression of NF-κB-2 activated the

TBLV enhancer. However, mutation of the 556 region of the TBLV enhancer

had no effect on the ability of NF-κB2 to activate the TBLV LTR (Fig. 3.24).

There are at least two possibilities for this result. NF-κB may bind to a

region of the enhancer outside of the 556 mutation since the 556WT probe has

flanking sequences that are outside the region of the 556 mutation. Alternatively,

NF-κB may bind to a region of the LTR that is not specific to TBLV. To

distinguish between these possibilities, another transient transfection experiment

was performed in HC11 mammary epithelial cells. Reporter constructs for the

wild-type MMTV LTR, wild-type TBLV-LTR, the MMTV LTR without the

NREs or flanking sequence (pd6) and 548M-TBLV LTR were co-transfected with

or without an NF-κB2 expression construct. Both wild-type MMTV and TBLV

LTR expression were activated by NF-κB2 overexpression (Fig. 3.24). NF-κB2

activation of the MMTV LTR was much less than that observed with TBLV,

(approximately 4-fold, compared to approximately 22-fold for TBLV). The pd6

and 548M reporter constructs also were responsive to the expression of NF-κB2,

similar to the levels observed with the wild-type MMTV (C3H) LTR. Together,

these results suggest that there is an NF-κB binding site in the enhancer repeat of

the TBLV LTR, either upstream of, or overlapping with the RUNX1 binding site.

Since the enhancer element is present in three copies, this explains why

enhancement of the TBLV LTR constructs is greater than that seen with MMTV

reporter constructs.

TRANSFAC analysis of the MMTV LTR predicts that there are a number

of NF-κB binding sites located near the 5’ end of the U3 region. The approximate

location of the NF-κB binding site coincides with the proposed NF-A binding

site. Interestingly, there is no obvious consensus NF-κB binding site in this

119

region. However, this does not rule out NF-κB binding since this factor binds to

sites that do not fit the consensus site rules (196,292,309).

3.2.2.10 Antagonism between NF-κB and RUNX1 on the TBLV

enhancer

Since RUNX1B and NF-κB activated the TBLV LTR individually when

overexpressed in HC11 mammary epithelial cells (Fig. 3.15 and 3.23), it was also

determined whether these factors could cooperate to activate the TBLV LTR

when co-expressed in non-T cells. Transient transfection analysis revealed that

overexpression of both NF-κB and RUNX1B abolished the activation observed

with either factor alone (Fig. 3.25). To determine whether this result required

DNA binding, the experiment was repeated with wild-type TBLV-, 548M- and

556M-LUC reporter plasmids. The effect was observed with all reporter plasmids

tested, regardless of whether a mutated NF-κB binding site (548M) or a mutated

RUNX1 binding site (both 548M and 556M) was included. It should be noted

that the lower activation seen with NF-κB overexpression and the 556M-LUC

vector may result from overlap between the NF-κB binding site and the 556

mutation.

To determine the contribution of NF-κB binding to the TBLV enhancer in

T cells, a dominant negative (DN) IκB expression construct was used in transient

transfections in both RL? 1 and Jurkat T cells, as well as in A20 B cells. This DN

IκB functions to prevent the nuclear translocation of NF-κB subunits by blocking

the degradation of IκB since it is mutated at phosphorylation sites necessary for

its ubiquitination and degradation (42,398). Thus, all NF-κB proteins are

sequestered in the cytoplasm. In RL? 1 cells, when the DN IκB vector was co-

120

transfected with pTBLV-LUC, there was a 2-fold increase in reporter gene levels

compared to pTBLV-LUC alone (data not shown). However, in Jurkat T cells,

0

2

4

6

8

10

12

14

16

18

1 2 3 4 5 6 7 8 9 10 11 12

DNA transfected

LU

C/1

00 µ

g p

rote

in

TBLV-LUC 548M-LUC 556M-LUC

RUNX1 (10 µg):NF-κB2 (10µg):

--

--

--

+-

+-

+-

-+

-+

-+

++

++

++

Fig. 3.25. Effect of overexpression of RUNX1 and NF-κB2 on TBLV LTR activity in HC11 mammary epithelial cells.

HC11 cells were transfected with either pTBLV-LUC (lanes 1-4), 548M-LUC (lanes 5-8) or 556M-LUC (lanes 9-12) (4 µg for each) reporter gene vectors. These vectors were co-transfected with either a RUNX1B (10 µg) (lanes 2, 6, and 10) or NF-κB2 (10 µg) (lanes 3, 7, and 11) expression vector alone or in combination (10 µg each) (lanes 4, 8, and 12). Luciferase levels are given in relative light units/100 µg protein.

121

reporter gene activity did not change in the presence or absence of DN IκB

protein (data not shown). Similar results were observed after transient

transfections of A20 cells (less than a two-fold elevation in the presence of DN

IκB) (Fig. 3.26).

These data suggest that NF-κB does not contribute significantly to the

enhancer function in T cells; instead this factor seems to have a small inhibitory

effect since NF-κB sequestration in the cytoplasm gives a small increase in TBLV

enhancer activity. Thus, NF-κB may modulate the activity of the TBLV enhancer

in non-T cells. Also, when RUNX1B and DN IκB were co-expressed in A20 B

cells, the effect on reporter activity is greater than that seen with RUNX1B or DN

IκB expression alone. This suggests that NF-κB proteins may function to

modulate activity of other transcription factors in B cells (e.g., RUNX1).

3.2.2.11 Mutational analyses of NF-A and NF-B binding sites

To determine the individual contributions of NF-A, RUNX1 and NF-B on

the TBLV enhancer, another series of smaller substitution mutations were made.

Mutation of RUNX1 binding with a 3-bp substitution mutation did not affect the

binding of NF-A or NF-B. The effect of the 3-bp RUNX1 mutation was analyzed

by cloning it into the pTBLV-1R-LUC construct (containing one 62 bp enhancer

element). This mutation reduced activity to about 60% of that observed with

wild-type TBLV LTR activity, suggesting that there is another factor responsible

for enhancer activity (Fig. 3.28).

As mentioned previously, NF-A binding can be resolved into at least three

distinct complexes in EMSAs. Since the initial substitution mutations in the

TBLV enhancer element were large (6-8 bp), smaller substitution mutations 5’ of

122

the RUNX1 binding site were used to distinguish these complexes by

oligonucleotide competition in EMSAs. One mutation, M2, disrupted only the

Fig. 3.26. Effect of NF-κB and RUNX1B on TBLV enhancer in A20 murine B cells.

A20 cells were transfected with a pTBLV-LUC reporter vector either alone or with a RUNX1B expression vector (10 µg), an NF-κB2 expression vector (10 µg), or a DN IκB expression vector (10 µg). Co-transfections also were performed with NF-κB2 and RUNX1B expression vectors, or with RUNX1B and DN IκB expression vectors (10 µg each). Luciferase levels are given as described in Fig. 3.2 except that all values are relative to pTBLV-LUC levels alone (assigned a value of 1). The p value for student’s t-test of the RUNX1B overexpression sample vs. the RUNX1B and DN IκB sample is 0.06.

0

5

10152025

30

35

RUNX1BDN-IKBNF-κB2

000

+00

+0+

0+0

++0

Rel

ativ

e L

UC

val

ue

DNA transfected

123

Fig. 3.27. Oligonucleotide competition analysis of TBLV enhancer complexes using 2 bp mutations.

RL?1 whole cell lysates (10 µg) were used in binding reactions containing the 556WT probe. Oligonucleotides with 2 bp substitution mutations were added at 50- or 200- fold molar excess to binding reactions. Lane 1 contains no cell extract. The positions and base changes for each mutation are shown below the gel. The RUNX1 binding site is also denoted. The mutations for mNF-A.1, mNF-B, the double mutation (DM) and the 3-bp RUNX1 mutation are also shown. NF-A, RUNX1 and NF-B complexes are shown by brackets.

NF-A

NF-B

RUNX1

1 2 3 4 5 6 7 8 9 10 11 12

10 µg RL1 WCL

50X 200X 50X 200X50X 200X 50X 200X 50X 200XM1 M2 M3 M4 M5

RUNX1556WT g a a c a g g t g c g g t t c c c a a g g c

M1 t c - - - - - - - - - - - - - - - - - - - -M2 - - g a - - - - - - - - - - - - - - - - - -M3 - - - - t c - - - - - - - - - - - - - - - -M4 - - - - - - t c - - - - - - - - - - - - - -M5 - - - - - - - - t a - - - - - - - - - - - -

3bpmRUNX - - - - - - - - - - t a g - - - - - - - - -mNF-B - - - - - - - - - - - - - c t a g - - - - -

DM - - g a - - - - - - - - - c t a g - - - - -

mNF-BmNF-A.1

124

upper band of the NF-A complex (Fig. 3.27). The other mutations failed to

disrupt NF-A binding (M1), or affected the lower two complexes (M3 and M4),

or all three complexes and RUNX1 (M5). These competition experiments

confirm the density of binding factors in this region of the TBLV enhancer.

To determine the effect on enhancer activity, the 2-bp M2 mutation was

substituted into a reporter construct containing a single enhancer element (pmNF-

A.1-LUC) and compared with a reporter construct containing a single wild-type

enhancer element after transient transfections in Jurkat T cells. This mutation

decreased transcriptional activity from the TBLV LTR by 78% (Fig. 3.28). Thus,

the upper NF-A complex makes a major contribution to the T-cell-specific

enhancer activity of TBLV.

Based on competition assays with oligonucleotides containing either the

548 or 556 mutations (Fig. 3.13B), the NF-B binding site was predicted to overlap

or juxtapose the RUNX1 binding site. To determine the effect of NF-B on TBLV

enhancer activity, an oligonucleotide containing a 4 bp substitution mutation 3’ of

the RUNX1 binding site was determined to specifically mutate only the NF-B

binding activity, but not NF-A or RUNX1 binding activity, by EMSA (data not

shown). This mutation was transferred into the pTBLV-1R-LUC vector, resulting

in the plasmid pmNF-B-LUC. Transient transfection analysis of these plasmids

was performed in Jurkat T cells to determine the contribution of the NF-B protein

complex to TBLV enhancer activity. Mutation of the NF-B binding site reduced

reporter gene levels by approximately 40% (Fig. 3.28). Similarly, a 3-bp

mutation that affected only RUNX1 binding also decreased enhancer activity by

40%.

To determine the effect of both the NF-A.1 and NF-B complexes on

TBLV enhancer activity, a double mutant vector (pDM-LUC) was generated that

contained both the 2 bp mutation from NF-A.1 and the 4 bp mutation from NF-B.

This mutant plasmid was compared to the two single mutant and the wild-type

125

plasmids by transient transfection analysis in Jurkat T cells (Fig. 3.28). The

combined mutations lowered reporter gene levels to approximately 30% of that

observed with mNF-A.1 alone. These data suggest that the NF-A.1 complex is

the major contributor to TBLV enhancer activity.

Fig. 3.28. Effect of TBLV enhancer mutations in Jurkat T cells.

Jurkat cells were transfected with various reporter constructs to compare their activities relative to wild-type MMTV and TBLV reporter constructs. The TBLV reporter construct has only one enhancer element. Luciferase levels are expressed as described in Fig. 3.2.

0

20

40

60

80

DNA transfected

Rel

ativ

e L

UC

val

ue

pC3H-LUC

pTBLV-1R-LUC

pmNF-A.1-LUC

pmNF-B-LUC

pDM-LUC

p3bp-mRUNX

-LUC

126

3.2.3 Characterization of factors affected by the 586 mutation in the TBLV enhancer

3.2.3.1 Contribution of GR binding to TBLV enhancer activity

Transient transfection experiments showed that the 586 mutation

dramatically reduced TBLV enhancer activity in Jurkat but not RL? 1 cells (Fig.

3.9). Analysis of transcription factor binding sites in this region revealed the

presence of a glucocorticoid receptor (GR) binding site (Fig 3.10). Interestingly,

GR binding sites have been reported in the enhancers of many murine leukemia

viruses (131). To determine if the 586 mutation eliminated the GR site, transient

transfection assays were performed in XC rat cells in the presence or absence of

dexamethasone (DEX) (Fig. 3.29). As expected, the wild-type C3H MMTV LTR

showed a strong (over 60-fold) induction in the presence of glucocorticoids, as did

the reconstructed TBLV-WT-LUC plasmid. However, the 586 mutation, but not

the 556 mutation, eliminated the glucocorticoid- induced stimulation of reporter

gene expression. Since there are other HREs downstream of the enhancer, the

result is very unexpected.

GR requires the presence of hormone to allow functional receptor to

translocate into the nucleus and allow DNA binding (174). Jurkat cells appear to

have low levels of functional GR, as measured by low-level enhancement of

MMTV LTR reporter gene expression in the presence of hormones compared to

that without added hormone (data not shown). To determine if the 586 mutation

affects TBLV enhancer activity in the absence of steroid hormones, media

supplemented with hormone-depleted serum was used to perform transient

transfection assays in Jurkat cells grown without exogenous glucocorticoids (Fig.

3.30). The TBLV enhancer-containing plasmid had approximately 500-fold

127

Fig. 3.29. Activity of the GR binding site mutant 586M in transient transfections of XC rat cells.

Hormones were added as indicated 24 h after transfection using the DMRIE-C method. After an additional 24 h in the presence or absence of 10 6 M DEX, cell extracts were prepared for reporter gene assays. LUC activity was determined as described in the legend to Fig. 3.2 except that values are relative to that for pC3H-LUC in the absence of DEX (assigned a value of 1). Mean values of triplicate assays with standard deviations are shown.

0

20

40

60

80

100

120

Rel

ativ

e L

UC

val

ue


pC3H-LUC pTBLV-WT-LUC

pTBLV-556M-LUC

pTBLV-586M-LUC

DEX - ---+ + + +

128

greater expression than the C3H MMTV LTR, and this activity was greatly

diminished by the 556 and 586 mutations. Since phenol red has mildly estrogenic

properties when present in cell culture medium (107), this experiment was

repeated with hormone-stripped serum and phenol red-free medium. A similar

result was obtained (data not shown). Based on these results, a factor other than

GR appears to regulate TBLV enhancer activity at position 586.

3.2.3.2 Identification of a c-Myb binding site in the TBLV enhancer

Since LTR enhancers from other leukemogenic retroviruses have c-Myb

binding sites (281), c-Myb consensus oligonucleotides were used to compete for

proteins that bind to the 556WT probe. No competition was observed (data not

shown). However, overexpression of the c-Myb protein in transient transfections

of HC11 cells activated TBLV LTR-driven transcription of a reporter gene.

Analysis of the 556M-LUC response to c-Myb overexpression revealed that this

mutation had no effect on TBLV-LUC activity (data not shown). These results

suggested that there was a c-Myb binding site located outside the region affected

by the 556 mutation.

TRANSFAC software predicted a c-Myb bindng site in the region

spanning the 586 mutation when the parameters for detection were less stringent.

As discussed above, the 586 mutation almost completely eliminates enhancer

activity in Jurkat T cells, and reduces enhancer activity by approximately half in

RL? 1 T cells (Fig. 3.9). To verify the existence of the predicted c-Myb binding

site,

129

Fig. 3.30. Activity of the GR binding site mutant in transient transfection assays of Jurkat T cells grown in the absence of exogenous steroid hormones.

LUC activity was determined as described in the legend to Fig. 3.2. Mean values of triplicate assays with standard deviations are shown.

0

100

200

300

400

500

600

pC3H-LUC pTBLV-WT-LUC

pTBLV-556M-LUC

pTBLV-586M-LUC

Rel

ativ

e L

UC

val

ue


130

transient transfection of a c-Myb expression plasmid with pTBLV-LUC in HC11

cells was performed. Up to nine-fold elevation was observed with c-Myb

expression (Fig. 3.31) and this activation of the TBLV LTR was dose-dependent

(data not shown). The 586M-LUC construct did not respond to the

overexpression of c-Myb in HC11 cells (Fig. 3.31), indicating that the predicted

binding site was disrupted by the 586 mutation.

Fig. 3.31. The 586 mutation in the TBLV enhancer abolishes the c-Myb binding site.

The pTBLV-LUC and p586M-LUC reporter constructs were transiently transfected in HC11 mammary epithelial cells with or without a c-Myb expression vector (2 µg). LUC values are given as described in Fig. 3.2 except that the level for pTBLV-LUC transfected alone was assigned a value of 1.

02468

1012

pTBLV-LUCc-Myb (µg):

p586M-LUC

DNA transfected

Rel

ativ

e L

UC

val

ue

pTBLV-LUC p586M-LUC0 02 2

131

0

10

20

30

40

0 c-myb(1 ug)

RUNX1(5 ug)

c-myb (1ug)RUNX1 (5 ug)

DNA transfected

Rel

ativ

e LU

C v

alue

Fig. 3.32. RUNX1 and c-Myb cooperative to activate the TBLV LTR in HC11 cells.

HC11 cells were transiently transfected with pTBLV-LUC reporter construct and either c-myb (1 µg) or RUNX1B expression vectors (5 µg) alone or in combination. Luciferase values are given as described in Fig. 3.2, except that the value for pTBLV-LUC transfected alone was given a value of 1.

132

3.2.3.3 c-Myb and RUNX1B cooperative to activate TBLV LTR

activity in non-T cells

To determine if c-Myb and RUNX1B cooperate to activate TBLV-LUC

activity in non-T cells, HC11 cells were co-transfected with varying amounts of

the two transcription factor expression vectors and pTBLV-LUC. As anticipated,

c-Myb overexpression showed approximately 2-fold enhancement of TBLV-LUC

activity, whereas RUNX1 overexpression showed approximately 15-fold

enhancement (Fig. 3.32). However, co-transfection of both c-myb and RUNX1B

expression vectors enhanced TBLV-LUC activity approximately 30-fold. Thus,

the combined effect of these transcription factors appeared to be additive rather

than cooperative on the TBLV enhancer, similar to that observed with ALY.

133

3.3 EFFECT OF THE TBLV LTR ON C-MYC ACTIVATION

3.3.1 Characterization of TBLV enhancer elements in proviruses integrated near the c-myc gene.

Because previous experiments indicated that the nature of the retroviral

enhancer was critical for proviral oncogenicity in T cells (56,217,372), LTRs from

integrated TBLV proviruses near c-myc were characterized. PCR was performed

with tumor DNAs and primers that would flank the copy of the TBLV enhancer

closest to the c-myc proto-oncogene, and the resulting products were subjected to

sequencing analysis. Surprisingly, some of the TBLV proviruses had a different

number of enhancer elements than that previously reported for an LTR cloned

from a TBLV-induced tumor (16). In two proviruses that were integrated

approximately 0.5 and 2 kb downstream of the c-myc gene in the T16 and T17

tumors, respectively (Fig. 1.8), there were four elements within the TBLV

enhancer (Table 3.3). Interestingly, the T16 and T17 tumors were the most clonal

of the characterized tumors based on our ability to detect TBLV integrations by

Southern blotting (328). of the other proviruses from polyclonal tumors contained

two or three enhancer elements within the LTR closest to the c-myc oncogene

(Table 3.3).

To determine if our starting TBLV population was a mixture of viruses,

PCR was performed on high-molecular-weight DNA obtained from the cell line

used for virus preparation (485-10). Using LTR primers localized outside the

enhancer repeat elements, a predominant PCR product was obtained consistent

with three enhancer elements as reported by Ball et al. (16). This PCR product

was cloned, and 10 independent clones were sequenced (data not shown). All

134

Table 3.3. Analysis of the enhancer elements in TBLV LTRs near the c- myc gene

No. of LTR enhancer elementsc

TBLV-induced

tumor Proviral locationa

Proviral orientationb

5’ LTR 3’ LTR

T9 Upstream Opposite 3

T623B Upstream Opposite 3, 3d

T623B Upstream Same 2, 2, 3d

T623B Exon 1 Opposite 3

T5 Intron 1 Opposite 3

T623B Exon 3 Same 2

T16 Downstream Same 4



T602 Downstream Opposite 3 a Location of the TBLV provirus relative to the c-myc proto-oncogene. b Transcriptional orientation of the TBLV provirus relative to that of the c-myc gene. c Number of copies of the 62-bp repeat element in the TBLV LTR. d The numbers of TBLV LTR enhancer elements found in different clustered proviruses in this orientation as verified by cloning and sequencing.

135

clones had three enhancer elements, and the sequence was identical to that

previously reported (16) except that the last two elements had G residuesinstead

of A residues in a portion of the enhancer element (5’ TAA GTA GGT TTA TGG

3’). Both the G and A residues resulted in a termination codon within the sag

gene.

PCR also was performed on DNA derived from the 485-10 tumor used for

virus preparation using TBLV-specific LTR primers that flanked the enhancer

elements (Fig. 3.33). As expected, gel analysis of these PCR mixtures showed

that enhancers with three copies of the element were dominant, although fragment

sizes consistent with one- or two-repeat enhancers could be detected. Similar

analysis of DNAs from the primary tumors T5, T9, T16, and T17 also revealed

that the three-repeat enhancer is dominant in proviruses integrated into tumor

DNA. However, the four-repeat enhancer was detected in tumors T5, T16, and

T17 (Fig. 3.33); quantitation indicated that the three-repeat enhancer was three- to

seven-fold more abundant than the four-repeat enhancer in these tumors (data not

shown). Since the semiclonal tumors T16 and T17 both had TBLV proviruses

with four-repeat enhancers downstream of c-myc, as detected by Southern blotting

(328) (Fig. 1.8), these results suggested that four-repeat enhancers at particular

insertion sites near c-myc have a selective advantage over three-repeat enhancers

during tumor progression.

136

Fig. 3.33. PCR analysis of primary tumor DNAs to determine the number of 62-bp repeats in the TBLV LTR enhancer.

PCR analysis of DNA from primary (1°) TBLV-induced tumors (T5, T9, T16, and T17) using sense and antisense primers that flank the LTR enhancer repeats (LTR408+ and LTR786-). Lanes M contain molecular size markers, and lane 2 is a reaction run with no template. The tumor cell line 485-10 used for virus production is shown in lane 4. Use of DNA from uninfected BALB/c mice shows the specificity of the PCRs. The numbered arrows to the right of the gel indicate the positions of fragments with different numbers (two to four) of enhancer repeats.

234

no D

NA

BA

LB

/c

485-

10

T5

1°

T9

1°

T16

1°

T17

1°

370

bp

262

497605

bp

PCR primers:TBLV-LTR408+/TBLV-LTR786-

1 2 3 4 5 6 7 8 9

M M

137

3.3.2 Selection for TBLV enhancer repeats during tumor passage

Only a few tumors induced by TBLV have integrations near c-myc

detectable by Southern analysis. These include tumors T16 and T17, which have

integrations near c-myc that contain four enhancer elements. Thus, there appeared

to be a selective advantage for more enhancer elements in proviruses integrated

near c-myc. To test this possibility, analysis of primary and passaged tumor cell

DNA was analyzed for retention or enrichment of certain integration sites and the

number of enhancer elements in or near the c-myc locus.

To determine if there was selection for particular integration sites or

enhancer composition during tumor progression, the semiclonal tumors T16 and

T17 and the polyclonal tumors T5, T9, T10, and T623B were transplanted in

immunocompetent syngeneic mice. DNA extracted from the primary or passaged

tumors was then subjected to nested PCR. Primary PCR products obtained using

primers that would detect a TBLV LTR-c-myc junction fragment were purified,

diluted, and used for secondary PCR with primers that flanked the LTR enhancer

repeats. Gel analysis of the secondary PCRs allowed detection of a change in the

number of enhancer repeats at particular TBLV integration sites found near c-myc

after tumor passage (Fig. 3.34). Cloning and sequencing verified the identities of

fragments composed of two, three, or four copies of the 62-bp repeats. As

anticipated, PCR results generated from the semiclonal tumors T16 and T17

showed that the four-repeat enhancer was dominant using primers that detected

insertions downstream of c-myc (lanes 3 and 6). The polyclonal tumor T623B had

no detectable product in primary PCRs (data not shown), but LTRs with three-

repeat enhancers were detectable in the primary tumor after secondary PCR (lane

9). However, such insertions did not appear to be selected during tumor passage

(lanes 10 and 11). TBLV insertions containing the three-repeat enhancer were

detected predominantly in primary T623B DNA upstream and in the same

138

orientation as c-myc (lane 12). However, both passages of this primary tumor

selected for the appearance of LTRs with the four-repeat enhancer (lanes 13 and

14). Similar results were obtained using a different c-myc primer for the primary

PCRs (lanes 15 to 17).

