Identification and characterization of a new conjugation/type IVA secretion system (trb/tra) of...

International Journal of Medical Microbiology 298 (2008) 411–428

Identification and characterization of a new conjugation/type IVA

secretion system (trb/tra) of Legionella pneumophila Corby

localized on two mobile genomic islands

Gernot Glocknera,1, Christiane Albert-Weissenbergerb,1, Erik Weinmannb,Sebastian Jacobib, Eva Schunderb, Michael Steinertc, Jorg Hackerb, Klaus Heunerb,�

aLeibniz Institute for Age Research – Fritz Lipmann Institute, Beutenbergstraße 11, D-07745 Jena, GermanybInstitut fur Molekulare Infektionsbiologie, Julius-Maximilians Universitat Wurzburg, Rontgenring 11,

D-97070 Wurzburg, GermanycInstitut fur Mikrobiologie, Technische Universitat Braunschweig, Spielmannstraße 7, D-38106 Braunschweig, Germany

Received 19 April 2007; received in revised form 14 June 2007; accepted 13 July 2007

Abstract

Horizontal gene transfer probably contributes to evolution of Legionella pneumophila and its adaptation to differentenvironments. Although horizontal gene transfer was observed in Legionella, the mechanism is still not specified. Inthis study we identified and analysed a new type of conjugation/type IVA secretion system (trb/tra) of L. pneumophila

Corby, a virulent human isolate. Two similar versions of this conjugation system were identified, localized on twodifferent genomic islands (Trb-1, 42,710 bp and Trb-2, 34,434 bp). Trb-1 and Trb-2 are integrated within the tRNAPro

gene (lpc2778) and the tmRNA gene (lpc0164), respectively. Both islands exhibit an oriT region and both can beexcised from the chromosome forming episomal circles. Trb-1 was analysed in more detail. It is active and can behorizontally transferred to other Legionella strains by conjugation and then integrated into the genome in a site-specificmanner within the tRNAPro gene. We characterized the sequence of the excision and integration sites of Trb-1 in threedifferent L. pneumophila strains. Here we demonstrate that L. pneumophila exhibits a functional oriT region and thatgenomic islands in Legionella can be mobilized and conjugated to other species of Legionella. Thus, we describe for thefirst time a mechanism that may explain the observed horizontal transfer of chromosomal DNA in Legionella.r 2007 Elsevier GmbH. All rights reserved.

Keywords: trb/tra; Genomic island; L. pneumophila; Conjugation; T4SS

Introduction

Legionella species are inhabitants of fresh water,replicating in the cytoplasm of amoebae and otherprotozoa (Fields, 1996). L. pneumophila (Lp) is addi-tionally able to invade and to proliferate in alveolarmacrophages of the human lung. Thus Lp can causesevere pneumonia. More than 48 species of Legionella

ARTICLE IN PRESS

www.elsevier.de/ijmm

1438-4221/$ - see front matter r 2007 Elsevier GmbH. All rights reserved.

doi:10.1016/j.ijmm.2007.07.012

�Corresponding author. Tel.: +49931 31 2151;

fax: +49931 31 2578.

E-mail address: [email protected] (K. Heuner).1G. Glockner and C. Albert-Weissenberger contributed equally to

this work.

are known (Fields et al., 2002), but the majority ofLegionnaires’ disease cases reported are caused by Lp

serogroup 1 (S1). Yet, the genetic background for thesedifferences in the virulence is unknown.

Secretion of proteins is important for the virulence ofLp and is apparent by the presence of a wide variety ofsecretion systems identified in Legionella (for a reviewsee Albert-Weissenberger et al., 2007). They play a rolein infection and maintenance within the host cell. Lp

possesses a twin-arginine translocation pathway (DeBuck et al., 2004; Rossier and Cianciotto, 2005), the Sectranslocon (Cazalet et al., 2004; Chien et al., 2004), aputative type I secretion system (T1SS) (Jacobi andHeuner, 2003), a T2SS (Liles et al., 1998; Hales andShuman, 1999), T4ASSs, T4BSS, and strain Parisencode a predicted T5SS specific to this strain (Cazaletet al., 2004).

T4SSs are needed for conjugation and for transport ofnucleic acids and proteins into host cells during infection(Ding et al., 2003; Nagai and Roy, 2003; Sexton andVogel, 2002). T4SSs are widespread and grouped intothe IVA and IVB families. The T4BSS encoded by thedot/icm genes is known to be essential for intracellularmultiplication of Lp by translocating effector proteinsinto the host cell (Andrews et al., 1998; Berger andIsberg, 1993; Brand et al., 1994; Edelstein et al., 1999;Luo and Isberg, 2004; Segal et al., 1998). The T4BSSDot/Icm is similar to the Tra/Trb system of IncIplasmids. Recently it was shown that dot/icm genesare present in many strains exhibiting a conservedorganization (Morozova et al., 2004). The second Lp

T4SS Lvh (T4ASS) was thought to be dispensable forintracellular growth, but it was shown that underenvironmental mimicking conditions the lvh systemwas able to restore some of the effects of dotA anddotB mutant strains, e.g. entry and intracellular replica-tion in Acanthamoeba castellanii (Bandyopadhyay et al.,2007). Earlier it was demonstrated that lvh is involved inhost cell infection at lower temperatures (Ridenouret al., 2003; Segal et al., 1999). The T4ASS is similar tothe Tra system of IncN plasmids. This chromosomalencoded secretion system can exist as a multicopyplasmid (pP36, Lp Paris; pLP45, Lp Philadelphia)(Cazalet et al., 2004). Recently, it was demonstratedthat the integration of pP36 was growth-phase-depen-dent, occurring during the exponential phase (Doleans-Jordheim et al., 2006).

Here we describe features of two genomic islands(Trb-1 and Trb-2) encoding a new conjugation/T4ASS.These loci are not present in the yet sequenced genomesof Lp (Cazalet et al., 2004; Chien et al., 2004) but asimilar locus was also found in various non-pneumophila

species of Legionella by hybridization experiments withtrb/tra-specific DNA probes. We demonstrate that thecomplete Trb-1 region (42,710 bp) is able to excise fromthe chromosome forming an episomal circle. The

genomic island Trb-1 can be transferred horizontallyto another Lp strain by conjugation and integrates site-specifically into the genome of transconjugants.

Materials and methods

Strains and plasmids

Lp Corby (S1) (Jepras et al., 1985) was used togenerate the complete genome sequence (see below).Lp JR32 (Marra and Shuman, 1989) and L. micdadei

(ATCC 33218) were used in conjugation assays.Legionella strains used in Southern blot analysis wereLp AA100 (130b) (Moffat et al., 1994), Lp PhiladelphiaI (S1) [ATCC 33152], Lp Msp19 (S1) (Bender et al.,1991), Lp 685 (S1) (Bender et al., 1991), Lp U22 (S3)(Bender et al., 1991), Lp U21 (S6) (Bender et al., 1991),Lp 664 (S6) (Bender et al., 1991), Lp-type strains (S7,S10, S12, S13) (P. C. Luck, Dresden, Germany),Lp Bloomington (S3) (ATCC 33155), Lp Los Angeles(S4) (ATCC 33156), Lp Chicago-2 (S6) (ATCC 33215),L. anisa (Fields et al., 1990), L. bozemanii (ATCC33217), L. dumoffii (ATCC 33279), L. feelei (S1) (ATCC35072), L. gormanii (ATCC 33297), L. hackeliae (S1 andS2) (ATCC 33250, ATCC 35999), L. israeliensis (ATCC43119), L. jordanis (ATCC 33623), L. longbeachae

(S1 and S2) (ATCC 33462, ATCC 33484), L. micdadei

(ATCC 33218), L. oakridgensis (ATCC 33761), L. erythra

(Saunders et al., 1992), and Sarcobium (Legionella)lyticum [Polish Culture of Microorganisms; PCM 2298).Primers and plasmids used in this study are given inTable 1. Escherichia coli DH5a was used for cloning ofrecombinant plasmid DNA. The plasmids pUC18,pUC19 (Pfizer Pharma GmbH, Karlsruhe, Germany)or pGEMTeasy (Promega, Mannheim) were used forsubcloning of DNA fragments, and vector pBC KS(Stratagene, La Jolla, USA) was used to constructplasmids for complementation of Lp mutants.

Media and chemicals

E. coli was cultivated in Luria–Bertani (LB) medium.Antibiotics used for culturing E. coli were chloramphe-nicol (Cm, 20 mg/ml) and ampicillin (Ap, 100 mg/ml).Lp was grown in YEB medium (1% yeast extract)supplemented with 1% ACES (N-(2-acetamido)-2-ami-noethanesulphonic acid), 0.025% ferric PPi and 0.04%L-cysteine or on buffered charcoal-yeast extract (BCYE)agar (Edelstein, 1981). Enzymes were purchased fromSt. Leon-Rot (Vilnius, Lithuania), Amersham/GEhealthcare, Roche Diagnostics GmbH (Mannheim,Germany), and Invitrogen GmbH (Karlsruhe,Germany). The AmpliTaqTM polymerase was pur-chased from Invitrogen GmbH. Chemicals and

ARTICLE IN PRESSG. Glockner et al. / International Journal of Medical Microbiology 298 (2008) 411–428412

