Tt

CMMMa

b

c

d

e

h

•

•

•

•

a

ARRAA

KNCA

T

h0

Journal of Hazardous Materials 297 (2015) 92–100

Contents lists available at ScienceDirect

Journal of Hazardous Materials

jo ur nal ho me p ag e: www.elsev ier .com/ locate / jhazmat

itanium dioxide nanoparticles modulate the toxicological responseo cadmium in the gills of Mytilus galloprovincialis

amilla Della Torre a,1, Teresa Balbi b, Giacomo Grassi a, Giada Frenzilli c,argherita Bernardeschi c, Arianna Smerilli d, Patrizia Guidi c, Laura Canesi b,arco Nigro c, Fabrizio Monaci a, Vittoria Scarcelli c, Lucia Rocco d, Silvano Focardi a,arco Monopoli e, Ilaria Corsi a,∗

Department of Physical, Earth and Environmental Sciences, University of Siena, ItalyDepartment of Earth, Environmental and Life Sciences-DISTAV, University of Genoa, ItalyDepartment of Clinical and Experimental Medicine, University of Pisa, ItalyDepartment of Environmental, Biological and Pharmaceutical Sciences and Technologies (DiSTABiF), Seconda Università di Napoli, Caserta, ItalyCentre for BioNanoInteractions, School of Chemistry and Chemical Biology, University College Dublin, Ireland

i g h l i g h t s

Nano-TiO2 modulate CdCl2 cellularresponses in gills of marine mussel.Nano-TiO2 reduced CdCl2-inducedeffects by lowering abcb1 m-RNA andGST activity.Nano-TiO2 reduced Cd accumulationin mussel’s gills but not in whole softtissue.Higher accumulation of Ti in the pres-ence of CdCl2 was observed in gills.

g r a p h i c a l a b s t r a c t

r t i c l e i n f o

rticle history:eceived 24 February 2015eceived in revised form 22 April 2015

a b s t r a c t

We investigated the influence of titanium dioxide nanoparticles (nano-TiO2) on the response to cad-mium in the gills of the marine mussel Mytilus galloprovincialis in terms of accumulation and toxicity.Mussels were in vivo exposed to nano-TiO2, CdCl2, alone and in combination. Several cellular biomarkers

ccepted 25 April 2015

vailable online 28 April 2015

eywords:ano-TiO2

admiumBC transporters

were investigated in gills: ABC transport proteins and metallothioneins at gene/protein (abcb1, abcc-likeand mt-20) and functional level, GST activity, NO production and DNA damage (Comet assay). Accu-mulation of total Cd and titanium in gills as in whole soft tissue was also investigated. Significantresponses to Cd exposure were observed in mussel gills as up-regulation of abcb1 and mt-20 gene tran-scription, increases in total MT content, P-gp efflux and GST activity, DNA damage and NO production.Nano-TiO2 alone increased P-gp efflux activity and NO production. When combined with Cd, nano-TiO2

∗ Corresponding author at. Department of Physical, Earth and Environmental Sciences, University of Siena, via Mattioli, 4, 53100 Siena, Italy.el.: +39 0577 232830; fax: +39 0577 232806.

E-mail address: ilaria.corsi@unisi.it (I. Corsi).1 Current address: Department of Biosciences University of Milano.

ttp://dx.doi.org/10.1016/j.jhazmat.2015.04.072304-3894/© 2015 Elsevier B.V. All rights reserved.

C. Della Torre et al. / Journal of Hazardous Materials 297 (2015) 92–100 93

GenotoxicityNO production

reduced the metal-induced effects by significantly lowering abcb1 gene transcription, GST activity, andDNA damage, whereas, additive effects were observed on NO production. A lower concentration of Cdwas observed in the gills upon co-exposure, whereas, Ti levels were unaffected. A competitive effect inuptake/accumulation of nano-TiO2 and Cd seems to occur in gills. A confirmation is given by the observedabsence of adsorption of Cd onto nano-TiO2 in sea water media.

