1 23

Marine BiotechnologyAn International Journal Focusing onMarine Genomics, Molecular Biologyand Biotechnology ISSN 1436-2228 Mar BiotechnolDOI 10.1007/s10126-015-9655-7

Hypoxia-Inducible Factor α and Hif-prolylHydroxylase Characterization and GeneExpression in Short-Time Air-ExposedMytilus galloprovincialis

Alessia Giannetto, Maria Maisano,Tiziana Cappello, Sabrina Oliva,Vincenzo Parrino, Antonino Natalotto,Giuseppe De Marco, et al.

1 23

Your article is protected by copyright and all

rights are held exclusively by Springer Science

+Business Media New York. This e-offprint is

for personal use only and shall not be self-

archived in electronic repositories. If you wish

to self-archive your article, please use the

accepted manuscript version for posting on

your own website. You may further deposit

the accepted manuscript version in any

repository, provided it is only made publicly

available 12 months after official publication

or later and provided acknowledgement is

given to the original source of publication

and a link is inserted to the published article

on Springer's website. The link must be

accompanied by the following text: "The final

publication is available at link.springer.com”.

ORIGINAL ARTICLE

Hypoxia-Inducible Factor α and Hif-prolyl HydroxylaseCharacterization and Gene Expression in Short-TimeAir-Exposed Mytilus galloprovincialis

Alessia Giannetto1 & Maria Maisano1 & Tiziana Cappello1 & Sabrina Oliva1 &

Vincenzo Parrino1 & Antonino Natalotto1 & Giuseppe De Marco1 & Chiara Barberi1 &

Orazio Romeo1 & Angela Mauceri1 & Salvatore Fasulo1

Received: 5 February 2015 /Accepted: 2 July 2015# Springer Science+Business Media New York 2015

Abstract Aquatic organisms experience environmental hyp-oxia as a result of eutrophication and naturally occurring tidalcycles. Mytilus galloprovincialis, being an anoxic/hypoxic-tolerant bivalve, provides an excellent model to investigatethe molecular mechanisms regulating oxygen sensing. Acrossthe animal kingdom, inadequacy in oxygen supply is signalledpredominantly by hypoxia-inducible factors (HIF) and Hif-prolyl hydroxylases (PHD). In this study, hif-α 5′-end andpartial phd mRNA sequences fromM. galloprovincialis wereobtained. Phylogenetic and molecular characterization of bothHIF-α and PHD putative proteins showed shared key featureswith the respective orthologues from animals strongly sug-gesting their crucial involvement in the highly conserved ox-ygen sensing pathway. Both transcripts displayed a tissue-specific distribution with prominent expression in gills. Quan-titative gene expression analysis of hif-α and phd mRNAsfrom gills ofM. galloprovincialis demonstrated that both thesekey sensors are transcriptionally modulated by oxygen avail-ability during the short-time air exposure and subsequent re-oxygenation treatments proving that they are critical playersof oxygen-sensingmechanisms in mussels. Remarkably, hif-αgene expression showed a prompt and transient response sug-gesting the precocious implication of this transcription factorin the early phase of the adaptive response to hypoxia inMytilus. HIF-α and PHD proteins were modulated in a time-

dependent manner with trends comparable to mRNA expres-sion patterns, thus suggesting a central role of their transcrip-tional regulation in the hypoxia tolerance strategies in marinebivalves. These results provide molecular information aboutthe effects of oxygen deficiency and identify hypoxia-responsive biomarker genes in mussels applicable in ecotoxi-cological studies of natural marine areas.

Keywords Mytilus galloprovincialis . Hypoxia-induciblefactor . Gene expression . Oxygen sensing

Introduction

Oxygen availability in aquatic ecosystems is one of the majorecological concerns in the world. Reduced oxygen concentra-tion (hypoxia) or lack of oxygen (anoxia) are expected to risein the next future due to the combined effects of eutrophica-tion and global climate change (Diaz and Rosenberg 2008).Most of the marine invertebrate species have evolved mecha-nisms for surviving to changes in oxygen availability devel-oping a variety of behavioral, physiological, and biochemicalmechanisms, regulating their metabolism and transcriptionalprocess to survive under hypoxia (Ivanina et al. 2010;Kurochkin et al. 2009). In particular, intertidal organisms,such as mussels, inhabit the interface between aquatic andterrestrial habitats where they are periodically exposed to ex-treme physical conditions including hypoxia during the tidalcycle. Although the modulation of enzyme activity by hypox-ia or anoxia has been widely described both in fish(Airaksinen et al. 1998; Guan et al. 2014; Terova et al.2008) and in marine invertebrates (Anestis et al. 2010; Davidet al. 2005; Greenway and Storey 1999), the knowledge ofmolecular response as gene expression to hypoxia in mussels

Electronic supplementary material The online version of this article(doi:10.1007/s10126-015-9655-7) contains supplementary material,which is available to authorized users.

* Alessia Giannettoagiannetto@unime.it; alegiannetto@hotmail.com

1 Department of Biological and Environmental Sciences, University ofMessina, 98166 Messina, Italy

Mar BiotechnolDOI 10.1007/s10126-015-9655-7

Author's personal copy

is still in its infancy (David et al. 2005; Kawabe andYokoyama 2012; Piontkivska et al. 2011; Woo et al. 2011).The oxygen-dependent gene expression in mammals is tran-scriptionally regulated by the hypoxia-inducible factor-1(HIF-1), a heterodimeric transcription factor; its α subunit isconstitutively transcribed and translated in the cells, but innormoxic conditions, its turnover is quickly controlled by afamily of Hif-prolyl hydroxylases (PHDs also called EGLNs)that, using molecular oxygen, oxidizes critical prolyl residuesin a HIF-1α domain prompting its proteosomal degradation(Aragones et al. 2009). Conversely, a decrease of intracellularoxygen level prevents the PHD-mediated oxidation of HIF-1α, leading to the subsequent stabilization of the protein andits translocation into the nucleus where it heterodimerizes withHIF-1β and binds the hypoxia response elements (HREs) oftarget genes involved in anaerobic glycolysis, cell signalling,and oxidative phosphorylation, thus activating the cascaderesponse to hypoxia (Benizri et al. 2008; Taylor andPouyssegur 2007). The mechanism by which HIF-1α is sta-bilized in hypoxia is therefore well understood, ascribable toreduced activity of oxygen-dependent PHD. Several studieshave shown that the upregulation of HIF-1α in mammalsoccurring in response to hypoxia is transient and involves aresolution phase even while the cells are maintained in hyp-oxia. However, the mechanisms underpinning the resolutionof HIF-1α during prolonged hypoxia remains incompletelyunderstood (Ginouves et al. 2008; Henze et al. 2010; Stiehlet al. 2006). To date, most of our knowledge concerning thestructure and function of HIF pathway come from the modelsystems such as mammals, insects (Drosophila melanogaster)and nematode (Caenorhabditis elegans) (Lahiri et al. 2006;Semenza 2004; Shen et al. 2005; Webster 2003). Far less isknown about HIF-1α function, metabolic and molecular path-way, and structure in hypoxia-tolerant animals such as fishand sessile invertebrates (Heise et al. 2006; Ivanina et al.2010; Li and Brouwer 2007; Rissanen et al. 2006). In partic-ular, very few studies have been conducted on pattern of geneexpression in condition of hypoxia in marine molluscs and,inter alia, in bivalves (Kawabe and Yokoyama 2012;Piontkivska et al. 2011). Although little is known about evo-lutionary relationships between HIF homologs from inverte-brate and vertebrate organisms, three isoforms have been de-scribed in vertebrate while, so far, a single one, known asHIF-α, has been identified in invertebrate animals (Rytkonenet al. 2011).