ARTICLE IN PRESS

Table 1. Primers and plasmids used in this study

Name Sequence or characteristics Reference

PCR

trbL1-H AAGCTTTTTGCAGCGAGCAGTCGC This study

trbI1-E GAATTCCGTATTAGTGGCTTGGCA This study

R8-F4 GCGAAAAGCAGACATTCAAGAG This study

traC1-R GAACCCACCAGCATACTGGCGATT This study

trb-1 TTCGATATCGCCGTCTGCCAT This study

trb-2 AGATTGCTCATCAATCAAACTTCC This study

trb-3 GTAAGCCTATCTATTGATAATGCAC This study

trb-4 GAGAAGGTCGATGGTGATC This study

trb-5 CATGCCGAGAAGGAGATCTCTCGT This study

trb-6 GCATGGTTCATAGCTCAACGTTGGAG This study

trb-7 GTTGTAAAGTAGTGTTGGCCTTGG This study

trb-8 GCAACCATCGTGCGACATTCATCT This study

trb1-1F TGGTCGGAGTGACAGGAAT This study

trb1-2R CGGAGTGTAGCTCAGACT This study

TP2-F GCAGCATGAGCATGTCAGAAA This study

TP2-R AGTGCATAAGCAGCTAAACCG This study

trbI1-F TAAGGAGTGAGACTGATGAATC This study

trbI1-R CATTGCACTCCTCCTGTATCAAT This study

traG1-F TGGAGACGGTCAATGAGCTTGA This study

traG1-R TAGTCTGATTTCCTCATCTTCQACG This study

trbB2-F CGTTGTATCCGGACCAACCTT This study

trbB2-R GCGCATCCTGAGTGTGGTTTT This study

traJ1-F ACAAGTGGTTTGCAATCCTTTAG This study

traJ1-R GCTAGCCAATGCAGCATT This study

traD-Fa GCTTATCATCACTTGCCCTTTA Brassinga

et al. (2003)

traD-Ra GCAGAGATACACCACCAATCCGA Brassinga

et al. (2003)

lvhB10-Fb GCAATCGGACTCAGGTTGCTA This study

lvhB10-Rb CTGCCAAAGCGCTCGAAGAAA This study

oriT-F1 AATCCGCGGACTTCCTAATTATTCCCT This study

oriT-R1 GAATTTTCTAGAATATAAAAATGAGTA This study

oriT-R2 TTTTGGTCTAGATGGATGCATGAGTTA This study

hsdM-F GCGTATATCTGATGGACAGTTGCT This study

hsdM-R CATTTATCTCGGCTACAGGACGCG This study

mip-F ATGAAGATGAAATTGGTGACTGCG This study

mip-R CCAATAGGTCCGCCAACGCTA This study

RT-PCR

trb1I-F GATGCTTTTGGCATCAGCCTG This study

trbI1-R GCTCTGAGTTCATATCGGGTG This study

trbHI-F CTGTGTTTGTGGTGTTGATAG This study

trbHI-R GCTCTGAGTTCATATCGGGTG This study

traG1-F TGCTGATGCCATTCATCAGCG This study

traG1-R CATCTAATGGATTCCATCGGG This study

trbLtraG-F CATCAGTATGCAGGTTGGCAC This study

trbLtraG-R CATCTAATGGATTCCATCGGG This study

traJ1-F AAACACGGTCGCCATCTTCGT This study

traJ1-R GTTGTTCCATATCATCGGCAAGAT This study

MutX-F CCGGCTTGAATTGAGCAATCC This study

MutX-R TTGGATGCAGCTAACAGATATGGT This study

traH-MutX-F CCGGCTTGAATTGAGCAATCC This study

traH-MutX-R CCAACGCTGACAGCATTAGAC This study

Plasmids

pKH179B 1780 bp PCR fragment (primers trbL1-H/ trbI1-E) in pBCKS This study

pKH179B2 880 bp BamH1/EcoR1 fragment of pKHr25 in pBCKS This study

G. Glockner et al. / International Journal of Medical Microbiology 298 (2008) 411–428 413

oligonucleotides were obtained from MWG-Biotech AG(Ebersberg, Germany).

DNA techniques, Southern blot hybridization, and

nucleotide sequencing analysis

Preparation of chromosomal or plasmid DNA, DNAmanipulations and Southern blot hybridization proce-dures were performed according to standard protocols(Sambrook et al., 1989). Chromosomal DNA fromvarious Legionella strains were digested with SacII andHindIII, electrophoresed and fragments were trans-ferred to nylon membranes (Pall, Dreieich, Germany) bycapillary blotting. DNA probes specific for trbB2, trbI1,hsdM, oriT, traG1, TP-2, lvhB10, traD, and mip weregenerated by PCR (for primers, see Table 1) and usedfor hybridization. DNA probes were labelled anddetected using the non-radioactive enhanced chemilu-minescence labelling and detection kit (ECL; Amer-sham/GE healthcare). Hybridization was performedunder low-stringency conditions as described earlier(Heuner et al., 1995).

Introduction of foreign DNA into bacterial strains byelectroporation was performed using a Bio-Rad gene

pulser (Bio-Rad, Munchen, Germany) according to themanufacturer’s specifications. Electroporation of E. coli

(Legionella) strains was carried out using 1.8 kV(2.3 kV), 200O (100O) and 25mF (25mF).

Both strands of plasmid DNA (see Table 1) weresequenced with infrared dye-labelled primers on anautomated DNA sequencer (LI-COR-DNA 4000;MWG-Biotech). Sequences were analysed using theGenetics Computer Group (GCG) package, Pendant(http://pendant.gfs.de), and SMART (http://smart.embl-heidelberg.de) programs. The genome of Lp

Corby was sequenced on an Abi3730xl sequencingmachine. Gene prediction was done by using theprogramme GeneMarkS (http://opal.biology.gatech.edu/GeneMark/). We used the GeneColors software(Romualdi et al., 2005) for annotation of the genes.

PCR analysis

PCR was carried out using a Thermocycler TRIO-Thermoblock (Biometra, Gottingen, Germany) andAmpliTaqTM polymerase. Cycling conditions were94 1C for 1min, 58 1C (trb-1 to trb-4) or 60 1C (trb-5to trb-8) for 1min, and 72 1C for 3–5min for 30 cycles.

ARTICLE IN PRESS

Table 1. (continued )

Name Sequence or characteristics Reference

pKH179C �880 bp NotI/EcoR1 fragment of pKH179B2 in pKH179B This study

pKH179D pKH179C with Km resistance cassette cloned into EcoR1 site instead of trbG1H1I1 This study

pKH176A 4484 bp PCR fragment (primers R8F4/traC1-R) cloned into pGMTeasy This study

pKH176B 2506 bp EcoRI fragment of pKH176A cloned into pUC19 This study

pKH176C 1983 bp EcoRI fragment of pKH176A cloned into pUC19 This study

pKH533 HindIII fragment of pKH176C cloned into pBCKS This study

pKH534 EcoRI/PstI fragment of pKH176B cloned into pKH533 This study

pKH538 Km resistance cassette cloned into EcoRI site of traG1 of pKH534 This study

pKH540 2,6 kb PCR fragment (oriT-F1/oriT-R1) cloned into pGEMT This study

pKH550 Lp Corby circularization point of Trb-1 (768 bp PCR fragment) This study

pKH551 Lp S13 circularization point of Trb-1 (768 bp PCR fragment) This study

pKH552 Lp Corby circularization point of Trb-2 (944 bp PCR fragment) This study

pKH553 Lp Corby tRNAPro region after excision of Trb-1 (844 bp PCR fragment) This study

pKH554 Lp S13 tRNAPro region after excision of Trb-1 (844 bp PCR fragment) This study

pKH555 Lp JR32 tRNAPro region (878 bp PCR fragment) This study

pKH556 trb/trb PCR fragment (656 bp) of transconjugant clone number 55 This study




pKHr25 946 bp DNA fragment (Sau3A) of Lp Corby chromosome (trbF1G1) This studyc

pKHr27 1137 bp DNA fragment (Sau3A) Lp Corby chromosome (lpc0219) This studyc

pKHr33 1146 bp DNA fragment (Sau3A) of Lp Corby chromosome (lpc2786/2787) This studyc

pCHA1 4kb PCR fragment (oriT-F1/oriT-R2) cloned into SacII/XbaI site of pBCKS (traH1I1J1-

oriT-traKLM)

This study

aLp strain Philadelphia-1-specific primers (Brassinga et al., 2003).bLp strain AA100-specific primers (Samrakandi et al., 2002).cPlasmid of a genomic library of Lp Corby identified by a random screen (Heuner et al., 1995, 2000).

G. Glockner et al. / International Journal of Medical Microbiology 298 (2008) 411–428414

Initial denaturation was performed at 95 1C for 3min,and final extension was performed at 72 1C for 5min. Toamplify the tRNAPro gene when Trb-1 is excised fromthe chromosome (primer pair trb-1/trb-4), PCR wasperformed using 45 cycles of amplification.

Amplification of the tRNAPro-encoding region ofLp Corby, Lp S13 and Lp JR32 was done by usingprimer pair trb-1/trb-4. Amplification of the 50 and 30

region of the integration point of Trb-1 into the genomeof Lp Corby, Lp S13 and Lp JR32 was done by usingprimer pairs trb-1/trb-2 (50) and trb-3/trb-4 (30). Thecircularization point of Trb-1 and Trb-2 was amplifiedby using primer pairs trb-2/trb-3 and trb-6/trb-7,respectively. All amplified DNA fragments were clonedinto vector pGEMTeasy and sequenced by GeneSysLaboratory, Munster, Germany.

Reverse transcription (RT)-PCR analysis

RT-PCR analysis was performed as described earlier(Jacobi et al., 2004). Briefly, total RNA was extractedfrom bacteria grown for 3 days on BCYE agar plates at30 1C (post-exponential phase) using the High PureRNA isolation kit (Roche, Mannheim, Germany) asdescribed by the manufacturer and incubated withDNase I (Roche, Mannheim, Germany) and then re-purified using an RNeasy Mini kit (Qiagen, Hilden,Germany). RT-PCR reactions were performed with anOneStep RT-PCR kit (Qiagen) according to theinstructions of the manufacturer using gene-specificprimers (see Table 1). The RT reaction was performedat 50 1C for 30min with 100 ng total RNA. PCRamplification was performed with 0.6 mM of eachprimer, 400 mM of each dNTP, 5� OneStep RT-PCRbuffer containing 12.5mM MgCl2 and 2 ml OneStep RT-PCR enzyme mix in a total volume of 50 ml. The cyclingconditions were 94 1C for 1min, 53–55 1C for 1min, and72 1C for 1min for 30–40 cycles with a Biometra T3Thermocycler (Biometra). Genes analysed by RT-PCRwere: trbH1I1, trbI1, traG1, trbL1traG1, traJ1, mutX,and traH1/mutX.