Selection for TBLV insertions with four-repeat LTRs was not apparent at

every integration site ana lyzed. For example, insertions into the T9 site about 4

kb upstream and in the transcriptional orientation opposite that of c-myc had

predominantly three-repeat enhancers (Fig. 3.34, lanes 21 to 23). Insertions into

intron 1 in the T5 tumor predominantly had three-repeat enhancers, although two-

repeat enhancers were detectable (lanes 27 to 29). Insertions within exon 3 in

T623B also had predominantly three-repeat enhancers (lanes 30 to 32).

To determine the relative abundance of tumor cells carrying different TBLV

insertions near c-myc, semi-quantitative PCRs were performed with DNAs

derived from primary and passaged tumors. In the T9 tumor where an insertion

ca. 4 kb upstream and in the transcriptional orientation opposite that of c-myc was

detected (see Fig. 1.8 for map position), tumor cells carrying TBLV insertions

near c-myc with a three-repeat enhancer declined during tumor passage (Fig.

3.35A). Alternatively, tumor cells in T623B carrying a TBLV insertion with a

three-repeat enhancer upstream and in the transcriptional orientation opposite that

of c-myc became more abundant during in vivo passage (Fig. 3.35B). However,

in the same tumor, cells carrying a TBLV insertion with a three-repeat enhancer

upstream and in the same transcriptional orientation as the oncogene disappeared

from the population (Fig. 3.35C, compare lanes 2 to 5 with lanes 6 to 9), yet cells

having a similar insertion with a four-repeat enhancer appeared after one tumor

passage (lanes 6 to 9) and persisted after a second passage (lanes 10 to 13). The

new insertion was confirmed to be ca. 300 bp upstream of c-myc in the same

orientation by cloning and sequencing. Sequencing also indicated that this x

139

Fig. 3.34. PCR analysis of primary and passage tumor DNAs to determine the number of 62-bp element in the TBLV LTR enhancer.

Semi-nested PCR analysis of tumor DNA. Primary PCRs were performed using DNAs from unpassaged (1°) or passaged (P1 or P2) tumors and the indicated c-myc and TBLV LTR primers. The c-myc-LTR junction fragments were then purified, diluted, and used for secondary (2°) PCR with primers that flank the LTR enhancer repeats (LTR 408+ and LTR 786-). The numbered arrows to the right of the gels indicate the positions of fragments with different numbers (two to four) of enhancer repeats. The strong band at ca. 260 bp in some lanes represents one copy of the 62-bp enhancer region, and this has been confirmed by sequencing. All PCR mixtures were analyzed by agarose gel electrophoresis.

370

605497

262234

bp bpBA

LB

/c

1o P1 P2 1o P1 P2 1o P1 P2 1o P1 P2 1o P1 P2

T16 T17 T623B T623B T623B

c-myc 695+/TBLV-LTR786- c-

myc

585-

/T

BL

V-L

TR

408+

c-m

yc15

3-/

TB

LV

-LT

R40

8+

1o PCR primers:

2o PCR primers:TBLV-LTR408+/TBLV-LTR786-

BA

LB

/c

1o P1 P2

T9

1o P1 P2

T10

1o P1 P2

T5

262

497

605

234

1o P1 P2

T623B

c-m

yc58

5-/

TB

LV

-LT

R78

6-

c-m

yc58

5-/

TB

LV

-LT

R78

6-

c-m

yc69

5-/

TB

LV

-LT

R40

8+

c-m

yc28

7+/

TB

LV

-LT

R40

8+

234

1o PCR primers:

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18

19 20 21 22 23 24 25 26 27 28 29 30 31 32

2o PCR primers:TBLV-LTR408+/TBLV-LTR786-

M M

M

140

insertion in tumor 623B consisted of the 5’ LTR and gag leader sequences (data

not shown).

3.3.3 Construction of a genomic c-myc reporter gene vector

To analyze the effect of integration of TBLV transcriptional control

elements in or near the c-myc locus in an in vitro system, an appropriate reporter

vector, pc-mycRluc, was constructed. To generate the vector, pc-mycRluc, a

series of steps were performed. First, PCR was used to amplify a 5.1 kb product

from BALB/c genomic DNA including 2.9 kb of sequences 5’ of c-myc gene,

exon 1, intron 1, and 15 bp of exon 2 of c-myc. Second, PCR was used to amplify

most of c-myc exon 3 (bp 61 to 897) and 4.7 kb of the downstream flanking

region from BALB/c genomic DNA. Third, the Renilla luciferase gene and SV40

polyadenylation signal from the pRL-TK plasmid were amplified by PCR and

cloned together with the other products into pBluescript II SK(-) to generate pc-

mycRluc (Fig. 3.36). This plasmid contains all of the c-myc promoters (P0 –P3)

and an in-frame substitution of the open reading frame of c-myc with the Renilla

luciferase gene, followed by an SV40 polyadenylation signal. The majority of c-

myc exon 2 was replaced with the Renilla luciferase gene at the transcription start

site to directly measure effects on oncogene transcription and to avoid potential

secondary effects of c-myc overexpression (e.g., apoptosis) (310,321). Inserts

were verified by sequencing and restriction digests of the DNA. Expression of

Renilla luciferase by pc-mycRluc was confirmed by transient transfection of the

construct in RL? 1 and Jurkat T cells (data not shown).

141

Fig. 3.35. Semi-quantitative PCR analysis to determine the relative abundance of TBLV integrations near c-myc after tumor passage.

(A) DNA (200 ng) from the primary (1°) or passaged (P1 or P2) T9 tumor was subjected to threefold serial dilutions (the amount of DNA indicated by the height of the black triangles over the lanes) and used for PCRs with an antisense primer for c-myc exon 1 (c-myc585-) and an antisense TBLV LTR primer (LTR786-). (B) DNA (70 ng) from the primary or passaged T623B tumor was subjected to 3-fold serial dilutions and used for PCRs with an antisense primer in c-myc exon 1 (c-myc585-) and an antisense primer in the TBLV LTR (LTR786-). (C) DNA (600 ng) from the primary or passaged T623B was subjected to 3-fold serial dilutions and used for PCRs with an antisense primer in c-myc exon 1 (c-myc585-) and a sense primer in the TBLV LTR (LTR408+). All PCR mixtures were analyzed by agarose gel electrophoresis.

1o P1 P2

DNAA

B

C

T9 c-myc585-/TBLV-LTR786-

9400

6600

4400

1 2 3 4 5 6 7 8 9 10 11 12 13

T623Bc-myc585-/TBLV-LTR408+1226

887

1 2 3 4 5 6 7 8 9 10 11 12 13

Mbp

T623B

2955

1226

887

1 2 3 4 5 6 7 8 9 10 11 12 13

c-myc585-/TBLV-LTR786-

142

5 60 8-2-3 1 2 3 4

AfeI AvrII AatII StuI

7

KpnI AfeI RlucNcoI

-1

TBLV LTR

U3 U5R

U5R U3

Forward

Reverse

Exon2

P0 P1

P2P3 T16 T17

Exon1 Exon3

pA

Fig. 3.36. Strategy for detection of TBLV enhancer effects on c-myc transcription.

The locations of different c-myc promoters (P0 to P3) in the pc-mycRluc vector are indicated. The stop codon following the Renilla luciferase gene should prevent expression of sequences from the third exon of c-myc. TBLV LTRs were inserted in both orientations at the restriction sites shown in cellular DNA flanking the c-myc locus. The TBLV LTR insertions at the AvrII site represent examples of the constructs that were made. The numbers below the map indicate distance (in kilobases) relative to the beginning of exon 1.

143

3.3.4 Effect of enhancer repeats on c-myc promoter activity

The pc-mycRluc vector was used for insertion of TBLV LTRs containing

three enhancer repeats in both orientations relative to the c-myc promoters at

various distances in cellular flanking DNA. Previous data suggest that expression

of c-myc promoters is relatively normal if there is an appropriate enhancer within

the construct (203). The LTR-containing constructs were transfected into

triplicate cultures of Jurkat T cells, and the luciferase activity was determined

relative to that of the parental construct lacking the TBLV LTR (Fig. 3.37).

Values were normalized for DNA uptake by cotransfection of a plasmid

expressing firefly luciferase and displayed on a map according to their position

within the c-myc locus. These experiments revealed that LTRs inserted at virtually

any location were capable of stimulating transcription of the c-myc promoters

between 2- and 160-fold, consistent with the enhancer function of the TBLV LTR.

As expected, in many instances, enhancer activity was relatively independent of

the orientation.

Transfections of LTR-containing pc-mycRluc plasmids were also

performed in RL? 1 immature T cells (Fig. 3.38). Although fewer constructs

were tested in this line, the trend for LTR enhancer activity on the c-myc promoter

was the same as that observed using Jurkat T cells, with elevation of reporter gene

activity levels ranging from 5- to 160-fold. As expected from previous results

(247), transfections of these plasmids into XC rat fibroblasts showed that the

insertion of the TBLV LTR had no effect on c-myc expression in non-T-cell lines

(Fig. 3.39). In fact, when these plasmids were transfected into XC cells,

expression from the c-myc promoters was slightly repressed when the TBLV LTR

was present.

144

Fig. 3.37. Transcriptional activity of the c-myc reporter plasmids containing TBLV LTRs with three-repeat enhancers in Jurkat T cells.

Activity of the c-myc reporter plasmid after transient transfections. Relative luciferase activity was determined after normalization for DNA uptake. Luciferase activity was determined relative to the activity of the c-myc reporter plasmid in the absence of LTR insertion. The means of triplicate assays (± standard deviations) are shown. The positions of LTR insertions are shown relative to the first exon of c-myc. The hatch marks on the x axis indicate that the graph is not drawn to scale. Results of assays with plasmids containing LTRs either in the same transcriptional orientation as the c-myc gene (pink bars) or in the transcriptional orientation opposite that of the c-myc gene (hatched pink bars) are shown. Restriction enzyme site abbreviations: B, BamHI; X, XbaI; H, HindIII.

HBB

5 60 8-2

H

Rel

ativ

e R

luc

exp

ress

ion

75

50

25

100

125

150

0

-3

H

1 2 3 4AfeI

B

AvrII AatII StuI

175

7KpnI AfeI

NcoIExI Ex3

X

= forward orientation= reverse orientation

Rluc pA

145

Fig. 3.38. Transcriptional activity of the c-myc reporter plasmids containing TBLV LTRs with three-repeat enhancers in RL? 1 cells.

Activity of the c-myc reporter plasmid after transient transfections. Results are expressed as in Fig. 3.37.

75

50

25

100

125

150

0

175

Rel

ativ

e R

luc

exp

ress

ion

HBB H H B

5 60 1 2 3 4

AfeI AvrII AatII

7AfeI

Ex1 Ex3Rluc pA

X


-1

146

Fig. 3.39. Activity of the c-myc reporter plasmid after transient transfections in XC fibroblast cells.

Results are expressed as in Fig. 3.37.

Because the most clonal tumors had TBLV proviruses with four-repeat

enhancers in the LTR, Jurkat T cells also were transfected with plasmids that had

four-repeat LTRs at several different locations relative to c-myc (Fig. 3.40).

Interestingly, the presence of four repeats lowered overall expression 2- to 100-

fold from c-myc promoters relative to that obtained with LTRs with three repeats.

An exception was insertion of the four-repeat LTR in the AfeI site downstream

and in the reverse orientation, a proviral insertion site that was not observed in

tumor cells (Fig. 1.8). Nevertheless, in most instances, the presence of four 62-bp

Rel

ativ

e R

Lu

cex

pre

ssio

n

0.6

0.4

0.2

0.8

1.0

0HXB

B

5 60

HH

1 2 3 4

B

AvrII7

Afe IpAEx I Ex 3Rluc


147

Fig. 3.40. Comparison of the enhancer activity of LTRs containing three- or four-element enhancers on the c-myc promoters.

Insertions in the same transcriptional orientation as the c-myc gene are shown as gray bars, whereas insertions in the opposite orientation are shown as white bars. Restriction enzyme site abbreviations: B, BamHI; X, XbaI; H, HindIII. (A) Transient-transfection assays in Jurkat cells using c-mycRluc plasmids containing three-repeat enhancers. These results are duplicated from Fig. 3.37 using a different scale for ease of comparison to results in panel B. (B) Transient-transfection assays in Jurkat cells using c-mycRluc plasmids containing the four-repeat enhancer. Results are reported as described in the legend to Fig. 3.37. For unknown reasons, the LTR with the four-repeat enhancer could not be cloned in the reverse orientation in the AfeI site upstream of c-myc exon 1; therefore, only the forward orientation is shown.

Rel

ativ

e R

luc

exp

ress

ion

15

10

5

20

25

30

0

Rel

ativ

e R

luc

exp

ress

ion

B

H

5 6

75

50

25

100

0H

4

AfeI

B

AatII

7

AfeI

-1

H

1 2 30

A

BpA

XB

H

5 6

H

4

AfeI

B

AatII

7

AfeI

-1

H

1 2 30

B XB

= forward= reverse

pA

ExI

ExI

Rluc

Rluc

Ex3

Ex3

148

repeats in the enhancer appeared to lower transcriptional activity from both the

TBLV and c-myc promoters (Fig. 3.6 and 3.41).

To verify that the T-cell specific enhancer elements were responsible for

the increase in Renilla luciferase gene expression in these constructs, a number of

constructs were made with a TBLV LTR that contains no enhancer elements.

This mutant LTR was cloned into pc-mycRluc at the AatII and AvrII sites located

downstream of c-myc coding sequences. Transient transfection analysis in Jurkat

T cells showed that these mutant LTRs gave no elevation of reporter gene activity

relative to that of the pc-mycRluc vector alone (Fig. 3.41), demonstrating the

specific effect of the 62-bp elements in enhancement of c-myc promoters.

Fig. 3.41. Comparison of TBLV LTR insertions with different numbers of enhancer elements in transient transfections of Jurkat T cells.

Results are given as described in Fig. 3.37.

HBB

5 60

H

Rel

ativ

e R

luc

exp

ress

ion

75

50

25

100

125

150

0H

1 2 3 4

B

AvrII AatII

175

7

X

= forward (3)= reverse (3)

200

= forward (0)= reverse (0)

Ex3Rluc pAExI

149

3.3.5 The TBLV LTR confers glucocorticoid responsiveness to the c-myc promoters by enhancer activation

To determine the ability of the TBLV LTR to confer glucocorticoid

sensitivity to the c-myc promoters, a number of pc-mycRluc constructs were

transiently transfected into XC rat fibroblast cells and then treated with 10-6 M

DEX. As expected, the presence of the TBLV LTR allowed for glucocorticoid

induction of c-myc expression (Fig. 3.42). One exception was the 5’ sense

orientation insertion of the TBLV LTR at the AfeI site, which had no effect on

Renilla luciferase levels, perhaps due to promoter interference. Thus, similar to

MMTV, expression from the TBLV LTR confers steroid responsive to

neighboring cellular genes that are targets for enhancer insertion.

3.3.6 Contribution of point mutations in TBLV enhancer repeats to enhancement of c-myc promoters

Sequence analysis of the enhancer elements from TBLV integrations in

tumor DNA revealed a point mutation in N minus 1 of the enhancer elements (e.g.

2 out of 3, 3 out of 4). Although this may be due to the infidelity of the viral

reverse transcriptase during proviral synthesis, all of the constructs used for

analysis lacked these point mutations. To determine the significance of these

point mutations for transcription initiated from the TBLV LTR, these mutations

were cloned into reporter gene vectors to better mimic actual integrations by

TBLV. No effect of these point mutations was observed on TBLV LTR-

luciferase activity using transient transfections of Jurkat T cells (Fig. 3.43). To

150

Fig. 3.42. Activity of the c-myc reporter plasmids after DEX induction of transiently transfected XC fibroblast cells.

Cells were transfected with c-mycRluc-TBLV LTR reporter plasmids and treated as indicated with 10-6 M DEX 24 h later. After an additional 24 h in the presence or absence of DEX, cell extracts were prepared for reporter gene assays. Results are expressed as in Fig. 3.37.

HBB

5 60

H

Rel

ativ

e R

luc

expr

essi

on

H

1 2 3 4

B

AvrII7

X

= forward ( -DEX)= reverse ( -DEX)

= forward (+DEX)= reverse (+DEX)

Ex3Rluc pAExI0

2

4

6

8

10

12

14

AfeI

151

Fig. 3.43. Naturally occurring point mutations in enhancer elements do not alter transcription from the TBLV LTR.

A reporter construct with three enhancer elements and two point mutations was compared to one with three wild-type enhancer elements in Jurkat T cells. Results are given in relative light units/100 µg protein.

determine whether this point mutation had any effect on the ability of the LTR to

activate transcription from c-myc promoters, these point mutations also were

transferred into several of the pc-mycRluc–TBLV LTR constructs. With one

exception, analysis of these constructs using transient transfections of Jurkat T

cells showed that LTRs with point mutations were not as efficient as wild-type

LTRs at activating the c-myc promoters in three different locations, (Fig. 3.44).

The 5’ reverse orientation insertion site at AfeI had reporter gene levels that were

moderately higher than point mutant-containing LTRs at the same site.

00.5

11.5

22.5

33.5

TBLV-LUC TBLV-WT-LUC

DNA transfected

LU

C/1

00 u

g p

rote

in

152

Fig. 3.44. Comparison of the effect of TBLV LTR with or without enhancer point mutations on c-myc promoter activity in Jurkat cells.

Results are given as described in Fig. 3.37.

HBB

5 60 8-2

HRel

ativ

e R

luc

expr

essi

on

0

-3

H

1 2 3 4AfeI

B

AvrII AatII StuI7

AfeINcoI

ExI Ex3X


Rluc pA

35

45

40

30

25

20

15

10

5

= WT forward orientation= WT reverse orientation

153

4. Discussion

4.1 IDENTIFICATION OF A T-CELL-SPECIFIC ENHANCER IN THE TBLV LTR

TBLV causes exclusively T-cell lymphomas in mice (13,15). The major

differences between TBLV and closely related MMTV strains that cause

mammary carcinomas are a deletion of negative elements within the LTR and

triplication of unique sequences flanking the deletion (16). In this study, it has

been shown that the TBLV LTR triplication constitutes a cell-type-specific

enhancer element (247). In support of this idea, the LTR triplication inserted

upstream of the NREs increased MMTV promoter activity approximately 250-

fold in transient reporter gene assays in Jurkat T cells (Fig. 3.2A). Interestingly,

the location of the enhancer with respect to the NREs resulted in different effects

on promoter activity. Placement of the triplication downstream of the NREs (at

the AflII site) resulted in a greater increase relative to insertion upstream of the

NREs, comparable to transcription levels seen with the native TBLV LTR (data

not shown; S. Bhadra, personal communication). This suggests that the spacing

and/or order of the transcriptional control elements are critical for proper function

since placement of the enhancer sequences closer to the transcriptional start site

negates the regulatory effect of the NREs. In addition, the triplication elevated

reporter gene expression from the heterologous TK promoter 10- to 140-fold in T

cells when inserted upstream or downstream in either orientation (Fig. 3.4). Such

properties are consistent with the action of transcriptional enhancer elements

(20,33,201). Unlike some enhancers, however, the TBLV triplication enhances

expression specifically in T cells (Fig. 3.2, 3.4 and 3.5 and Table 3.1). Even a

closely related lymphoid lineage, B cells, did not support TBLV enhancer

function. Previous experiments by Paquette et al. (307) that used the TBLV LTR

154

to drive CD4 or c-myc expression also are consistent with the T-cell-specific

enhancer activity of the TBLV triplication. However, the latter experiments did

not distinguish the transcriptional activity of the triplication from the effects of

NRE deletion.

4.1.1 Enhancer function of the TBLV LTR on c-myc promoters

Recently members of our group reported that TBLV, similar to other

retroviruses that induce leukemias, frequently integrates near the c-myc oncogene

(328). In two of the tumors, the TBLV provirus inserted downstream up to 3 kb

from the c-myc third exon in the same transcriptional orientation. Both tumors

showed elevated levels of c-myc RNA compared to that obtained from normal

murine thymus or thymic lymphomas lacking TBLV integrations. Since there

was no alteration in the size of the c-myc RNA observed in TBLV-induced

tumors, these results favor the idea that the TBLV LTR, like the MMTV LTR,

activates oncogene expression primarily through enhancer, rather than promoter,

insertion (66,182,285,328).

Proviruses integrated near c-myc generally are inserted upstream in the

opposite orientation or downstream in the same transcriptional orientation as

MMTV proviruses found near Wnt-1 or fgf-3 in virus- induced mammary

carcinomas (66,66,285,285,289,314). Previous experiments have shown that the

levels of c-myc RNA are elevated 2- to 6-fold in TBLV-induced tumors compared

to healthy mouse thymus or radiation-induced tumors (328). This level of c-myc

elevation may be an underestimate in cells with TBLV insertions near the

oncogene because of tumor heterogeneity. Nevertheless, these results are

compatible with the enhancer insertion model for TBLV-induced tumors. TBLV

proviruses were also detected in the c-myc coding region using primary tumor

155

DNA and PCR primers within the c-myc coding regions (Fig. 1.8). Thus far,

hybrid transcripts have not been detected between the TBLV LTR and c-myc

coding sequences in RNA extracted from these T-cell tumors (328), suggesting

that most cells in the population overexpress RNA from the normal c-myc

promoters (104,234).

Prior results in transgenic mice indicate that the TBLV LTR can direct

reporter gene expression preferentially in CD4+ CD8+ T cells in vivo (307). The

TBLV U3 region has a deletion of sequences shown to suppress MMTV

transcription in lymphoid tissues (37,163,224) as well as a triplication of

sequences flanking the deletion (16,247). In addition, the cell-type-specific

enhancer combined with the deletion of NREs, is sufficient to change the

pathogenicity of MMTV from mammary tumors to T-cell lymphomas (274). In

agreement with these results, the TBLV LTR has enhancer activity for the c-myc

promoters in T cells (40). Using a genomic reporter gene vector, pc-mycRluc,

with the TBLV LTR (containing three enhancer elements) inserted upstream or

downstream of c-myc, elevation of reporter gene levels from approximately 2- to

160-fold was observed when transiently transfected in T cells. As expected,

enhancement of c-myc expression by the TBLV LTR was not observed when pc-

mycRluc constructs were analyzed in XC rat fibroblast cells (Fig. 3.39) and

enhancement was eliminated after removal of the 62-bp LTR repeats (Fig. 3.41).

Thus, it appears that TBLV enhancer elements can elevate transcription from

MMTV, TK, and c-myc promoters specifically in T cells.

Insertion of TBLV LTRs near the c-myc gene also confers glucocorticoid

responsiveness on the c-myc promoters (Fig. 3.42). This is not surprising since it

is known that the HRE of MMTV can confer hormone responsiveness to

heterologous promoters (165,232,406). The significance of this observation for

TBLV biology is unclear since TBLV enhancer activity in T cells is not

dependent on steroid hormones (Fig 3.30). Furthermore, TBLV and other

156

thymotropic MMTV strains cause lymphomas in both male and female mice,

suggesting that these strains of MMTV do not rely on the pregnancy-associated

hormonal stimulation of transcription that mammotropic MMTV strains require

for tumorigenesis (252).