The intertidal marine mussel Mytilus galloprovincialis be-ing an anoxic/hypoxic-tolerant bivalve provides an excellentmodel to investigate the molecular mechanisms regulatingoxygen sensing. Early studies on emersedM. galloprovincialishave shown a general adaptive strategy, common to otherintertidal organisms, involving the shell valve closure duringexposure to air. Moreover, a certain degree of aerial respirationand a strong depression of metabolic rate (energy

conservation), together with the production of alternativeend products of fermentative metabolism such as succinateand propionate, play a key role in anoxic survival and subse-quent recovery of anoxia-tolerant marine molluscs (Laradeand Storey 2009). Babarro et al. (2007) showed that anaero-biosis is activated after just 6 h of air exposure inM. galloprovincialis according to a 6-fold increase in succi-nate, simultaneously with aerobic metabolism; most signifi-cant biochemical changes occurred during the first 24 h ofoxygen deprivation, but significant differences were still ob-served after 24–48 h.

Despite its wide use in environmental monitoring (D’Agataet al. 2014; Fasulo et al. 2012), genome-wide and molecular-level information, such as gene expression changes or geneticfunctions, are largely unexplored in this organism. In particu-lar, only few studies have been reported on transcriptionalresponse of M. galloprovincialis exposed to hypoxia (Wooet al. 2011) and no data on hif-α gene expression nor phdsequence have been published.

We were interested in the involvement of HIF-α in theresponse to air exposure-induced hypoxia and a possible roleof PHD in the control of HIF-α degradation to fine regulatethe hypoxic response in gills of air-exposed and re-oxygenated M. galloprovincialis. The present study is aimedto investigate the short-time transcriptional response ofM. galloprovincialis to hypoxic stress induced by air exposureand to subsequent re-oxygenation focusing on quantitativegene expression analysis of hif-α and phd. We also examinedthe tissue distribution of these key molecular components ofthe oxygen sensing pathway and reported the molecular clon-ing and sequencing of phd for the f i rs t t ime inM. galloprovincialis.

Materials and Methods

Mussels Maintenance and Experimental Plan

Adult specimens of M. galloprovincialis (65±2.7-mm shelllength) were purchased from an aquaculture farm (Consor-tium of Fishermen) in Goro (Ferrara, Italy). Mussels wereplaced into aquaria of filtered seawater at a density of 80individuals per 100 Lwith strictly water controlled conditions:temperature 18±0.5 °C, salinity 32–35‰, pH 8±0.02, DO8 mg/L. Animals were fed ad libitum on alternate days witha commercial algal diet (Shellfish Diet 1800, Reed Maricul-ture, Campbell, CA, USA) during the 2-week acclimationperiod prior to experimentation. After acclimation, one groupof mussels was exposed to air and subsequent re-oxygenation(treatment) and the other group was maintained under thesame normoxic conditions as above (control). Hypoxic stresswas elicited by exposingmussels to air at 18 °C on a seawater-soaked paper towel for 48 h. After 2 days of anoxia, mussels

Mar Biotechnol

Author's personal copy

were returned into well-aerated tanks with filtered seawaterand allowed to recover up to 48 h. During air exposure mus-sels were sampled at 0, 8, 24, and 48 h and gill tissues weredissected immediately, snap-frozen in liquid nitrogen, andstored at −80 °C. During the re-oxygenation period gill sam-ples were collected at 1, 4, 8, 24, and 48 h thereafter. Gillsamples from the control group were collected at each sam-pling time during the experiment.

RNA Extraction and cDNA Synthesis

Total RNAwas isolated from gill tissues ofM. galloprovincialiscollected at each sampling point. Tissue homogenization andRNA extraction were performed using TissueLyser II (Qiagen)and Qiazol reagent (Qiagen) as detailed by Fernandez et al.(2013). The RNA integrity was evaluated on 1 % (w/v) agarosegel and the concentration and the purity verified by Nanodropspectrophotometer (Thermo Scientific). cDNA synthesis from1μg total RNAwas performed by QuantiTect reverse transcrip-tion kit (Qiagen) after gDNAwipeout buffer treatment in orderto remove any potential genomic DNA contamination, accord-ing to manufacturer’s instructions.

Hif-α 5′-transcript End Characterization

RNA from gill tissue of control mussels was used for theisolation and characterization of hif-α 5′-end by rapid ampli-fication of cDNA ends using the 5′/3′ RACE kit 2nd Genera-tion (Roche). M. galloprovincialis hif-α sequences was re-trieved from the NCBI database (GenBank accession numberJN595864) and specific sp1-2-3 primers were designed for theRACE reaction (Table 1). A first-strand cDNA synthesis from1 μg of total RNA and a specific sp1 primer was performedaccording to the manufacturer’s instructions. The cDNA ob-tained was purified by the High Pure PCR Product Purifica-tion Kit (Roche) and used for the poly(A) tailing reaction. ThePCR amplification of the dA-tailed cDNAwas performed in afinal volume of 50 μL as detailed in the protocol kit usingspecific sp2 reverse primer and the Expand High FidelityPCR System (Roche). A nested PCR was performed using aspecific sp3 reverse primer from the 20-fold diluted first roundPCR product. Single-band products of circa 500 bp were vi-sualized on 1 % agarose gel, purified by Qiaquick gel extrac-tion kit (Qiagen), cloned, and sequenced as detailed byCampos et al. (2010). A 3730 DNA Analyzer (AppliedBiosystems) was used to collect the sequence data. ControlPCR reactions using the control neo-RNA and specific neo-primers were performed and a specific single band of theexpected size (293 bp) was obtained. All primers used in theRACE reactions are listed in Table 1.

DNA sequences were analyzed with CodonCode Alignerv.2.0.6 (CodonCode Corporation, Dedham, MA, USA) andtheir identity determined by BLASTN similarity searches

against the NCBI database (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The ATGpr tool (http://flj.hinv.jp/ATGpr/atgpr/index.html) (Salamov et al. 1998) was used with the defaultsettings to predict the translation initiation site (TIS) in hif-αsequence.

Phd Isolation and Sequencing

Degenerate primers were designed against conserved frag-ments of the PHD protein sequences from Strongylocentrotuspurpuratus, Apis millifera, D. melanogaster, and Homosapiens (NCBI access ion numbers : XP_783963,XP_397368, NP_649525, and NP_444274, respectively)within the 2OG-Fe(II) high-conserved domain (Table 1).The reaction mixture for PCR amplification contained 1 μLcDNA template, 1 μL of each 10 μM primer, 1 μL of 10 mMdNTPs, 5 μL of 10× buffer, and 2.5 U of HotStarTaq DNAPolymerase (Qiagen) in a total volume of 50 μL. PCR reac-tions were performed in a Ep-Gradient Mastercycler(Eppendorf) using the following parameters: one cycle at94 °C for 2 min followed by 35 cycles at 94 °C for 15 s,55 °C for 30 s, and 72 °C for 30 s with a final extension at72 °C for 7 min. Specific PCR products were purified, cloned,and sequenced as detailed by Lazado et al. (2014). DNA se-quences were analyzed by BLASTN and TBLASTN similar-ity searches against the NCBI database.

Genome- and Transcriptome-Wide Surveys of hif-αand phd

The hif-α and phd sequences cloned in this study were sub-mitted to NCBI database (GenBank accession numbersKP185351 and KP185352, respectively) and used to searchtheM. galloprovincialis genome (GenBank accession numberAPJB000000000.1) using BLAST algorithm with defaultvalues. Unfortunately, the published draft genome sequenceof this species contains a very high number of relatively smallsequences resulting in high numbers of contigs (2,315,965contigs). Therefore, in order to find the complete coding re-gion of our sequences on a single contig we tried to reassem-ble the genome using the original FASTQ file submitted in thesequence reads archive database (SRA accessionSRP041653). Before assembly, raw reads were filtered (cutoffquality-score, 25; cutoff read-length, 50%) and trimmed usingFASTX-toolkit (version 0.0.14; http://hannonlab.cshl.edu/fastx_toolkit) to remove sequences with low Phred-scores.The final data set, used for assembling, contained 335,557quality-controlled reads (mean length 490 bp±SD 84.5). M.galloprovincialis genome was reassembled de novo usingMIRA 4.0.2 assembler (Chevreux et al. 1999) which generat-ed 12,663 contigs with a total consensus length of9,847,192 bp.