Legionella mutant construction

The trbG1H1I1 genes and the traG1 gene wereamplified by PCR and cloned into pGEMTeasy orpBC KS. Then the trbG1H1I1 genes and the traG1 genewere disrupted by introduction of a KmR cassette(received from Tn1732; Ubben and Schmitt, 1986)leading to plasmids pKH179D and pKH538, respec-tively (Table 1). In pKH179D the 30 region of trbG, trbH

and the 50 region of trbI were replaced by the KmR

cassette. In pKH538 the traG gene was inactivated byinserting the KmR cassette at the EcoRI/HindIIIrestriction sites of traG (see Fig. 1). PCR products

of the inactivated genes were then integrated intothe chromosome of strain Corby by natural transforma-tion and following homologous recombination asdescribed by Stone and Abu Kwaik (1999), resulting inmutant strains trbG1H1I1 (trb mutant) and traG1 (tra

mutant). PCR and Southern blot analysis (Sambrooket al., 1989) were used to examine KmR Lp Corby clonesfor the presence of the correct insertion (data notshown).

Lp mating experiments

Recipient Lp JR32 SmR and donor (Lp Corby wild-type harbouring pCHA1, traG1 or trbG1H1I1 mutantstrains) were taken from ABCYE plates after 72 h ofgrowth. Strains were suspended in sterile water toOD600 ¼ 2; 0.5ml of donor was mixed with 0.5ml ofrecipient strain. Matings were performed in triplicate byincubating the mixed bacteria cultures for 24 h at 30 1Con YEB agar plates with or without DNase (1 mg/ml).After mating, Lp transconjugants were selected onABCYE plates containing chloramphenicol (20 mg/ml)and streptomycin (50–100mg/ml) or kanamycin (15mg/ml)and streptomycin (50–100 mg/ml). Dilutions of trans-conjugants were plated on agar plates and the number oftransconjugants was determined. Conjugation frequen-cies were calculated as the number of transconjugantsdivided by the number of donor cells.

Intracellular multiplication in Acanthamoebacastellanii

A. castellanii was maintained and infected with Lp

Corby as previously described (Dietrich et al., 2001).Briefly, 5� 105 amoebae were infected with 1� 103

bacteria and incubated at 37 1C in 24-well plates up to 3days. Amoebae were lysed daily and serial dilutions werespread on BCYE agar plates to determine the number ofcolony-forming units (CFU). Whole lysates were usedfor PCR analysis using primer pair trb-2/trb-3 and�5� 104 bacteria as described above.

Nucleotide sequence accession number

The genome sequences of Lp Corby have been enteredin GenBank (accession number CP000675).

Results

Identification of the trb/tra region of Lp Corby

In a shot-gun sequencing project of the genome of Lp

Corby, several random sequences were generated.A BLAST search was performed and the insert of one

ARTICLE IN PRESSG. Glockner et al. / International Journal of Medical Microbiology 298 (2008) 411–428 415

clone (pKHr25, see Fig. 2) was predicted to encode aTrbG homologue of the Enterobacter aerogenes R751IncPb plasmid (Thorsted et al., 1998). TrbG was alsofound to be homologous to the VirB9 and LvhB9 ofAgrobacterium tumefaciens and Lp Philadelphia, respec-tively, both proteins found in T4ASSs (Alt-Morbe et al.,1996; Segal et al., 1999). We then cloned the completetrb1/tra1 region of Lp Corby by chromosomal walking(Trb-1). The cloned region encodes proteins found to behomologous to proteins of various known T4SSs (icm/

dot, lvh, vir, cag) of Lp, A. tumefaciens and Helicobacter

pylori (Censini et al., 1996; Covacci et al., 1997),respectively. At this time, the genome sequence of Lp

Corby was completed (Steinert et al., 2007). Homo-logues of TrbB (LvhB11, DotB, VirB11; Lp lvh operon,Lp icm/dot gene cluster and A. tumefaciens vir genecluster, respectively), TrbE (LvhB4, IcmB, VirB4), TrbG(LvhB9, Dot, VirB9), TrbI (LvhB10, IcmE, VirB10),and TraG (LvhD4, IcmO, VirD4) of pR751 wereidentified within the group of proteins encoded byTrb-1 (Fig. 1). However, most of the identified proteinsrevealed the highest identity to proteins of the IncPbplasmid R751 (data not shown). Since T4SSs areinvolved in the pathogenicity of various bacteria (Alt-Morbe et al., 1996; Covacci et al., 1997; O’Callaghanet al., 1999; Ridenour et al., 2003), we decided to furthercharacterize the identified trb1/tra1 region of Lp Corby.

In addition, by analysing the complete genome of Lp

Corby we identified a second trb/tra gene cluster (Trb-2)similar to Trb-1 (Fig. 2). Thus, we identified two lociencoding a new putative T4ASS with significantsimilarity to the tra/trb-encoded conjugation systemfound on the IncPb plasmid R751 of Enterobacter

aerogenes (Thorsted et al., 1998). These two loci aredescribed in detail below.

Description of genomic islands Trb-1 and Trb-2,

each encoding a putative conjugation/T4ASS of LpCorby

In silico analysis revealed that the trb/tra regions(Trb-1 and Trb-2), have no counterpart in any of thepublished Lp genomes. In the following, we designateTrb-1 genes with the extension 1 and Trb-2 genes with 2.

Trb1 region 1/I – the mating pair formation complex

(Mpf)

The genomic island Trb-1 of Lp Corby is composed of10 tra and 11 trb genes (Fig. 2A, region 1/I). The overallstructure is similar to the organization of the tra/trb

region of plasmid R751 (IncPb) of E. aerogenes

(Thorsted et al., 1998). Interestingly, Lp Corby trb/tra

loci exhibit all genes necessary to encode a functionalconjugation apparatus, but lack nearly all non-essentialgenes (trbMNOP and traE). In contrast to pR751, noTn element could be identified between the trb and tra

region. Furthermore, the trb and parts of the tra regionare fused to one major region (Fig. 1). The pilus is madeby a cyclized TrbC (Kalkum et al., 2002). The domainsor motifs (signal peptide sequences, transmembraneregions, and the cyclization motifs) needed for thisprocess are all present in Lp Corby TrbC (data notshown). TrbC of Lp Corby exhibits 45% identity toTrbC of E. aerogenes. Thus Trb-1 encodes all proteins

ARTICLE IN PRESS

function: mating pair formation / surface exclusion auxiliary transfer transfer / relaxosome

trbA B C D E F G H I J K L traC4,C3, C2 F G H I J traK L M

trbM N O P Tn402/5090 E

Enterobacter(IncP , pR751)tra/trb

A. tumefaciensvir

B1 B2 B3 B4 B5 B6 B7 B8 B9 B10 B11 D4

Lp Corby (IncP )trb/tra

lvrA B C trbB C D E F G H I J K L traG F D C mutT mutX traH I J K L M

oriTter

Lp Phil (IncN)lvh

lvrA B C lvhB2 B3 B4 B5 B7 B6 B8 B9 B10 B11 D4

oriT

KmR KmR

Fig. 1. Genetic organization of T4ASSs of Enterobacter aerogenes plasmid R751, Lp Corby trb/tra, Lp Philadelphia lvh and

Agrobacterium tumefaciens vir genes. Homologous genes are shaded in the same pattern. The insertion points of the KmR cassette of

the trbG1H1I1 mutant strain and the traG1 mutant strain are indicated below the trb/tra genes of Lp Corby (Heuner et al., 2002;

modified).


needed to assemble a functional putative conjugation/T4ASS.

In Lp Corby Trb-1, two genes (named mutT andmutX) were identified between the Mpf-encoding oper-ons and the oriT region (Fig. 1). MutT is a putativeprotein exhibiting a MutT-Pfam domain, commonlyfound in MutT proteins involved in the 8-oxodGTP(GO) system of bacteria (Oliver et al., 2002; Tsai-Wu etal., 1991). MutT exhibits 31% and 30% identity to theMutT proteins of A. tumefaciens and Brucella melitensis,respectively. mutX encodes a putative protein exhibitinga ParB-Pfam domain, commonly found in ParB-likenucleases. ParB-encoding genes were found in the IncPaplasmids and encode proteins needed for stable main-tenance of the plasmid. In the IncPa plasmids the par

operon is located between the trb and tra-1 region(Thorsted et al., 1998).

We identified an origin of transfer (oriT) consensussequence within the oriT region (traHIJ-oriT-traKLM)

(Fig. 1). Recently, another oriT region was identified inLp AA100 but not further characterized (Samrakandiet al., 2002). However, this oriT region shows only 70%identity (on DNA level) to the oriT region of the trb/tra

system of Lp Corby, but the oriT consensus sequence(�250 bp) of both strains are nearly identical to the oriT

consensus sequences of plasmids R751 and RP4(Fig. 3A).

Trb-1 region 1/II

Upstream of traM1 are additional 12 genes (region 1/II, see Fig. 2A) belonging to the genomic island but notrelated to the trb/tra genes (Table 2A). In this region aputative type I restriction modification (R-M) system(lpc2788-2790), putative regulatory proteins and onecopy of an IS4-like element (TP-3, lpc2783) are present.