4.1.2 Optimal number of enhancer elements for transcription in T cells

Different numbers of enhancer elements (two to four) were found in

TBLV proviruses integrated near the c-myc gene (Table 3.1). Experiments were

performed to determine if more copies of elements correlated with greater

enhancement of neighboring promoters. When the number of enhancer elements

was varied from one to four in the TBLV LTR, the highest transcription was

observed with two or three elements in the two T-cell lines tested (Fig. 3.6).

Interestingly, an LTR containing two enhancer elements was optimal in a

CD4+CD8+ T-cell line, whereas three enhancer elements was optimal in the CD4+

line (Fig. 3.6). This result suggests that the enhancer necessary for blood-borne

transmission of TBLV (three elements) is suboptimal for transformation of

thymocytes.

TBLV LTRs detected near c-myc in T-cell lymphomas commonly had

three or four enhancer elements. Therefore, similar experiments were performed

with the pc-mycRluc vector using three or four enhancer elements (Fig. 3.40).

When LTRs with four enhancer elements were inserted in the same site instead of

those with three elements, from 2- to 100-fold reductions in transcriptional

activity from the c-myc promoters were observed. An exception to this paradigm

was insertion of the LTR with a four-repeat enhancer into the AfeI site about 1 kb

downstream and in the reverse orientation from c-myc. In this case, four-repeat

LTRs gave approximately 30-fold elevation of oncogene expression, whereas

157

three-repeat LTRs had approximately twofold elevation. However, proviruses

with four-repeat enhancers in the LTR (from the T16 and T17 tumors) were

detected only in the forward orientation downstream of c-myc. If insertions are

compared at the AfeI site downstream and in the same orientation as that of c-myc

(the site closest to that of the T16 tumor integration), LTRs with four-repeat

enhancers gave 10-fold elevation of oncogene expression compared to 20-fold for

LTRs with three repeats. More than four copies of enhancer elements were not

tested since TBLV integrations have not been identified that have more than four

copies of the element. Since one would expect that more enhancer elements

would result in higher transcriptional activity, this result suggests selection for

lower expression of c-myc (discussed in Section 4.2).

Interestingly, the number of enhancer elements present in proviruses

recovered from SL3-3-induced tumors changed depending on when the tumors

were examined. In the pre- lymphomatous stage, LTRs containing two enhancer

elements predominated, whereas the majority of proviruses recovered from

lymphomas contained three or four copies of the enhancer. These results suggest

that the optimal number of enhancer elements for replication and leukemogenesis

or progression may be different (236). Two enhancer elements may provide

optimal MuLV transcription whereas three or four elements provide optimal

enhancer activity for proto-oncogene activation. Optimal (which may or may not

be the highest) transcription levels in proviruses integrated adjacent to cellular

oncogenes may confer a growth advantage and allow cells containing these

integrations to clonally outgrow cells with proviral integrations containing two

enhancer elements. In support of this theory, five of six SL3-3 proviruses

examined with integrations near c-myc or pim-1 had three enhancer elements

(268).

158

4.1.3 Significance of naturally-occurring point mutations in TBLV enhancers near c-myc promoters

Sequence analysis of TBLV LTRs from proviral integrations near c-myc

showed that there were single point mutations in N minus 1 of the enhancer

elements. Transient transfections with LTR-reporter vectors containing N minus

1 point mutations showed that these changes had no effect on transcription from

the TBLV promoter relative to those without mutations, but did have an effect on

transcription from c-myc promoters. With only one exception, LTRs containing

point mutations inserted in the pc-mycRluc vector were less efficient at elevating

transcription from the c-myc promoters than those without any mutations. The

significance of these point mutations for TBLV pathogenesis may be the same as

the selection for insertions near c-myc with four enhancer elements, i.e., decreased

oncogene expression (discussed in section 4.2). Retroviruses are known to have

high frequencies of misincorporation during reverse transcription, which could

have caused the single base changes during generation of the provirus

(68,95,333,334). A similar phenomenon has been observed in SL3-3 MuLV

proviral integrations near c-myc (268). In the case of SL3-3, variable numbers of

enhancer elements were also present with point mutations in N minus 1 of the

enhancers. The authors postulated that nucleotide misincorporation in one

enhancer element was followed by template misalignment during proviral

synthesis. These changes were presumably selected because they gave a

replicative advantage to the virus and/or a proliferative advantage to the infected

cells.

159

4.2 EVIDENCE FOR MODULATION OF C-MYC OVEREXPRESSION BY THE TBLV ENHANCER

Several types of evidence argue that there is selection for particular TBLV

insertion sites near c-myc. First, although viruses containing four-repeat LTR

enhancers appeared to be less than 10% of the injected population, both of the

most clonal tumors (as judged by Southern blotting) had proviral insertions with

four copies of the 62-bp enhancer element immediately downstream of c-myc.

Second, semi-nested PCR analysis showed that the polyclonal population of 623B

tumor cells lost proviral insertions that had three-repeat enhancers just upstream

and in the same orientation as the c-myc promoters after growth in

immunocompetent mice, consistent with selection against such insertions during

tumor passage (Fig. 3.34 and 3.35). In contrast, the same tumor showed an

apparent increase in the number of cells carrying proviruses with four-repeat

enhancers near c-myc using the same primers and PCR conditions. This insertion

was confirmed by sequencing. Thus, there appeared to be selection during

passage in mice (three of six tumors tested) for proviruses carrying four-repeat

enhancers near c-myc. Third, semi-quantitative PCR showed that there was

selection for TBLV proviruses containing a three-repeat enhancer at a position

approximately 1 kb upstream and in the opposite orientation in tumor 623B.

Interestingly, this is similar to the orientation and position of MuLV proviruses

integrated near c-myc in many murine T-cell lymphomas (73,194,218,268,290).

However, another TBLV integration with three-repeat enhancers in the LTR

located approximately 4 kb upstream and in the orientation opposite that of c-myc

appeared to decrease in the tumor population after passage (Fig. 3.36A). Such

results indicate that only particular insertions near c-myc are selected during tumor

progression.

160

What is the nature of the selection? Previous experiments have suggested

that MuLV LTR enhancers have been selected for optimal activity during T-cell

leukemogenesis (56,144,372). MuLVs containing mutations in c-Myb, Ets, or

RUNX1 binding sites that compromise enhancer activity of proviral LTRs were

shown to revert to the wild-type sequence when proviruses found in T-cell tumors

were characterized (236,439). Recent experiments indicate that proviruses with

two-repeat enhancers predominate early during infections, yet lymphomas

predominantly had proviruses with three- or four-repeat enhancers (268). Our

data suggest that TBLV proviruses that are clonally selected during lymphoma

growth frequently have insertions that activate c-myc transcription through the

LTR enhancer activity, but this activity may be modulated during tumor cell

selection. Possible mechanisms for modulation of c-myc expression include (i)

selection for tumor cells carrying TBLV insertions with suboptimal numbers of

enhancer repeats, (ii) selective growth of cells with a TBLV proviral orientation

relative to c-myc that minimizes oncogene overexpression, and (iii) selection for

increasing distance between c-myc and the TBLV provirus.

The following data support the assumption that TBLV proviruses near c-

myc may be selected for suboptimal oncogene expression. First, proviruses

located near c-myc in the most clonal tumors, T16 and T17, had four-repeat

enhancers in the LTR, rather than the three repeats observed in proviruses derived

from the tumor population used to prepare the inoculated virus. As discussed

earlier, experiments indicated that four-repeat enhancers reproducibly gave lower

transcriptional activity from the TBLV promoter than the three-repeat enhancers

in CD4+ Jurkat and CD4+ CD8+ RL? 1 T-cell lines (Fig. 3.6). Using constructs

where TBLV enhancer activity was assessed on the c-myc promoters (Fig. 3.40),

four-repeat LTRs gave up to 100-fold- lower expression than did three-repeat

LTRs. Second, the placement of LTRs relative to c-myc did not appear to be

optimal for oncogene overexpression. For example, the highest expression with

161

three-repeat LTRs was observed with insertions into the AvrII site 1.75 kb

downstream and in the orientation opposite that of c-myc. All of the proviruses

located in this region (T16, T604, and T17) were oriented in the forward

orientation (Fig. 1.8). Only the T602 tumor had a provirus that was located

downstream and in the reverse orientation and had three-enhancer repeats in the

LTR. This provirus was located approximately 2.5 kb further downstream than

insertions tested at the AvrII site, and the trend for constructs tested was a

decrease in c-myc expression in sites 3’ to AvrII. Third, semiquantitative PCR

indicated that cells carrying proviruses with three-repeat enhancers and in optimal

insertion sites for c-myc overexpression (for example, some of the T623B

insertions upstream and in the same orientation as the oncogene and the T9

insertion [Fig. 3.36A]) were diluted within the population after tumor passage. In

the case of T623B, cells carrying a solo LTR with a four-repeat enhancer quite

similar to the TBLV LTR tested at the AfeI site upstream of c-myc (Fig. 3.40)

were selected after tumor passage. Such results are consistent with selection for

suboptimal c-myc expression, since four-repeat enhancers at this position

decreased expression ca. 15-fold relative to expression with three-repeat

enhancers.

Why would there be selection against the highest levels of c-myc

expression? One explanation is that there is a threshold level of c-myc RNA that

is required to drive tumor cell growth, but above this threshold, oncogene

expression becomes cytotoxic or leads to apoptosis. Recent experiments using a

tetracycline-regulated c-myc oncogene indicate that continued proto-oncogene

expression is required for maintenance of leukemia cell growth (111). However,

several pieces of evidence also suggest that certain levels of c-myc lead to tumor

cell apoptosis. For example, in mice that express a hybrid protein that brings c-

Myc under the control of the ligand-binding domain of a modified estrogen

receptor, viability of the tumor cells was decreased in the presence of an estrogen

162

derivative (where c-myc expression was increased) (52). Moreover, other studies

have shown that upregulation of antiapoptotic genes, such as Gfi-1/pal-1 and Bcl-

2, can complement upregulation of c-myc during leukemogenesis (110,140,354).

Thus, these data lead to the intriguing hypothesis that transient increases in c-myc

levels or decreases in anti-apoptotic gene expression could be used therapeutically

to induce tumor cell destruction.

4.3 TRANSCRIPTION FACTORS BINDING TO A CRITICAL REGION OF THE TBLV ENHANCER

4.3.1 RUNX1 binding to the TBLV enhancer

Deletion mutations of the TBLV LTR suggested that the 5’ sequences of

the TBLV enhancer were critical for optimal activity (Fig. 3.7). To determine the

sequences necessary for TBLV enhancer function, substitution mutations were

engineered in a single copy of the 62-bp element that then were triplicated and

inserted into a C3H MMTV LTR lacking the NREs. The activities of these

mutant LTRs upstream of a luciferase reporter gene were tested in transient

transfection assays in two different T-cell lines (Fig. 3.9). A single substitution

mutant (556M) showed dramatic loss of enhancer function in both cell lines, and

this mutation overlapped a putative RUNX1 binding site (GTGCGGTTC)

(compare to consensus in Fig. 3.11). Several pieces of evidence confirm that

RUNX1 binding contributes to TBLV enhancer function. (i) Gel shift

experiments showed that RUNX1 DNA binding activity was detectable in whole-

cell extracts from Jurkat cells using a wild-type probe that overlapped the

556 mutation within the TBLV LTR. This complex had a molecular mass similar

163

to that detected with a known RUNX1 binding site probe. (ii) The DNA binding

activity for the TBLV LTR was confirmed to be RUNX1, as judged by supershift

experiments with specific antibody; the supershifted complex was not obtained

with antibody against RUNX3 or RUNX2 (data not shown). (iii) The RUNX1

supershift was greatly reduced by the addition of an excess of the RUNX1 peptide

used to produce the antibody. (iv) Overexpression of RUNX1B, but not RUNX2

(96), in mammary cells was sufficient to elevate TBLV LTR activity 30-fold

compared to cells without RUNX1B overexpression (Fig. 3.15 and data not

shown). Therefore, enhancer mutations, gel shift experiments, and overexpression

assays indicated that RUNX1 DNA binding activity contributes to the cell- type-

specific activity of the TBLV enhancer.

MMTV strains that induce leukemias (other than TBLV) also have been

described (98,210,251,435). Invariably these strains have an LTR deletion

spanning the NREs, and in some cases, the sequences flanking the deletion are

multimerized. The multimers encompass sequences in the LTRs of several

mammotropic MMTV proviruses (RGTGGT) that match five of six bases within a

consensus RUNX1 binding site (YGYGGT) (16,210,251,435). Lee et al. showed

that the altered LTR from the DBA/2 ML T-cell tumor was more transcriptionally

active in NIH 3T3 cells than mammotropic MMTV LTRs (210), whereas another

altered LTR from the DL-8 tumor showed enhanced activity in mammary cells

compared to LTRs derived from mammotropic MMTVs (435). However, TBLV

enhancer activity was only observed in T-cell lines. Similarly, Yanagawa et al.

(435) and Theunissen et al. (388) showed that altered MMTV enhancer elements

from DBA/2 or GR-derived leukemias could stimulate transcription in T cells

above that observed with mammotropic LTRs. As pointed out by Yanagawa et al.

(435), the region of the LTR containing a RUNX1 binding site contributes greatly

to T-cell enhancer function. Thus, RUNX1 DNA-binding activity may be

164

important for T-cell-specific enhancer activities of many leukemogenic MMTV

strains.

4.3.2 Importance of NF-A and NF-B for enhancer activity

NF-A and NF-B bind to the crucial region of the TBLV enhancer (Fig.

4.1). NF-A resolves on EMSA gels into at least three complexes and appears to

be lymphoid-specific since binding activity is only detected in T- and B-cell

extracts. Based on mutational analysis of the region 5’ of the RUNX1 site in the

TBLV enhancer (Fig. 3.27) and oligonucleotide competition with HIV-1 enhancer

sequences (Fig. 3.21), it appears that the NF-A complex is comprised of at least

two different factors. Deletion of sequences 5’ of the RUNX1 binding site

drastically reduces the activity of the enhancer in T cells (Fig. 3.7). In addition,

NF-A.1, which constitutes the lowest mobility band of the NF-A complex (Fig.

3.27), appears to be the major contributor to TBLV enhancer activity since

mutation of the NF-A.1 binding site reduces transcriptional activity in T cells by

approximately 80%, whereas either the RUNX1 or the NF-B binding site

mutation only reduced activity by ca. 40% (Fig 3.28). A sequence (CAGGTA)

related to an E-box (CACGTG) overlaps with the 5’ end of the RUNX1 binding

site in the TBLV enhancer. Since NF-A binding is affected by the 548 mutation

and appears to be present in T- and B-cell extracts, it is possible the NF-A

complex contains a lymphoid-specific E-box binding protein. NF-B binding

activity is detectable in all cell types tested thus far and is necessary for full

enhancer function, but does not appear to be the crucial factor for T-cell

specificity of the TBLV enhancer. However, the exact roles of NF-A and NF-B

in TBLV transcription will await their identification.

165

4.3.3 ALY enhancement of RUNX1 activity on the TBLV enhancer

The transcriptional co-activator ALY was identified by biochemical

purification of proteins that bind to the critical region of the TBLV enhancer.

ALY interacts with RUNX1 and LEF-1 on the TCRα enhancer to increase the

transcriptional activity of these two factors (43). ALY cannot bind DNA alone.

Instead, other transcription factors tether ALY to target DNA and activate

transcription. Expression of ALY in HC11 mammary epithelial cells had no

effect on TBLV promoter activity (data not shown). However, when RUNX1 and

ALY were co-expressed in HC11 cells, ALY enhanced RUNX1-mediated

activation of TBLV due to minimal levels of RUNX1 in these cells (Fig. 3.19).

Similar results were seen in EL4b T cells (Fig. 3.20). However, ALY expression

alone also was able to activate TBLV independent of RUNX1 overexpression due

to higher levels of endogenous RUNX1 relative to HC11 cells. It is possible that

ALY bridges RUNX1, NF-A and/or NF-B proteins on the TBLV enhancer to

allow cooperative activation. This is the first report of ALY activity on a viral

promoter. Although there have been no reports of ALY function on MuLV

enhancers, it is possible that there is also cooperation between ALY and RUNX1

on these enhancers.

4.3.4 NF-κB binding to the TBLV enhancer

The role of NF-κB binding to the TBLV enhancer is unclear. When

overexpressed in HC11 cells, the NF-κB subunits NF-κB-1 and NF-κB-2 can

activate the TBLV enhancer (Fig. 3.23). However, when co-expressed with

RUNX1, the activation seen with either protein alone is abrogated, regardless of

166

mutation of either DNA-binding site (Fig. 3.25). Furthermore, sequestration of

NF-κB proteins in the cytoplasm by a DN IκB has no significant effect on TBLV

LTR activity in T cells. Interestingly, when DN IκB is co-expressed with

RUNX1 in B cells, the RUNX1-mediated activation of the TBLV LTR is elevated

relative to that seen when RUNX1 is overexpressed alone. This suggests that NF-

κB may have a role in modulating the enhancer in non-T cells.

The identification of an NF-κB binding site in the TBLV enhancer is

novel among enhancers from murine retroviruses that cause lymphomas and

leukemias. NF-κB binds HIV-1 enhancers and cooperates with neighboring Sp1

and NFAT sites to activate transcription in T cells (175,186,313). NF-κB also

regulates transcription of a number of other viruses, including adenoviruses (426),

JC virus (238) as well as herpes viruses HSV-1 (338) and CMV (347). NF-κB

activates lymphoid-specific expression of early region 3 genes in adenovirus. The

CMV enhancer contains four κB-binding sites, but full enhancer function in

embryonic lung cells requires additional factors. JC virus requires NF-κB binding

for optimal transcriptional activity in glial cells. Thus, NF-κB can activate

transcription in lymphoid or non- lymphoid cells depending on cooperating factors

that bind different promoters. TBLV may represent a unique retroviral enhancer

element that combines components of the MuLV (c-Myb and RUNX1) and HIV-

1 (NF-κB) enhancers.

4.3.5 HMG and hnRNP roles in transcriptional regulation

Three other proteins identified by mass spectrometry of enhancer-binding

factors were HMG1, HMG2 and hnRNPA1/A2. HMG proteins are non-specific

DNA-bending proteins that enhance the affinity of other DNA-binding proteins

167

for their recognition sites. HMG proteins play a role in the architecture of the

enhanceosome (55,245). Studies using Epstein Barr virus (EBV) activator

proteins have revealed two models for how HMG1 proteins act to promote

enhanceosome assembly. The first model is based on binding of HMG1 and

ZEBRA to target gene promoters. In these studies, it was shown that HMG1

bound the promoter in a sequence-dependent manner, the HMG1 binding site was

flanked on either side by ZEBRA protein-binding sites, and HMG1 binding was

cooperative with ZEBRA binding (106). Later studies using the EBV activator

protein Rta showed that HMG1 enhanced binding of Rta to DNA, but was not

part of the nucleoprotein complex and did not stably bind DNA near the Rta

binding site (257). According to this model, HMG proteins may bend DNA to

allow the binding of Rta, but HMG binding to the promoter sequences is transient.

Therefore, HMG may act in different ways based on the promoter sequence and

interacting factors.

The hnRNP A1 protein is an RNA-binding protein usually associated with

pre-mRNA processing (11) or maintenance of telomere length (199). However,

hnRNP A1 has been implicated in binding to double-stranded DNA and

transcriptional regulation of a number of promoters, including a vitamin D-

resistant promoter (59,60), the thymidine kinase (TK) promoter (202) as well as

the APOE gene promoter (53). This protein suppresses transcription from the TK

promoter as well as both basal and induced expression from vitamin D-responsive

promoters. In contrast, hnRNPA1 activates the APOE promoter, suggesting that

the context in which this protein binds to promoters determines its effect on

transcriptional activity.

Experiments to determine the role of HMG1, HMG2 and hnRNP A1

proteins in TBLV enhancer activity have not been performed. However, there is

recent evidence that these proteins, which have not previously been associated

168

with transcriptional regulation, modulates the activity of a number of promoters

(53,59,60,106,202,257).

4.4 CONTRIBUTION OF GR AND C-M YB TO TBLV ENHANCER FUNCTION

Interestingly, like the MuLV enhancers, the TBLV 62-bp element contains

a consensus GR binding site, and this sit e mediates glucocorticoid-stimulated

transcription in XC fibroblasts (Fig. 3.29). The 586 mutation in the TBLV

enhancer spans both GR and c-Myb binding sites (Fig. 4.1). Experiments showed

that these sites were most important for function of the enhancer in Jurkat CD4+ T

cells, and not in CD4+ CD8+ cells, one of the major cell targets for TBLV-induced

leukemias (Fig. 4.1, 586 mutation) (249,272). Moreover, experiments using

hormone-stripped serum suggested that the factor in Jurkat cells that binds to the

GR element of the TBLV enhancer is not GR (Fig. 3.30). It is possible that

another factor may bind near the GR site and may be related to the basic helix-

loop-helix (bHLH) proteins SEF2 or ALF1 shown to bind the MuLV enhancers

(280,281).

Binding of c-Myb to the TBLV enhancer has been detected by EMSA

(data not shown). The contribution of c-Myb to enhancer activity has been

confirmed by overexpression in HC11 mammary epithelial cells, resulting in

activation of the TBLV LTR. RUNX1 and c-Myb co-expression in HC11 cells

resulted in additive activation of the TBLV LTR, in contrast to the antagonism

seen with the co-expression of RUNX1 and NF-κB proteins in HC11 cells.

169

4.5 MECHANISM OF RETROVIRAL ENHANCERS ACTIVE IN T CELLS

RUNX1 binding activity is crucial for the activity of the MuLV family of

enhancers, including those from the gibbon ape and feline leukemia viruses (439).

Many experiments have shown MuLV LTRs carry viral determinants of

leukemogenicity (56,85,170,213,339) in tandem repeats of 50- to 100-bp

segments of the U3 region (131). Exchange of Friend and Moloney MuLV LTR

repeat regions also switched the type of leukemia induced (57,130,170). Within

the enhancer repeat region of MuLVs that cause T-cell tumors are binding sites

for RUNX1. Some MuLVs that induce rapidly appearing T-cell leukemias (e.g.,

SL3-3) have two binding sites for RUNX1 (called cores I and II) in the 72-bp

repeat element (438,439), and therefore four RUNX1 binding sites in the

enhancer, whereas other MuLVs, such as Moloney, have a single RUNX1 binding

site in each repeat element (281). Core I of SL3-3 appears to have the strongest

affinity for binding to RUNX1 (438), and mutations within this binding site

reduce leukemogenicity in mice and transcriptional activity in T-cell lines

(216,236,438,439). An MuLV strain (SAA) that has a 1-bp mutation in core I of

each enhancer repeat (TGTGGTCAA) is weakly leukemogenic compared to SL3-

3 (containing TGTGGTTAA), and most SAA-induced lymphomas had reversions

or second-site suppressor mutations within the enhancer (236). Interestingly, there

is a general correlation between increased affinity of RUNX1 for the core I

enhancer and both transcriptional activity in T cells and leukemogenicity.

However, this correlation can be subtle. For example, the RUNX1 DNA-binding

(Runt) domain has an apparent Kd of 3.5 × 10 11 for core I of the weakly

leukemogenic Akv virus and an apparent Kd of 2.4 × 10 11 for the highly

leukemogenic SL3-3 core (216). This observation suggests that binding of factors

in addition to RUNX1 is important for MuLV leukemogenicity.

170

Fig. 4.1. Diagram of TBLV enhancer-binding factors and activity of corresponding substitution mutations.