1

wptsrwPsw

eatbomCrai[bOaIcTTmaw

iastapdcDnd[

atstetra[

. Introduction

Titanium dioxide nanoparticles (nano-TiO2) are one of the mostidely used nanomaterial, present in consumer and industrial

roducts [1]. Due to the large production and growing applica-ion, nano-TiO2 is released in huge amounts in urban and industrialewage and occurs in the aquatic environment [2,3]. From itselease into soil and waterways nano-TiO2 will end up in the sea,here it may represent a risk for ecosystem and human health [4].

redicted Environmental Concentrations (PECs) for nano-TiO2 inurface waters are of �g/L, but no data are available yet in marineaters [5].

Nano-TiO2 might affect aquatic organisms through its inher-nt properties, but also by modifying the bioavailability of otherquatic contaminants, including heavy metals [6–13]. Thereforeheir uptake, organ/tissue distribution and toxicity may be alteredy the presence of nano-TiO2 in the water media [14]. Co-exposuref nano-TiO2 with Cd has been investigated in different freshwaterodels leading to conflicting results [7–9,13–15]. In the green algae

hlamydomonas reinhardtii, Cd accumulation and toxicity seemededuced by nano-TiO2 [9]. In Daphnia magna increase Cd bioavail-bility has been reported in the presence of nano-TiO2, while nonfluence was observed on Cd uptake on Lumbriculus variegatus8]. In the zebrafish, nano-TiO2 enhanced Cd2+ bioaccumulation,ut this effect was reduced in the presence of humic acid [14].verall results suggest that interactions might be species specificnd affected by particle properties and behavior in water media.n addition, molecular mechanisms behind such interactions, ashanges in Cd accumulation and toxicity in the presence of nano-iO2, as well as effects on key cellular pathways are still unknown.he interactions of nano-TiO2 with Cd should be studied also onarine species, since several factors as for instance salinity, NOM

nd pH might strongly affect nano-TiO2 fate and behavior in seaater.

The effects of nano-TiO2 on marine organisms have beennvestigated in terms of physiological and reproductive alter-tions, immunotoxicity, genotoxicity, cytotoxicity and oxidativetress [2,13,16–21]. Suspension-feeders clearly represent impor-ant model organisms to assess the impact of nanoparticles onquatic biota [22,23]. In the Mediterranean mussel Mytilus gallo-rovincialis, nano-TiO2 has been reported to affect immune andigestive gland function [10,11,15,16,23,24,]. Induced genotoxi-ity has been reported also in mussel hemocytes as oxidativeNA damage [26]. Moreover, a recent study on co-exposure ofano-TiO2 with Cd revealed complex interactive effects in musseligestive gland and hemocytes, as well as on embryo development27].

In the digestive gland, distinct interactive effects of nano-TiO2nd Cd were observed on lysosomal biomarkers and transcrip-ion of the immune genes. However, nano-TiO2 did not affectpecific metal-induced responses (metallothionein induction) andissue metal accumulation. These data indicated that the interactiveffects observed were not due to differences in bioaccumula-ion of Cd in the presence of nano-TiO2 agglomerates, but may

esult from interactions of either contaminant with both commonnd distinct targets/mechanisms of action in different cells/tissues27].

© 2015 Elsevier B.V. All rights reserved.

In bivalves the gills represent the first site of entry of solublechemicals, including metals, from the surrounding environment[28]. Due to their role in the feeding process, they might representthe main site of disposal of NPs and their agglomerates. Parti-cles in fact are trapped by the gill sieve and moved toward thelabial palps and mouth to the digestive system, whereas, thoseinglobated in mucus are rejected as pseudofaeces [23]. Severalstudies reported sub-lethal effects of metal-oxide (Ag, Cu, Zn) NPsat environmentally-realistic concentrations, on bivalve gills, oftenderiving from dissolution of heavy metal ions [29]. However, infor-mation on the effects of nano-TiO2 in bivalve gills is still scarce.The only data available so far showed that nano-TiO2 (0.1 mg/L)affected ABC transporters efflux activities [12]. Higher concentra-tions of nano-TiO2 (10 mg/L) resulted in moderate gill damage andhemocyte infiltration (D’agata et al. 2013) [26].