The genomic island is flanked by a direct repeat of54bp (see Fig. 4D), the 30 end of tRNAPro, showing thatthe complete region is inserted into the tRNAPro-encoding

ARTICLE IN PRESS

TPR

LpC Trb-2 (34,434 bp)

trbB2C2D2E2 F2G2H2 I2 J2K2 L2 traG2 F2D2 C2 traH2 I2J2K2L2M2 Int Int SdeC-like Mrr SidClvrR2

lvrA BC Tn map-1

2/I 2/II pKHr27

lpplvhB2 B3 B4 B5B7lvrDlvhB6B8B9 B10 B11 lvhD4 lvrE 82-------------87 ---------------------- 97 98 99-----------206 07----09 17 -----

lpc ---------------------------------------------------------------------82-------------------------------------91- --------------------- ------------------------------------------------------------ -- - - -

Tn Tn Tn InttraA traD Int

0158----- ---64

lvrABC

lpgTn IntTnIs

2 43-----47 48----51 ----------

trbB1C1D1E1 F1G1H1 I1 J1K1L1 traG1 F1D1 C-1 traH1 I1J1K1L1M1 hsdM S R trwB traR

Lp Corby (lpc)

Lp Philadelphia (lpg)

Lp Paris (lpp)

Lp Lens (lpl)

0522/3 25 26 27

LpC Trb-1 (42,710 bp)

0586 89 90 91 92

0561/ 7172 73

lvrA BC mutT mutX RecB/helicase Tn

lvrR1

DUF1526

Int

lpl0562--70

lpp0587/8

pKHr251/I 1/II

2822- 20 2777---75

lpc2819-----16----------------------------------------------------------800------------------795-----------91 90------------88---------------------------83---------79

genomic island

variable genomic region

95-99% aa identity (core-genome) trb/tra genes trb/tra-associated

tRNA-Pro oriTTP1tmRNA Trb-2-associated repeat

DNA-restriction/modification

repeat

putative type I secretion system

Trb1-associated repeat Tn/IS element

Fig. 2. Genetic organization of the genomic islands Trb-1 (A) and Trb-2 (B) of Lp Corby encoding two similar T4AS/conjugation

systems. Trb-1 is integrated in gene lpc2778 (tRNAPro). No insertion is found within the tRNAPro genes of strains Lp Philadelphia,

Lp Paris and Lp Lens. Homologous genes are shaded in the same pattern and the meaning of colours is given at the bottom of the

figure. The gene numbers (lpc, lpg, lpp, or lpl for Lp strain Corby, Philadelphia, Paris or Lens, respectively) are given above the genes

which are indicated by arrows. Trb-1 and Trb-2 subregions 1/I, 1/II and 2/I, 2/II are given above the genes. Locations of plasmids

(pKHr25, pKHr27) are indicated above the subregions.


gene lpc2778 of Lp Corby. Probably this integration ismediated by the site-specific integrase (Int-1, lpc2818),located within the genomic island (see below). Thegenome still exhibits a complete version of the tRNAPro

gene (see Fig. 4A). In the genomes of the three othersequenced Lp strains (Paris, Lens, Philadelphia) noinsertion in the tRNAPro gene (see Fig. 2A) and also nocopy of the Int-1-encoding gene is found.

Genomic island Trb-2

There is a second Trb-1-like region (Trb-2) present inthe genome of Lp Corby (Fig. 2B and Table 2B). Thisgenomic island encodes a similar trb/tra locus (Fig. 2B,region 2/I) exhibiting an overall identity of approxi-mately 77% to the trb/tra genes of Trb-1 (data notshown). Thus, this region is not a direct duplication ofthe Trb-1 region and probably has a different origin.Furthermore, traK2 is inactivated by the integration ofan IS-like element (TP1). TP1 is flanked by a directrepeat (TTTGGG), probably evolved by the integrationprocess and by various copies of another repeat(ATTCCGG-N7-TGATCA). TP1 exhibits two openreading frames of 503 and 248 amino acids (TP1A and -B), coding for a putative integrase and a predictedDnaA/C-ATPase, respectively. Trb-2 also exhibits a

site-specific integrase (Int-2, lpc0199) located in region2/II and is flanked by a direct repeat of 31 nucleotides(see Fig. 4D). Trb-2 is inserted in tmRNA gene lpc0163

at the same position as lvh in Lp Paris and Lp Lens(Fig. 2B). In Lp Philadelphia this gene (tmRNA,lpp0142) exhibits no integrated DNA but varioustransposons and IS elements nearby (Fig. 2B).

Region 2/II of Trb-2 is completely different fromregion 1/II of Trb-1 (Fig. 2B). In this region areadditional 10 genes which do not belong directly tothe trb/tra genes (Table 2B), encoding a putativeguanine/cytosine deaminase (lpc0193), two putativeregulatory proteins (lpc0196, lpc0201) and a site-specificintegrase (lpc 0199). A similar region is also localized onthe genomic islands of Lp Paris (pP36) (Fig. 2B) and Lp

Philadelphia (pLP45) encoding the Lvh system.It is noticeable that in front of the trb/tra, lvh and the

LpPI-1-associated tra region paralogs (LvrC) of theglobal regulator CsrA are found (Cazalet et al., 2004). InpR751, trbA, encoding a regulator of the tra/trb region,is found in front of trbB. Accordingly, the CsrAparalogs of Lp trb/tra regions might be regulators ofthe expression of the trb/tra genes. There are differencesin the degree of homology and length of the differentCsrA paralogs in Lp (data not shown).

ARTICLE IN PRESS

0,000001 0,00001 0,0001 0,001 0,01 0,11

Trb-1 GGTTTGTGAAGATTGATAGCCAGCTTGCTGGTTAGCTAACTTCACCTATCTTGCCCTGCTTTT

Trb-2 ...........T...................................................

Lp.Ph ..C.C......T...GC.A......C.................................A...

Lp.Pa .AC.C......T...G..A..........................A.............A...

Lp.Le .AC.C......T...GC.A......C.................................A...

Tra-1 .AC......G.T...G...........................................G...

R751 ..ACA........A....A..G...C..C................AC...C.....GC...AC

RP4 ..ACA.......AG..ACA..C...C..G...GG..CT............C.....G...GAC

TraKTraJ TraI

replication

Transconjugation rate

wt pKS

traG pCHA1

wt pCHA1/DNase

wt pCHA1

Fig. 3. Structure and functionality of the oriT region of Lp Corby. (A) Alignment of the oriT consensus sequence of Lp Corby

(Trb-1 and Trb-2) with the oriT of Lp Philadelphia (Lp.Ph), Lp Paris (Lp.Pa), Lp Lens (Lp. Le), Lp AA100 (Tra-1) and of plasmids

R751 and RP4. The putative TraJ-binding site (large arrows), the TraI-binding site (dotted line) and the nick region (small arrow)

are indicated. (B) Conjugation experiments using plasmid pCHA1, harbouring the oriT region of Trb-1 and strain Lp Corby/

pCHA1 as donor and Lp JR32 as recipient. Wild-type (wt) pKS, Lp Corby harbouring plasmid pBC KS (negative control); traG

pCHA1, donor traG1 mutant strain harbouring plasmid pCHA1; wt pCHA1, donor strain Lp Corby harbouring plasmid pCHA1

with or without DNase during conjugation.


Trb-1 of Lp Corby encodes a functional conjugation

system

Computer analysis

In silico analysis of the proteins encoded by Trb-1(TrbB, TrbC, TrbE, TraG, TraF, TraI) revealed thepresence of motifs commonly found in proteins encod-ing conjugation systems, which are indispensable for thefunctionality of the conjugation systems (Balzer et al.,1994; Kalkum et al., 2002; Krause et al., 2000a, b;Pansegrau et al., 1993; Rabel et al., 2003; Schroder et al.,2002). All proteins necessary for assembling a functionalconjugation/T4ASS are present. Only proteins notessential for conjugation are missing in the trb/tra genecluster of Lp Corby (see above). Altogether thisindicates that the conjugation system of Lp Corbyencoded by Trb-1 may be functional.

Expression analysis

Analysis of trb/tra gene expression of Trb-1 was doneby RT-PCR experiments (see Materials and methods).The results revealed that the genes encoding theconjugation system of Trb-1 are active in the wild-typestrain of Lp Corby (data not shown). Furthermore, RT-PCR experiments showed that the traG1 gene is nottranscribed in the trbG1H1I1 mutant strain. Therefore,traG1 seems to be a member of the same operon astrbG1H1I1 (data not shown). Thus, the results suggestthat a major operon exists which exhibits at least thetrbI1J1K1L1-traG1 genes. However, further studies arein progress to analyse trb/tra gene expression in detail.

Excision and mobilization of the Trb regions

The presence of direct repeats and a putative site-specific integrase indicated a potential for excision of theTrb regions. Therefore, we analysed liquid- and agar-grown bacteria for excision of genomic islands by PCR.Using primer pairs specific for the chromosomal and thepotential circular excised form (see Materials andmethods), we show that the genomic island Trb-1 canbe excised from the chromosome resulting in anepisomal circular form (Fig. 4C; lane 1) plus achromosomal ‘‘wild-type’’ tRNAPro gene (Fig. 4A, C;lane 5). The integration of Trb-1 into the tRNAPro genewas demonstrated by the presence of amplificationproducts using primer pairs trb-1/trb-2 (Fig. 4C; lane2) and trb-3/trb-4 (Fig. 4C; lane 3). Detection of the‘‘wild-type’’ tRNAPro gene (after excision of Trb-1 fromthe chromosome) was possible by PCR analysis using 45amplification cycles (Fig. 4C; lane 5) but not with 30amplification cycles (Fig. 4C; lane 4). Similar resultswere obtained for a second Lp strain S13 which alsoexhibits a homologue of Trb-1 (data not shown). Inaddition, we found by PCR analysis that excision of

ARTICLE IN PRESS

Table 2A. Structure of the genomic island Trb-1 of

L. pneumophila Corby

Trb-1 (42,710 bp)

Lpc Name Putative function or similar

protein

– Repeat attL-1 site

2819 DUF1526 Present on the Ti plasmid of

Agrobacterium tumefaciens

2818 Int-1 Integrase with similarity to

bacteriophage integrase P4

2817 ORF139

2816 lvrR3 Pfam: HTH_Xre, Peptidase_24;

putative regulator

2815 lvrA3 Similar to lpp0166

2814 lvrB3 Similar to lpp0167

2813 lvrC3 CsrA paralog, regulation (?)

2812 trbB1 Mpf, ATPase

2811 trbC1 Mpf, Prepilin

2810 trbD1 Mpf

2809 trbE1

2808 trbF1 Mpf

2807 trbG1 Mpf

2806 trbH1 Mpf

2805 trbI1 Mpf

2804 trbJ1 Mpf

2803 trbK1 Entry exclusion

2802 trbL1 Mpf, topoisomerase (?)