(A) The TBLV enhancer element is comprised of 18 bp from 5’ sequences flanking the deletion (hatched box) and 44 bp from the 3’ flanking sequences (open box). Transcription factors that bind the TBLV enhancer are shown by circles and boxes. (B) Reporter gene activity of mutant enhancers in transient assays in Jurkat (yellow) or RL?1 (pink) T cells. Means of triplicate assays with standard deviations are shown. Luciferase activity was determined as described in the legend to Fig. 3.2 except that values are relative to that of the pTBLV-WT-LUC vector (assigned a value of 100). The enhancer element in panel A is aligned with the corresponding mutations in panel B to show the location of binding sites and transcriptional activity of mutants spanning these sites.

NF-Ac-myb

NF-BNF-κB

RUNX1

18 bp 44 bpALY

GR

0

50

100

150

200

WT54

0M54

8M55

6M56

4M57

2M57

8M58

6M59

4M

Rel

ativ

e L

UC

val

ue


A

B

171

A number of other transcription factor complexes have been reported to

bind to the MuLV enhancer repeats, including Ets-1, Myb, GR, NF1, and bHLH

proteins (Fig. 4.2) (74,131,280,371). In the Moloney MuLV enhancer, the

RUNX1 binding site is flanked by Ets-1 binding sites (also called LVb and LVc)

(371,381). Intact binding sites for both Ets-1 and RUNX1 are required for

constitutive activity of the MuLV and TCR β-chain enhancers in T-cells (381).

Recent evidence suggests that interactions between Ets-1 and RUNX1 stimulate

binding to DNA (430) and that the interaction counteracts autoinhibitory

sequences in both proteins (127,141). The Myb-binding site (like core II) is

present only in the SL3-3 and Gross passage A virus (281). Mutations of the Myb

site in the SL3-3 LTR had greater effects on enhancer activity in T cells than did

mutations of the Ets site; however, other MuLVs (e.g., Moloney) that lack Myb

sites also have high transcriptional activity in T cells (281). Nevertheless, these

data indicate that RUNX1 binding in conjunction with several other proteins may

provide potent transcriptional enhancement in T cells. The evidence that RUNX1

overexpression in HC11 causes a 30-fold elevation of transcription from the

TBLV LTR (Fig. 3.15) strongly suggests that RUNX1 binding also contributes to

the activity of the novel TBLV enhancer.

The TBLV enhancer contains a novel assembly of transcription factor

binding sites, combining sites commonly found in MuLV enhancers (c-Myb, GR

and RUNX1) and in the HIV-1 enhancer (NF-κB). Similar to MuLV enhancers,

TBLV contains a GR binding site, but does not appear to require GR at this site to

activate transcription. According to Nielsen et al., bHLH E-box proteins bind to

an E-box overlapping the HRE in MuLV enhancers to activate transcription (280).

However, there have been no reports of c-Myb binding to overlapping sequences

in the region of the MuLV GR site. In data presented here, a functional c-Myb

site has been identified that overlaps with the HRE in the TBLV enhancer.

Oligonucleotide competition with consensus binding site sequences for c-Myb or

172

Ets family members do not compete for NF-A or NF-B binding activity,

suggesting that the TBLV enhancer is more divergent from the typical MuLV

enhancer structure. TBLV and some MuLVs do share a c-Myb site, but the

position of the site relative to the RUNX1 site is different between these viral

enhancers (Fig. 4.2). Furthermore, co-expression of c-Myb and RUNX1 is not

synergistic on the TBLV enhancer, while this synergism is observed on the SL3-3

enhancer. This suggests that a different mechanism of transcriptional activation is

used for each virus to achieve the T-cell enhancer effect.

In contrast to MuLVs, TBLV has an NF-κB binding site in the crucial

region of the enhancer (548-556 region) (Fig. 4.1). As mentioned previously, the

NF-κB sites in the HIV-1 enhancer play a critical role in transcriptional regulation

and replication of the virus (58,198). The role of the κB site in the TBLV

enhancer is unclear since elimination of NF-κB binding by a DN IκB has a

negligible effect on enhancer function in T cells. It is possible that the κB site,

similar to the GR site in the TBLV enhancer, overlaps with binding site(s) for

positive factors that are more abundant in T cells (i.e., NF-A), and NF-κB may

function to modulate enhancer activity in non-T cells. In support of this

hypothesis, depletion of NF-κB from the nucleus of B cells results in higher

RUNX1-mediated activation of the TBLV enhancer. However, a role for B cells

in TBLV infection has not been established (S. Bhadra, personal communication).

NF-κB may bind to the enhancer in other cell types and function to block binding

of any positive factors or may cooperate with other factors on the DNA to repress

transcription in these cells. Since the antagonistic relationship of RUNX1 and

NF-κB in HC11 mammary cells does not appear to depend on DNA binding,

further experiments are necessary to determine the nature of the interaction.

There may be a direct protein-protein between RUNX1 and NF-κB or the effect

could be mediated via some other mechanism, such as squelching of other factors.

173

Fig. 4.2. Schematic representation of factors binding to the TBLV enhancer and other retroviral enhancers active in T cells.

Numbers outside the brackets indicate the number of enhancer elements commonly observed in proviruses. Known transcription factor-binding sites are shown. The numbers in parentheses refer to the length in base pairs of a single enhancer element.

NF1

NFAEts Runx1bHLH GR

NFBE-box c-Myb

MoMuLV (75 bp)2

FeLV (50 bp)2

Akv (99 bp)2

SL3-3 (72 bp)2

TBLV (62 bp)3

NF-kB Sp-1

AP-2

HIV-1 (26 bp)1

NFAT

174

Fig. 4.3. Phylogenetic analysis of retroviral enhancers active in lymphoid cells.

This diagram was obtained using Vector NTI, version 7.0 software (Informax, Inc. Bethesda, MD).

Irrespective of the outcome of these experiments, it does not appear that NF-κB is

a positive regulator of TBLV enhancer function in T cells.

In agreement with analysis of binding sites in various retroviral enhancers

active in T cells (Fig. 4.2), sequence analysis shows that MuLV and FeLV

enhancers are the most closely related as the nucleotide level as well. Somewhat

surprisingly, the thymotropic MMTV enhancers (DL-8, DBA/2 t-MMTV and

TBLV) aligned more closely with the HIV-1 enhancer than with those from the

DBA/2 t-MMTVTBLV

DL-8HIV-1

Moloney MuLVFriend MuLV

FeLVMCF 247

AKVGross MuLVSL3-3 MuLV

175

MuLVs or FeLV (Fig. 4.3). The ability of the HIV-1 enhancer to compete for

binding of NF-B and part of NF-A complexes suggests that the HIV-1 and TBLV

enhancers share more than NF-κB binding.

In the present study of a T-cell-specific enhancer, it is interesting to note

that, similar to MuLV enhancers in which T-cell enhancer function has been

studied, there does not appear to be one T-cell-specific factor that is responsible

for the activity. Instead, the specific combination and relative abundance of

transcription factors present in T cells and the organization of binding sites on the

enhancer appears to determine the T-cell specificity of the TBLV enhancer.

Much work remains to be done to fully understand the mechanism of the TBLV

enhancer action. Identification of NF-A, NF-B and other factors that bind the

enhancer in both T and non-T cells will help elucidate the powerful and specific

action of this enhancer. Transfer of specific mutations to a molecular clone of

TBLV and subsequent infection of susceptible mice will allow understanding of

the importance of individual factors and regions of the enhancer to the tissue-

specificity of tumorigenesis, the pathogenicity of the virus and tumor latency.

The composition of the enhancer is critical for determining the ability of the virus

to activate certain oncogenes (i.e., c-myc), which can influence tumor formation

(100,268). The TBLV enhancer is a useful tool for studying cell-type-specific

transcriptional regulation and its role in the disease tropism of a model retrovirus.

176

Appendix A

List of abbreviations used:

AML-1 acute myeloid leukemia 1 AMV avian myeloblastosis virus BEF basic region- leucine zipper (bZIP) enhancing factor bHLH basic helix- loop-helix CA capsid CBF core binding factor CBP/p300 CREB-binding protein/adenovirus E1A-associated 300 kDa

protein CDP CCAAT displacement protein COX-2 cyclooxygenase-2 DBD DNA binding domain DU dUTPase Ex exon FeLV feline leukemia virus Fgf fibroblast growth factor GM-CSF granulocyte-monocyte colony stimulating factor GR glucocoricoid receptor GRR glycine-rich region HERV-K human endogenous retrovirus K HIV-1 human immunodeficiency virus 1 hnRNP heterogeneous nuclear ribonucleoprotein HRE hormone responsive element HTLV-1 human T-cell leukemia virus type 1 IκB inhibitor of κB ICAM intercellular adhesion molecule IL interleukin IN integrase iNOS inducible nitric oxide synthase IR inverted repeat KO knockout LEF-1 lymphoid enhancer binding factor 1 LT α/β lymphotoxin α and β LTR long terminal repeat LZ leucine zipper MA matrix MCP1 monocyte

177

MGE mammary gland enhancer MHC major histocompatibility complex mim-1 myb induced myeloid protein 1 MIP1α macrophage inflammatory protein α MMTV mouse mammary tumor virus MoMuLV moloney murine leukemia virus MPO myeloperoxidase MRE myb responsive element mTfR1 murine transferring receptor 1 MTVR1 MMTV receptor 1 MTVR2 MMTV receptor 2 MuLV murine leukemia virus NC nucleocapsid NF-κB nuclear factor required for immunoglobulin kappa light chain

transcription in B cells NFAT nuclear factor of activated T cells NLS nuclear localization sequence NRD negative regulatory domain NRE negative regulatory element OCT-1 octamer 1 PB primer binding site PBS phosphate buffered saline PCR polymerase chain reaction PEA2 polyomavirus enhancer activating protein 2 PEBP2αB polyomavirus enhancer binding protein 2 αB PR protease RANTES regulated upon activation normal T-cell expressed and secreted RBD RNA-binding domain RD runt domain REF RNA export factor Rev-T reticuloendotheliosis virus strain T rhd runt homology domain RHD rel homology domain RNase ribonuclease RNP ribonucleoprotein RT reverse transcriptase RUNX1 runt-related transcription factor 1 S/A-CBFαB SL3-3/Akv-core binding factor αB SA splice acceptor SAA serum amyloid A Sag superantigen SATBI special AT-rich binding protein 1

178

SD splice donor SEF-1αB SL3-3 enhancer factor 1 αB subunit SU surface protein TAD transcription activation domain TAP tip-associate protein TBLV type B leukemogenic virus TCR T cell receptor TFIID transcription factor II D TLE1 transducin- like element 1 TM transmembrane TNFα tumor necrosis factor-α VCAM vascular cellular adhesion molecule

179

Appendix B

180

References

1. Acha-Orbea, H., W. Held, G. A. Waanders, A. N. Shakhov, L.

Scarpellino, R. K. Lees, and H. R. MacDonald. 1993. Exogenous and endogenous mouse mammary tumor virus superantigens. Immunol.Rev. 131:5-25.

2. Acha-Orbea, H. and H. R. MacDonald. 1995. Superantigens of mouse mammary tumor virus. Annu.Rev.Immunol. 13:459-486.

3. Acha-Orbea, H., A. N. Shakhov, L. Scarpellino, E. Kolb, V. Muller, A. Vessaz-Shaw, R. Fuchs, K. Blochlinger, P. Rollini, J. Billotte, and . 1991. Clonal deletion of V beta 14-bearing T cells in mice transgenic for mammary tumour virus. Nature 350:207-211.

4. Amtoft, H. W., A. B. Sorensen, C. Bareil, J. Schmidt, A. Luz, and F. S. Pedersen. 1997. Stability of AML1 (core) site enhancer mutations in T lymphomas induced by attenuated SL3-3 murine leukemia virus mutants. J.Virol. 71:5080-5087.

5. Anfossi, G., A. M. Gewirtz, and B. Calabretta. 1989. An oligomer complementary to c-myb-encoded mRNA inhibits proliferation of human myeloid leukemia cell lines. Proc.Natl.Acad.Sci.U.S.A 86:3379-3383.

6. Anrather, J., V. Csizmadia, M. P. Soares, and H. Winkler. 1999. Regulation of NF-kappaB RelA phosphorylation and transcriptional activity by p21(ras) and protein kinase Czeta in primary endothelial cells. J.Biol.Chem. 274:13594-13603.

7. Archer, T. K., P. Lefebvre, R. G. Wolford, and G. L. Hager. 1992. Transcription factor loading on the MMTV promoter: a bimodal mechanism for promoter activation. Science 255:1573-1576.

8. Arroyo, J., E. Winchester, B. S. McLellan, and B. T. Huber. 1997. Shared promoter elements between a viral superantigen and the major histocompatibility complex class II-associated invariant chain. J.Virol. 71:1237-1245.

9. Asano, K., W. C. Merrick, and J. W. Hershey. 1997. The trans lation initiation factor eIF3-p48 subunit is encoded by int-6, a site of frequent

181

integration by the mouse mammary tumor virus genome. J.Biol.Chem. 272:23477-23480.

10. Austen, B. M. 1979. Predicted secondary structures of amino-terminal extension sequences of secreted proteins. FEBS Lett. 103:308-313.

11. Bai, Y., D. Lee, T. Yu, and L. A. Chasin. 1999. Control of 3' splice site choice in vivo by ASF/SF2 and hnRNP A1. Nucleic Acids Res. 27:1126-1134.

12. Baldwin, A. S., Jr. 1996. The NF-kappa B and I kappa B proteins: new discoveries and insights. Annu.Rev.Immunol. 14:649-683.

13. Ball, J. K., L. O. Arthur, and G. A. Dekaban. 1985. The involvement of a type-B retrovirus in the induction of thymic lymphomas. Virology 140:159-172.

14. Ball, J. K. and G. A. Dekaban. 1987. Characterization of early molecular biological events associated with thymic lymphoma induction following infection with a thymotropic type-B retrovirus. Virology 161:357-365.

15. Ball, J. K., G. A. Dekaban, J. A. McCarter, and S. M. Loosmore . 1983. Molecular biological characterization of a highly leukaemogenic virus isolated from the mouse. III. Identity with mouse mammary tumour virus. J.Gen.Virol. 64 (Pt 10):2177-2190.

16. Ball, J. K., H. Diggelmann, G. A. Dekaban, G. F. Grossi, R. Semmler, P. A. Waight, and R. F. Fletcher. 1988. Alterations in the U3 region of the long terminal repeat of an infectious thymotropic type B retrovirus. J.Virol. 62:2985-2993.

17. Ball, J. K. and J. A. McCarter . 1971. Repeated demonstration of a mouse leukemia virus after treatment with chemical carcinogens. J.Natl.Cancer Inst. 46:751-762.

18. Ball, R. K., R. R. Friis, C. A. Schoenenberger, W. Doppler, and B. Groner. 1988. Prolactin regulation of beta-casein gene expression and of a cytosolic 120-kd protein in a cloned mouse mammary epithelial cell line. EMBO J. 7:2089-2095.

19. Banerjee, C., S. W. Hiebert, J. L. Stein, J. B. Lian, and G. S. Stein. 1996. An AML-1 consensus sequence binds an osteoblast-specific

182

complex and transcriptionally activates the osteocalcin gene. Proc.Natl.Acad.Sci.U.S.A 93:4968-4973.

20. Banerji, J., S. Rusconi, and W. Schaffner. 1981. Expression of a beta-globin gene is enhanced by remote SV40 DNA sequences. Cell 27:299-308.

21. Beg, A. A. and A. S. Baldwin, Jr. 1993. The I kappa B proteins: multifunctional regulators of Rel/NF-kappa B transcription factors. Genes Dev. 7:2064-2070.

22. Beg, A. A., W. C. Sha, R. T. Bronson, and D. Baltimore . 1995. Constitutive NF-kappa B activation, enhanced granulopoiesis, and neonatal lethality in I kappa B alpha-deficient mice. Genes Dev. 9:2736-2746.

23. Beg, A. A., W. C. Sha, R. T. Bronson, S. Ghosh, and D. Baltimore . 1995. Embryonic lethality and liver degeneration in mice lacking the RelA component of NF-kappa B. Nature 376:167-170.

24. Berge, T., S. L. Bergholtz, K. B. Andersson, and O. S. Gabrielsen. 2001. A novel yeast system for in vivo selection of recognition sequences: defining an optimal c-Myb-responsive element. Nucleic Acids Res. 29:E99.

25. Bergman, A. C., O. Bjornberg, J. Nord, P. O. Nyman, and A. M. Rosengren. 1994. The protein p30, encoded at the gag-pro junction of mouse mammary tumor virus, is a dUTPase fused with a nucleocapsid protein. Virology 204:420-424.

26. Berkowitz, R., J. Fisher, and S. P. Goff. 1996. RNA packaging. Curr.Top.Microbiol.Immunol. 214:177-218.

27. Bernhard, W. 1958. Electron microscopy of tumor cells and tumor viruses: a review. Cancer Research 18:491-509.

28. Beutner, U., E. Kraus, D. Kitamura, K. Rajewsky, and B. T. Huber. 1994. B cells are essential for murine mammary tumor virus transmission, but not for presentation of endogenous superantigens. J.Exp.Med. 179:1457-1466.

183

29. Bies, J. and L. Wolff. 1997. Oncogenic activation of c-Myb by carboxyl-terminal truncation leads to decreased proteolysis by the ubiquitin-26S proteasome pathway. Oncogene 14:203-212.

30. Bishop, J. M. 1978. Retroviruses. Annu.Rev.Biochem. 47:35-88.

31. Bittner, J. J. 1936. Some Possible Effects of Nursing on the Mammary Gland Tumor Incidence in Mice. Science 84:162.

32. Bittner, J. J. 1943. Possible relationship of the oestrogenic hormones, genetic susceptibility and milk influence in the production of mammary cancer in mice. Cancer Res. 2:710-721.

33. Blackwood, E. M. and J. T. Kadonaga. 1998. Going the distance: a current view of enhancer action. Science 281:61-63.

34. Boral, A. L., S. A. Okenquist, and J. Lenz. 1989. Identification of the SL3-3 virus enhancer core as a T- lymphoma cell-specific element. J.Virol. 63:76-84.

35. Bosselut, R., F. Lim, P. C. Romond, J. Frampton, J. Brady, and J. Ghysdael. 1992. Myb protein binds to multiple sites in the human T cell lymphotropic virus type 1 long terminal repeat and transactivates LTR-mediated expression. Virology 186:764-769.

36. Bours, V., G. Franzoso, V. Azarenko, S. Park, T. Kanno, K. Brown, and U. Siebenlist. 1993. The oncoprotein Bcl-3 directly transactivates through kappa B motifs via association with DNA-binding p50B homodimers. Cell 72:729-739.

37. Bramblett, D., C. L. Hsu, M. Lozano, K. Earnest, C. Fabritius, and J. Dudley. 1995. A redundant nuclear protein binding site contributes to negative regulation of the mouse mammary tumor virus long terminal repeat. J.Virol. 69:7868-7876.

38. Brandt-Carlson, C. and J. S. Butel. 1991. Detection and characterization of a glycoprotein encoded by the mouse mammary tumor virus long terminal repeat gene. J.Virol. 65:6051-6060.

39. Britos-Bray, M. and A. D. Friedman. 1997. Core binding factor cannot synergistically activate the myeloperoxidase proximal enhancer in immature myeloid cells without c-Myb. Mol.Cell Biol. 17:5127-5135.

184

40. Broussard, D. R., J. A. Mertz, M. Lozano, and J. P. Dudley. 2002. Selection for c-myc integration sites in polyclonal T-cell lymphomas. J.Virol. 76:2087-2099.

41. Brown, A. M., M. W. Linhoff, B. Stein, K. L. Wright, A. S. Baldwin, Jr., P. V. Basta, and J. P. Ting. 1994. Function of NF-kappa B/Rel binding sites in the major histocompatibility complex class II invariant chain promoter is dependent on cell-specific binding of different NF-kappa B/Rel subunits. Mol.Cell Biol. 14:2926-2935.

42. Brown, K., S. Gerstberger, L. Carlson, G. Franzoso, and U. Siebenlist. 1995. Control of I kappa B-alpha proteolysis by site-specific, signal-induced phosphorylation. Science 267:1485-1488.

43. Bruhn, L., A. Munnerlyn, and R. Grosschedl. 1997. ALY, a context-dependent coactivator of LEF-1 and AML-1, is required for TCRalpha enhancer function. Genes Dev. 11 :640-653.

44. Bryant, M. and L. Ratner. 1990. Myristoylation-dependent replication and assembly of human immunodeficiency virus 1. Proc.Natl.Acad.Sci.U.S.A 87:523-527.

45. Buetti, E. 1994. Stably integrated mouse mammary tumor virus long terminal repeat DNA requires the octamer motifs for basal promoter activity. Mol.Cell Biol. 14:1191-1203.

46. Burd, C. G. and G. Dreyfuss. 1994. Conserved structures and diversity of functions of RNA-binding proteins. Science 265:615-621.

47. Burkly, L., C. Hession, L. Ogata, C. Reilly, L. A. Marconi, D. Olson, R. Tizard, R. Cate, and D. Lo. 1995. Expression of relB is required for the development of thymic medulla and dendritic cells. Nature 373:531-536.

48. Burns, C. E., T. DeBlasio, Y. Zhou, J. Zhang, L. Zon, and S. D. Nimer. 2002. Isolation and characterization of runxa and runxb, zebrafish members of the runt family of transcriptional regulators. Exp.Hematol. 30:1381-1389.

49. Bushman, F. D. and M. D. Miller. 1997. Tethering human immunodeficiency virus type 1 preintegration complexes to target DNA promotes integration at nearby sites. J.Virol. 71:458-464.

185

50. Calafat, J., F. Buijs, P. C. Hageman, J. Links, J. Hilgers, and A. Hekman. 1974. Distribution of virus particles and mammary tumor virus antigens in mouse mammary tumors, transformed BALB-c mouse kidney cells, and GR ascites leukemia cells. J.Natl.Cancer Inst. 53:977-992.

51. Calafat, J. and P. Hageman. 1968. Some remarks on the morphology of virus particles of the B type and their isolation from mammary tumors. Virology 36:308-312.

52. Cameron, E. R., J. Morton, C. J. Johnston, J. Irvine, M. Bell, D. E. Onions, J. C. Neil, M. Campbell, and K. Blyth. 2000. Fas-independent apoptosis in T-cell tumours induced by the CD2-myc transgene. Cell Death.Differ. 7:80-88.

53. Campillos, M., J. R. Lamas, M. A. Garcia, M. J. Bullido, F. Valdivieso, and J. Vazquez. 2003. Specific interaction of heterogeneous nuclear ribonucleoprotein A1 with the -219T allelic form modulates APOE promoter activity. Nucleic Acids Res. 31 :3063-3070.

54. Cardiff, R. D., M. J. Puentes, L. J. Young, G. H. Smith, Y. A. Teramoto, B. W. Altrock, and T. S. Pratt. 1978. Serological and biochemical characterization of the mouse mammary tumor virus with localization of p10. Virology 85:157-167.

55. Carey, M. 1998. The enhanceosome and transcriptional synergy. Cell 92:5-8.

56. Chatis, P. A., C. A. Holland, J. W. Hartley, W. P. Rowe, and N. Hopkins . 1983. Role for the 3' end of the genome in determining disease specificity of Friend and Moloney murine leukemia viruses. Proc.Natl.Acad.Sci.U.S.A 80:4408-4411.

57. Chatis, P. A., C. A. Holland, J. E. Silver, T. N. Frederickson, N. Hopkins, and J. W. Hartley. 1984. A 3' end fragment encompassing the transcriptional enhancers of nondefective Friend virus confers erythroleukemogenicity on Moloney leukemia virus. J.Virol. 52:248-254.