Mar Biotechnol

Author's personal copy

Sequence and Phylogenetic Analysis

The hif-α and phd sequences were analyzed by the BLASTalgorithm at NCBI web site (http://www.ncbi.nlm.nih.gov/blast), and the open reading frame and the deduced aminoacid sequences were analyzed with the Expert ProteinAnalysis System (http://www.expasy.org/). Multiplesequence alignments of amino acids were performed withClustalW version 1.81 and used for maximum likelihood(ML) and minimum evolution (ME) phylogenetic analysis.ML tree was obtained using PhyML program (v3.0 aLRT).The LG substitution model was selected in the ML analysiswith the parameters setting detailed in our previous papers(Giannetto et al. 2013; Nagasawa et al. 2012). Dayhoff aminoacid substitution model was used in the ME method and 1000bootstrap pseudo-replications were used to evaluate the reli-ability of internal branches as implemented in MEGA5(Tamura et al. 2011). The graphical representation and editionof the phylogenetic trees were performed with FigTree 1.4software (http://tree.bio.ed.ac.uk/software/figtree/). TheGenBank accession numbers for the HIF-α and PHD aminoacid sequences of selected species used for the phylogenetictrees were shown in Table 2.

Protein conserved domains were predicted comparingthe putative HIF-α and PHD protein sequences against theConserved Domain Database (http://www.ncbi.nlm.nih.gov/cdd/) and the pfam protein families database (http://pfam.sanger.ac.uk/) using their default parameters (Finnet al. 2014; Marchler-Bauer et al. 2011).

Tissue Distribution

RNA extracted from different tissues—gill, foot, gonad, di-gestive gland, posterior adductor muscle (PAM), and

Table 1 Nucleotide sequences of primers, amplicons size (bp), methods, qPCR efficiencies (E%), and correlation coefficients (R2) of the calibrationcurve

Primer Forward primer sequence Reverse primer sequence Size (bp) Methods E (%) R2

phd TTCNATGGTSGCDTGTTAYCC GGCAKVACYTCRTGTGGRTTBC 243 Cloning

hif-α TGCTAAATACCTTGGCATCTCA GCTCTCCAAACGGCAATGTA 303 RT-PCR

phd CCATGGTGGCGTGTTATCC GGTTGCGTTTGTCGGACCAGAA 225

act GGGAGTCATGGTTGGTATGG TCAGAAGGACTGGGTGCTCT 194

ef1-α TGACAGCAAAAATGACCCACCC CTTTGATGACTCCTACGGCGAC 338

hif-α_rev Sp1 GCTCTCCAAACGGCAATGTA 5′ RACE

hif-α_rev Sp2 TTGTTGGTGGTCTTGTGGCA

hif-α_Sp3 GTCAATCTGTGAGATGCCAAGG

qhif-α GCTAAATACCTTGGCATCTCACAG TTGTTGGTGGTCTTGTGGCA 116 qPCR 103 0.99

qphd ATCCGGGAAATGGTACACAG CAACCCTGTCTTGACCCTCA 153 102 0.99

qef1-α CCTCCCACCATCAAGACCCA GGCTGGAGCAAAGGTAACAAC 145 104 0.99

q18SrRNA GTGCTCTTGACTGAGTGTCTCG CGAGGTCCTATTCCATTATTCC 116 99 0.98

qact CTCTTGATTTCGAGCAGGAAA AGGATGGTTGGAATAATGATT 138 102 0.97

Table 2 GenBank accession numbers of HIF-α and PHD protein se-quences used in the alignment and phylogenetic tree

Gene Specie Accession number

HIF-α Mytilus galloprovincialis KP185351

Crassostrea virginica AED87588.1

Crassostrea gigas BAG85183.1

Haliotis diversicolor AGE97172.1

Cerapachys biroi EZA55822.1

Carassius carassius ABC24677.1

Aspius aspius ABO26713.1

Danio rerio AAQ91619.1

Xenopus laevis CAB96628.1

Anolis carolinensis XP_008121253

Gallus gallus NP_989628.1

Mus musculus AAH26139.1

Homo sapiens AAH12527.1

PHD Mytilus galloprovincialis KP185352

Crassostrea virginica HM441077.1

Aplysia californica XM_005090729.1

Tribolium castaneum NM_001170620.1

Danio rerio NP_998475.1

Astyanax mexicanus XP_007240528.1

Xiphophorus maculatus XP_005811598.1

Lepisosteus oculatus XP_006632221.1

Xenopus laevis NP_001106325.1

Xenopus (Silurana) tropicalis NP_001120484.1

Corvus brachyrhynchos XP_008637797.1

Alligator mississippiensis XP_006259640.1

Cricetulus griseus XP_007605789.1

Bos mutus XP_005898623.1

Homo sapiens ABM44412.1

Mar Biotechnol

Author's personal copy

mantle—and reverse transcribed as above, was used for deter-mination of hif-α and phd tissue-specific expression. Specifichif-α primers against the M. galloprovincialis sequence(GenBank accession number JN595864) and specific phdprimers against the sequence cloned in this study (GenBankaccession number KP185352) were designed (Table 1).

PCR reactions were performed in a Ep-GradientMastercycler (Eppendorf) using the Expand High FidelityTaq polymerase (Roche) according to the manufacturer’s in-structions in a total volume of 25 μL. After the initial dena-turation at 94 °C for 2 min, variable cycles (see below) of94 °C for 15 s, specific annealing temperatures for 30 s,72 °C for 30 s, and a final elongation of 72 °C for 7 min wereset. To determine the exponential phase of amplification, sep-arate PCR reactions with an increasing number of cycles wereperformed for each primer set. The selected cycle range wasbetween 25–30 and 20–25 cycles for target and referencegenes, respectively. Actin (act) (GenBank accession numberAF157491.1) and elongation factor (ef1-α) (GenBank acces-sion number AB162021.1) were used as internal expressioncontrols.

Quantitative Real-Time PCR

Hif-α and phd gene expression were quantified by real-timePCR using the Rotor-Gene Q 2plex Hrm thermocycler(Qiagen) with SYBR Green chemistry (Qiagen) as reportedby Giannetto et al. (2014). Briefly, 25-fold diluted gill cDNAsamples were run in duplicate. No template and minus reversetranscriptase controls were included in each reactions. ThePCR efficiency was determined using a five-point standardcurve of a 5-fold dilution series (1:1 to 1:32) from pooledRNA (Fernandes et al. 2006). The actin (act), 18S ribosomalRNA (18S rRNA) (GenBank accession number JQ611492.1),and elongation factor (ef1-α) as reference genes were used.The normalization factor, calculated from the two most stablegenes, ef1-α and 18S rRNA, was used in order to correct theraw target gene data using geNorm software (http://medgen.ugent.be/~jvdesomp/genorm/). Specific quantitative real-timePCR (qPCR) primers for hif-α and phd amplifications weredesigned across conserved intron/exon junctions in order toprevent amplification of any genomic DNA (Fernandes et al.2008). All sets of primers are listed in Table 1. PCR reactionswere performed using the following parameters: 95 °C(15 min) followed by a two-step cycling of 95 °C (5 s) andcombined annealing/extension at 60 °C (10 s) for 40 cycles.The specificity of the reaction was confirmed from single-peak melting curves. Analysis of variance followed byStudent-Newman-Keuls post hoc tests was performed to as-sess differences in expression levels of hif-α and phd genes inrelation to oxygen availability. SigmaPlot (Systat software)was used for all analyses and significance levels were set atP values of less than 0.05.