Considering the importance of this tissue as a first barrier againstthe uptake of contaminants, including NPs, in the present study weinvestigated the in vivo effects of nano-TiO2 and its influence onthe bioconcentration and sub-lethal toxicity of Cd in the gills of M.galloprovincialis.

Key proteins involved in the cellular protective response towardCd and well established biomarkers of exposure/effects wereinvestigated: ABC transport proteins and metallothioneins bothat gene (abcb1, abcc-like and mt-20) and protein function/level,were evaluated as components of cellular disposition of xenobioticsand of metal induced defense response, respectively. Glutathionetransferase-GST activity was measured as a marker of intracel-lular biotransformation and antioxidant protection. Tissue nitricoxide-NO production was evaluated as a possible biomarker of tis-sue inflammation. Finally, DNA damage was also evaluated (Cometassay). Accumulation of Cd and total titanium in gills and in wholesoft tissue was determined. Characterization of the interactionsbetween nano-TiO2 and Cd in artificial sea water (ASW) was alsoperformed.

2. Methods

2.1. Preparation and characterization of nano-TiO2

Nanosized titanium dioxide (n-TiO2), namely Aeroxide©

(declared purity of 99.9%) was kindly supplied by Eigenmann &Veronelli (Milan, Italy). Stock suspensions (10 mg mL−1) were pre-pared daily in Artificial Seawater (ASW) (pH 8, salinity 36‰) [30]and in 0.22 �m membrane-filtered natural seawater (NSW) (pH 7.9,salinity 30‰) by sonication at 100 W for 45 min in a cooling icebath and immediately diluted in different media to obtain properworking suspensions.

Primary particle diameter and shape were determined throughtransmission electron microscopy (TEM); dynamic light scatter-ing (DLS) analysis was performed on a Malvern Zetasizer 3000 HSa(Malvern Instruments, UK) to evaluate size and z-potential of thesuspensions in ASW and NSW. Time-dependent size distributionswas investigated through differential centrifuge sedimentation(DCS) with a CPS Disk Centrifuge DC24000 using an 8–24% sucrose

gradient. The experiment was repeated for suspensions spikedwith CdCl2 (Merck, Analytical grade) to a final concentration of0.1 mg L−1 to investigate possible interactive effects between CdCl2

9 azardo

awfaao

2

fs3cvatt

2

stuiatttctfqi

2

wcCCgdde

f4degofs

TP

4 C. Della Torre et al. / Journal of H

nd nano-TiO2 in terms of size. The dynamic sedimentation processas monitored using a Cary 6000i UV–vis NIR spectrophotometer

or suspensions at nano-TiO2 concentrations (1, 10 and 50 mg L−1)lone and in combination with 0.1 mg L−1 of CdCl2. Changes inbsorbance at 323 nm were measured every 6 min over a periodf 360 min.

.2. Animals and treatments

Mussels (M. galloprovincialis Lam.) 4–5 cm long, were purchasedrom an aquaculture farm (Arborea-OR, Italy) and kept for 3 days intatic tanks containing 1 L ASW mussel−1 at 16 ◦C and daily fed with0 mg mussel−1 Marine Liquifry (Interpet, England). Sea water washanged daily. Stock suspensions of nano-TiO2 in ASW for both initro (P-gp efflux assay) and in vivo exposure studies were prepareds described above and immediately added to ASW in order to reachhe tested concentration. CdCl2 was diluted in ASW to reach theested concentrations.