2801 traG1 Dtr-Mpf connector

2800 traF1 Maturation

2799 traD1

2798 traC1 DNA primase

2797 mutT MutT (Pfam_NUDIX)

2796 mutX ParB-like

– traH1 Relaxasome stability

2795 traI1 DNA relaxase

2794 traJ1 oriT binding

2793 traK1 oriT binding

2792 traL1

2791 traM1

2790 hsdM hsdM, putative type-1 restriction

enzyme M

2789 hsdS hsdS, putative type-1 restriction

enzyme S

2788 hsdR hsdR, putative type-1 restriction

enzyme R

2787 ORF417 Signal peptide

2786 ORF586 Exhibits a putative domain of

TrwB

2785 ORF1139 Putative recB/helicase

2784 ORF107 TraR-like, with autoinducer-

binding domain

2783 TP3 Pfam_Transposase 11

2782 ORF400 Putative proline/betaine

transporter

2781 ORF114 Similar to lpp1282

2780 ORF65

2779 ORF255 Putative Ca++/H+ antiporter

domain

– Repeat attR-1 site


ARTICLE IN PRESS

tRNAPro region of the genome of Lp Corby

attR-1tRNAPro

1 2 3 4

lpc2822Trb-1

attL-1

attP-1

Trb-1 Ci

Trb-1

cggagtgtagctcagactggtagagcactgccttcgggaggcaggggtcgcaggttcaattcctgtcactccgaccatataaaatcaaaaattagaattttccacataatg

tRNAPro+

tRNAPro region of the genome of Lp Corby after excision of Trb-1 4

lpc2822

1

Excision, circularization

tmRNA region of the genome of Lp Corby

Trb-2

attR-2tmRNA

5 6 7 8

lpc0163 lpc0202Trb-2

attL-2

Excision, circularization

attP-2

Trb-2 Ci

lvgA

lvgA

attB-1

2/3 1/2 3/4 1/4 1/4 M

1 2 3 4 5 6

6/7 5/6 7/8 5/8 M

7 8 9 10 11

Fig. 4. Mechanism of generating the episomal circular form of Trb-1 (A) and Trb-2 (B) of Lp Corby. (A) After excision and

circularization of Trb-1 (Trb-1 Ci) as an episomal element, an intact tRNAPro gene is left at the ‘‘core’’ genome of Lp Corby. The

genomic island Trb-1 is indicated by a vertical striped arrow and the sequence of the tRNAPro gene (lpc2778) after excision of Trb-1

is given. (B) Trb-2, indicated by a checkered arrow, is also able to be excised from the chromosome forming a ring-shaped structure

(Trb-2 Ci). Insertion point of Trb-2 is the tmRNA gene lpc0164. The name and orientation of primers used in PCR analysis are given

below the arrows (see also Table 1). (C) Results of PCR analysis of Trb-1 and Trb-2. The trb primers used for amplification are

indicated above the lanes. (Lane 4) 30 amplification cycles; (lane 5) 45 amplification cycles; (lanes 6 and 11) (M), 1-kb DNA ladder.

(D) Nucleotide sequence of the attP sites of the circular form of Trb-1Ci and Trb-2Ci. The attP site is indicated as an arrow above the

nucleotide sequence. Abbreviations: attB, chromosomal integration site; attP, episomal integration site; attL and attR,

chromosome-genomic island junctions.


Trb-1 also occurs during intracellular replication inAcanthamoeba castellanii (data not shown).

Using the same PCR method as described above, wedemonstrate that like Trb-1, Trb-2 can be excised fromthe chromosome resulting in a circular form (Fig. 4B, C;lane 7) and the tmRNA gene without integrated Trb-2(Fig. 4C; lane 10). The integration of Trb-2 wasdemonstrated by using primer pairs trb-5/trb-6(Fig. 4C; lane 8) and trb-7/trb-8 (Fig. 4C; lane 9). Thecircular forms of both islands were identified bysequence analysis of the PCR products showing a directrepeat (attP site) which presumably is necessary forthe integration of the islands into the chromosome(see Fig. 4D).

The comparison of the integrases of Int-1, Int-2 andthe integrases encoded by pP36 (lpp0194) and pLP45(lpg1229) revealed that Int-2 and Lpp0194 are similar(�82% amino acid similarity), and also Int-1 andLpg1229 (�78% amino acid similarity), whereas theseboth groups of integrases are unrelated (Int-1 and Int-2exhibit only �38% amino acid similarity) (Fig. 5A). Onthe other hand, the att sites of Trb-2 and pP36 areidentical; both islands are integrated within the tmRNAgene of each strain. However, the att sites of Trb-1 andpLP45 are not identical. Though the integration sites ofTrb-1 within the tRNAPro gene and of pLP45 within thetRNAArg gene are very similar (Fig. 5B).

The oriT region of Trb-1 is functional and Trb-1 is

horizontally transferred to an Lp JR32 strain by

conjugation

As mentioned above, we identified an oriT region inboth Trb islands. The nucleotide sequences of oriT ofTrb-1 and Trb-2 are nearly identical and the completeoriT region of strain AA100 (Samrakandi et al., 2002) is70% identical (DNA level) to the oriT region of Trb-1 ofLp Corby. A similar oriT consensus sequence, butwithout the traHIJLM genes is also present in thegenomes of Lp Philadelphia, Paris, and Lens (Fig. 3A).

We tested whether the oriT region of Trb-1 isfunctional. For this purpose we cloned the traH111J1-

oriT-traK1L1M1 region of Lp Corby into vector pBCKS, resulting in plasmid pCHA1. Then pCHA1 wastransformed into Lp Corby wild type and an isogenictraG1 mutant strain (see Materials and methods).Conjugation assays with Lp Corby wild-type and traG1

mutant strains exhibiting pCHA1 as donors and Lp

JR32 SmR as recipient substantiated that the oriT regionof Trb-1 is able to mobilize this non-mobile plasmid(Fig. 3B). However, the conjugation ability of the traG1mutant strain was not significantly reduced (Fig. 3B).Probably the gene products of genomic island Trb-2 areable to substitute for the missing Trb-1 protein in themutant strain. As expected, the traG1 and the trbG1H1I

ARTICLE IN PRESS

Table 2B. Structure of the genomic island Trb-2 of

L. pneumophila Corby

Trb-2 (34,434 bp)

Lpc Name Putative function or similar

protein

– Repeat attL-2 site

0164 ORF53

0165 ORF434 TPR-like protein

0166 lvrR2 Pfam: HTH_Xre, Peptidase_24;

putative regulator

0167 lvrA2 Similar to lpp0166

0168 lvrB2 Similar to lpp0167

0169 lvrC2 CsrA paralog, regulation (?)

0170 trbB2 Mpf, ATPase

0171 trbC2 Mpf, Prepilin

0172 trbD2 Mpf

0173 trbE2

0174 trbF2 Mpf

0175 trbG2 Mpf

0176 trbH2 Mpf

0177 trbI2 Mpf

0178 trbJ2 Mpf

0179 trbK2 Entry exclusion

0180 trbL2 Mpf, topoisomerase (?)

0181 traG2 Dtr-Mpf connector

0182 traF2 Maturation

0183 traD2

0184 traC2 DNA primase

0185 ORF123 Conserved hypothetical protein,

putative ATPase subunit alpha

0186 ORF352 Putative prophage protein

– traH2 Relaxasome stability

0187 traI2 DNA relaxase

0188 traJ2 oriT binding

0189a traK2 oriT binding

0190 traL2

0191 traM2

0192 ORF645 Two transmembrane regions

0193 ORF153 lpp0188 homolog; putative

guanine/cytosine deaminase

0194 ORF480 lpp0189 homolog; signal peptide,

putative membrane protein

0195 ORF119 lpp0190 homolog; ?

0196 ORF217 Pfam: HTH_Xre, Peptidase_24;

putative regulator

0197 ORF82 lpp0192 homolog

0198 ORF68 lpp0193 homolog; putative phage

excisionase

0199 Int-2 lpp0194 homolog; putative

integrase (lambdoid prophage)

0200 ORF271

0201 ORF263 H-T-H, putative transcriptional

regulator

– Repeat attR-2 site

aWith inserted TP1 element (two genes flanked by repeats, see

Fig. 2B).


ARTICLE IN PRESS

Fig. 5. (A) Comparison of the amino acid sequences of Lpc0190 (Int-C2) and Lpc2817 (Int-C1) with the amino acid sequences of the

integrases Lpp0194 (Int-Pa) and Lpg1229 (Int-Ph) of plasmids pP36 and pLP45 of Lp Paris and Lp Philadelphia, respectively.:,

identical amino acid; �, missing amino acid. (B) Comparison of the tRNA-Arg gene of Lp Philadelphia with the tRNA-Pro gene of

Lp Corby with integrated genomic islands (pLp45 and Trb-1). Identical nucleotides are shown in bold. The nucleotide sequence of

the att(L) sites (underlined) of the integration point of pLP45 (Lp Philadelphia) and Trb-1 (Lp Corby) are given. In both strains, the

underlined sequence is also found at the opposite end of the genomic island (attR).


ARTICLE IN PRESS

tRNAPro region of the genome of Lp JR32 transconjugants (TK50, 80)

tRNAPro region of the genome of Lp JR32

tRNAPro

+(Int-1)

attR-1tRNAPro

1 2 3 4

lvgA Trb-1

attL-1

attB-1

trb tra JR 55 80 Mtrb tra JR 55 80 Mtrb tra JR 55 80 M

Integration(1/2) (1/4) oriT

19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 361 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18

lvhB10 TP-2 Circular form (2/3)

trb tra JR 55 80 Mtrb tra JR 55 80 Mtrb tra JR 55 80 M

attaagagcagggtctattccgaagacatcggttacaaattatatcggagacccaggttaacataatglvgA

tRNAPro region of the genome of Lp Corby

attR-1tRNAPro

1 2 3 4

lpc2822Trb-1

attL-1attP-1

Trb-1 CiExcision, circularization

lvgA

Conjugation with Lp JR32

Integration

Fig. 6. (A) Putative mechanism of horizontal transfer and integration of Trb-1 into the genome of recipient strain Lp JR32 (for

details, see text). The excised and circular form of Trb-1 is mobilized and transferred to strain JR32. Trb-1 is then site-specifically

integrated into the genome of Lp JR32 (indicated in grey) at the attB site, at the identical nucleotide position of the tRNAPro gene as

in strain Corby, suggesting a role of the site-specific integrase Lpc2818 (Int-1) for that process. The sequence of the tRNAPro gene is

indicated by an arrow, the episomal integration site (attP-1) of Trb-1 is marked in black and the genomic island Trb-1 as a vertical

striped arrow. The nucleotide sequence downstream of the tRNAPro gene of strain JR32 is given. Gene sequences of strain Corby

and JR32 are indicated as black or grey lines, respectively. The name and orientation of primers used in PCR analysis are given

below the lines (see also Table 1). (B) Results of PCR analysis of transconjugants. The primers used for amplification were: (lanes

1–5) lvhB10F/R; (lanes 7–11) TP-2F/R; (lanes 13–17) trb-2/trb-3; (lanes 19–23) trb-1/trb-2; (lanes 25–29) trb-1/trb-4; (lanes 31-35)

oriTF/R. Abbreviations: attB, chromosomal integration site; attP, episomal integration site; attL and attR, chromosome-genomic

island junctions; Int-1, integrase encoded by gene lpc2818; M, 1-kb DNA ladder; trb, trbG1H1I1 mutant strain of Lp Corby; tra,

traG1 mutant strain of Lp Corby; JR, Lp JR32; 55, transconjugant (clone number 55) using the trb mutant strain as donor; 80,

transconjugant (clone number 80) using the tra mutant strain as donor.


mutant strains still were able to form the Trb-1 circle(see Fig. 6B, lanes 13 and 14).