Western Blotting Analysis

Gill samples were solubilized in lysis buffer as described bySciortino et al. (2008). Soluble proteins were quantified usingthe Pierce BCA Protein Assay Kit (Thermo Scientific) and aNanodrop spectrophotometer (Thermo Scientific). Bovine se-rum albumin was used as a standard. Results were expressedin milligrams of protein per milliliter. An amount of 40 μg ofproteins was boiled in SDS sample buffer (60 mM Tris-HCl,pH 6.8, 5 % 2-mercaptoethanol, 2 % SDS, 10 % bromphenolblue, 10 % glycerol), then subjected to electrophoresis on15 % denaturing polyacrylamide gel, and transferred to a ni-trocellulose membrane overnight at 4 °C. The membraneswere stained with Ponceau Red in order to verify the occurredtransferring and blocked for 1 h with 5 % BSA before theincubation with a mouse monoclonal primary antibodyagainst HIF-1α (Abcam, ab113642) or rabbit polyclonalanti-PHD (Abcam, ab154375) 1:1000 diluted (5 % BSA,0.1 % Tween 20 in PBS) overnight at 4 °C. The blots werethen washed and incubated with horseradish peroxidase-conjugated secondary antibodies (Sigma) at 1:2000 dilution.Antibody binding was detected by chemiluminescence stain-ing using the Immuno-Star Western C Chemiluminescent Kit(Biorad). The specificity of the anti-HIF-1α and anti-PHDantibodies was tested pre-incubating each antibody with therespective control peptide (data not shown). The relative in-tensities of protein bands were analyzed by Alliance LD287WL (UVITEC Ltd, Cambridge, UK) using the Actin anti-body (Sigma, A2066) as loading control. Analysis of variancefollowed by Student-Newman-Keuls post hoc tests was per-formed in SigmaPlot (Systat software) to assess the statisticalsignificance of any differences in HIF-α and PHD proteinscontent, between controls and treatments at each samplingpoint and among all sampling point within each experimentalgroup. P values less than 0.05 were considered significant.

Results

Molecular Characterization of hif-α and phd Sequences

The 5′-end of hif-α and a partial sequence of phd cDNAweresuccessfully obtained from the gills of M. galloprovincialis.Using the rapid amplification of cDNA ends (RACE) ap-proach, a 761 bp cDNA sequence coding for hif-α was iden-tified. This partial coding sequence was 308 bp longer thanM. galloprovincialis hif-α sequence retrieved from the NCBIdatabase (GenBank accession number JN595864); its identitywas determined by BLASTN similarity searches against theNCBI database (Supp. 1 of the Electronic SupplementaryMaterial) and the putative translation initiation site (TIS)was identified as the ATG codon at position 141–143 in ourhif-α sequence (GenBank accession number KP185351).

Mar Biotechnol

Author's personal copy

Using degenerate PCR primers, we have obtained a partialcoding sequence of 243 bp for M. galloprovincialis phd(GenBank accession number KP185352). Results fromBLASTN similarity search against the NCBI database showedthat the sequence was highly similar to phd/egln sequencefrom distantly related species at about 77 % identity (Supp.1 of the Electronic Supplementary Material). As far as weknow, this is the first report of a phd homolog in Mytilidae.

BLAST searches against M. galloprovincialis publishedgenome (GenBank APJB000000000.1) using hif-α revealedthat this sequence maps partially on ten diverse contigs whilethe results obtained using phd as query revealed that this se-quence was split on two different contigs (Table 3). Overall,these data indicate that hif-α and phd genes were incorrectlyassembled in the currently available draft sequence ofM. galloprovincialis genome. However, also using our newcontigs, which were assembled using reads with high Phred-scores (cutoff value, 25), we were unable to produce any fur-ther information on hif-α and phd sequences useful to eluci-date their complete CDS or gene structure. In our opinion,based on obtained data, the genome of M. galloprovincialisneeds further molecular characterization in order to reduce thehigh number of small contigs and obtain a more completeassembly.

To elucidate phylogenetic relationships among animals,amino acid alignment of the putative translation of hif-α andphd genes fromM. galloprovincialiswith the respective coun-terpart protein sequences from representative invertebratesand vertebrates were performed (Table 2). Amino acid align-ment of the putative hif-α translation of M. galloprovincialiswith other orthologues revealed that the sequence was highlyconserved among several species including bivalves, arthro-pods, bony fishes, amphibians, lizards, birds, rodents, andprimates. Putative conserved domains were detected byCDD search in the amino acid region between 10–63 and88–138, revealing a helix-loop-helix (HLH) domain, foundin specific DNA-binding proteins that act as transcription fac-tors, and PAS domain, found to act as sensors for oxygen insignal transduction, respectively (Fig. 1). The aminoacid alignment of the putative PHD protein fromM. galloprovincialis with representative aminoacidic se-quences from animals revealed the presence of 2-oxoglutarate,Fe2+-dependent (2OG-Fe(II)) oxygenase superfamily domainin the 2–79 amino acid interval with the well conserved 11aminoacids motif (FWSDRRNPHEV) in all retrieved se-quences (Fig. 1). This family includes the C-terminal of prolyl4-hydroxylase alpha subunit domain within a EGL-9 multi-domain predictive of a proline hydroxylase in mussels.

HIF-α and PHD Phylogenetic Analysis

On the ML tree of HIF-α amino acid sequences from repre-sentative animals, the HIF-α protein fromM. galloprovincialis

was found within a clade that includes mollusks andarthropoda (Fig. 2). Vertebrate sequences formed a separatecluster supported by a one approximate likelihood-ratio value.Similar clustering pattern was revealed by the ME tree recon-structed using the Dayhoff substitution model (Supp. 2 of theElectronic Supplementary Material), with vertebrates and in-vertebrates separated to two main clusters.

Putative translation of phd gene from M. galloprovincialiscloned in this study, clustered with other PHD/EGLN homol-ogous amino acid sequences from invertebrates and was relat-ed to the PHD of Crassostrea virginica (0.65 approximatelikelihood-ratio value). Vertebrate PHD orthologues se-quences formed a separate cluster supported by a one approx-imate likelihood-ratio value (Fig. 3). Phylogenetic trees ob-tained using maximum-likelihood (Figs. 2 and 3) and ME(Supp. 2 and Supp. 3 of the Electronic SupplementaryMaterial) methods showed similar topology.

Hif-α and phd cDNATissue Distribution

Hif-α and phd mRNAs showed a tissue-specific distributionin M. galloprovincialis under normoxic conditions (Fig. 4).Both transcripts abundance was significantly higher in gillsrelative to other examined tissues, with comparable level toactin housekeeping gene expression. In gonad, digestivegland, mantle and posterior adductor muscle, hif-α gene wasexpressed in smaller amount compared to gills, while phdshowed an expression pattern limited to gills and gonad andto a lesser extent to the posterior adductor muscle and diges-tive gland.

HIF-α and PHD Gene and Protein Expression

To elucidate the molecular response to air exposure and sub-sequent re-oxygenation in M. galloprovincialis, HIF-α andPHD mRNA and protein levels in gill tissue wereinvestigated.

In the absence of the specific molluscan antibodies againstHIF-α and PHD, commercial mammalian antibodies were usedfor western blot analysis as reported in several studies whereimmunoblotting of protein extracts from Mytilus by using an-tibodies with reactivity against species diverse from musselswas performed (Nicastro et al. 2010; Piano et al. 2004; Yaoand Somero 2013). Our results show that HIF-α and PHD inmolluscs can be tagged with mouse or rabbit antibodies asrecently reported in crayfish for the immunodetection ofHIF-α using an anti-HIF-α specific for mouse, rat, and humanHIF-α ( Velázquez-Amado et al. 2012).

HIF and PHD gene and protein expression levels in perma-nently submersed animals (control) did not show statisticallysignificant differences over time (Fig. 5; Supp. 4 of theElectronic Supplementary Material). Expression of hif-α andphd mRNAs were analyzed to investigate in mussels the

Mar Biotechnol

Author's personal copy

involvement of their transcriptional regulation in the oxygen-sensing pathway, and we found that the mRNA levels weremarkedly influenced by oxygen availability during air expo-sure and subsequent re-oxygenation in M. galloprovincialisgills (Fig. 5). During the 48-h air exposure, a significant earlyincrease in hif-α transcript level was observed starting at 8 h,reaching a peak at 24 h (3.7-fold compared to the control). At48 h, on the contrary, the mRNA level value became compa-rable to the control. During the re-oxygenation, no statisticallysignificant difference in hif-α gene expression was detectedamong all tested sampling times within each experimentalgroup nor between control and treatment groups (Fig. 5).HIF-α protein appeared as a band of about 90 kDa in gilland HeLa (positive control) extracts (data not shown). Proteinand mRNA levels of HIF-α displayed parallel patterns duringthe air exposure phase, as HIF-α protein increased rapidlywithin 8 h of exposure reaching a peak at 24 h (Fig. 6). BothHIF-α protein and transcript were reduced after 48 h. Note-worthy, while the hif-α transcript levels were comparable tocontrol throughout the re-oxygenation period, HIF-α proteinlevels showed an appreciable decrease over time to reach thecontrol level after 4 h of re-oxygenation.