.2.1. In vitro P-gp efflux assayIn vitro P-gp efflux assay was performed using gill punch biop-

ies (6 mm diameter Acuderm Inc.) and performed according tohe method already described [31]. Gill arches from at least 10ntreated individuals were used for obtaining punch biopsies and

ncubated with nano-TiO2 (0.1 �g mL−1) or CdCl2 (0.1 �g mL−1)lone and in combination for 120 min and with ASW. The concen-ration of nano-TiO2 was chosen as the lowest concentration ableo induce changes in ABC efflux among a dose-dependent concen-ration curve (from 0.01 to 10 �g mL−1) (data not shown). Similaronsiderations apply to CdCl2, that was able to affect ABC efflux athe concentration used, whereas, lower concentrations were inef-ective (data not shown). Exposed biopsies were collected for theuantification of gene expression or processed for P-gp efflux activ-

ty as described below.

.2.2. In vivo exposure experimentsMussels (at least 15 mussels in quadruplicate for each condition)

ere exposed for 96 h to either nano-TiO2 at 0.1 mg L−1 nominaloncentration levels, or CdCl2 0.1 mg L−1 and to both nano-TiO2 anddCl2 at the same concentrations. The concentrations of n-TiO2 anddCl2 were chosen on the basis of previous data [25,27]. A parallelroup of mussels were kept in clean ASW. Sea water was changedaily before addition of the contaminants. Animals were not feduring the experiments. No mortality was observed in differentxperimental conditions.

After exposure, both gill arches were excised from 40 musselsrom each experimental group as described above in order to obtain

samples pooled from 10 animals. Punch biopsies were imme-iately processed for P-gp efflux assay. Ten punch biopsies perxperimental point were processed for Comet assay. The remaining

ill samples were frozen at −80 ◦C for subsequent determinationf other biomarkers. For each exposure group, whole soft tissuesrom 10 mussels from each experimental group were removed andtored at −20 ◦C for Ti and Cd residue analysis.

able 1rimers sequences used for the qRT-PCR analyses.

Gene Fw 5′–3′ Rev 5′–3′

abcb1 AAAGCAAGCCCACTGGTATGGT ATGGCAGTGAAGGCAATGGCAabcc-like CCGGTAGGCAGGATTGTAAA AAGCGCTGTAAGGCGAAATA

mt-20 TGTGAAAGTGGCTGCGGA GTACAGCCACATCCACACGC

ef˛ TTGCTGTCCGAGACATGAGACA TCATTTCTTGCCACCGGCCTTT

us Materials 297 (2015) 92–100

2.2.3. qRT-PCR analysis of abc and mt-20 genesTotal RNA was isolated from gills pools in Tripure reagent

according to the manufacturer’s protocol. RNA concentrationswere measured using a Traycell spectrophotometer (Eppendorf) at260 nM. cDNA for RT-PCR was generated from 0.25 �g total RNAfrom all samples in 20 �l reaction volume using iScript cDNA Syn-thesis Kit according to the manufacturer’s protocol (Biorad, USA).Specific primers for abcb1, abcc-like genes, mt-20, housekeeping(hk) and Elongation Factor (ef˛) were designed for qRT-PCR usingIDTDNA www.idtdna.com. Primer sequences used for qRT-PCR aresummarized in Table 1. qRT-PCR was performed in Stratagene3000 × P thermal cycler at parameters described previously [31].The modulation of mRNA transcription was measured using the��Ct method [32].

2.2.4. P-gp efflux activityABC transporter activity assays were performed on gills biop-

sies [33]. Incubations of 60 gill biopses per experimental group (invivo and in vitro) obtained from 4 pools of 10 individuals each wereperformed in glass dishes in a volume of 30 ml of ASW plus Rho-damineB (RhB) (1 �M) in the dark with gentle shaking. A groupwas also exposed to the P-gp inhibitor Verapamil (20 �M) as apositive control. After 90 min incubation biopsies were washedtwice and sonicated 20 s in hypotonic lysis buffer (10 mM KCl,1.5 mM MgCl2, 10 mM Tris pH 7.4). Sonicates were centrifugedat 23,182 × g for 5 min and 150 �l of the supernatant transferredin 96-well black microplates. RhB fluorescence was measuredusing Victor3 microplate reader (Wallak) at �Excitation = 545 nm and�Emission = 575 nm.