We then asked whether the whole Trb-1 region can betransferred to a different Lp strain. We performed aconjugation assay using trbG1H1I1 and traG1 mutantstrains as donor and the Lp strain JR32 SmR asrecipient. These experiments demonstrated that Trb-1can be mobilized, transferred to strain JR32, and site-specifically inserted into the genome. The transconjuga-tion rates were approximately 10�5. The resultingtransconjugants of Lp JR32 harboured the completeTrb-1 region (plus the Km resistance cassette) integratedat the identical position within the tRNAPro geneas in strain Corby (Fig. 6A). This was shown by cloningand sequencing of the tRNAPro gene of strainJR32 (recipient) and the 50 and 30 insertion points ofthe transconjugants (Fig. 6A). Three different transcon-jugants (clones 55, 75, and 80) were analysed indetail (by PCR analysis and DNA sequencing) andfurther 30 transconjugants by PCR analysis (seealso Materials and methods). To ensure that theobtained clones were correct transconjugants and tocontrol for correct integration of Trb-1 into thetRNAPro gene, we also used primers specific for thedonor Lp Corby (TP2 gene) and for the recipient Lp

JR32 (JR32, lvhB10 gene) (Fig. 6B, lanes 10–11, 4–5and 22–23/28–29, respectively). The transconjugantswere also able to excise Trb-1 from the chromosomeresulting in a circular form, as shown by PCR analysis(Fig. 6B, lanes 16 and 17). These results clarify that theoriT region of Trb-1 is functional and that the wholeisland is mobile and is able to be transferred to anotherLp strain.

Distribution of the trb/tra gene cluster

To analyse the distribution of the trb/tra region in thegenus Legionella, Southern hybridization of chromoso-mal DNA of various Lp and non-pneumophila strainswith different trb/tra-specific probes was performed (seeMaterial and methods). Results are summarized inTable 3. Only 4/17 Lp strains and 6/15 non-pneumophila

strains exhibit trb/tra-homologous loci. trbB-, trbI- andtraG-specific probes hybridized with the correspondinggenes of Trb-1 and Trb-2. Southern blot analysis withprobes specific for trbI1, traG1 and lpc2790 (hsdM,region 1/II) indicated that an apparent identical Trb-1cluster is only present in strain Lp S13, which seems tolack the Trb-2 island. A similar Trb-1 cluster (region 1/I)is present in Lp strain 640, L. israeliensis and L. jordanis.

A trb/tra system similar to Trb-2 is present in strains Lp

640, L. dumoffii, L. gormanii, L. anisa, and L. lyticum. Inaddition, the chromosomal DNA of all these strains alsohybridized with a DNA probe specific for the oriT

region.

We further analysed the distribution of lvhB10 andthe PI-1-associated traD region of Lp Philadelphia(Table 3). The results indicated that trb/tra is commonlynot found if lvh is present, with the exception of Lp

strain AA100 and L. dumoffii. On the other hand, noneof the strains tested exhibited all three types of islands.L. anisa and L. erythra exhibited a homologue ofLp-PI1. A mip-specific probe was used as a positivecontrol for hybridization.

Discussion

Lp Corby (S1) is a virulent human isolate. The strainmultiplies very rapidly in the lung of guinea pigs. Inaerosol-infected animals the bacteria were found in thelung, blood, liver, spleen, and kidney (Jepras et al.,1985). Lp Corby is used in a growing number of studiesin different laboratories investigating virulence mecha-nisms of Lp. Lp Corby has not only the T4BSS commonto all Lp strains tested so far, but also encodes twoadditional T4ASSs located on two separate genomicislands (Trb-1 and Trb-2). The trb/tra genes of the novelT4ASSs of strain Corby are most similar to proteins ofthe T4SSs tra/trb and vir of E. aerogenes andA. tumefaciens, respectively. On the other hand, Lp

Corby lacks the lvh-encoded T4ASS common to Lp

strains Philadelphia, Paris, Lens, and others (Cazaletet al., 2004; Heuner et al., 2002; Ridenour et al., 2003;Segal et al., 1999).

Our data suggest that trb/tra (Trb-1) encodes afunctional conjugation/T4ASS. (i) The organization ofthe trb/tra gene cluster seems to be optimized (seeabove), all essential genes are present in the trb/tra genecluster and the predicted proteins exhibit the expectedPfam motifs. (ii) RT-PCR analysis indicates that thetrb/tra region is expressed. (iii) We demonstrated thatthe identified oriT region was able to mobilize a non-mobile plasmid. (iv) The genomic island Trb-1 can beexcised from the chromosome and then transferred byconjugation and integrated site-specifically into thegenome of another Lp strain.

In addition to the trb/tra gene cluster Trb-1, Lp

Corby possess a second trb/tra gene cluster (Trb-2). Dueto the comparative low identity of the trb/tra genes ofboth islands we hypothesize that they have beenacquired via independent horizontal gene transferevents. Southern blot analysis of various Legionella

strains indicate that trb/tra is widely distributed amongthe genus Legionella. However, in some cases, the failureof cross-hybridization may arise from DNA diversityfound in different Legionella strains. In addition, theexperiments revealed that in general lvh is missing if atrb/tra gene cluster is present, with exception of Lp

strain AA100 and L. dumoffii. But since Trb-1 was able


to be conjugated to JR32 and integrated into thegenome of this lvh-positive strain, there seems to be noexclusion mechanism present in Legionella for theseT4ASSs. It would be interesting to analyse, if the trb/tra

gene cluster is able to complement an lvh mutant strain.In Lp Corby Trb-1, two genes are localized between

the trb gene cluster and the oriT region. MutX exhibitssimilarity to ParB, which is involved in the maintenanceof plasmid stability (Roberts et al., 1990; Thorsted et al.,1998). The second gene encodes a protein withhomology to MutT proteins of various bacteria (Oliveret al., 2002). MutT was the first mutator gene describedin E. coli (Tsai-Wu et al., 1991). It encodes a hydrolasethat converts GO to 8-oxodGMP, preventing GOincorporation into the DNA and therefore preventing

A:T to C:G mutations. In Lp these genes may beinvolved in the maintenance of genomic island stability.

Upstream of trbB1 and 2 of Lp Corby we identified aCsrA paralog (LvrC) of E. coli and Lp CsrA. A CsrAparalog (lvrABC gene cluster) was also identified directlyupstream of the lvh region and the tra region of PI1 butnot within the two icm/dot regions (Brassinga et al.,2003; Segal et al., 1999). Likely, these regulators areinvolved in the regulation of T4ASS expression. Bothislands of Lp Corby exhibit further regulatory proteins(transcriptional regulator, regulator with autoinducer-binding domain) which also could be involved in theregulation of trb/tra gene expression or of the excision/integration process of the islands. It was describedrecently, that the lvh region can be excised from the

ARTICLE IN PRESS

Table 3. Distribution of several trb/tra genes among various Legionella strainsa

Strain Trb-1 Trb-2

1/I 1/II 2/I LpPI-1

trbI1 traG1 oriT/(traJ1) hsdM trbB2 TP-2 lvhB10 traD mip

Lp. Corby + + + + + + � � +

Lp.AA100 + + + nd + nd + � +

Lp.JR32 � � � � � + � +

Lp. Phil I � � (+) � � � + + +

Lp. S7 � � � � � � + � +

Lp. S10 � � � � � � + � +

Lp. S12 � � (+) � � � � + +

Lp. S13 + + + + + + � � +

Lp. Msp 19 � � � � � (+) (+) � +

Lp. U22 � � � � � � (+) � +

Lp. U21 � � � � � � (+) � +

Lp. 685 � � � � � � (+) � +

Lp. 640 + + + � + � � � +

Lp. 664 � � � � � + (+) � +

L. bloomington � � (+) � � � (+) � +

Lp. Los Angeles � � (+) � � + (+) � +

Lp. Chicago 2 � � (+) � � + (+) � +

L. bozemanii � � � � � � � � +

L. dumoffii + + + � + � + � +

L. feelei � � � � � � � � +

L. gormanii + + + � + � � � +

L. hackeliae [S1] � � � � � � � � +

L. hackeliae [S2] � � � � � � � � +

L. israeliensis + + + � + + � � (+)

L. jordanis + + + � + � � � +

L. longbeachae [S1] � � � � � � � � +

L. longbeachae [S2] � � � � � � � � +

L. micdadei � � � � � � � � +

L. oakridgensis � � � � � + + � +

L. anisa + + (+) � + � � + +

L. erythra � � � � � � � + +

L. lyticum + + + � + � � � +

+, positive; (+), weakly positive; �, negative; nd, not done.aHybridization was done using low-stringency conditions (Heuner et al., 1995).


chromosome forming a multicopy plasmid (Cazaletet al., 2004). The excision seemed to be growth-phasedependent, occurring during exponential phase, but noregulator was identified (Doleans-Jordheim et al., 2006).