PhdmRNA levels showed a comparable value to control at8 h of air exposure, followed by an increase of 5- and 3-fold at24 and 48 h, respectively, with an overall pattern of expressionsimilar to hif-α time course (Fig. 5). Early, after only 1 h of re-oxygenation, the phd transcript level increased up to 12-foldcompared to its control, and 4-fold compared to 48 h of airexposure. A prompt decrease to control level at 4, 8, 24, and48 h was observed (Fig. 5). PHD protein appeared as a band ofabout 50 kDa (Fig. 6) in gill and HeLa (positive control)extracts (data not shown). Partially overlapping expressionpatterns of PHD protein and transcript were observed in spec-imens from air exposure and re-oxygenation experimentalphases. In specimens from air-exposed M. galloprovincialis,the induction of PHD protein was dependent on the duration

of exposure. The protein levels of PHD were fairly detectableup to 8 h and significantly increased at 24–48 h when a visiblepresence of PHD protein was observed (Fig. 6). In extractsfrom individuals of the re-oxygenation phase, PHD proteinincreased rapidly within 1 h with levels 5-fold higher in re-spect to the control (Supp. 4 of the Electronic SupplementaryMaterial). Following the rapid induction of the PHD proteinobserved at 1 h, its expression decreased after 4 h (Fig. 6).These data are in accordance with the well-established role ofPHD in the post-translational control of HIF-α abundanceduring normoxia. Densitometric analysis revealed that bothHIF-α and PHD proteins expression was significantly affect-ed by oxygen availability (Supp. 4 of the ElectronicSupplementary Material).

Discussion

Though hypoxia-sensitive and hypoxia-tolerant animals showdifferent homeostatic strategies to deal with the oxygen dep-rivation (Gorr et al. 2006), the isolation and molecular char-acterization of hif-α and phd partial coding sequences fromM. galloprovincialis showed significant sequences similarityand conserved key functional domains with the previouslydescribed isoforms from vertebrates and invertebrates(Fig. 1), thus highlighting the conserved critical role of thesegenes in the evolution of oxygen-sensing pathway and ho-meostasis throughout the animal kingdom. Phylogenetic anal-ysis of HIF-α and PHD amino acid sequences from represen-ta t ive animals showed tha t bo th pro te ins f romM. galloprovincialis clustered with respective homologousamino acid sequences from invertebrates (Figs. 2 and 3).The separate clades for vertebrates and invertebrates HIF-αand PHD sequences were recently documented (Piontkivskaet al. 2011) and it was inferred that, despite overall amino acidsequence similarity, HIF-α, and PHD homologs are involved

Table 3 BLAST results obtainedby searching theM. galloprovincialis genome(GenBank assembly accessionnumber GCA_000715055.1)using the hif-α and phd sequencesas query (GenBank accessionnumbers KP185351 andKP185352, respectively)

Gene Contig’s name E value Identity (%) Accession number

hif-α MYTG_1945170_length_478_cov_31.997908 6e-83 98 APJB012202215.1

MYTG_3430122_length_348_cov_29.948277 4e-55 100 APJB010566546.1

MYTG_3250721_length_347_cov_32.487030 2e-53 95 APJB010505040.1

MYTG_997839_length_278_cov_32.028778 5e-49 97 APJB011782947.1

MYTG_2994612_length_906_cov_16.536425 5e-49 95 APJB010394329.1

MYTG_2436899_length_348_cov_17.853449 5e-49 95 APJB010173549.1

MYTG_502019_length_873_cov_17.808706 1e-35 93 APJB011524745.1

MYTG_10101138_length_606_cov_20.072607 5e-34 92 APJB011539339.1

MYTG_1945169_length_719_cov_14.173853 4e-25 99 APJB012202216.1

MYTG_6199616_length_302_cov_17.152317 2e-23 97 APJB011225730.1

phd MYTG_272931_length_504_cov_35.892857 1e-49 97 APJB010096423.1

MYTG_3172198_length_1452_cov_30.994490 2e-43 94 APJB010460754.1

Mar Biotechnol

Author's personal copy

Fig. 1 Multiple alignment of deduced amino acid sequences of a HIF-αand b PHD proteins from Mytilus galloprovincialis with other animalorthologous sequences. a Conserved domains of HIF-α (HLH, in blueand PAS superfamilies, in green) are depicted by colored bars; DNA-binding region and dimerization interface on conserved domain HLHtogether with the residues that compose this conserved feature are indi-cated by lines and triangles, respectively (blue); putative active site andheme pocket on conserved PAS domain together with the amino acid

residues are indicated by lines and triangles, respectively (green). HLHand PAS domains in the partial amino acid sequences alignment aremarked with continuous and dotted boxes, respectively. b Conserved2OG-Fe(II)_Oxy superfamily domain within the deduced amino acidsequence of PHD is depicted by pink bar. Conserved amino acid positionsare marked with a box; strictly conserved residues are shown in bold. TheHIF-α and PHD sequences used in these alignments were listed in Table 2

Mar Biotechnol

Author's personal copy

in important cellular functions beyond the oxygen sensing ininvertebrate organisms with respect to their vertebrate coun-terparts (Heise et al. 2006).

Recently, Piontkivska et al. (2011) reported the easternoyster hif-α and phd gene expression in digestive gland, gills,mantle, and muscle tissues. Our data demonstrated that bothtranscripts displayed a tissue-specific distribution with prom-inent expression in gills and were absent in foot tissue; more-over, phd mRNA was absent also in mantle fromM. galloprovincialis (Fig. 4). The relatively high sensitivityo f t he oxygen- s ens ing pa thway to hypox i a i nM. galloprovincialis gills probably reflects the key role of gillsin gas exchange, osmoregulation, and in activating the com-pensatory response to hypoxia (Brunelli et al. 2010). There-fore, our study on quantitative gene and protein expression ofhif-α and phd has been performed in gill tissue. The commonexpression pattern of both genes may suggest that the role ofPHD in prompting HIF-α degradation, widely documented inmodel systems, is an evolutionary conserved function also inmarine invertebrates.

A substantial amount of data on hif-α modulation by oxy-gen availability in a broad range of mammalian tissues hasbeen reported (Wang et al. 2006; Zhao et al. 2004). In contrast,only limited information of hif-α regulation has been obtainedin fish and bivalves. Besides the primary mechanism that reg-ulates HIF1-α abundance occurring at the post-translationallevel, via the oxygen-, and PHD-dependent proteosomal deg-radation of HIF1-α protein, more recent studies on in vivomammalian models, as well as in fish, crustaceans, and mol-luscs, strongly suggest that transcription of hif1-α gene canalso be regulated by hypoxia (Ke and Costa 2006; Law et al.2006; Liu et al. 2014; Nikinmaa et al. 2008; Rytkonen et al.2008; Sollid et al. 2006; Sonanez-Organis et al. 2009); such arole in the adaptive response to oxygen deficiency could com-plement a more rapid post-translational regulation of HIF1-αprotein but, as far as we know, the precise mechanism of hif-αtranscriptional regulation is not fully understood.

The prompt and transient activation of hif-α gene expres-sion reported in this study (Fig. 5) suggests the involvement ofthis transcription factor in the early phase of the adaptive

Fig. 2 Maximum-likelihood phylogeny analysis of HIF-α proteins. The phylogenetic tree was constructed by Phy ML using the LG model.Approximate likelihood-ratio values higher than 0.5 are indicated at the nodes. Abbreviations and sequence accession numbers are shown in Table 2

Mar Biotechnol

Author's personal copy

response to hypoxia in M. galloprovincialis. Based on ourHIF-α western blot results, we suggest that this may be thephase during which increasing HIF-α protein levels enhanceHIF-dimer formation and DNA binding to induce hypoxicgene expression. Therefore, it is plausible that the importantrole of HIF-α is limited to trigger the cascade response occur-ring just a few hours after oxygen deprivation. This couldexplain the decrease of hif-α gene expression at 48 h of airexposure as well as the maintenance of hif-α transcript level tovalues comparable to the normoxic condition during the re-oxygenation phase.