2.2.5. Metallothionein contentThe metallothionein tissue content was analyzed as already

described [34]. Pooled gills were homogenized in 4 vol. 0.5 Msucrose, 20 mM Tris–HCl, pH 8.6, containing 6 �M leupep-tine, 1 mM phenylmethylsulpfonyl-fluoride (PMSF), and 0.01%B-mercaptoethanol. Metallothionein concentration in the sampleswas quantified by spectrophotometric titration of the sulphydrylicresidues using the Ellman’s reagent, 5,5-dithiobis-2-nitrobenzoicacid. Metallothionein content (�g protg−1 w.w. sample) was calcu-lated against a standard curve of glutathione (GSH).

2.2.6. GST activityPooled gills were homogenized in 5 vol. of 20 mM Tris buffer,

0.5 M sucrose, 0,15 M NaCl, pH 7.6 and centrifuged at 500 × gfor 15 min at 4 ◦C. The supernatants were then centrifuged at12,000 × g for 30 min and utilised for determination of GSHtransferase (GST) (E.C. 2.5.1.18) activity using CDNB (chloro-dinitrobenzoic acid) as a substrate [35]. Protein content wasdetermined by the BCA (bicinchoninic acid assay) using bovineserum albumin (BSA) as a standard. Spectrophotometric analyseswere carried out at 25 ◦C using a Varian Cary 50 spectrophotometer(Varian, Torino Italy) [35]. All data are reported as percent changewith respect to control values.

2.2.7. NO productionPooled gills were homogenized in 3 vol. of 0.05 M Tris buffer

solution 2% NaCl, pH 7.4 and centrifuged at 1000 × g for 15 min

Amplicon size bp Annealing T ◦C Accession number

A 162 55 FM999809.2194 56 FM999810.280 59 AY566248

119 55 AB162021.1

C. Della Torre et al. / Journal of Hazardous Materials 297 (2015) 92–100 95

FI , 90 af

a3tAiw(sdbtp

2

saoappesmDq(Vs

2

Aa

2

mAeypai

ig. 1. DLS time-resolved size distribution for nano-TiO2 in ASW.n the graph are reported 4 distinct measurements of the same suspension (30, 60rom 972 ± 35.37 to 1448 ± 25.72 and PDI from 0.294 ± 0.007 to 0.383 ± 0.041.

t 4 ◦C. The supernatants were then centrifuged at 20,000 × g for0 min and the resulting supernatants utilized for the spectropho-ometric evaluation of nitrite content by the Griess reaction [36].bsorbance at 540 nm was evaluated by a Varian Cary 50 Bio UVvis-

ble spectrophotometer equipped with a microplate reader. Valuesere corrected for sample blanks readings. Nitrite accumulation

�mol NaNO2−1 mg sample protein−1) was calculated against a

tandard curve of sodium nitrite (NaNO2). Protein content wasetermined according to the bicinchoninic (BCA) method usingovine serum albumin (BSA) as a standard. Average nitrite con-ent in the gill of control mussels was 2 ± 0.4 �mol NaNO2 mg−1

rotein−1 and data reported as percent of control values.

.2.8. Comet assayThe genotoxic effects were evaluated in mussel gills as DNA

trand breaks (SB) by Single Cell Gel Electrophoresis (or Cometssay). Gill cells were isolated by enzymatic digestion as previ-usly described [37]. The cell suspension obtained was centrifugedt 2000 × g for 5 min and the pellet used for the Comet assay, theellet was resuspended in HBSS and cell viability evaluated by Try-an blue exclusion (>95%). Procedures for slide preparation andlectrophoresis were carried out according to [38]. Slides weretained with ethidium bromide and observed under a fluorescenceicroscope (200×). Damaged nuclei were comet shaped due toNA migration toward the anode. The amount of DNA damage wasuantified as the percentage of DNA migrated into the comet tail%tail DNA) using an image analyzer (Kinetic Imaging Ltd., Komet,ersion 5). At least 50 nuclei per slide and 2 slides per sample werecored, for a total of 100 nuclei and the mean calculated.