In this study, we pinpoint the consensus sequence ofthe excision and/or integration site of Trb-1 and Trb-2.We further showed that the excision of the Trb-1 islandoccurs in vitro and also in vivo during infection ofA. castellanii. In addition, we demonstrated that thewhole genomic island can be transferred to another Lp

strain and site-specifically integrated into the genome.Preliminary results revealed that this element also can betransferred and site-specifically integrated into thegenome of L. micdadei, indicating that the transfer ofTrb-1 by conjugation is not restricted to Lp strains (datanot shown). Thus, the island seems to be able to behorizontally transferred to other Legionella species alsoin its natural environment. The circular episomal formof Trb-1 was also detectable in the transconjugants ofL. micdadei. We suppose that the site-specific integrase,present on the genomic island, may be responsible forthis mechanism of excision and integration (see Fig. 6).The comparison of the integrases of Trb-1 and Trb-2(Int-1 and Int-2) with integrases found on the genomicislands pP36 (lpp0194) and pLP45 (lpg1229) revealedthat Int-1 and Int-2 are unrelated and the integrationsites are very different (Fig. 5). Furthermore, Int-1 issimilar to Lpg1229, but Trb-1 is integrated within thetRNAPro gene and pLP45 within the tRNAArg gene.However, the att sites of both integrases are very similar(Fig. 5B), suggesting that the mechanism of integration/excision seems to be identical. On the other hand, the attsites of Int-2 and Lpp0194 are identical, and bothcorresponding islands are integrated within the tmRNAgene.

Although Lp is able to transfer chromosomal DNAinto another Lp strain, no element or mechanism couldbe identified so far, responsible for this observation(Miyamoto et al., 2003). Lp can conjugate RSF1010-related plasmids in an icm/dot-dependent manner andlvh also contributes to the ability to mobilize a plasmid(Ridenour et al., 2003; Segal and Shuman, 1998, 1999;Segal et al., 1998, 1999; Vogel et al., 1998). Anintegrated (chromosomal) conjugation system contain-ing an oriT region, like the one present within the Trb-1and Trb-2 genomic islands, might explain this ability. Ifa chromosome acquires an oriT, e.g. by integration of aconjugative plasmid, it can become mobilized. In E. coli,such strains are known as strains of high frequency ofrecombination (Hfr) (Low, 1996). Our in silico analysisrevealed that all yet sequenced Lp strains exhibit an oriT

element in their genomes (Fig. 3A).We showed that after excision of Trb-1, the whole

genomic island can be conjugated to the genome ofanother Legionella strain and integrated site-specificallyinto the genome of the recipient. This mechanism

explains for the first time horizontal DNA transfer inLegionella, which is not due to natural competence forDNA transformation (Stone and Abu Kwaik, 1999).Thus, here we demonstrate a putative mechanism ofhorizontal transfer of large chromosomal DNA regionsin Legionella.

Acknowledgements

This work was supported by grants from the DeutscheForschungsgemeinschaft (Grants GRK 587/2 and HE2845/2-1/2), the ‘‘Bayerisches Umweltministerium’’ andfrom the BMBF (JCB D4 project). C. Albert-Weissen-berger is holder of a research Fellowship of the BavarianResearch Foundation (Bayerische Forschungsstiftung).

References

Albert-Weissenberger, C., Cazalet, C., Buchrieser, C., 2007.

Legionella pneumophila – a human pathogen that co-

evolved with fresh water protozoa. Cell. Mol. Life Sci. 64,

432–448.

Alt-Morbe, J., Stryker, J.L., Fuqua, C., Li, P.L., Farrand,

S.K., Winans, S.C., 1996. The conjugal transfer system of

Agrobacterium tumefaciens octopine-type Ti plasmids is

closely related to the transfer system of an IncP plasmid

and distantly related to Ti plasmid vir genes. J. Bacteriol.

178, 4248–4257.

Andrews, H.L., Vogel, J.P., Isberg, R.R., 1998. Identification

of linked Legionella pneumophila genes essential for

intracellular growth and evasion of the endocytic pathway.

Infect. Immun. 66, 950–958.

Balzer, D., Pansegrau, W., Lanka, E., 1994. Essential motifs of

relaxase (TraI) and TraG proteins involved in conjugative

transfer of plasmid RP4. J. Bacteriol. 176, 4285–4295.

Bandyopadhyay, P., Liu, S., Gabbai, C.B., Venitelli, Z.,

Steinman, H.M., 2007. Environmental mimics and the

Lvh type IVA secretion system contribute to virulence-

related phenotypes of Legionella pneumophila. Infect.

Immun. 75, 723–735.

Bender, L., Ott, M., Debes, A., Rdest, U., Heesemann, J.,

Hacker, J., 1991. Distribution, expression, and long-range

mapping of legiolysin gene (lly)-specific DNA sequences in

legionellae. Infect. Immun. 59, 3333–3336.

Berger, K.H., Isberg, R.R., 1993. Two distinct defects in

intracellular growth complemented by a single genetic locus

in Legionella pneumophila. Mol. Microbiol. 7, 7–19.

Brand, B.C., Sadosky, A.B., Shuman, H.A., 1994. The

Legionella pneumophila icm locus: a set of genes required

for intracellular multiplication in human macrophages.

Mol. Microbiol. 14, 797–808.

Brassinga, A.K., Hiltz, M.F., Sisson, G.R., Morash, M.G.,

Hill, N., Garduno, E., Edelstein, P.H., Garduno, R.A.,

Hoffman, P.S., 2003. A 65-kilobase pathogenicity island is

unique to Philadelphia-1 strains of Legionella pneumophila.

J. Bacteriol. 185, 4630–4637.


Cazalet, C., Rusniok, C., Bruggemann, H., Zidane, N.,

Magnier, A., Ma, L., Tichit, M., Jarraud, S., Bouchier,

C., Vandenesch, F., Kunst, F., Etienne, J., Glaser, P.,

Buchrieser, C., 2004. Evidence in the Legionella pneumo-

phila genome for exploitation of host cell functions and

high genome plasticity. Nat. Genet. 36, 1165–1173.

Censini, S., Lange, C., Xiang, Z., Crabtree, J.E., Ghiara, P.,

Borodovsky, M., Rappuoli, R., Covacci, A., 1996. Cag, a

pathogenicity island of Helicobacter pylori, encodes type I-

specific and disease-associated virulence factors. Proc. Natl.

Acad. Sci. USA 93, 14648–14653.

Chien, M., Morozova, I., Shi, S., Sheng, H., Chen, J., Gomez,

S.M., Asamani, G., Hill, K., Nuara, J., Feder, M., Rineer, J.,

Greenberg, J.J., Steshenko, V., Park, S.H., Zhao, B.,

Teplitskaya, E., Edwards, J.R., Pampou, S., Georghiou,

A., Chou, I.C., Iannuccilli, W., Ulz, M.E., Kim, D.H.,

Geringer-Sameth, A., Goldsberry, C., Morozov, P., Fischer,

S.G., Segal, G., Qu, G., Rzhetsky, A., Zhang, P., Cayanis,

E., De Jong, P.J., Ju, J., Kalachikov, S., Shuman, H.A.,

Russo, J.J., 2004. The genomic sequence of the accidental

pathogen Legionella pneumophila. Science 305, 1966–1968.

Covacci, A., Falkow, S., Berg, D.E., Rappuoli, R., 1997. Did

the inheritance of a pathogenicity island modify the

virulence of Helicobacter pylori? Trends Microbiol. 5,

205–208.

De Buck, E., Lebeau, I., Maes, L., Geukens, N., Meyen, E.,

Van Mellaert, L., Anne, J., Lammertyn, E., 2004. A

putative twin-arginine translocation pathway in Legionella

pneumophila. Biochem. Biophys. Res. Commun. 317,

654–661.

Dietrich, C., Heuner, K., Brand, B.C., Hacker, J., Steinert, M.,

2001. The flagellum of Legionella pneumophila positively

affects the early phase of infection of eukaryotic host cells.

Infect. Immun. 64, 2116–2122.

Ding, Z., Atmakuri, K., Christie, P.J., 2003. The outs and ins

of bacterial type IV secretion substrates. Trends Microbiol.

11, 527–535.

Doleans-Jordheim, A., Akermi, M., Ginevra, C., Cazalet, C.,

Kay, E., Schneider, D., Buchrieser, C., Atlan, D.,

Vandenesch, F., Etienne, J., Jarraud, S., 2006. Growth-

phase-dependent mobility of the lvh-encoding region in

Legionella pneumophila strain Paris. Microbiology 152,

3561–3568.

Edelstein, P.H., 1981. Improved semiselective medium for

isolation of Legionella pneumophila from contaminated

clinical and environmental specimens. J. Clin. Microbiol.

14, 298–303.

Edelstein, P.H., Edelstein, M.A., Higa, F., Falkow, S., 1999.

Discovery of virulence genes of Legionella pneumophila by

using signature tagged mutagenesis in a guinea pig pneumo-

nia model. Proc. Natl. Acad. Sci. USA 96, 8190–8195.

Fields, B.S., 1996. The molecular ecology of legionellae.

Trends Microbiol. 4, 286–290.

Fields, B.S., Barbaree, J.M., Sanden, G.N., Morrill, W.E.,

1990. Virulence of a Legionella anisa strain associated with

Pontiac fever: an evaluation using protozoan, cell culture,

and guinea pig models. Infect. Immun. 58, 3139–3142.

Fields, B.S., Benson, R.F., Besser, RE., 2002. Legionella and

Legionnaires’ disease: 25 years of investigation. Clin.

Microbiol. Rev. 15, 506–526.

Hales, L.M., Shuman, H.A., 1999. Legionella pneumophila

contains a type II general secretion pathway required for

growth in amoebae as well as for secretion of the Msp

protease. Infect. Immun. 67, 3662–3666.

Heuner, K., Bender-Beck, L., Brand, B.C., Luck, P.C., Mann,

K.-H., Marre, R., Ott, M., Hacker, J., 1995. Cloning and

genetic characterization of the flagellum subunit gene (flaA)

of Legionella pneumophila serogroup 1. Infect. Immun. 63,

2499–2507.