58. Chen, B. K., M. B. Feinberg, and D. Baltimore . 1997. The kappaB sites in the human immunodeficiency virus type 1 long terminal repeat enhance virus replication yet are not absolutely required for viral growth. J.Virol. 71:5495-5504.

186

59. Chen, H., M. Hewison, B. Hu, and J. S. Adams . 2003. Heterogeneous nuclear ribonucleoprotein (hnRNP) binding to hormone response elements: a cause of vitamin D resistance. Proc.Natl.Acad.Sci.U.S.A 100:6109-6114.

60. Chen, H., B. Hu, E. A. Allegretto, and J. S. Adams . 2000. The vitamin D response element-binding protein. A novel dominant-negative regulator of vitamin D-directed transactivation. J.Biol.Chem. 275:35557-35564.

61. Chiao, P. J., S. Miyamoto, and I. M. Verma. 1994. Autoregulation of I kappa B alpha activity. Proc.Natl.Acad.Sci.U.S.A 91:28-32.

62. Choi, Y., J. W. Kappler, and P. Marrack. 1991. A superantigen encoded in the open reading frame of the 3' long terminal repeat of mouse mammary tumour virus. Nature 350:203-207.

63. Choi, Y., P. Marrack, and J. W. Kappler. 1992. Structural analysis of a mouse mammary tumor virus superantigen. J.Exp.Med. 175:847-852.

64. Choi, Y. W., D. Henrard, I. Lee, and S. R. Ross. 1987. The mouse mammary tumor virus long terminal repeat directs expression in epithelial and lymphoid cells of different tissues in transgenic mice. J.Virol. 61:3013-3019.

65. Churchill, M. J., R. G. Ramsay, D. I. Rhodes, and N. J. Deacon. 2001. c-Myb influences HIV type 1 gene expression and virus production. AIDS Res.Hum.Retroviruses 17 :1481-1488.

66. Clausse, N., D. Baines, R. Moore, S. Brookes, C. Dickson, and G. Peters . 1993. Activation of both Wnt-1 and Fgf-3 by insertion of mouse mammary tumor virus downstream in the reverse orientation: a reappraisal of the enhancer insertion model. Virology 194:157-165.

67. Coffin, J. M. 1984. Endogenous Viruses, p. 1162-1173. In R. Weiss, N. Teich, H. Varmus, and J. M. Coffin (ed.), RNA Tumor Viruses. Raven Press, New York.

68. Coffin, J. M., P. N. Tsichlis, C. S. Barker, S. Voynow, and H. L. Robinson. 1980. Variation in avian retrovirus genomes. Ann.N.Y.Acad.Sci. 354:410-425.

69. Coffman, J. A., C. V. Kirchhamer, M. G. Harrington, and E. H. Davidson. 1996. SpRunt-1, a new member of the runt domain family of

187

transcription factors, is a positive regulator of the aboral ectoderm-specific CyIIIA gene in sea urchin embryos. Dev.Biol. 174:43-54.

70. Cohen, J. C. and H. E. Varmus . 1979. Endogenous mammary tumour virus DNA varies among wild mice and segregates during inbreeding. Nature 278:418-423.

71. Colgin, M. A. and J. K. Nyborg . 1998. The human T-cell leukemia virus type 1 oncoprotein Tax inhibits the transcriptional activity of c-Myb through competition for the CREB binding protein. J.Virol. 72:9396-9399.

72. Coope, H. J., P. G. Atkinson, B. Huhse, M. Belich, J. Janzen, M. J. Holman, G. G. Klaus, L. H. Johnston, and S. C. Ley. 2002. CD40 regulates the processing of NF-kappaB2 p100 to p52. EMBO J. 21:5375-5385.

73. Corcoran, L. M., J. M. Adams, A. R. Dunn, and S. Cory. 1984. Murine T lymphomas in which the cellular myc oncogene has been activated by retroviral insertion. Cell 37:113-122.

74. Corneliussen, B., A. Thornell, B. Hallberg, and T. Grundstrom. 1991. Helix- loop-helix transcriptional activators bind to a sequence in glucocorticoid response elements of retrovirus enhancers. J.Virol. 65:6084-6093.

75. Craven, R. C., A. E. Leure-duPree, R. A. Weldon, Jr., and J. W. Wills. 1995. Genetic analysis of the major homology region of the Rous sarcoma virus Gag protein. J.Virol. 69:4213-4227.

76. Daga, A., C. A. Karlovich, K. Dumstrei, and U. Banerjee. 1996. Patterning of cells in the Drosophila eye by Lozenge, which shares homologous domains with AML1. Genes Dev. 10:1194-1205.

77. Dalton, A. J. 1966. An electron microscopic study of a virus- induced murine sarcoma (Moloney). Natl.Cancer Inst.Monogr 22:143-168.

78. Damen, W. G., M. Weller, and D. Tautz. 2000. Expression patterns of hairy, even-skipped, and runt in the spider Cupiennius salei imply that these genes were segmentation genes in a basal arthropod. Proc.Natl.Acad.Sci.U.S.A 97:4515-4519.

79. Dasgupta, P., C. D. Reddy, P. Saikumar, and E. P. Reddy. 1992. The cellular proto-oncogene product Myb acts as transcriptional activator of

188

the long terminal repeat of human T- lymphotropic virus type I. J.Virol. 66:270-276.

80. Dasgupta, P., P. Saikumar, C. D. Reddy, and E. P. Reddy. 1990. Myb protein binds to human immunodeficiency virus 1 long terminal repeat (LTR) sequences and transactivates LTR-mediated transcription. Proc.Natl.Acad.Sci.U.S.A 87:8090-8094.

81. Davis, N., S. Ghosh, D. L. Simmons, P. Tempst, H. C. Liou, D. Baltimore, and H. R. Bose, Jr. 1991. Rel-associated pp40: an inhibitor of the rel family of transcription factors. Science 253:1268-1271.

82. de Parseval, N., H. Alkabbani, and T. Heidmann. 1999. The long terminal repeats of the HERV-H human endogenous retrovirus contain binding sites for transcriptional regulation by the Myb protein. J.Gen.Virol. 80 ( Pt 4):841-845.

83. Dekaban, G. A. and J. K. Ball. 1984. Integration of type B retroviral DNA in virus- induced primary murine thymic lymphomas. J.Virol. 52:784-792.

84. Deroo, B. J. and T. K. Archer. 2001. Glucocorticoid receptor-mediated chromatin remodeling in vivo. Oncogene 20:3039-3046.

85. DesGroseillers, L. and P. Jolicoeur. 1984. The tandem direct repeats within the long terminal repeat of murine leukemia viruses are the primary determinant of their leukemogenic potential. J.Virol. 52:945-952.

86. DesGroseillers, L., E. Rassart, and P. Jolicoeur. 1983. Thymotropism of murine leukemia virus is conferred by its long terminal repeat. Proc.Natl.Acad.Sci.U.S.A 80:4203-4207.

87. Dickinson, L. A., T. Joh, Y. Kohwi, and T. Kohwi-Shigematsu. 1992. A tissue-specific MAR/SAR DNA-binding protein with unusual binding site recognition. Cell 70:631-645.

88. Dickson, C. and M. Atterwill. 1979. Composition, arrangement and cleavage of the mouse mammary tumor virus polyprotein precursor Pr77gag and p110gag. Cell 17:1003-1012.

89. Dickson, C. and G. Peters . 1983. Proteins encoded by mouse mammary tumour virus. Curr.Top.Microbiol.Immunol. 106:1-34.

189

90. Dickson, C. and J. J. Skehel. 1974. The polypeptide composition of mouse mammary tumor virus. Virology 58:387-395.

91. Dickson, C., R. Smith, S. Brookes, and G. Peters . 1984. Tumorigenesis by mouse mammary tumor virus: proviral activation of a cellular gene in the common integration region int-2. Cell 37:529-536.

92. Dievart, A., N. Beaulieu, and P. Jolicoeur. 1999. Involvement of Notch1 in the development of mouse mammary tumors. Oncogene 18:5973-5981.

93. Doi, T. S., T. Takahashi, O. Taguchi, T. Azuma, and Y. Obata. 1997. NF-kappa B RelA-deficient lymphocytes: normal development of T cells and B cells, impaired production of IgA and IgG1 and reduced proliferative responses. J.Exp.Med. 185:953-961.

94. Donehower, L. A., A. L. Huang, and G. L. Hager. 1981. Regulatory and coding potential of the mouse mammary tumor virus long terminal redundancy. J.Virol. 37:226-238.

95. Dougherty, J. P. and H. M. Temin. 1988. Determination of the rate of base-pair substitution and insertion mutations in retrovirus replication. J.Virol. 62:2817-2822.

96. Drissi, H., Q. Luc, R. Shakoori, L. S. Chuva De Sousa, J. Y. Choi, A. Terry, M. Hu, S. Jones, J. C. Neil, J. B. Lian, J. L. Stein, A. J. van Wijnen, and G. S. Stein. 2000. Transcriptional autoregulation of the bone related CBFA1/RUNX2 gene. J.Cell Physiol 184:341-350.

97. Dudek, H. and E. P. Reddy. 1989. Identification of two translational products for c-myb. Oncogene 4:1061-1066.

98. Dudley, J. and R. Risser. 1984. Amplification and novel locations of endogenous mouse mammary tumor virus genomes in mouse T-cell lymphomas. J.Virol. 49:92-101.

99. Dudley, J. P. 1999. Mouse mammary tumor virus, p. 965-972. In R. G. Webster and A. Granoff (ed.), Encyclopedia of Virology. Academic Press, Ltd., London.

100. Dudley, J. P., J. A. Mertz, L. Rajan, M. Lozano, and D. R. Broussard. 2002. What retroviruses teach us about the involvement of c-Myc in leukemias and lymphomas. Leukemia 16:1086-1098.

190

101. Duh, E. J., W. J. Maury, T. M. Folks, A. S. Fauci, and A. B. Rabson. 1989. Tumor necrosis factor alpha activates human immunodeficiency virus type 1 through induction of nuclear factor binding to the NF-kappa B sites in the long terminal repeat. Proc.Natl.Acad.Sci.U.S.A 86:5974-5978.

102. Durgam, V. R. and R. R. Tekmal. 1994. The nature and expression of int-5, a novel MMTV integration locus gene in carcinogen- induced mammary tumors. Cancer Lett. 87:179-186.

103. Dushay, M. S., B. Asling, and D. Hultmark. 1996. Origins of immunity: Relish, a compound Rel- like gene in the antibacterial defense of Drosophila. Proc.Natl.Acad.Sci.U.S.A 93:10343-10347.

104. Eick, D., A. Polack, E. Kofler, G. M. Lenoir, A. B. Rickinson, and G. W. Bornkamm. 1990. Expression of P0- and P3-RNA from the normal and translocated c-myc allele in Burkitt's lymphoma cells. Oncogene 5:1397-1402.

105. Elliott, J. F., B. Pohajdak, D. J. Talbot, J. Shaw, and V. Paetkau. 1988. Phorbol diester- inducible, cyclosporine-suppressible transcription from a novel promoter within the mouse mammary tumor virus env gene. J.Virol. 62:1373-1380.

106. Ellwood, K. B., Y. M. Yen, R. C. Johnson, and M. Carey. 2000. Mechanism for specificity by HMG-1 in enhanceosome assembly. Mol.Cell Biol. 20:4359-4370.

107. Ernst, M., C. Schmid, and E. R. Froesch. 1989. Phenol red mimics biological actions of estradiol: enhancement of osteoblast proliferation in vitro and of type I collagen gene expression in bone and uterus of rats in vivo. J.Steroid Biochem. 33 :907-914.

108. Evans, J. L., T. L. Moore, W. M. Kuehl, T. Bender, and J. P. Ting. 1990. Functional analysis of c-Myb protein in T- lymphocytic cell lines shows that it trans-activates the c-myc promoter. Mol.Cell Biol. 10:5747-5752.

109. Fan, H., M. Palmarini, and J. C. DeMartini. 2003. Transformation and oncogenesis by jaagsiekte sheep retrovirus. Curr.Top.Microbiol.Immunol. 275:139-177.

191

110. Fanidi, A., E. A. Harrington, and G. I. Evan. 1992. Cooperative interaction between c-myc and bcl-2 proto-oncogenes. Nature 359:554-556.

111. Felsher, D. W. and J. M. Bishop. 1999. Reversible tumorigenesis by MYC in hematopoietic lineages. Mol.Cell 4:199-207.

112. Fletcher, T. M., B. W. Ryu, C. T. Baumann, B. S. Warren, G. Fragoso, S. John, and G. L. Hager. 2000. Structure and dynamic properties of a glucocorticoid receptor- induced chromatin transition. Mol.Cell Biol. 20:6466-6475.

113. Fouret, P., R. M. du Bois, J. F. Bernaudin, H. Takahashi, V. J. Ferrans, and R. G. Crystal. 1989. Expression of the neutrophil elastase gene during human bone marrow cell differentiation. J.Exp.Med. 169:833-845.

114. Franzoso, G., V. Bours, V. Azarenko, S. Park, M. Tomita-Yamaguchi, T. Kanno, K. Brown, and U. Siebenlist. 1993. The oncoprotein Bcl-3 can facilitate NF-kappa B-mediated transactivation by removing inhibiting p50 homodimers from select kappa B sites. EMBO J. 12:3893-3901.

115. Franzoso, G., V. Bours, S. Park, M. Tomita-Yamaguchi, K. Kelly, and U. Siebenlist. 1992. The candidate oncoprotein Bcl-3 is an antagonist of p50/NF-kappa B-mediated inhibition. Nature 359:339-342.

116. Fromm, M. and P. Berg. 1982. Deletion mapping of DNA regions required for SV40 early region promoter function in vivo. J.Mol.Appl.Genet. 1:457-481.

117. Fryer, C. J. and T. K. Archer . 1998. Chromatin remodelling by the glucocorticoid receptor requires the BRG1 complex. Nature 393:88-91.

118. Furuichi, Y., A. J. Shatkin, E. Stavnezer, and J. M. Bishop. 1975. Blocked, methylated 5'-terminal sequence in avian sarcoma virus RNA. Nature 257:618-620.

119. Gallahan, D., C. Kozak, and R. Callahan. 1987. A new common integration region (int-3) for mouse mammary tumor virus on mouse chromosome 17. J.Virol. 61:218-220.

120. Garcia, M., R. Wellinger, A. Vessaz, and H. Diggelmann. 1986. A new site of integration for mouse mammary tumor virus proviral DNA

192

common to BALB/cf(C3H) mammary and kidney adenocarcinomas. EMBO J. 5:127-134.

121. Gewirtz, A. M., G. Anfossi, D. Venturelli, S. Valpreda, R. Sims, and B. Calabretta. 1989. G1/S transition in normal human T- lymphocytes requires the nuclear protein encoded by c-myb. Science 245:180-183.

122. Gewirtz, A. M. and B. Calabretta. 1988. A c-myb antisense oligodeoxynucleotide inhibits normal human hematopoiesis in vitro. Science 242:1303-1306.

123. Ghosh, S., M. J. May, and E. B. Kopp. 1998. NF-kappa B and Rel proteins: evolutionarily conserved mediators of immune responses. Annu.Rev.Immunol. 16:225-260.

124. Ghozi, M. C., Y. Bernstein, V. Negreanu, D. Levanon, and Y. Groner. 1996. Expression of the human acute myeloid leukemia gene AML1 is regulated by two promoter regions. Proc.Natl.Acad.Sci.U.S.A 93:1935-1940.

125. Gilmore, T. D. 1999. Multiple mutations contribute to the oncogenicity of the retroviral oncoprotein v-Rel. Oncogene 18:6925-6937.

126. Girard, L., Z. Hanna, N. Beaulieu, C. D. Hoemann, C. Simard, C. A. Kozak, and P. Jolicoeur. 1996. Frequent provirus insertional mutagenesis of Notch1 in thymomas of MMTVD/myc transgenic mice suggests a collaboration of c-myc and Notch1 for oncogenesis. Genes Dev. 10:1930-1944.

127. Goetz, T. L., T. L. Gu, N. A. Speck, and B. J. Graves. 2000. Auto-inhibition of Ets-1 is counteracted by DNA binding cooperativity with core-binding factor alpha2. Mol.Cell Biol. 20:81-90.

128. Goff, S. P. 1990. Retroviral reverse transcriptase: synthesis, structure, and function. J.Acquir.Immune.Defic.Syndr. 3:817-831.

129. Golay, J., V. Facchinetti, G. Ying, and M. Introna. 1997. The A-myb transcription factor in neoplastic and normal B cells. Leuk.Lymphoma 26:271-279.

130. Golemis, E., Y. Li, T. N. Fredrickson, J. W. Hartley, and N. Hopkins . 1989. Distinct segments within the enhancer region collaborate to specify

193

the type of leukemia induced by nondefective Friend and Moloney viruses. J.Virol. 63:328-337.

131. Golemis, E. A., N. A. Speck, and N. Hopkins . 1990. Alignment of U3 region sequences of mammalian type C viruses: identification of highly conserved motifs and implications for enhancer design. J.Virol. 64:534-542.

132. Golovkina, T. V., A. Chervonsky, J. P. Dudley, and S. R. Ross. 1992. Transgenic mouse mammary tumor virus superantigen expression prevents viral infection. Cell 69 :637-645.

133. Golovkina, T. V., J. P. Dudley, A. B. Jaffe, and S. R. Ross. 1995. Mouse mammary tumor viruses with functional superantigen genes are selected during in vivo infection. Proc.Natl.Acad.Sci.U.S.A 92:4828-4832.

134. Golovkina, T. V., J. P. Dudley, and S. R. Ross. 1998. B and T cells are required for mouse mammary tumor virus spread within the mammary gland. J.Immunol. 161:2375-2382.

135. Golovkina, T. V., J. Dzuris, H. B. van den, A. B. Jaffe, P. C. Wright, S. M. Cofer, and S. R. Ross. 1998. A novel membrane protein is a mouse mammary tumor virus receptor. J.Virol. 72:3066-3071.

136. Golovkina, T. V., M. Shlomchik, L. Hannum, and A. Chervonsky. 1999. Organogenic role of B lymphocytes in mucosal immunity. Science 286:1965-1968.

137. Gonda, T. J. and D. Metcalf. 1984. Expression of myb, myc and fos proto-oncogenes during the differentiation of a murine myeloid leukaemia. Nature 310:249-251.

138. Gorer PA. 1950. Studies in antibody response of mice to tumour inoculation. Br.J.Cancer 4:372-379.

139. Grilli, M., J. J. Chiu, and M. J. Lenardo. 1993. NF-kappa B and Rel: participants in a multiform transcriptional regulatory system. Int.Rev.Cytol. 143:1-62.

140. Grimes, H. L., C. B. Gilks, T. O. Chan, S. Porter, and P. N. Tsichlis. 1996. The Gfi-1 protooncoprotein represses Bax expression and inhibits T-cell death. Proc.Natl.Acad.Sci.U.S.A 93:14569-14573.

194

141. Gu, T. L., T. L. Goetz, B. J. Graves, and N. A. Speck. 2000. Auto-inhibition and partner proteins, core-binding factor beta (CBFbeta) and Ets-1, modulate DNA binding by CBFalpha2 (AML1). Mol.Cell Biol. 20:91-103.

142. Guerra, J., D. A. Withers, and L. M. Boxer. 1995. Myb binding sites mediate negative regulation of c-myb expression in T-cell lines. Blood 86:1873-1880.

143. Gunzburg, W. H., F. Heinemann, S. Wintersperger, T. Miethke, H. Wagner, V. Erfle, and B. Salmons . 1993. Endogenous superantigen expression controlled by a novel promoter in the MMTV long terminal repeat. Nature 364:154-158.

144. Hallberg, B., J. Schmidt, A. Luz, F. S. Pedersen, and T. Grundstrom. 1991. SL3-3 enhancer factor 1 transcriptional activators are required for tumor formation by SL3-3 murine leukemia virus. J.Virol. 65:4177-4181.

145. Hansen, S. K., P. A. Baeuerle, and F. Blasi. 1994. Purification, reconstitution, and I kappa B association of the c-Rel-p65 (RelA) complex, a strong activator of transcription. Mol.Cell Biol. 14:2593-2603.

146. Hansen, S. K., L. Guerrini, and F. Blasi. 1994. Differential DNA sequence specificity and regulation of HIV-1 enhancer activity by cRel-RelA transcription factor. J.Biol.Chem. 269:22230-22237.

147. Haraguchi, S., R. A. Good, R. W. Engelman, S. Greene, and N. K. Day. 1997. Prolactin, epidermal growth factor or transforming growth factor-alpha activate a mammary cell-specific enhancer in mouse mammary tumor virus-long terminal repeat. Mol.Cell Endocrinol. 129:145-155.

148. Haskill, S., A. A. Beg, S. M. Tompkins, J. S. Morris, A. D. Yurochko, A. Sampson-Johannes, K. Mondal, P. Ralph, and A. S. Baldwin, Jr. 1991. Characterization of an immediate-early gene induced in adherent monocytes that encodes I kappa B-like activity. Cell 65:1281-1289.

149. Hatfield, D. and S. Oroszlan. 1990. The where, what and how of ribosomal frameshifting in retroviral protein synthesis. Trends Biochem.Sci. 15:186-190.

150. Hebbar, P. B. and T. K. Archer. 2003. Nuclear factor 1 is required for both hormone-dependent chromatin remodeling and transcriptional

195

activation of the mouse mammary tumor virus promoter. Mol.Cell Biol. 23:887-898.

151. Henderson, L. E., H. C. Krutzsch, and S. Oroszlan. 1983. Myristyl amino-terminal acylation of murine retrovirus proteins: an unusual post-translational proteins modification. Proc.Natl.Acad.Sci.U.S.A 80:339-343.

152. Henrard, D. and S. R. Ross. 1988. Endogenous mouse mammary tumor virus is expressed in several organs in addition to the lactating mammary gland. J.Virol. 62:3046-3049.

153. Herman, A., J. W. Kappler, P. Marrack, and A. M. Pullen. 1991. Superantigens: mechanism of T-cell stimulation and role in immune responses. Annu.Rev.Immunol. 9:745-772.

154. Hernandez-Munain, C. and M. S. Krangel. 1994. Regulation of the T-cell receptor delta enhancer by functional cooperation between c-Myb and core-binding factors. Mol.Cell Biol. 14:473-483.

155. Hernandez-Munain, C. and M. S. Krangel. 1995. c-Myb and core-binding factor/PEBP2 display functional synergy but bind independently to adjacent sites in the T-cell receptor delta enhancer. Mol.Cell Biol. 15:3090-3099.

156. Hernandez-Munain, C. and M. S. Krangel. 2002. Distinct roles for c-Myb and core binding factor/polyoma enhancer-binding protein 2 in the assembly and function of a multiprotein complex on the TCR delta enhancer in vivo. J.Immunol. 169:4362-4369.

157. Heusch, M., L. Lin, R. Geleziunas, and W. C. Greene . 1999. The generation of nfkb2 p52: mechanism and efficiency. Oncogene 18:6201-6208.

158. Higuchi, R. 1990. Recombinant PCR, p. 177-183. In M. A. Innis, D.H.Gelfand, J.J.Sninsky, and T.J.White (ed.), PCR Protocols, a guide to methods and applications. Academic Press, Inc., San Diego, CA.

159. Hizi, A., L. E. Henderson, T. D. Copeland, R. C. Sowder, C. V. Hixson, and S. Oroszlan. 1987. Characterization of mouse mammary tumor virus gag-pro gene products and the ribosomal frameshift site by protein sequencing. Proc.Natl.Acad.Sci.U.S.A 84:7041-7045.

196

160. Hizi, A., L. E. Henderson, T. D. Copeland, R. C. Sowder, H. C. Krutzsch, and S. Oroszlan. 1989. Analysis of gag proteins from mouse mammary tumor virus. J.Virol. 63:2543-2549.