The parallel patterns of HIF-α protein (Fig. 6) andmRNA levels (Fig. 5) in air-exposed specimens as wellas the early increase in hif-α transcript together with itsprotein, only after 8 h of oxygen deprivation, indicate atranscriptional activation of hif-α by hypoxia that maysuggest the central role of the hif-α transcriptional regu-lation in oxygen homeostasis. However, in the subsequentre-oxygenation phase, hif-α mRNA expression appearedunaffected by normoxia while the observed reduction inHIF-α protein amount could be imputable to degradationby PHD activity being consistent with other studies

Fig. 3 Maximum-likelihood (ML) phylogeny analysis of PHD proteins. The phylogenetic tree was constructed by Phy ML using the LG model.Approximate likelihood-ratio values higher than 0.5 are indicated at the nodes. Abbreviations and sequence accession numbers are shown in Table 2

Fig. 4 Tissue distribution ofM. galloprovincialis hif-α andphd transcripts. Representativeexpression patterns from threebiological replicates are shown.Act and ef1-α were used asreference genes

Mar Biotechnol

Author's personal copy

(Myllyharju and Koivunen 2013) and with PHD proteinlevel found in our study. Although with extremely shorthalf-life, hif-α is constitutively expressed under normoxic

condition (Aragones et al. 2009) and the basal level ofmRNA and protein found in our experimental controlare in agreement with this assumption.

Fig. 5 Relative gene expressionof hif-α (a) and phd (b) mRNA ingill tissue of Mytilusgalloprovincialis during the airexposure and re-oxygenationphases. Data are shown as mean±SD, n=6.Different letters indicatesignificant differences betweentime points in the treatmentgroup, and different numbers referto significant differences betweentime points in the control group.Stars represent significantdifferences between the treatmentand control group at the sametime point (P<0.05)

Fig. 6 Western blot analysis of HIF-α (a) and PHD (b) protein levels in gill tissue of Mytilus galloprovincialis during the air exposure andre-oxygenation phases. Actin antibody was used as a loading control. Representative blots from six biological replicates are shown

Mar Biotechnol

Author's personal copy

Albeit the mechanism by which HIF-α protein is stabilizedin hypoxia is well established and is due to reduced PHDactivity, the mechanism underpinning the resolution of hif-αmRNA during hypoxia (observed in our experiment after24 h) remains poorly understood. While gene induction bylow oxygen has arguably dominated hypoxia research, studieson gene repression are limited to the hypoxic condition thatoccurs in cancer cell lines (Bruning et al. 2011; Favaro et al.2010; Ivan et al. 2008; Rane et al. 2009). These authors dem-onstrated the involvement of some micro-RNA, endogenoussmall RNA molecules that regulate gene expression bydestabilizing mRNA or repressing translation, in response tohypoxia. Bruning et al. (2011), for instance, provided evi-dence that hif-α, in intestinal epithelial cells, is a direct targetof miR-155, a hypoxia-inducible micro-RNA. On the otherhand, hif-α is the transcription factor primarily responsiblefor miR-155 induction in hypoxia assuming that miR-155 isa component of the network of negative feedback loop respon-sible for the resolution of hif-α transcription in hypoxia. Al-thoughM. galloprovincialis is so far from the mammalian celllines, the evolutionary conserved features found in our hif-αsequence might lead us to hypothesize a similar mechanism ofhif-α resolution in mussel under hypoxic conditions.

The overall pattern of phd mRNA expression was similarto hif-α time course during the air exposure phase, with aforward shifted peak level at 24 h (Fig. 5). These data maysuggest a probable role of HIF-α on phd gene transcriptionalregulation, but further insight could come from phd promoteranalysis studies. Negative feedback mechanisms involvingHIF-α-dependent upregulation of phds have been indeedidentified, and the role of over-expressed PHDs in decreasingthe hypoxia-induced HIF activity has widely reported inmam-mals (Minamishima et al. 2009; Stiehl et al. 2006). The in-crease in PHD protein showed in this study after 1 h of re-oxygenation could, hence, determine the observed decline ofHIF-α at 4 h, and furthermore, the subsequent decrease ofPHD protein at 4 h of re-oxygenation coincides with theHIF-α protein stabilization up to the end of the experiment.These results, besides suggesting the HIF-α post-translationalregulation via PHD, strongly indicate that PHD can be tran-scriptionally regulated by HIF-α, forming a negative-feedback loop also in mussels. In hypoxia-tolerant organisms,the basal expression of HIF-α in normoxia and hypoxic reg-ulation of its mRNA is, indeed, an adapting feature (Law et al.2006; Rissanen et al. 2006; Wang et al. 2014), and PHD con-tributes to the enhanced rates of HIF-α degradation during re-oxygenation, thus playing an important role for setting thelevels of HIF-α. It appears evident that the relative abundanceof HIF-α and PHD protein is the result of a complex regula-tory network whose elucidation needs further investigation.

The strong increase of phd mRNA and protein level at 1 hof re-oxygenation and the following decrease might suggest,even in mussels, a possible role of PHD in oxygen availability

sensing other than its role in targeting HIF-α subunit for deg-radation as previously shown by Berra et al. (2003) in mam-malian cell lines.

Overall, HIF-α and PHD mRNA and protein expressionwere modulated in a oxygen-dependent manner with compa-rable trends suggesting a possible supplemental role of tran-scriptional activation in addition to post-translational controlmechanisms that are well characterized in mammalian models(Brocato et al. 2014).

Taken together, these results give further insights in thecomprehension of molecular strategies of hypoxia tolerancein mussels suggesting a pivotal role of HIF-α and PHD inM. galloprovincialis O2 sensing. It can be inferred that bothkey genes participate a cooperative action according to oxy-gen availability where PHD plays as an BO2-sensor^ whileHIF-α as an early BO2-lack sensor .̂

The environmental hypoxia is a common, naturally occur-ring phenomenon in many aquatic ecosystems; the prevalenceof which is increasing as a result of eutrophication. Data re-ported in this study on the biological response ofM. galloprovincialis experimentally subjected to air exposureprovide hypoxia-responsive biomarkers that can give a majorcontribution in future environmental monitoring studies.

Acknowledgments This research was supported by a National InterestResearch Project, PRIN 2010–2011 (prot. 2010ARBLT7_001/008).

References

Airaksinen S, Rabergh CMI, Sistonen L, Nikinmaa M (1998) Effects ofheat shock and hypoxia on protein synthesis in rainbow trout(Oncorhynchus mykiss) cells. J Exp Biol 201:2543–2551

Anestis A, Portner HO, Michaelidis B (2010) Anaerobic metabolic pat-terns related to stress responses in hypoxia exposed musselsMytilusgalloprovincialis. J Exp Mar Biol Ecol 394:123–133

Aragones J, Fraisl P, Baes M, Carmeliet P (2009) Oxygen sensors at thecrossroad of metabolism. Cell Metab 9:11–22

Babarro JMF, Labarta U, Reiriz MJF (2007) Energy metabolism andperformance of Mytilus galloprovincialis under anaerobiosis. JMar Biol Assoc UK 87:941–946

Benizri E, Ginouves A, Berra E (2008) The magic of the hypoxia-signaling cascade. Cell Mol Life Sci 65:1133–1149

Berra E, Benizri E,GinouvesA,VolmatV,RouxD, Pouyssegur J (2003)HIFprolyl-hydroxylase 2 is the key oxygen sensor setting low steady-statelevels of HIF-1 alpha in normoxia. EMBO J 22:4082–4090

Brocato J, Chervona Y, Costa M (2014) Molecular responses to hypoxia-inducible factor 1 alpha and beyond. Mol Pharmacol 85:651–657