Heuner, K., Dietrich, C., Steinert, M., Gobel, U.B., Hacker, J.,

2000. Cloning and characterization of a Legionella pneumo-

phila specific gene encoding a member of the LysR family of

transcriptional regulators. Mol. Gen. Genet. 264, 204–211.

Heuner, K., Steinert, M., Marre, R., Hacker, J., 2002.

Genomic structure and evolution of Legionella species.

Curr. Top. Microbiol. Immunol. 264, 61–78.

Jacobi, S., Heuner, K., 2003. Description of a putative type I

secretion system in Legionella pneumophila. Int. J. Med.

Microbiol. 293, 349–358.

Jacobi, S., Hacker, J., Schade, R., Heuner, K., 2004. Cloning

and characterization of the alternative sigma factor s54 and

the transcriptional regulator FleQ of Legionella pneumo-

phila, both involved in the regulation cascade of flagellar

gene expression. J. Bacteriol. 186, 2540–2547.

Jepras, R.I., Fitzgeorge, R.B., Baskerville, A., 1985. A

comparison of virulence of two strains of Legionella

pneumophila based on experimental aerosol infection of

guinea-pigs. J. Hyg. 95, 29–38.

Kalkum, M., Eisenbrandt, R., Lurz, R., Lanka, E., 2002.

Tying rings for sex. Trends Microbiol. 10, 382–387.

Krause, S., Pansegrau, W., Lurz, R., de la Cruz, F., Lanka, E.,

2000a. Enzymology of type IV macromolecule secretion

systems: the conjugative transfer regions of plasmids RP4

and R388 and the cag pathogenicity island of Helicobacter

pylori encode structurally and functionally related nucleo-

side triphosphate hydrolases. J. Bacteriol. 182, 2761–2770.

Krause, S., Barcena, M., Pansegrau, W., Lurz, R., Carazo,

J.M., Lanka, E., 2000b. Sequence-related protein export

NTPases encoded by the conjugative transfer region of RP4

and by the cag pathogenicity island of Helicobacter pylori

share similar hexameric ring structures. Proc. Natl. Acad.

Sci. USA 97, 3067–3072.

Liles, M.R., Viswanathan, V.K., Cianciotto, N.P., 1998.

Identification and temperature regulation of Legionella

pneumophila genes involved in type IV pilus biogenesis and

type II protein secretion. Infect. Immun. 66, 1776–1782.

Low, K.B., 1996. Hfr strains of Escherichia coli K-12. In:

Neidhardt, F.C., Curtiss III., R., Ingraham, J.L., Lin,

E.C.C., Low, K.B., Magasanik, B., Reznikoff, W.S., Riley,

M., Schaechter, M., Umbarger, H.E. (Eds.), Escherichia

coli and Salmonella: cellular and molecular biology, second

ed. ASM Press, Washington, DC, pp. 2402–2405.

Luo, Z.Q., Isberg, R.R., 2004. Multiple substrates of the

Legionella pneumophila Dot/Icm system identified by

interbacterial protein transfer. Proc. Natl. Acad. Sci. USA

101, 841–846.

Marra, A., Shuman, H.A., 1989. Isolation of a Legionella

pneumophila restriction mutant with increased ability to act

as a recipient in heterospecific matings. J. Bacteriol. 171,

2238–2240.

ARTICLE IN PRESSG. Glockner et al. / International Journal of Medical Microbiology 298 (2008) 411–428 427

Miyamoto, H., Yoshida, S., Taniguchi, H., Shuman, H.A.,

2003. Virulence conversion of Legionella pneumophila by

conjugal transfer of chromosomal DNA. J. Bacteriol. 185,

6712–6718.

Moffat, J.F., Edelstein, P.H., Regula Jr., D.P., Cirillo, J.D.,

Tompkins, L.S., 1994. Effects of an isogenic Zn-metallo-

protease-deficient mutant of Legionella pneumophila in a

guinea-pig pneumonia model. Mol. Microbiol. 12, 693–705.

Morozova, I., Qu, X., Shi, S., Asamani, G., Greenberg, J.E.,

Shuman, H.A., Russo, J.J., 2004. Comparative sequence

analysis of the icm/dot genes in Legionella. Plasmid 51,

127–147.

Nagai, H., Roy, C.R., 2003. Show me the substrates:

modulation of host cell function by type IV secretion

systems. Cell. Microbiol. 5, 373–383.

O’Callaghan, D., Cazevieille, C., Allardet-Servent, A.,

Boschiroli, M.L., Bourg, G., Foulongne, V., Frutos, P.,

Kulakov, Y., Ramuz, M., 1999. A homologue of the

Agrobacterium tumefaciens VirB and Bordetella pertussis Ptl

type IV secretion systems is essential for intracellular

survival of Brucella suis. Mol. Microbiol. 33, 1210–1220.

Oliver, A., Sanchez, J.M., Blazquez, J., 2002. Characterization

of the GO system of Pseudomonas aeruginosa. FEMS

Microbiol. Lett. 217, 31–35.

Pansegrau, W., Schoumacher, F., Hohn, B., Lanka, E., 1993.

Site-specific cleavage and joining of single-stranded DNA

by VirD2 protein of Agrobacterium tumefaciens Ti plas-

mids: analogy to bacterial conjugation. Proc. Natl. Acad.

Sci. USA 90, 11538–11542.

Rabel, C., Grahn, A.M., Lurz, R., Lanka, E., 2003. The VirB4

family of proposed traffic nucleoside triphosphatases:

common motifs in plasmid RP4 TrbE are essential for

conjugation and phage adsorption. J. Bacteriol. 185,

1045–1058.

Ridenour, D.A., Cirillo, S.L., Feng, S., Samrakandi, M.M.,

Cirillo, J.D., 2003. Identification of a gene that affects the

efficiency of host cell infection by Legionella pneumophila in

a temperature-dependent fashion. Infect. Immun. 71,

6256–6263.

Roberts, R.C., Burioni, R., Helinski, D.R., 1990. Genetic

characterization of the stabilizing functions of a region of

broad-host-range plasmid RK2. J. Bacteriol. 172,

6204–6216.

Romualdi, A., Siddiqui, R., Glockner, G., Lehmann, R.,

Suhnel, J., 2005. GenColors: accelerated comparative

analysis and annotation of prokaryotic genomes at various

stages of completeness. Bioinformatics 21, 3669–3671.

Rossier, O., Cianciotto, N.P., 2005. The Legionella pneumo-

phila tatB gene facilitates secretion of phospholipase C,

growth under iron-limiting conditions, and intracellular

infection. Infect. Immun. 73, 2020–2032.

Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular

Cloning: A Laboratory Manual, second ed. Cold Spring

Harbor Laboratory Press, Cold Spring Harbor, NY.

Samrakandi, M.M., Cirillo, S.L., Ridenour, D.A., Bermudez,

L.E., Cirillo, J.D., 2002. Genetic and phenotypic differences

between Legionella pneumophila strains. J. Clin. Microbiol.

40, 1352–1362.

Saunders, N.A., Doshi, N., Harrison, T.G., 1992. A second

serogroup of Legionella erythra serologically indistinguish-

able from Legionella rubrilucens. J. Appl. Bacteriol. 72,

262–265.

Schroder, G., Krause, S., Zechner, E.L., Traxler, B., Yeo, H.J.,

Lurz, R., Waksman, G., Lanka, E., 2002. TraG-like

proteins of DNA transfer systems and of the Helicobacter

pylori type IV secretion system: inner membrane gate for

exported substrates? J. Bacteriol. 184, 2767–2779.

Segal, G., Shuman, H.A., 1998. Intracellular multiplication

and human macrophage killing by Legionella pneumophila

are inhibited by conjugal components of IncQ plasmid

RSF1010. Mol. Microbiol. 30, 197–208.

Segal, G., Shuman, H.A., 1999. Possible origin of the

Legionella pneumophila virulence genes and their relation

to Coxiella burnetii. Mol. Microbiol. 33, 669–670.

Segal, G., Purcell, M., Shuman, H.A., 1998. Host cell killing

and bacterial conjugation require overlapping sets of genes

within a 22-kb region of the Legionella pneumophila

genome. Proc. Natl. Acad. Sci. USA 95, 1669–1674.

Segal, G., Russo, J.J., Shuman, H.A., 1999. Relationships

between a new type IV secretion system and the icm/dot

virulence system of Legionella pneumophila. Mol. Micro-

biol. 34, 799–809.

Sexton, J.A., Vogel, J.P., 2002. Type IVB secretion by

intracellular pathogens. Traffic 3, 178–185.

Steinert, M., Heuner, K., Buchrieser, C., Albert-Weissenber-

ger, C., Glockner, G., 2007. Legionella pathogenicity:

Genome structure, regulatory networks and the host cell

response. Int. J. Med. Microbiol. (E-pub ahead of print).

Stone, B.J., Abu Kwaik, Y., 1999. Natural competence for

DNA transformation by Legionella pneumophila and its

association with the expression of type IV pili. J. Bacteriol.

181, 1395–1402.

Thorsted, P.B., Macartney, D.P., Akhtar, P., Haines, A.S.,

Ali, N., Davidson, P., Stafford, T., Pocklington, M.J.,

Pansegrau, W., Wilkins, B.M., Lanka, E., Thomas, C.M.,

1998. Complete sequence of the IncPbeta plasmid R751:

implications for evolution and organisation of the IncP

backbone. J. Mol. Biol. 282, 969–990.

Tsai-Wu, J.J., Radicella, J.P., Lu, A.L., 1991. Nucleotide

sequence of the Escherichia coli micA gene required for A/

G-specific mismatch repair: identity of micA and mutY. J.

Bacteriol. 173, 1902–1910.

Ubben, D., Schmitt, R., 1986. Tn1721 derivatives for

transposon mutagenesis, restriction mapping and nucleo-

tide sequence analysis. Gene 41, 145–152.

Vogel, J.P., Andrews, H.L., Wong, S.K., Isberg, R.R., 1998.

Conjugative transfer by the virulence system of Legionella

pneumophila. Science 279, 873–876.


Identification and characterization of a new conjugation/type IVA secretion system (trb/tra) of...

Documents

Transcript of Identification and characterization of a new conjugation/type IVA secretion system (trb/tra) of...