161. Horwitz, B. H., M. L. Scott, S. R. Cherry, R. T. Bronson, and D. Baltimore . 1997. Failure of lymphopoiesis after adoptive transfer of NF-kappaB-deficient fetal liver cells. Immunity. 6:765-772.

162. Howe, K. M., C. F. Reakes, and R. J. Watson. 1990. Characterization of the sequence-specific interaction of mouse c-myb protein with DNA. EMBO J. 9:161-169.

163. Hsu, C. L., C. Fabritius, and J. Dudley. 1988. Mouse mammary tumor virus proviruses in T-cell lymphomas lack a negative regulatory element in the long terminal repeat. J.Virol. 62:4644-4652.

164. Hutchison, K. A., L. C. Scherrer, M. J. Czar, L. F. Stancato, Y. H. Chow, R. Jove, and W. B. Pratt. 1993. Regulation of glucocorticoid receptor function through assembly of a receptor-heat shock protein complex. Ann.N.Y.Acad.Sci. 684:35-48.

165. Hynes, N., A. J. van Ooyen, N. Kennedy, P. Herrlich, H. Ponta, and B. Groner. 1983. Subfragments of the large terminal repeat cause glucocorticoid-responsive expression of mouse mammary tumor virus and of an adjacent gene. Proc.Natl.Acad.Sci.U.S.A 80:3637-3641.

166. Imai, S., J. Morimoto, Y. Tsubura, Y. Iwai, M. Okumoto, Y. Takamori, A. Tsubura, and J. Hilgers . 1983. Tissue and organ distribution of mammary tumor virus antigens in low and high mammary cancer strain mice. Eur.J.Cancer Clin.Oncol. 19:1011-1019.

167. Imai, S., M. Okumoto, M. Iwai, S. Haga, N. Mori, N. Miyashita, K. Moriwaki, J. Hilgers, and N. H. Sarkar. 1994. Distribution of mouse mammary tumor virus in Asian wild mice. J.Virol. 68:3437-3442.

168. Inoue, J., L. D. Kerr, A. Kakizuka, and I. M. Verma. 1992. I kappa B gamma, a 70 kd protein identical to the C-terminal half of p110 NF-kappa B: a new member of the I kappa B family. Cell 68:1109-1120.

169. Ip, Y. T., M. Reach, Y. Engstrom, L. Kadalayil, H. Cai, S. Gonzalez-Crespo, K. Tatei, and M. Levine . 1993. Dif, a dorsal-related gene that mediates an immune response in Drosophila. Cell 75:753-763.

197

170. Ishimoto, A., M. Takimoto, A. Adachi, M. Kakuyama, S. Kato, K. Kakimi, K. Fukuoka, T. Ogiu, and M. Matsuyama. 1987. Sequences responsible for erythroid and lymphoid leukemia in the long terminal repeats of Friend-mink cell focus-forming and Moloney murine leukemia viruses. J.Virol. 61:1861-1866.

171. Jacks, T., K. Townsley, H. E. Varmus, and J. Majors . 1987. Two efficient ribosomal frameshifting events are required for synthesis of mouse mammary tumor virus gag-related polyproteins. Proc.Natl.Acad.Sci.U.S.A 84:4298-4302.

172. Jackson, B. and C. C. Little. 1933. The Existence of Non-Chromosomal Influence in the Incidence of Mammary Tumors in Mice. Science 78:465-466.

173. Jaffray, E., K. M. Wood, and R. T. Hay. 1995. Domain organization of I kappa B alpha and sites of interaction with NF-kappa B p65. Mol.Cell Biol. 15:2166-2172.

174. Jensen, E. V., T. Suzuki, T. Kawashima, W. E. Stumpf, P. W. Jungblut, and E. R. DeSombre . 1968. A two-step mechanism for the interaction of estradiol with rat uterus. Proc.Natl.Acad.Sci.U.S.A 59:632-638.

175. Jones, K. A., J. T. Kadonaga, P. A. Luciw, and R. Tjian. 1986. Activation of the AIDS retrovirus promoter by the cellular transcription factor, Sp1. Science 232:755-759.

176. Jouvin-Marche, E., P. N. Marche, and P. A. Cazenave. 1992. Clonal deletion of V beta 17 T cells in mice from natural populations. Semin.Immunol. 4:305-312.

177. Jouvin-Marche, E., P. N. Marche, A. Six, C. Liebe-Gris, D. Voegtle, and P. A. Cazenave. 1993. Identification of an endogenous mammary tumor virus involved in the clonal deletion of V beta 2 T cells. Eur.J.Immunol. 23:2758-2764.

178. Kagoshima, H., K. Shigesada, M. Satake, Y. Ito, H. Miyoshi, M. Ohki, M. Pepling, and P. Gergen. 1993. The Runt domain identifies a new family of heteromeric transcriptional regulators. Trends Genet. 9:338-341.

198

179. Kaltschmidt, C., B. Kaltschmidt, H. Neumann, H. Wekerle, and P. A. Baeuerle. 1994. Constitutive NF-kappa B activity in neurons. Mol.Cell Biol. 14:3981-3992.

180. Kang, J. J., T. Schwegel, and J. E. Knepper. 1993. Sequence similarity between the long terminal repeat coding regions of mammary-tumorigenic BALB/cV and renal-tumorigenic C3H-K strains of mouse mammary tumor virus. Virology 196:303-308.

181. Kang, S. M., A. C. Tran, M. Grilli, and M. J. Lenardo. 1992. NF-kappa B subunit regulation in nontransformed CD4+ T lymphocytes. Science 256:1452-1456.

182. Kapoun, A. M. and G. M. Shackleford. 1997. Preferential activation of Fgf8 by proviral insertion in mammary tumors of Wnt1 transgenic mice. Oncogene 14:2985-2989.

183. Karin, M. and Y. Ben Neriah. 2000. Phosphorylation meets ubiquitination: the control of NF-[kappa]B activity. Annu.Rev.Immunol. 18:621-663.

184. Keith, J. and H. Fraenkel-Conrat. 1975. Identification of the 5' end of Rous sarcoma virus RNA. Proc.Natl.Acad.Sci.U.S.A 72:3347-3350.

185. Kim, K. J., C. Kanellopoulos-Langevin, R. M. Merwin, D. H. Sachs, and R. Asofsky. 1979. Establishment and characterization of BALB/c lymphoma lines with B cell properties. J.Immunol. 122:549-554.

186. Kinoshita, S., L. Su, M. Amano, L. A. Timmerman, H. Kaneshima, and G. P. Nolan. 1997. The T cell activation factor NF-ATc positively regulates HIV-1 replication and gene expression in T cells. Immunity. 6:235-244.

187. Klement, J. F., N. R. Rice, B. D. Car, S. J. Abbondanzo, G. D. Powers, P. H. Bhatt, C. H. Chen, C. A. Rosen, and C. L. Stewart. 1996. IkappaBalpha deficiency results in a sustained NF-kappaB response and severe widespread dermatitis in mice. Mol.Cell Biol. 16:2341-2349.

188. Klement, V., W. P. Rowe, J. W. Hartley, and W. E. Pugh. 1969. Mixed culture cytopathogenicity: a new test for growth of murine leukemia viruses in tissue culture. Proc.Natl.Acad.Sci.U.S.A 63:753-758.

199

189. Klemenz, R., M. Reinhardt, and H. Diggelmann. 1981. Sequence determination of the 3' end of mouse mammary tumor virus RNA. Mol.Biol.Rep. 7:123-126.

190. Kontgen, F., R. J. Grumont, A. Strasser, D. Metcalf, R. Li, D. Tarlinton, and S. Gerondakis. 1995. Mice lacking the c-rel proto-oncogene exhibit defects in lymphocyte proliferation, humoral immunity, and interleukin-2 expression. Genes Dev. 9:1965-1977.

191. Koppe, B., L. Menendez-Arias, and S. Oroszlan. 1994. Expression and purification of the mouse mammary tumor virus gag-pro transframe protein p30 and characterization of its dUTPase activity. J.Virol. 68:2313-2319.

192. Kozak, C., G. Peters, R. Pauley, V. Morris, R. Michalides, J. Dudley, M. Green, M. Davisson, O. Prakash, A. Vaidya, and . 1987. A standardized nomenclature for endogenous mouse mammary tumor viruses. J.Virol. 61:1651-1654.

193. Kuff, E. L. and K. K. Lueders . 1988. The intracisternal A-particle gene family: structure and functional aspects. Adv.Cancer Res. 51:183-276.

194. Kung, H. J., C. Boerkoel, and T. H. Carter. 1991. Retroviral mutagenesis of cellular oncogenes: a review with insights into the mechanisms of insertional activation. Curr.Top.Microbiol.Immunol. 171:1-25.

195. Kunsch, C. and C. A. Rosen. 1993. NF-kappa B subunit-specific regulation of the interleukin-8 promoter. Mol.Cell Biol. 13:6137-6146.

196. Kunsch, C., S. M. Ruben, and C. A. Rosen. 1992. Selection of optimal kappa B/Rel DNA-binding motifs: interaction of both subunits of NF-kappa B with DNA is required for transcriptional activation. Mol.Cell Biol. 12:4412-4421.

197. Kwon, B. S. and S. M. Weissman. 1984. Mouse mammary tumor virus-related sequences in mouse lymphocytes are inducible by 12-O-tetradecanoyl phorbol-13-acetate. J.Virol. 52:1000-1004.

198. Kwon, H., N. Pelletier, C. DeLuca, P. Genin, S. Cisternas, R. Lin, M. A. Wainberg, and J. Hiscott. 1998. Inducible expression of IkappaBalpha repressor mutants interferes with NF-kappaB activity and HIV-1 replication in Jurkat T cells. J.Biol.Chem. 273:7431-7440.

200

199. LaBranche, H., S. Dupuis, Y. Ben David, M. R. Bani, R. J. Wellinger, and B. Chabot. 1998. Telomere elongation by hnRNP A1 and a derivative that interacts with telomeric repeats and telomerase. Nat.Genet. 19:199-202.

200. Lai, M. M. and P. H. Duesberg . 1972. Adenylic acid-rich sequence in RNAs of Rous sarcoma virus and Rauscher mouse leukaemia virus. Nature 235:383-386.

201. Laimins, L. A., G. Khoury, C. Gorman, B. Howard, and P. Gruss. 1982. Host-specific activation of transcription by tandem repeats from simian virus 40 and Moloney murine sarcoma virus. Proc.Natl.Acad.Sci.U.S.A 79:6453-6457.

202. Lau, J. S., P. Baumeister, E. Kim, B. Roy, T. Y. Hsieh, M. Lai, and A. S. Lee. 2000. Heterogeneous nuclear ribonucleoproteins as regulators of gene expression through interactions with the human thymidine kinase promoter. J.Cell Biochem. 79:395-406.

203. Lavenu, A., S. Pournin, C. Babinet, and D. Morello. 1994. The cis-acting elements known to regulate c-myc expression ex vivo are not sufficient for correct transcription in vivo. Oncogene 9:527-536.

204. Lazo, P. A., J. S. Lee, and P. N. Tsichlis. 1990. Long-distance activation of the Myc protooncogene by provirus insertion in Mlvi-1 or Mlvi-4 in rat T-cell lymphomas. Proc.Natl.Acad.Sci.U.S.A 87:170-173.

205. Le Hir, H., E. Izaurralde, L. E. Maquat, and M. J. Moore . 2000. The spliceosome deposits multiple proteins 20-24 nucleotides upstream of mRNA exon-exon junctions. EMBO J. 19:6860-6869.

206. Le Hir, H., M. J. Moore, and L. E. Maquat. 2000. Pre-mRNA splicing alters mRNP composition: evidence for stable association of proteins at exon-exon junctions. Genes Dev. 14:1098-1108.

207. Lee, F. S., T. F. Lane, A. Kuo, G. M. Shackleford, and P. Leder. 1995. Insertional mutagenesis identifies a member of the Wnt gene family as a candidate oncogene in the mammary epithelium of int-2/Fgf-3 transgenic mice. Proc.Natl.Acad.Sci.U.S.A 92:2268-2272.

208. Lee, H. L. and T. K. Archer. 1994. Nucleosome-mediated disruption of transcription factor-chromatin initiation complexes at the mouse

201

mammary tumor virus long terminal repeat in vivo. Mol.Cell Biol. 14:32-41.

209. Lee, M. S. and R. Craigie. 1994. Protection of retroviral DNA from autointegration: involvement of a cellular factor. Proc.Natl.Acad.Sci.U.S.A 91:9823-9827.

210. Lee, W. T., O. Prakash, D. Klein, and N. H. Sarkar. 1987. Structural alterations in the long terminal repeat of an acquired mouse mammary tumor virus provirus in a T-cell leukemia of DBA/2 mice. Virology 159:39-48.

211. Lefebvre, P., D. S. Berard, M. G. Cordingley, and G. L. Hager. 1991. Two regions of the mouse mammary tumor virus long terminal repeat regulate the activity of its promoter in mammary cell lines. Mol.Cell Biol. 11:2529-2537.

212. Lei, E. P., H. Krebber, and P. A. Silver. 2001. Messenger RNAs are recruited for nuclear export during transcription. Genes Dev. 15:1771-1782.

213. Lenz, J., D. Celander, R. L. Crowther, R. Patarca, D. W. Perkins, and W. A. Haseltine . 1984. Determination of the leukaemogenicity of a murine retrovirus by sequences within the long terminal repeat. Nature 308:467-470.

214. Levanon, D., G. Glusman, T. Bangsow, E. Ben Asher, D. A. Male, N. Avidan, C. Bangsow, M. Hattori, T. D. Taylor, S. Taudien, K. Blechschmidt, N. Shimizu, A. Rosenthal, Y. Sakaki, D. Lancet, and Y. Groner. 2001. Architecture and anatomy of the genomic locus encoding the human leukemia-associated transcription factor RUNX1/AML1. Gene 262:23-33.

215. Levanon, D., R. E. Goldstein, Y. Bernstein, H. Tang, D. Goldenberg, S. Stifani, Z. Paroush, and Y. Groner. 1998. Transcriptional repression by AML1 and LEF-1 is mediated by the TLE/Groucho corepressors. Proc.Natl.Acad.Sci.U.S.A 95:11590-11595.

216. Lewis, A. F., T. Stacy, W. R. Green, L. Taddesse-Heath, J. W. Hartley, and N. A. Speck. 1999. Core-binding factor influences the disease specificity of Moloney murine leukemia virus. J.Virol. 73:5535-5547.

202

217. Li, Y., E. Golemis, J. W. Hartley, and N. Hopkins . 1987. Disease specificity of nondefective Friend and Moloney murine leukemia viruses is controlled by a small number of nucleotides. J.Virol. 61:693-700.

218. Li, Y., C. A. Holland, J. W. Hartley, and N. Hopkins . 1984. Viral integration near c-myc in 10-20% of mcf 247- induced AKR lymphomas. Proc.Natl.Acad.Sci.U.S.A 81:6808-6811.

219. Lin, L., G. N. DeMartino, and W. C. Greene . 1998. Cotranslational biogenesis of NF-kappaB p50 by the 26S proteasome. Cell 92:819-828.

220. Lin, L., G. N. DeMartino, and W. C. Greene . 2000. Cotranslational dimerization of the Rel homology domain of NF-kappaB1 generates p50-p105 heterodimers and is required for effective p50 production. EMBO J. 19:4712-4722.

221. Lin, L. and S. Ghosh. 1996. A glycine-rich region in NF-kappaB p105 functions as a processing signal for the generation of the p50 subunit. Mol.Cell Biol. 16:2248-2254.

222. Linial, M. L. and A. D. Miller. 1990. Retroviral RNA packaging: sequence requirements and implications. Curr.Top.Microbiol.Immunol. 157:125-152.

223. Liou, H. C. 2002. Regulation of the immune system by NF-kappaB and IkappaB. J.Biochem.Mol.Biol. 35:537-546.

224. Liu, J., D. Bramblett, Q. Zhu, M. Lozano, R. Kobayashi, S. R. Ross, and J. P. Dudley. 1997. The matrix attachment region-binding protein SATB1 participates in negative regulation of tissue-specific gene expression. Mol.Cell Biol. 17:5275-5287.

225. Liu, L. P., Y. F. Xia, L. Yang, J. A. DiDonato, P. E. DiCorleto, C. P. Zhong, and J. G. Geng. 2001. B lymphocytes and plasma cells express functional E-selectin by constitutive activation of NF-kappaB. Biochem.Biophys.Res.Commun. 286:281-291.

226. Look, A. T. 1997. Oncogenic transcription factors in the human acute leukemias. Science 278:1059-1064.

227. Lutterbach, B., J. J. Westendorf, B. Linggi, S. Isaac, E. Seto, and S. W. Hiebert. 2000. A mechanism of repression by acute myeloid

203

leukemia-1, the target of multiple chromosomal translocations in acute leukemia. J.Biol.Chem. 275:651-656.

228. MacArthur, C. A., D. B. Shankar, and G. M. Shackleford. 1995. Fgf-8, activated by proviral insertion, cooperates with the Wnt-1 transgene in murine mammary tumorigenesis. J.Virol. 69:2501-2507.

229. MacKichan, M. L., F. Logeat, and A. Israel. 1996. Phosphorylation of p105 PEST sequence via a redox-insensitive pathway up-regulates processing of p50 NF-kappaB. J.Biol.Chem. 271:6084-6091.

230. Maillard, I., P. Launois, I. Xenarios, J. A. Louis, H. Acha-Orbea, and H. Diggelmann. 1998. Immune response to mouse mammary tumor virus in mice lacking the alpha/beta interferon or the gamma interferon receptor. J.Virol. 72:2638-2646.

231. Majello, B., L. C. Kenyon, and R. Dalla-Favera. 1986. Human c-myb protooncogene: nucleotide sequence of cDNA and organization of the genomic locus. Proc.Natl.Acad.Sci.U.S.A 83:9636-9640.

232. Majors, J. and H. E. Varmus . 1983. A small region of the mouse mammary tumor virus long terminal repeat confers glucocorticoid hormone regulation on a linked heterologous gene. Proc.Natl.Acad.Sci.U.S.A 80:5866-5870.

233. Marchetti, A., F. Buttitta, S. Miyazaki, D. Gallahan, G. H. Smith, and R. Callahan. 1995. Int-6, a highly conserved, widely expressed gene, is mutated by mouse mammary tumor virus in mammary preneoplasia. J.Virol. 69:1932-1938.

234. Marcu, K. B., S. A. Bossone, and A. J. Patel. 1992. myc function and regulation. Annu.Rev.Biochem. 61:809-860.

235. Marrack, P., E. Kushnir, and J. Kappler. 1991. A maternally inherited superantigen encoded by a mammary tumour virus. Nature 349:524-526.

236. Martiney, M. J., L. S. Levy, and J. Lenz. 1999. Suppressor mutations within the core binding factor (CBF/AML1) binding site of a T-cell lymphomagenic retrovirus. J.Virol. 73:2143-2152.

237. Matsuda, I., E. S. Masuda, A. Tsuboi, S. Behnam, N. Arai, and K. Arai. 1994. Characterization of NF(P), the nuclear factor that interacts with the regulatory P sequence (5'-CGAAAATTTCC-3') of the human

204

interleukin-4 gene: relationship to NF-kappa B and NF-AT. Biochem.Biophys.Res.Commun. 199:439-446.

238. Mayreddy, R. P., M. Safak, M. Razmara, P. Zoltick, and K. Khalili. 1996. Transcription of the JC virus archetype late genome: importance of the kappa B and the 23-base-pair motifs in late promoter activity in glial cells. J.Virol. 70:2387-2393.

239. McCaffrey, P. G., J. Jain, C. Jamieson, R. Sen, and A. Rao. 1992. A T cell nuclear factor resembling NF-AT binds to an NF-kappa B site and to the conserved lymphokine promoter sequence "cytokine-1". J.Biol.Chem. 267:1864-1871.

240. McCarthy, T. L., C. Ji, Y. Chen, K. K. Kim, M. Imagawa, Y. Ito, and M. Centrella. 2000. Runt domain factor (Runx)-dependent effects on CCAAT/ enhancer-binding protein delta expression and activity in osteoblasts. J.Biol.Chem. 275:21746-21753.

241. McMahon, C. W., L. Y. Bogatzki, and A. M. Pullen. 1997. Mouse mammary tumor virus superantigens require N-linked glycosylation for effective presentation to T cells. Virology 228:161-170.

242. McNally, J. G., W. G. Muller, D. Walker, R. Wolford, and G. L. Hager. 2000. The glucocorticoid receptor: rapid exchange with regulatory sites in living cells. Science 287:1262-1265.

243. Mellentin-Michelotti, J., S. John, W. D. Pennie, T. Williams, and G. L. Hager. 1994. The 5' enhancer of the mouse mammary tumor virus long terminal repeat contains a functional AP-2 element. J.Biol.Chem. 269:31983-31990.

244. Melnikova, I. N., B. E. Crute, S. Wang, and N. A. Speck. 1993. Sequence specificity of the core-binding factor. J.Virol. 67:2408-2411.

245. Merika, M. and D. Thanos. 2001. Enhanceosomes. Curr.Opin.Genet.Dev. 11:205-208.

246. Merriman, H. L., A. J. van Wijnen, S. Hiebert, J. P. Bidwell, E. Fey, J. Lian, J. Stein, and G. S. Stein. 1995. The tissue-specific nuclear matrix protein, NMP-2, is a member of the AML/CBF/PEBP2/runt domain transcription factor family: interactions with the osteocalcin gene promoter. Biochemistry 34:13125-13132.

205

247. Mertz, J. A., F. Mustafa, S. Meyers, and J. P. Dudley. 2001. Type B leukemogenic virus has a T-cell-specific enhancer that binds AML-1. J.Virol. 75:2174-2184.

248. Meyers, S., J. R. Downing, and S. W. Hiebert. 1993. Identification of AML-1 and the (8;21) translocation protein (AML-1/ETO) as sequence-specific DNA-binding proteins: the runt homology domain is required for DNA binding and protein-protein interactions. Mol.Cell Biol. 13:6336-6345.

249. Meyers, S., P. D. Gottlieb, and J. P. Dudley. 1989. Lymphomas with acquired mouse mammary tumor virus proviruses resemble distinct prethymic and intrathymic phenotypes defined in vivo. J.Immunol. 142:3342-3350.

250. Meyers, S., N. Lenny, and S. W. Hiebert. 1995. The t(8;21) fusion protein interferes with AML-1B-dependent transcriptional activation. Mol.Cell Biol. 15:1974-1982.

251. Michalides, R. and E. Wagenaar. 1986. Site-specific rearrangements in the long terminal repeat of extra mouse mammary tumor proviruses in murine T-cell leukemias. Virology 154:76-84.

252. Michalides, R., E. Wagenaar, J. Hilkens, J. Hilgers, B. Groner, and N. E. Hynes. 1982. Acquisition of proviral DNA of mouse mammary tumor virus in thymic leukemia cells from GR mice. J.Virol. 43:819-829.

253. Michalides, R., E. Wagenaar, and P. Weijers . 1985. Rearrangements in the long terminal repeat of extra mouse mammary tumor proviruses in T-cell leukemias of mouse strain GR result in a novel enhancer- like structure. Mol.Cell Biol. 5:823-830.

254. Miller, C. L., R. Garne r, and V. Paetkau. 1992. An activation-dependent, T-lymphocyte-specific transcriptional activator in the mouse mammary tumor virus env gene. Mol.Cell Biol. 12:3262-3272.

255. Mink, S., E. Hartig, P. Jennewein, W. Doppler, and A. C. Cato. 1992. A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor. Mol.Cell Biol. 12:4906-4918.

206

256. Misteli, T. and D. L. Spector . 1998. The cellular organization of gene expression. Curr.Opin.Cell Biol. 10:323-331.