Brunelli E, Mauceri A, Salvatore F, Giannetto A, Maisano M, Tripepi S(2010) Localization of aquaporin 1 and 3 in the gills of the rainbowwrasse Coris julis. Acta Histochem 112:251–258

Bruning U, Cerone L, Neufeld Z, Fitzpatrick SF, Cheong A, Scholz CC,Simpson DA, Leonard MO, Tambuwala MM, Cummins EP, TaylorCT (2011) MicroRNA-155 promotes resolution of hypoxia-inducible factor 1 alpha activity during prolonged hypoxia. MolCell Biol 31:4087–4096

Campos C, Valente LMP, Borges P, Bizuayehu T, Fernandes JMO(2010) Dietary lipid levels have a remarkable impact on the

Mar Biotechnol

Author's personal copy

expression of growth-related genes in Senegalese sole (Soleasenegalensis Kaup). J Exp Biol 213:200–209

Chevreux B, Wetter T, Suhai S (1999) Genome sequence assembly usingtrace signals and additional sequence information computer scienceand biology. Computer Science and Biology: Proceedings of theGerman Conference on Bioinformatics (GCB) 99:45–56

D’Agata A, Cappello T,MaisanoM, ParrinoV, Giannetto A, BrundoMV,Ferrante M, Mauceri A (2014) Cellular biomarkers in themussel Mytilus galloprovincialis (Bivalvia: Mytilidae) from LakeFaro (Sicily, Italy). Ital J Zool 81:43–54

David E, Tanguy A, Pichavant K, Moraga D (2005) Response of thePacific oyster Crassostrea gigas to hypoxia exposure under exper-imental conditions. FEBS J 272:5635–5652

Diaz RJ, Rosenberg R (2008) Spreading dead zones and consequencesfor marine ecosystems. Science 321:926–929

Fasulo S, Iacono F, Cappello T, Corsaro C, Maisano M, D'Agata A,Giannetto A, De Domenico E, Parrino V, Lo Paro G, Mauceri A( 2 0 1 2 ) M e t a b o l o m i c i n v e s t i g a t i o n o f My t i l u sga l loprov inc ia l i s (Lamarck 1819) caged in aqua t icenvironments. Ecotoxicol Environ Saf 84:139–146

Favaro E, Ramachandran A, McCormick R, Gee H, Blancher C, CrosbyM, Devlin C, Blick C, Buffa F, Li JL, Vojnovic B, Pires das Neves R,Glazer P, Iborra F, Ivan M, Ragoussis J , Harr is AL(2010) MicroRNA-210 regulates mitochondrial free radical re-sponse to hypoxia and krebs cycle in cancer cells by targeting ironsulfur cluster protein ISCU. PLoS One 5:e10345

Fernandes JMO, MacKenzie MG, Wright PA, Steele SL, Suzuki Y,Kinghorn JR, Johnston IA (2006) Myogenin in model pufferfishspecies: comparative genomic analysis and thermal plasticity of ex-pression during early development. Comp Biochem Physiol Part DGenomics Proteomics 1:35–45

Fernandes JMO, Macqueen DJ, Lee HT, Johnston IA (2008) Genomic,evolutionary, and expression analyses of cee, an ancient gene in-volved in normal growth and development. Genomics 91:315–325

Fernandez CG, Roufidou C, Antonopoulou E, Sarropoulou E(2013) Expression of developmental-stage-specific genes in thegilthead sea bream Sparus aurata L. Mar Biotechnol 15:313–320

Finn RD, Bateman A, Clements J, Coggill P, Eberhardt RY, Eddy SR,Heger A, Hetherington K, Holm L, Mistry J, Sonnhammer ELL,Ta te J , Pun ta M (2014) Pfam: the pro te in fami l i e sdatabase. Nucleic Acids Res 42:D222–D230

Giannetto A, Nagasawa K, Fasulo S, Fernandes JMO (2013) Influence ofphotoperiod on expression of DNA (cytosine-5) methyltransferasesin Atlantic cod. Gene 519:222–230

Giannetto A, Fernandes JMO, Nagasawa K, Mauceri A, Maisano M, DeDomenico E, Cappello T, Oliva S, Fasulo S (2014) Influence ofcontinuous light treatment on expression of stress biomarkers inAtlantic cod. Dev Comp Immunol 44:30–34

Ginouves A, Ilc K, Macias N, Pouyssegur J, Berra E (2008) PHDsoveractivation during chronic hypoxia "desensitizes" HIF alphaand protects cells from necrosis. Proc Natl Acad Sci U S A 105:4745–4750

Gorr TA, Gassmann M, Wappner P (2006) Sensing and responding tohypoxia via HIF in model invertebrates. J Insect Physiol 52:349–364

Greenway SC, Storey KB (1999) The effect of prolonged anoxia onenzyme activities in oysters (Crassostrea virginica) at differentseasons. J Exp Mar Biol Ecol 242:259–272

Guan L, Chi W, Xiao W, Chen L, He S (2014) Analysis of hypoxia-inducible factor alpha polyploidization reveals adaptation toTibetan Plateau in the evolution of schizothoracine fish. BMCEvol Biol 14:192

Heise K, Puntarulo S, Nikinmaa M, Lucassen M, Portner HO, Abele D(2006) Oxidative stress and HIF-1 DNA binding during stressfulcold exposure and recovery in the North Sea eelpout (Zoarces

viviparus). Comp Biochem Physiol A Mol Integr Physiol 143:494–503

Henze AT, Riedel J, Diem T, Wenner J, Flamme I, Pouyseggur J, PlateKH, Acker T (2010) Prolyl Hydroxylases 2 and 3 act in gliomas asprotective negative feedback regulators of hypoxia-induciblefactors. Cancer Res 70:357–366

Ivan M, Harris AL, Martelli F, Kulshreshtha R (2008) Hypoxia responseandmicroRNAs: no longer two separate worlds. J Cell MolMed 12:1426–1431

Ivanina AV, Sokolov EP, Sokolova IM (2010) Effects of cadmium onanaerobic energy metabolism and mRNA expression during air ex-posure and recovery of an intertidal mollusk Crassostreavirginica. Aquat Toxicol 99:330–342

Kawabe S, Yokoyama Y (2012) Role of Hypoxia-Inducible Factor alphain response to hypoxia and heat shock in the Pacificoyster Crassostrea gigas. Mar Biotechnol 14:106–119

Ke Q, Costa M (2006) Hypoxia-Inducible Factor-1 (HIF-1). MolPharmacol 70:1469–1480

Kurochkin IO, Ivanina AV, Eilers S, Downs CA, May LA, Sokolova IM(2009) Cadmium affects metabolic responses to prolonged anoxiaand reoxygenation in eastern oysters (Crassostrea virginica). Am JPhysiol Regul Integr Comp Physiol 297:1262–1272

Lahiri S, Roy A, Baby SM, Hoshi T, Semenza GL, Prabhakar NR(2006) Oxygen sensing in the body. Prog Biophys Mol Biol 91:249–286

Larade K, Storey KB (2009) Living without oxygen: anoxia-responsivegene expression and regulation. Curr Genomics 10:76–85

Law SHW,Wu RSS, Ng PKS, Yu RMK, Kong RYC (2006) Cloning andexpression analysis of two distinct HIF-alpha isoforms-gcHIF-1alpha and gcHIF-4alpha from the hypoxia-tolerant grass carp,Ctenopharyngodon idellus. BMC Mol Biol 7:15

Lazado CC, Kumaratunga HPS, Nagasawa K, Babiak I, Giannetto A,Fernandes JMO (2014) Daily rhythmicity of clock gene transcriptsin Atlantic cod fast skeletal muscle. PLoS One 9:e99172

Li T, Brouwer M (2007) Hypoxia-inducible factor, gsHIF, of the grassshrimp Palaemonetes pugio: molecular characterization and re-sponse to hypoxia. Comp Biochem Physiol B Biochem Mol Biol147:11–19

Liu CC, Shin PKS, Cheung SG (2014) Isolation and mRNA expressionof hypoxia-inducible factor α (HIF-α) in two sublittoral nassariidgastropods: Nassarius siquijorensis and Nassarius conoidalis. MarEnviron Res 99:44–51