257. Mitsouras, K., B. Wong, C. Arayata, R. C. Johnson, and M. Carey. 2002. The DNA architectural protein HMGB1 displays two distinct modes of action that promote enhanceosome assembly. Mol.Cell Biol. 22:4390-4401.

258. Miyamoto, S. and I. M. Verma. 1995. Rel/NF-kappa B/I kappa B story. Adv.Cancer Res. 66:255-292.

259. Miyamoto, T., I. L. Weissman, and K. Akashi. 2000. AML1/ETO-expressing nonleukemic stem cells in acute myelogenous leukemia with 8;21 chromosomal translocation. Proc.Natl.Acad.Sci.U.S.A 97:7521-7526.

260. Miyoshi, H., M. Ohira, K. Shimizu, K. Mitani, H. Hirai, T. Imai, K. Yokoyama, E. Soeda, and M. Ohki. 1995. Alternative splicing and genomic structure of the AML1 gene involved in acute myeloid leukemia. Nucleic Acids Res. 23:2762-2769.

261. Miyoshi, H., K. Shimizu, T. Kozu, N. Maseki, Y. Kaneko, and M. Ohki. 1991. t(8;21) breakpoints on chromosome 21 in acute myeloid leukemia are clustered within a limited region of a single gene, AML1. Proc.Natl.Acad.Sci.U.S.A 88:10431-10434.

262. Moelling, K., D. P. Bolognesi, and H. Bauer. 1971. Polypeptides of avian RNA tumor viruses. 3. Purification and identification of a DNA synthesizing enzyme. Virology 45:298-302.

263. Mohan, N., D. Mottershead, M. Subramanyam, U. Beutner, and B. T. Huber. 1993. Production and characterization of an Mls-1-specific monoclonal antibody. J.Exp.Med. 177:351-358.

264. Mok, E., T. V. Golovkina, and S. R. Ross. 1992. A mouse mammary tumor virus mammary gland enhancer confers tissue-specific but not lactation-dependent expression in transgenic mice. J.Virol. 66:7529-7532.

265. Moore, D. H., C. A. Long, A. B. Vaidya, J. B. Sheffield, A. S. Dion, and E. Y. Lasfargues. 1979. Mammary tumor viruses. Adv.Cancer Res. 29:347-418.

266. Moore, R., M. Dixon, R. Smith, G. Peters, and C. Dickson. 1987. Complete nucleotide sequence of a milk-transmitted mouse mammary

207

tumor virus: two frameshift suppression events are required for translation of gag and pol. J.Virol. 61:480-490.

267. Moreau, P., R. Hen, B. Wasylyk, R. Everett, M. P. Gaub, and P. Chambon. 1981. The SV40 72 base repair repeat has a striking effect on gene expression both in SV40 and other chimeric recombinants. Nucleic Acids Res. 9:6047-6068.

268. Morrison, H. L., B. Soni, and J. Lenz. 1995. Long terminal repeat enhancer core sequences in proviruses adjacent to c-myc in T-cell lymphomas induced by a murine retrovirus. J.Virol. 69:446-455.

269. Moscovici, C. 1975. Leukemic transformation with avian myeloblastosis virus: present status. Curr.Top.Microbiol.Immunol. 71:79-101.

270. Mucenski, M. L., K. McLain, A. B. Kier, S. H. Swerdlow, C. M. Schreiner, T. A. Miller, D. W. Pietryga, W. J. Scott, Jr., and S. S. Potter. 1991. A functional c-myb gene is required for normal murine fetal hepatic hematopoiesis. Cell 65:677-689.

271. Mueller, R. E., L. Baggio, C. A. Kozak, and J. K. Ball. 1992. A common integration locus in type B retrovirus- induced thymic lymphomas. Virology 191:628-637.

272. Mueller, R. E., J. K. Ball, and F. P. Chan. 1989. Characterization of cell markers in type B retroviral- induced thymic lymphomas--I. Surface antigen phenotype and karyotype in developing and primary lymphomas. Leuk.Res. 13:553-559.

273. Muller, W. G., D. Walker, G. L. Hager, and J. G. McNally. 2001. Large-scale chromatin decondensation and recondensation regulated by transcription from a natural promoter. J.Cell Biol. 154:33-48.

274. Mustafa, F., S. Bhadra, D. Johnston, M. Lozano, and J. P. Dudley. 2003. The type B leukemogenic virus truncated superantigen is dispensable for T-cell lymphomagenesis. J.Virol. 77:3866-3870.

275. Mustafa, F., M. Lozano, and J. P. Dudley. 2000. C3H mouse mammary tumor virus superantigen function requires a splice donor site in the envelope gene. J.Virol. 74:9431-9440.

208

276. Nabel, G. and D. Baltimore . 1987. An inducible transcription factor activates expression of human immunodeficiency virus in T cells. Nature 326:711-713.

277. Ness, S. A. 1996. The Myb oncoprotein: regulating a regulator. Biochim.Biophys.Acta 1288:F123-F139.

278. Neubauer, G., A. King, J. Rappsilber, C. Calvio, M. Watson, P. Ajuh, J. Sleeman, A. Lamond, and M. Mann. 1998. Mass spectrometry and EST-database searching allows characterization of the multi-protein spliceosome complex. Nat.Genet. 20:46-50.

279. Nicot, C., R. Mahieux, C. Pise-Masison, J. Brady, A. Gessain, S. Yamaoka, and G. Franchini. 2001. Human T-cell lymphotropic virus type 1 Tax represses c-Myb-dependent transcription through activation of the NF-kappaB pathway and modulation of coactivator usage. Mol.Cell Biol. 21:7391-7402.

280. Nielsen, A. L., N. Pallisgaard, F. S. Pedersen, and P. Jorgensen. 1994. Basic helix- loop-helix proteins in murine type C retrovirus transcriptional regulation. J.Virol. 68:5638-5647.

281. Nieves, A., L. S. Levy, and J. Lenz. 1997. Importance of a c-Myb binding site for lymphomagenesis by the retrovirus SL3-3. J.Virol. 71:1213-1219.

282. Niki, M., H. Okada, H. Takano, J. Kuno, K. Tani, H. Hibino, S. Asano, Y. Ito, M. Satake, and T. Noda. 1997. Hematopoiesis in the fetal liver is impaired by targeted mutagenesis of a gene encoding a non-DNA binding subunit of the transcription factor, polyomavirus enhancer binding protein 2/core binding factor. Proc.Natl.Acad.Sci.U.S.A 94:5697-5702.

283. Nolan, G. P. 1994. NF-AT-AP-1 and Rel-bZIP: hybrid vigor and binding under the influence. Cell 77:795-798.

284. Nusse, R. 1988. The int genes in mammary tumorigenesis and in normal development. Trends Genet. 4:291-295.

285. Nusse, R. 1991. Insertional mutagenesis in mouse mammary tumorigenesis. Curr.Top.Microbiol.Immunol. 171:43-65.

286. Nusse, R., F. A. Asselbergs, M. H. Salden, R. J. Michalides, and H. Bloemendal. 1978. Translation of mouse mammary tumor virus RNA:

209

precursor polypeptides are phosphorylated during processing. Virology 91:106-115.

287. Nusse, R., P. L. van der, L. van Duijn, R. Michalides, and J. Hilgers . 1979. Impaired maturation of mouse mammary tumor virus precursor polypeptides in lymphoid leukemia cells, producing intracytoplasmic A particles and no extracellular B-type virions. J.Virol. 32:251-258.

288. Nusse, R., A. van Ooyen, D. Cox, Y. K. Fung, and H. Varmus . 1984. Mode of proviral activation of a putative mammary oncogene (int-1) on mouse chromosome 15. Nature 307:131-136.

289. Nusse, R. and H. E. Varmus . 1982. Many tumors induced by the mouse mammary tumor virus contain a provirus integrated in the same region of the host genome. Cell 31 :99-109.

290. O'Donnell, P. V., E. Fleissner, H. Lonial, C. F. Koehne, and A. Reicin. 1985. Early clonality and high-frequency proviral integration into the c-myc locus in AKR leukemias. J.Virol. 55:500-503.

291. Oda, M., K. Furukawa, K. Ogata, A. Sarai, S. Ishii, Y. Nishimura, and H. Nakamura. 1997. Identification of indispensable residues for specific DNA-binding in the imperfect tandem repeats of c-Myb R2R3. Protein Eng 10:1407-1414.

292. Oeth, P. A., G. C. Parry, C. Kunsch, P. Nantermet, C. A. Rosen, and N. Mackman. 1994. Lipopolysaccharide induction of tissue factor gene expression in monocytic cells is mediated by binding of c-Rel/p65 heterodimers to a kappa B-like site. Mol.Cell Biol. 14:3772-3781.

293. Ogata, K., H. Hojo, S. Aimoto, T. Nakai, H. Nakamura, A. Sarai, S. Ishii, and Y. Nishimura. 1992. Solution structure of a DNA-binding unit of Myb: a helix- turn-helix-related motif with conserved tryptophans forming a hydrophobic core. Proc.Natl.Acad.Sci.U.S.A 89:6428-6432.

294. Ogata, K., S. Morikawa, H. Nakamura, H. Hojo, S. Yoshimura, R. Zhang, S. Aimoto, Y. Ametani, Z. Hirata, A. Sarai, and . 1995. Comparison of the free and DNA-complexed forms of the DNA-binding domain from c-Myb. Nat.Struct.Biol. 2:309-320.

295. Ogata, K., S. Morikawa, H. Nakamura, A. Sekikawa, T. Inoue, H. Kanai, A. Sarai, S. Ishii, and Y. Nishimura. 1994. Solution structure of

210

a specific DNA complex of the Myb DNA-binding domain with cooperative recognition helices. Cell 79:639-648.

296. Ogawa, E., M. Inuzuka, M. Maruyama, M. Satake, M. Naito-Fujimoto, Y. Ito, and K. Shigesada. 1993. Molecular cloning and characterization of PEBP2 beta, the heterodimeric partner of a novel Drosophila runt-related DNA binding protein PEBP2 alpha. Virology 194:314-331.

297. Ogawa, E., M. Maruyama, H. Kagoshima, M. Inuzuka, J. Lu, M. Satake, K. Shigesada, and Y. Ito. 1993. PEBP2/PEA2 represents a family of transcription factors homologous to the products of the Drosophila runt gene and the human AML1 gene. Proc.Natl.Acad.Sci.U.S.A 90:6859-6863.

298. Ohno, H., G. Takimoto, and T. W. McKeithan. 1990. The candidate proto-oncogene bcl-3 is related to genes implicated in cell lineage determination and cell cycle control. Cell 60:991-997.

299. Okuda, T., J. van Deursen, S. W. Hiebert, G. Grosveld, and J. R. Downing. 1996. AML1, the target of multiple chromosomal translocations in human leukemia, is essential for normal fetal liver hematopoiesis. Cell 84:321-330.

300. Olnes, M. I. and R. N. Kurl. 1994. Isolation of nuclear extracts from fragile cells: a simplified procedure applied to thymocytes. Biotechniques 17:828-829.

301. Orian, A., A. L. Schwartz, A. Israel, S. Whiteside, C. Kahana, and A. Ciechanover. 1999. Structural motifs involved in ubiquitin-mediated processing of the NF-kappaB precursor p105: roles of the glycine-rich region and a downstream ubiquitination domain. Mol.Cell Biol. 19:3664-3673.

302. Osborn, L., S. Kunkel, and G. J. Nabel. 1989. Tumor necrosis factor alpha and interleukin 1 stimulate the human immunodeficiency virus enhancer by activation of the nuclear factor kappa B. Proc.Natl.Acad.Sci.U.S.A 86:2336-2340.

303. Pahl, H. L. 1999. Activators and target genes of Rel/NF-kappaB transcription factors. Oncogene 18:6853-6866.

211

304. Palmarini, M. and H. Fan. 2003. Molecular biology of jaagsiekte sheep retrovirus. Curr.Top.Microbiol.Immunol. 275:81-115.

305. Panet, A., D. Baltimore, and T. Hanafusa. 1975. Quantitation of avian RNA tumor virus reverse transcriptase by radioimmunoassay. J.Virol. 16:146-152.

306. Panganiban, A. T. and H. M. Temin. 1984. The retrovirus pol gene encodes a product required for DNA integration: identification of a retrovirus int locus. Proc.Natl.Acad.Sci.U.S.A 81:7885-7889.

307. Paquette, Y., L. Doyon, A. Laperriere, Z. Hanna, J. Ball, R. P. Sekaly, and P. Jolicoeur. 1992. A viral long terminal repeat expressed in CD4+CD8+ precursors is downregulated in mature peripheral CD4-CD8+ or CD4+CD8- T cells. Mol.Cell Biol. 12 :3522-3530.

308. Park, C. G., M. Y. Jung, Y. Choi, and G. M. Winslow. 1995. Proteolytic processing is required for viral superantigen activity. J.Exp.Med. 181:1899-1904.

309. Parry, G. C. and N. Mackman. 1994. A set of inducible genes expressed by activated human monocytic and endothelial cells contain kappa B-like sites that specifically bind c-Rel-p65 heterodimers. J.Biol.Chem. 269:20823-20825.

310. Pelengaris, S., B. Rudolph, and T. Littlewood. 2000. Action of Myc in vivo - proliferation and apoptosis. Curr.Opin.Genet.Dev. 10:100-105.

311. Pereira, L. A., K. Bentley, A. Peeters, M. J. Churchill, and N. J. Deacon. 2000. A compilation of cellular transcription factor interactions with the HIV-1 LTR promoter. Nucleic Acids Res. 28:663-668.

312. Pereira, L. A., M. J. Churchill, A. G. Elefanty, T. Gouskos, P. F. Lambert, R. G. Ramsay, and N. J. Deacon. 2002. Characterization of interactions between transcription factors and a regulatory region spanning nt -320 to -281 of the HIV-1 LTR in T- lymphoid and non-T-lymphoid cells. J.Biomed.Sci. 9:68-81.

313. Perkins, N. D., N. L. Edwards, C. S. Duckett, A. B. Agranoff, R. M. Schmid, and G. J. Nabel. 1993. A cooperative interaction between NF-kappa B and Sp1 is required for HIV-1 enhancer activation. EMBO J. 12:3551-3558.

212

314. Peters, G., S. Brookes, R. Smith, and C. Dickson. 1983. Tumorigenesis by mouse mammary tumor virus: evidence for a common region for provirus integration in mammary tumors. Cell 33:369-377.

315. Peters, G., S. Brookes, R. Smith, M. Placzek, and C. Dickson. 1989. The mouse homolog of the hst/k-FGF gene is adjacent to int-2 and is activated by proviral insertion in some virally induced mammary tumors. Proc.Natl.Acad.Sci.U.S.A 86:5678-5682.

316. Peters, G. and C. Glover. 1980. tRNA's and priming of RNA-directed DNA synthesis in mouse mammary tumor virus. J.Virol. 35:31-40.

317. Peters, G., R. Smith, S. Brookes, and C. Dickson. 1982. Conservation of protein coding potential in the long terminal repeats of exogenous and endogenous mouse mammary tumor viruses. J.Virol. 42:880-888.

318. Piette, J. and M. Yaniv. 1987. Two different factors bind to the alpha-domain of the polyoma virus enhancer, one of which also interacts with the SV40 and c-fos enhancers. EMBO J. 6:1331-1337.

319. Plaksin, D., P. A. Baeuerle, and L. Eisenbach. 1993. KBF1 (p50 NF-kappa B homodimer) acts as a repressor of H-2Kb gene expression in metastatic tumor cells. J.Exp.Med. 177:1651-1662.

320. Portman, D. S., J. P. O'Connor, and G. Dreyfuss. 1997. YRA1, an essential Saccharomyces cerevisiae gene, encodes a novel nuclear protein with RNA annealing activity. RNA. 3:527-537.

321. Prendergast, G. C. 1999. Mechanisms of apoptosis by c-Myc. Oncogene 18:2967-2987.

322. Pringle, C. R. 1999. Virus taxonomy--1999. The universal system of virus taxonomy, updated to include the new proposals ratified by the International Committee on Taxonomy of Viruses during 1998. Arch.Virol. 144:421-429.

323. Pryciak, P. M. and H. E. Varmus . 1992. Nucleosomes, DNA-binding proteins, and DNA sequence modulate retroviral integration target site selection. Cell 69:769-780.

324. Pryzwansky, K. B., L. E. Martin, and J. K. Spitznagel. 1978. Immunocytochemical localization of myeloperoxidase, lactoferrin,

213

lysozyme and neutral proteases in human monocytes and neutrophilic granulocytes. J.Reticuloendothel.Soc. 24:295-310.

325. Pullen, A. M., T. Wade, P. Marrack, and J. W. Kappler. 1990. Identification of the region of T cell receptor beta chain that interacts with the self-superantigen MIs-1a. Cell 61:1365-1374.

326. Racevskis, J. and H. Beyer. 1989. Amplification of mouse mammary tumor virus genomes in non-mammary tumor cells. J.Virol. 63:456-459.

327. Radke, K., H. Beug, S. Kornfeld, and T. Graf. 1982. Transformation of both erythroid and myeloid cells by E26, an avian leukemia virus that contains the myb gene. Cell 31:643-653.

328. Rajan, L., D. Broussard, M. Lozano, C. G. Lee, C. A. Kozak, and J. P. Dudley. 2000. The c-myc locus is a common integration site in type B retrovirus- induced T-cell lymphomas. J.Virol. 74:2466-2471.

329. Rajan, L., C. A. Kozak, and J. P. Dudley. 1998. Chromosomal localization of acquired MMTV proviral integration sites in T-cell lymphomas. Mamm.Genome 9:84-85.

330. Rao, G. S. 1981. MOde of entry of steroid and thyroid hormones into cells. Mol.Cell Endocrinol. 21:97-108.

331. Rein, A., M. R. McClure, N. R. Rice, R. B. Luftig, and A. M. Schultz. 1986. Myristylation site in Pr65gag is essential for virus particle formation by Moloney murine leukemia virus. Proc.Natl.Acad.Sci.U.S.A 83:7246-7250.

332. Robbins, J., B. J. Blondel, D. Gallahan, and R. Callahan. 1992. Mouse mammary tumor gene int-3: a member of the notch gene family transforms mammary epithelial cells. J.Virol. 66:2594-2599.

333. Roberts, J. D., K. Bebenek, and T. A. Kunkel. 1988. The accuracy of reverse transcriptase from HIV-1. Science 242:1171-1173.

334. Roberts, J. D., B. D. Preston, L. A. Johnston, A. Soni, L. A. Loeb, and T. A. Kunkel. 1989. Fidelity of two retroviral reverse transcriptases during DNA-dependent DNA synthesis in vitro. Mol.Cell Biol. 9:469-476.

335. Robinson, F. R. and M. J. Twiehaus . 1974. Isolation of tha avian reticuloendothelial virus (strain T). Avian Dis. 18:278-288.

214

336. Roelink, H., E. Wagenaar, d. S. Lopes, and R. Nusse. 1990. Wnt-3, a gene activated by proviral insertion in mouse mammary tumors, is homologous to int-1/Wnt-1 and is normally expressed in mouse embryos and adult brain. Proc.Natl.Acad.Sci.U.S.A 87:4519-4523.

337. Romieu-Mourez, R., D. W. Kim, S. M. Shin, E. G. Demicco, E. Landesman-Bollag, D. C. Seldin, R. D. Cardiff, and G. E. Sonenshein. 2003. Mouse mammary tumor virus c-rel transgenic mice develop mammary tumors. Mol.Cell Biol. 23:5738-5754.

338. Rong, B. L., T. A. Libermann, K. Kogawa, S. Ghosh, L. X. Cao, D. Pavan-Langston, and E. C. Dunkel. 1992. HSV-1-inducible proteins bind to NF-kappa B-like sites in the HSV-1 genome. Virology 189:750-756.

339. Rosen, C. A., W. A. Haseltine, J. Lenz, R. Ruprecht, and M. W. Cloyd. 1985. Tissue selectivity of murine leukemia virus infection is determined by long terminal repeat sequences. J.Virol. 55:862-866.

340. Ross, S. R., J. J. Schofield, C. J. Farr, and M. Bucan. 2002. Mouse transferrin receptor 1 is the cell entry receptor for mouse mammary tumor virus. Proc.Natl.Acad.Sci.U.S.A 99:12386-12390.

341. Ross, S. R. and D. Solter. 1985. Glucocorticoid regulation of mouse mammary tumor virus sequences in transgenic mice. Proc.Natl.Acad.Sci.U.S.A 82:5880-5884.

342. Ryseck, R. P., F. Weih, D. Carrasco, and R. Bravo. 1996. RelB, a member of the Rel/NF-kappa B family of transcription factors. Braz.J.Med.Biol.Res. 29:895-903.

343. Sakura, H., C. Kanei-Ishii, T. Nagase, H. Nakagoshi, T. J. Gonda, and S. Ishii. 1989. Delineation of three functional domains of the transcriptional activator encoded by the c-myb protooncogene. Proc.Natl.Acad.Sci.U.S.A 86:5758-5762.

344. Sala, A. and R. Watson. 1999. B-Myb protein in cellular proliferation, transcription control, and cancer: latest developments. J.Cell Physiol 179:245-250.

345. Sambasivarao, D. and V. Paetkau. 1996. Interactions of a transcriptional activator in the env gene of the mouse mammary tumor virus with

215

activation-dependent, T cell-specific transacting factors. J.Biol.Chem. 271:8942-8950.

346. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Woodbury, NY.

347. Sambucetti, L. C., J. M. Cherrington, G. W. Wilkinson, and E. S. Mocarski. 1989. NF-kappa B activation of the cytomegalovirus enhancer is mediated by a viral transactivator and by T cell stimulation. EMBO J. 8:4251-4258.

348. Sarkar, N. H. and A. S. Dion. 1975. Polypeptides of the mouse mammary tumor virus. I. Characterization of two group-specific antigens. Virology 64:471-491.

349. Sarkar, N. H., S. Haga, A. F. Lehner, W. Zhao, S. Imai, and K. Moriwaki. 1994. Insertional mutation of int protooncogenes in the mammary tumors of a new strain of mice derived from the wild in China: normal- and tumor-tissue-specific expression of int-3 transcripts. Virology 203:52-62.

350. Sarkar, N. H., E. S. Whittington, J. Racevskis, and S. L. Marcus . 1978. Phosphoproteins of the murine mammary tumor virus. Virology 91:407-422.

351. Satake, M., T. Ibaraki, Y. Yamaguchi, and Y. Ito. 1989. Loss of responsiveness of an AP1-related factor, PEBP1, to 12-O-tetradecanoylphorbol-13-acetate after transformation of NIH 3T3 cells by the Ha-ras oncogene. J.Virol. 63:3669-3677.

352. Satake, M., S. Nomura, Y. Yamaguchi-Iwai, Y. Takahama, Y. Hashimoto, M. Niki, Y. Kitamura, and Y. Ito. 1995. Expression of the Runt domain-encoding PEBP2 alpha genes in T cells during thymic development. Mol.Cell Biol. 15:1662-1670.

353. Sato, H., E. A. Boyse, T. Aoki, C. Iritani, and L. J. Old. 1973. Leukemia-associated transplantation antigens related to murine leukemia virus. The X.1 system: immune response controlled by a locus linked to H-2. J.Exp.Med. 138:593-606.

216

354. Scheijen, B., J. Jonkers, D. Acton, and A. Berns . 1997. Characterization of pal-1, a common proviral insertion site in murine leukemia virus-induced lymphomas of c-myc and Pim-1 transgenic mice. J.Virol. 71:9-16.

355. Scherdin, U., K. Rhodes, and M. Breindl. 1990. Transcriptionally active genome regions are preferred targets for retrovirus integration. J.Virol. 64:907-912.

356. Schlom, J., D. Colcher, S. Spiegelman, S. Gillespie, and D. Gillespie. 1973. Quantitation of RNA tumor viruses and viruslike particles in human milk by hybridization to polyadenylic acid sequences. Science 179:696-698.

357. Schmid, R. M., N. D. Perkins, C. S. Duckett, P. C. Andrews, and G. J. Nabel. 1991. Cloning of an NF-kappa B subunit which stimulates HIV transcription in synergy with p65. Nature 352:733-736.

358. Schmitz, M. L. and P. A. Baeuerle. 1991. The p65 subunit is responsible for the strong transcription activating potential of NF-kappa B. EMBO J. 10:3805-3817.

359. Schroder, A. R., P. Shinn, H. Chen, C. Berry, J. R. Ecker, and F. Bushman. 2002. HIV-1 integration in the human genome favors active genes and local hotspots. Cell 110:521-529.

360. Schultz, A. M. and S. Oroszlan. 1983. In vivo modification of retroviral gag gene-encoded polyproteins by myristic acid. J.Virol. 46:355-361.

361. Sedgwick, S. G. and S. J. Smerdon. 1999. The ankyrin repeat: a diversity of interactions on a common structural framework. Trends Biochem.Sci. 24:311-316.

362. Sen, R. and D. Baltimore . 1986. Inducibility of kappa immunoglobulin enhancer-binding protein Nf-kappa B by a posttranslational mechanism. Cell 47:921-928.

363. Sen, R. and D. Baltimore . 1986. Multiple nuclear factors interact with the immunoglobulin enhancer sequences. Cell 46:705-716.

364. Sha, W. C., H. C. Liou, E. I. Tuomanen, and D. Baltimore . 1995. Targeted disruption of the p50 subunit of NF-kappa B leads to multifocal defects in immune responses. Cell 80:321-330.

217

365. Shackleford, G. M. and H. E. Varmus . 1988. Construction of a clonable, infectious, and tumorigenic mouse mammary tumor virus provirus and a derivative genetic vector. Proc.Natl.Acad.Sci.U.S.A 85:9655-9659.

366. Siebenlist, U., G. Franzoso, and K. Brown. 1994. Structure, regulation and function of NF-kappa B. Annu.Rev.Cell Biol. 10:405-455.

367. Sims, R. J., III, A. S. Liss, and P. D. Gottlieb. 2003. Normalization of luciferase reporter assays under conditions that alter internal controls. Biotechniques 34 :938-940.

368. Sinn, E., W. Muller, P. Pattengale, I. Tepler, R. Wallace, and P. Leder. 1987. Coexpression of MMTV/v-Ha-ras and MMTV/c-myc genes in transgenic mice: synergistic action of oncogenes in vivo. Cell 49:465-475.

369. Smith, G. H. and N. A. Wivel. 1973. Intracytoplasmic A particles: mouse mammary tumor virus nucleoprotein cores? J.Virol. 11:575-584.

370. Sobieszczuk, P. W., T. J. Gonda, and A. R. Dunn. 1989. Structure and biological activity of the transcriptional initiation sequences of the murine c-myb oncogene. Nucleic Acids Res. 17:9593-9611.

371. Speck, N. A. and D. Baltimore . 1987. Six distinct nuclear factors interact with the 75-base-pair repeat of the Moloney murine leukemia virus enhancer. Mol.Cell Biol. 7:1101-1110.

372. Speck, N. A., B. Renjifo, E. Golemis, T. N. Fredrickson, J. W. Hartley, and N. Hopkins . 1990. Mutation of the core or adjacent LVb elements of the Moloney murine leukemia virus enhancer alters disease specificity. Genes Dev. 4:233-242.

373. Speck, N. A. and S. Terryl. 1995. A new transcription factor family associated with human leukemias. Crit Rev.Eukaryot.Gene Expr. 5:337-364.

374. Steward, R. 1987. Dorsal, an embryonic polarity gene in Drosophila, is homologous to the vertebrate proto-oncogene, c-rel. Science 238:692-694.

375. Stewart, T. A., P. K. Pattengale, and P. Leder. 1984. Spontaneous mammary adenocarcinomas in transgenic mice that carry and express MTV/myc fusion genes. Cell 38:627-637.

218

376. Strasser, K. and E. Hurt. 2000. Yra1p, a conserved nuclear RNA-binding protein, interacts directly with Mex67p and is required for mRNA export. EMBO J. 19:410-420.

377. Strasser, K. and E. Hurt. 2001. Splicing factor Sub2p is required for nuclear mRNA export through its interaction with Yra1p. Nature 413:648-652.

378. Strasser, K., S. Masuda, P. Mason, J. Pfannstiel, M. Oppizzi, S. Rodriguez-Navarro, A. G. Rondon, A. Aguilera, K. Struhl, R. Reed, and E. Hurt. 2002. TREX is a conserved complex coupling transcription with messenger RNA export. Nature 417:304-308.

379. Stuck, B., A. E. Boyse, L. J. Old, and E. A. Carswell. 1964. A new antigen found in leukemias and mammary tumors of the mouse. Nature (London) 203:1033-1034.

380. Stutz, F., A. Bachi, T. Doerks, I. C. Braun, B. Seraphin, M. Wilm, P. Bork, and E. Izaurralde . 2000. REF, an evolutionary conserved family of hnRNP-like proteins, interacts with TAP/Mex67p and participates in mRNA nuclear export. RNA. 6:638-650.

381. Sun, W., B. J. Graves, and N. A. Speck. 1995. Transactivation of the Moloney murine leukemia virus and T-cell receptor beta-chain enhancers by cbf and ets requires intact binding sites for both proteins. J.Virol. 69:4941-4949.

382. Swanstrom, R. and J. W. Wills . 1997. Assembly and Processing of Viral Proteins, p. 263-334. In J. M. Coffin, S. H. Hughes, and H. Varmus (ed.), Retroviruses. Cold Spring Harbor Laboratory Press, Plainview (NY).

383. Syrovets, T., M. Jendrach, A. Rohwedder, A. Schule, and T. Simmet. 2001. Plasmin- induced expression of cytokines and tissue factor in human monocytes involves AP-1 and IKKbeta-mediated NF-kappaB activation. Blood 97:3941-3950.

384. Takahashi, H., T. Nukiwa, P. Basset, and R. G. Crystal. 1988. Myelomonocytic cell lineage expression of the neutrophil elastase gene. J.Biol.Chem. 263:2543-2547.

219

385. Tanaka, H., A. Tamura, and D. Tsujimura. 1972. Properties of the intracytoplasmic A particles purified from mouse tumors. Virology 49:61-78.

386. Taube, R., S. Loya, O. Avidan, M. Perach, and A. Hizi. 1998. Reverse transcriptase of mouse mammary tumour virus: expression in bacteria, purification and biochemical characterization. Biochem.J. 329 ( Pt 3):579-587.

387. Tekmal, R. R. and V. R. Durgam. 1995. The overexpression of int-5/Aromatase, a novel MMTV integration locus gene, is responsible for D2 mammary tumor cell proliferation. Cancer Lett. 88:147-155.

388. Theunissen, H. J., M. Paardekooper, L. J. Maduro, R. J. Michalides, and R. Nusse. 1989. Phorbol ester- inducible T-cell-specific expression of variant mouse mammary tumor virus long terminal repeats. J.Virol. 63:3466-3471.

389. Thompson, J. E., R. J. Phillips, H. Erdjument-Bromage, P. Tempst, and S. Ghosh. 1995. I kappa B-beta regulates the persistent response in a biphasic activation of NF-kappa B. Cell 80:573-582.

390. Thornell, A., B. Hallberg, and T. Grundstrom. 1988. Differential protein binding in lymphocytes to a sequence in the enhancer of the mouse retrovirus SL3-3. Mol.Cell Biol. 8:1625-1637.

391. Thornell, A., B. Hallberg, and T. Grundstrom. 1991. Binding of SL3-3 enhancer factor 1 transcriptional activators to viral and chromosomal enhancer sequences. J.Virol. 65:42-50.

392. Threadgill, D. S., W. K. Steagall, M. T. Flaherty, F. J. Fuller, S. T. Perry, K. E. Rushlow, S. F. Le Grice, and S. L. Payne . 1993. Characterization of equine infectious anemia virus dUTPase: growth properties of a dUTPase-deficient mutant. J.Virol. 67:2592-2600.

393. Tobler, A., C. W. Miller, K. R. Johnson, M. E. Selsted, G. Rovera, and H. P. Koeffler. 1988. Regulation of gene expression of myeloperoxidase during myeloid differentiation. J.Cell Physiol 136:215-225.

394. Todokoro, K., R. J. Watson, H. Higo, H. Amanuma, S. Kuramochi, H. Yanagisawa, and Y. Ikawa . 1988. Down-regulation of c-myb gene expression is a prerequisite for erythropoietin- induced erythroid differentiation. Proc.Natl.Acad.Sci.U.S.A 85:8900-8904.

220

395. Tonjes, R. R., R. Lower, K. Boller, J. Denner, B. Hasenmaier, H. Kirsch, H. Konig, C. Korbmacher, C. Limbach, R. Lugert, R. C. Phelps, J. Scherer, K. Thelen, J. Lower, and R. Kurth. 1996. HERV-K: the biologically most active human endogenous retrovirus family. J.Acquir.Immune.Defic.Syndr.Hum.Retrovirol. 13 Suppl 1:S261-S267.

396. Tooze, J., S. Tooze, H. Haisma, and J. Hilgers . 1985. AtT20 pituitary tumour cells contain mouse mammary tumour virus and intracisternal A-type particles in addition to murine leukemia virus. Eur.J.Cell Biol. 39:224-231.

397. Tracey, W. D., Jr., M. E. Pepling, M. E. Horb, G. H. Thomsen, and J. P. Gergen. 1998. A Xenopus homologue of aml-1 reveals unexpected patterning mechanisms leading to the formation of embryonic blood. Development 125:1371-1380.

398. Traenckner, E. B., H. L. Pahl, T. Henkel, K. N. Schmidt, S. Wilk, and P. A. Baeuerle. 1995. Phosphorylation of human I kappa B-alpha on serines 32 and 36 controls I kappa B-alpha proteolysis and NF-kappa B activation in response to diverse stimuli. EMBO J. 14:2876-2883.

399. Truss, M., G. Chalepakis, and M. Beato. 1992. Interplay of steroid hormone receptors and transcription factors on the mouse mammary tumor virus promoter. J.Steroid Biochem.Mol.Biol. 43:365-378.

400. Tsichlis, P. N., J. S. Lee, S. E. Bear, P. A. Lazo, C. Patriotis, E. Gustafson, S. Shinton, N. A. Jenkins, N. G. Copeland, K. Huebner, and . 1990. Activation of multiple genes by provirus integration in the Mlvi-4 locus in T-cell lymphomas induced by Moloney murine leukemia virus. J.Virol. 64:2236-2244.

401. Tsujimura, D. and H. Tanaka. 1974. Quantitative studies on intracytoplasmic A particles formed in DBA-2 mouse leukemias. Cancer Res. 34:1475-1486.

402. Vaidya, A. B., C. A. Long, J. B. Sheffield, A. Tamura, and H. Tanaka. 1980. Murine mammary tumor virus deficient in the major glycoprotein: biochemical and biological studies on virions produced by a lymphoma cell line. Virology 104:279-293.

403. van Gurp, M. F., J. Pratap, M. Luong, A. Javed, H. Hoffmann, A. Giordano, J. L. Stein, E. J. Neufeld, J. B. Lian, G. S. Stein, and A. J. van Wijnen. 1999. The CCAAT displacement protein/cut homeodomain

221

protein represses osteocalcin gene transcription and forms complexes with the retinoblastoma protein-related protein p107 and cyclin A. Cancer Res. 59:5980-5988.

404. van Ooyen, A. J., R. J. Michalides, and R. Nusse. 1983. Structural analysis of a 1.7-kilobase mouse mammary tumor virus-specific RNA. J.Virol. 46:362-370.

405. van Wijnen, A. J., T. K. Choi, T. A. Owen, K. L. Wright, J. B. Lian, R. Jaenisch, J. L. Stein, and G. S. Stein. 1991. Involvement of the cell cycle-regulated nuclear factor HiNF-D in cell growth control of a human H4 histone gene during hepatic development in transgenic mice. Proc.Natl.Acad.Sci.U.S.A 88:2573-2577.

406. Varmus, H. E., G. Ringold, and K. R. Yamamoto. 1979. Regulation of mouse mammary tumor virus gene expression by glucocorticoid hormones. Monogr Endocrinol. 12:253-278.

407. Verbeek, W., A. F. Gombart, A. M. Chumakov, C. Muller, A. D. Friedman, and H. P. Koeffler. 1999. C/EBPepsilon directly interacts with the DNA binding domain of c-myb and cooperatively activates transcription of myeloid promoters. Blood 93:3327-3337.

408. Verma, I. M., J. K. Stevenson, E. M. Schwarz, D. Van Antwerp, and S. Miyamoto. 1995. Rel/NF-kappa B/I kappa B family: intimate tales of association and dissociation. Genes Dev. 9:2723-2735.

409. Vijaya, S., D. L. Steffen, and H. L. Robinson. 1986. Acceptor sites for retroviral integrations map near DNase I-hypersensitive sites in chromatin. J.Virol. 60:683-692.

410. Virbasius, C. M., S. Wagner, and M. R. Green. 1999. A human nuclear-localized chaperone that regulates dimerization, DNA binding, and transcriptional activity of bZIP proteins. Mol.Cell 4:219-228.

411. Vogt, V. M. 1996. Proteolytic processing and particle maturation. Curr.Top.Microbiol.Immunol. 214:95-131.

412. Wang, D. and A. S. Baldwin, Jr. 1998. Activation of nuclear factor-kappaB-dependent transcription by tumor necrosis factor-alpha is mediated through phosphorylation of RelA/p65 on serine 529. J.Biol.Chem. 273:29411-29416.

222

413. Wang, Q., T. Stacy, M. Binder, M. Marin-Padilla, A. H. Sharpe, and N. A. Speck. 1996. Disruption of the Cbfa2 gene causes necrosis and hemorrhaging in the central nervous system and blocks definitive hematopoiesis. Proc.Natl.Acad.Sci.U.S.A 93:3444-3449.

414. Wang, Q., T. Stacy, J. D. Miller, A. F. Lewis, T. L. Gu, X. Huang, J. H. Bushweller, J. C. Bories, F. W. Alt, G. Ryan, P. P. Liu, A. Wynshaw-Boris, M. Binder, M. Marin-Padilla, A. H. Sharpe, and N. A. Speck. 1996. The CBFbeta subunit is essential for CBFalpha2 (AML1) function in vivo. Cell 87:697-708.

415. Wang, S., Q. Wang, B. E. Crute, I. N. Melnikova, S. R. Keller, and N. A. Speck. 1993. Cloning and characterization of subunits of the T-cell receptor and murine leukemia virus enhancer core-binding factor. Mol.Cell Biol. 13:3324-3339.

416. Weidhaas, J. B., E. L. Angelichio, S. Fenner, and J. M. Coffin. 2000. Relationship between retroviral DNA integration and gene expression. J.Virol. 74:8382-8389.

417. Weih, F., D. Carrasco, S. K. Durham, D. S. Barton, C. A. Rizzo, R. P. Ryseck, S. A. Lira, and R. Bravo. 1995. Multiorgan inflammation and hematopoietic abnormalities in mice with a targeted disruption of RelB, a member of the NF-kappa B/Rel family. Cell 80:331-340.

418. Weih, F., S. K. Durham, D. S. Barton, W. C. Sha, D. Baltimore, and R. Bravo. 1997. p50-NF-kappaB complexes partially compensate for the absence of RelB: severely increased pathology in p50(-/-)relB(-/-) double-knockout mice. J.Exp.Med. 185:1359-1370.

419. Weiher, H., M. Konig, and P. Gruss. 1983. Multiple point mutations affecting the simian virus 40 enhancer. Science 219:626-631.

420. Weiss, A., R. L. Wiskocil, and J. D. Stobo. 1984. The role of T3 surface molecules in the activation of human T cells: a two-stimulus requirement for IL 2 production reflects events occurring at a pre-translational leve l. J.Immunol. 133:123-128.

421. Westin, E. H., R. C. Gallo, S. K. Arya, A. Eva, L. M. Souza, M. A. Baluda, S. A. Aaronson, and F. Wong-Staal. 1982. Differential expression of the amv gene in human hematopoietic cells. Proc.Natl.Acad.Sci.U.S.A 79:2194-2198.

223

422. Weston, K. 1992. Extension of the DNA binding consensus of the chicken c-Myb and v-Myb proteins. Nucleic Acids Res. 20:3043-3049.

423. Whitcomb, J. M. and S. H. Hughes. 1992. Retroviral reverse transcription and integration: progress and problems. Annu.Rev.Cell Biol. 8:275-306.

424. Whiteside, S. T. and A. Israel. 1997. I kappa B proteins: structure, function and regulation. Semin.Cancer Biol. 8:75-82.

425. Wichmann, I., J. R. Garcia-Lozano, N. Respaldiza, M. F. Gonzalez-Escribano, and A. Nunez-Roldan. 1999. Autoantibodies to transcriptional regulation proteins DEK and ALY in a patient with systemic lupus erythematosus. Hum.Immunol. 60:57-62.

426. Williams, J. L., J. Garcia, D. Harrich, L. Pearson, F. Wu, and R. Gaynor. 1990. Lymphoid specific gene expression of the adenovirus early region 3 promoter is mediated by NF-kappa B binding motifs. EMBO J. 9:4435-4442.

427. Wills, J. W. and R. C. Craven . 1991. Form, function, and use of retroviral gag proteins. AIDS 5:639-654.

428. Wingender, E., X. Chen, R. Hehl, H. Karas, I. Liebich, V. Matys, T. Meinhardt, M. Pruss, I. Reuter, and F. Schacherer. 2000. TRANSFAC: an integrated system for gene expression regulation. Nucleic Acids Res. 28:316-319.

429. Winslow, G. M., M. T. Scherer, J. W. Kappler, and P. Marrack. 1992. Detection and biochemical characterization of the mouse mammary tumor virus 7 superantigen (Mls-1a). Cell 71:719-730.

430. Wotton, D., J. Ghysdael, S. Wang, N. A. Speck, and M. J. Owen. 1994. Cooperative binding of Ets-1 and core binding factor to DNA. Mol.Cell Biol. 14:840-850.

431. Wu, X., Y. Li, B. Crise, and S. M. Burgess. 2003. Transcription start regions in the human genome are favored targets for MLV integration. Science 300:1749-1751.

432. Yagi, M. J., R. E. Stutzman, B. H. Robertson, and R. W. Compans . 1978. Structural components of mouse mammary tumor virus. II. Isolation and purification of virion polypeptides. J.Virol. 26:448-456.

224

433. Yamaguchi, Y., M. Satake, and Y. Ito. 1989. Two overlapping sequence motifs within the polyomavirus enhancer are independently the targets of stimulation by both the tumor promoter 12-O-tetradecanoylphorbol-13-acetate and the Ha-ras oncogene. J.Virol. 63:1040-1048.

434. Yanagawa, S., K. Kakimi, H. Tanaka, A. Murakami, Y. Nakagawa, Y. Kubo, Y. Yamada, H. Hiai, K. Kuribayashi, T. Masuda, and . 1993. Mouse mammary tumor virus with rearranged long terminal repeats causes murine lymphomas. J.Virol. 67:112-118.

435. Yanagawa, S., A. Murakami, and H. Tanaka. 1990. Extra mouse mammary tumor proviruses in DBA/2 mouse lymphomas acquire a selective advantage in lymphocytes by alteration in the U3 region of the long terminal repeat. J.Virol. 64:2474-2483.

436. Yanagawa, S., H. Tanaka, and A. Ishimoto. 1991. Identification of a novel mammary cell line-specific enhancer element in the long terminal repeat of mouse mammary tumor virus, which interacts with its hormone-responsive element. J.Virol. 65:526-531.

437. Zaiman, A. L. and J. Lenz. 1996. Transcriptional activation of a retrovirus enhancer by CBF (AML1) requires a second factor: evidence for cooperativity with c-Myb. J.Virol. 70:5618-5629.

438. Zaiman, A. L., A. F. Lewis, B. E. Crute, N. A. Speck, and J. Lenz. 1995. Transcriptional activity of core binding factor-alpha (AML1) and beta subunits on murine leukemia virus enhancer cores. J.Virol. 69:2898-2906.

439. Zaiman, A. L., A. Nieves, and J. Lenz. 1998. CBF, Myb, and Ets binding sites are important for activity of the core I element of the murine retrovirus SL3-3 in T lymphocytes. J.Virol. 72:3129-3137.

440. Zeng, C., S. McNeil, S. Pockwinse, J. Nickerson, L. Shopland, J. B. Lawrence, S. Penman, S. Hiebert, J. B. Lian, A. J. van Wijnen, J. L. Stein, and G. S. Stein. 1998. Intranuclear targeting of AML/CBFalpha regulatory factors to nuclear matrix-associated transcriptional domains. Proc.Natl.Acad.Sci.U.S.A 95:1585-1589.

441. Zenklusen, D., P. Vinciguerra, Y. Strahm, and F. Stutz. 2001. The yeast hnRNP-Like proteins Yra1p and Yra2p participate in mRNA export through interaction with Mex67p. Mol.Cell Biol. 21:4219-4232.

225

442. Zhang, Y. W., S. C. Bae, G. Huang, Y. X. Fu, J. Lu, M. Y. Ahn, Y. Kanno, T. Kanno, and Y. Ito. 1997. A novel transcript encoding an N-terminally truncated AML1/PEBP2 alphaB protein interferes with transactiva tion and blocks granulocytic differentiation of 32Dcl3 myeloid cells. Mol.Cell Biol. 17:4133-4145.

443. Zhong, H., M. J. May, E. Jimi, and S. Ghosh. 2002. The phosphorylation status of nuclear NF-kappa B determines its association with CBP/p300 or HDAC-1. Mol.Cell 9:625-636.

444. Zhong, H., H. SuYang, H. Erdjument-Bromage, P. Tempst, and S. Ghosh. 1997. The transcriptional activity of NF-kappaB is regulated by the IkappaB-associated PKAc subunit through a cyclic AMP-independent mechanism. Cell 89:413-424.

445. Zhou, Z., M. J. Luo, K. Straesser, J. Katahira, E. Hurt, and R. Reed. 2000. The protein Aly links pre-messenger-RNA splicing to nuclear export in metazoans. Nature 407:401-405.

446. Zhu, Q. and J. P. Dudley. 2002. CDP binding to multiple sites in the mouse mammary tumor virus long terminal repeat suppresses basal and glucocorticoid- induced transcription. J.Virol. 76:2168-2179.

447. Zhu, Q., K. Gregg, M. Lozano, J. Liu, and J. P. Dudley. 2000. CDP is a repressor of mouse mammary tumor virus expression in the mammary gland. J.Virol. 74:6348-6357.

226

Vita

Jennifer Andrea Mertz was born in St. Louis, MO on January 21, 1975,

the daughter of John L. and Mary A. Mertz. After attending St. Joseph’s

Academy for her high school education, she entered St. Louis University in the

fall of 1993. In May, 1997, she graduated magna cum laude with a Bachelor of

Science degree in Biology. In the fall of 1997, she entered the Microbiology

Ph.D. program at The University of Texas at Austin; joining Dr. Jaquelin

Dudley’s lab in June, 1998. She has published seven journal articles and a book

chapter.

Permanent address: 915 Warson Woods Drive

Saint Louis, MO 63122-1731

This dissertation was typed by the author.

Identification and characterization of a T cell growth inhibitory factor produced by K562...

Documents

Transcript of Identification and characterization of a T cell growth inhibitory factor produced by K562...