Marchler-Bauer A, Lu SN, Anderson JB, Chitsaz F, Derbyshire MK,DeWeese-Scott C, Fong JH, Geer LY, Geer RC, Gonzales NR,Gwadz M, Hurwitz DI, Jackson JD, Ke ZX, Lanczycki CJ, Lu F,Marchler GH, Mullokandov M, Omelchenko MV, Robertson CL,Song JS, Thanki N, Yamashita RA, Zhang DC, Zhang NG, ZhengCJ, Bryant SH (2011) CDD: a Conserved Domain Database for thefunctional annotation of proteins. Nucleic Acids Res 39:D225–D229

Minamishima YA, Moslehi J, Padera RF, Bronson RT, Liao R, KaelinWG (2009) A feedback loop involving the Phd3 Prolyl Hydroxylasetunes the mammalian hypoxic response in vivo. Mol Cell Biol 29:5729–5741

Myllyharju J, Koivunen P (2013) Hypoxia-inducible factor prolyl 4-hy-droxylases: common and specific roles. Biol Chem 394:435–448

Nagasawa K, Giannetto A, Fernandes JMO (2012) Photoperiod influ-ences growth and mll (Mixed-Lineage Leukaemia) expression inAtlantic cod. PLoS One 7:e36908

Nicastro KR, Zardi GI, McQuaid CD, Stephens L, Radloff S, Blatch GL(2010) The role of gaping behaviour in habitat partitioning betweencoexisting intertidal mussels. BMC Ecol 10:17

Nikinmaa M, Leveelahti L, Dahl E, Rissanen E, Rytkonen KT, Laurila A(2008) Population origin, development and temperature of develop-ment affect the amounts of HSP70, HSP90 and the putative

Mar Biotechnol

Author's personal copy

hypoxia-inducible factor in the tadpoles of the common frog Ranatemporaria. J Exp Biol 211:1999–2004

Piano A, Valbonesi P, Fabbri E (2004) Expression of cytoprotective pro-teins, heat shock protein 70 and metallothioneins, in tissues ofOstrea edulis exposed to heat and heavy metals. Cell StressChaperones 9:134–142

PiontkivskaH, Chung JS, IvaninaAV, Sokolov EP, Techa S, Sokolova IM(2011) Molecular characterization and mRNA expression of twokey enzymes of hypoxia-sensing pathways in eastern oystersCrassostrea virginica (Gmelin): Hypoxia-inducible factor alpha(HIF-alpha) and HIF-prolyl hydroxylase (PHD). Comp BiochemPhysiol Part D Genomics Proteomics 6:103–114

Rane S, He M, Sayed D, Vashistha H, Malhotra A, Sadoshima J, VatnerDE, Vatner SF, Abdellatif M (2009) Downregulation of miR-199aderepresses hypoxia-inducible factor-1alpha and Sirtuin 1 and reca-pitulates hypoxia preconditioning in cardiac myocytes. Circ Res104:879–886

Rissanen E, Tranberg HK, Nikinmaa M (2006) Oxygen availability reg-ulates metabolism and gene expression in trout hepatocytecultures. Am J Physiol Regul Integr Comp Physiol 291:R1507–R1515

Rytkonen KT, Ryynanen HJ, Nikinmaa M, Primmer CR (2008) Variablepatterns in the molecular evolution of the hypoxia-inducible factor-1alpha (HIF-1 alpha) gene in teleost fishes and mammals. Gene 420:1–10

Rytkonen KT, Williams TA, Renshaw GM, Primmer CR, Nikinmaa M(2011) Molecular evolution of the metazoan PHD-HIF oxygen-sensing system. Mol Biol Evol 28:1913–1926

Salamov AA, Nishikawa T, Swindells MB (1998) Assessing protein cod-ing region integrity in cDNA sequencing projects. Bioinformatics14:384–390

Sciortino MT, Medici MA, Marino-Merlo F, Zaccaria D, Giuffre-Cuculletto M, Venuti A, Grelli S, Mastino A (2008) Involvementof HVEM receptor in activation of nuclear factor kappa B by herpessimplex virus 1 glycoprotein D. Cell Microbiol 10:2297–2311

Semenza GL (2004) Hydroxylation of HIF-1: oxygen sensing at the mo-lecular level. Physiology 19:176–182

Shen C,NettletonD, JiangM,Kim SK, Powell-Coffman JA (2005) Rolesof the HIF-1 hypoxia-inducible factor during hypoxia response inCaenorhabditis elegans. J Biol Chem 280:20580–20588

Sollid J, Rissanen E, Tranberg HK, Thorstensen T, Vuori KA, NikinmaaM, Nilsson GE (2006) HIF-1alpha and iNOS levels in crucian carpgills during hypoxia-induced transformation. J Comp Physiol B176:359–369

Sonanez-Organis JG, Peregrino-Uriarte AB, Gomez-Jimenez S, Lopez-Zavala A, Forman HJ, Yepiz-Plascencia G (2009) Molecular char-acterization of hypoxia inducible factor-1 (HIF-1) from the whiteshrimp Litopenaeus vannamei and tissue-specific expression underhypoxia. Comp Biochem Physiol C Toxicol Pharmacol 150:395–405

Stiehl DP, Wirthner R, Koditz J, Spielmann P, Camenisch G, Wenger RH(2006) Increased prolyl 4-hydroxylase domain proteins compensatefor decreased oxygen levels-evidence for an autoregulatory oxygen-sensing system. J Biol Chem 281:23482–23491

Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S(2011) MEGA5: Molecular Evolutionary Genetics Analysis usingMaximum Likelihood, Evolutionary Distance, and MaximumParsimony methods. Mol Biol Evol 28:2731–2739

Taylor CT, Pouyssegur J (2007) Oxygen, hypoxia, and stress. Ann N YAcad Sci 1113:87–94

Terova G, Rimoldi S, Cora S, Bernardini G, Gornati R, Saroglia M(2008) Acute and chronic hypoxia affects HIF-1 alphamRNA levelsin sea bass (Dicentrarchus labrax). Aquaculture 279:150–159

Velázquez-Amado RM, Escamilla-Chimal EG, Fanjul-Moles ML(2012) Daily light-dark cycles influence hypoxia-inducible factor-1 and heat shock protein levels in the pacemakers of cray-fish. Photochem Photobiol 88:81–89

Wang DP, Li HG, Li YJ, Guo SC, Yang J, Qi DL, Jin C, Zhao XQ(2006) Hypoxia-inducible factor 1alpha cDNA cloning and itsmRNA and protein tissue specific expression in domestic yak (Bosgrunniens) from Qinghai-Tibetan plateau. Biochem Biophys ResCommun 348:310–319

Wang G, Yu Z, Zhen Y, Mi T, Shi Y, Wang J, Wang M, Sun S(2014) Molecular characterisation, evolution and expression ofhypoxia-inducible factor in Aurelia sp.1. PLoS One 9:e100057

Webster KA (2003) Evolution of the coordinate regulation of glycolyticenzyme genes by hypoxia. J Exp Biol 206:2911–2922

Woo S, Jeon HY, Kim SR, Yum S (2011) Differentially displayed geneswith oxygen depletion stress and transcriptional responses in themarine mussel, Mytilus galloprovincialis. Comp Biochem PhysiolPart D Genomics Proteomics 6:348–356

Yao CL, Somero GN (2013) Thermal stress and cellular signaling pro-cesses in hemocytes of native (Mytilus californianus) and invasive(M. galloprovincialis) mussels: Cell cycle regulation and DNArepair. Comp Biochem Physiol A Mol Integr Physiol 165:159–168

Zhao TB, Ning HX, Zhu SS, Sun P, Xu SX, Chang ZJ, Zhao XQ(2004) Cloning of hypoxia-inducible factor 1 alpha cDNA from ahigh hypoxia tolerant mammal-plateau pika (Ochotonacurzoniae). Biochem Bioph Res Commun 316:565–572

Mar Biotechnol

Author's personal copy