.3. Cadmium and titanium residue in gills and whole soft tissue

Total Cadmium and titanium contents were measured by ICP-ES [27] on 4 independent pools of gills and whole soft tissue. Datare expressed as �g g−1 dry weight.

.4. Statistical analysis

Data obtained on gills in vivo and in vitro, representing theean ± SD of at least four samples in triplicate, were analyzed by

NOVA plus Tukey’s post-test. For genotoxicity data the effect ofxposure, slides, replicates were evaluated by the multifactor anal-

sis of variance (MANOVA). The multiple range test (MRT) waserformed in order to detect differences in the tail DNA (%) meansmong experimental groups. For all data analysis, statistical signif-cance was set at p < 0.05.

nd 120 min after sonication) expressed by intensity. Z-average were in the range:

3. Results and discussion

3.1. Nano-TiO2 characterization and behavior in sea water

Typical spheroid irregular shape of nano-TiO2 (Aeroxide© P25)and primary size of a mean particle diameter of 24 ± 7 nm was con-firmed by TEM (Fig. S1). DLS analysis of the particle suspension(10 mg L−1) in ASW confirmed the formation of agglomerates ofnano-TiO2 of micrometric size within the first minute after soni-cation (Fig. 1), with values of PDI ranging from 0.295 (±0.028) to0.383 (±0.041) and Z-average ranging from 972 (±35.37) to 1448(±25.72) nm (Fig. 1).

Nano-TiO2 agglomeration and consequent sedimentation wereobserved in ASW, while suspensions in MilliQ water showed neg-ligible sedimentation (Fig. S2). This was also confirmed by UV–visexperiments. As expected, 10 and 50 mg–L−1 suspensions in ASW(as well as in NSW) showed dramatic sedimentation over 6 h, lead-ing to a decrease of about 50% and 80% of the initial suspendedconcentration (Fig. S4a,b), while 1 mg L−1 suspensions remainedmore stable (Fig. 2a). The same behavior was observed in NSW(Fig. 2a and Fig. S4a,b), while suspensions in MilliQ water did notshow any relevant lowering of initial concentrations (Fig. 2a and Fig.S4a,b). No changes in sedimentation rate of 1 mg L−1 of nano-TiO2in the presence of CdCl2 100 �g L−1 were observed (Fig. 2b) either inASW, NSW and MilliQ water. On the opposite, at higher nano-TiO2concentrations an increased in sedimentation rate over 6 h com-pared to cadmium free suspensions was observed in MilliQ water,while no changes were observed in ASW and NSW (Fig. S4a,b).

Since nano-TiO2 surface charges remain highly unsaturated inMilliQ water, even a small amount of CdCl2 could enhance parti-cles aggregation and perhaps sedimentation by reducing particlecharge. Is thus highly unlikely to find bare nanoparticles of TiO2 asmonomers in high ionic strenght (IS) media, suggesting the absenceof physico-chemical interactions between nano-TiO2 and CdCl2 inASW. This outcome was confirmed by differential centrifugal sed-imentation (DCS) analysis that allowed an in deep investigationof time-dependent size distribution changes (0, 30, 60, 90 and120 min) with a high level of accuracy and reproducibility, regard-less interferences due to large microscale agglomerates.

Fig. 3(a) clearly shows an agglomerate population of around120 nm in size in 10 mg L−1 nano-TiO2 in ASW over the wholeexperiment, though several variations (from 122.4 to 133.6 nm)are observed time-dependently, leading to shifted peaks, remark-ably within the first half an hour. The same sort of experiment was

carried out by adding 0.1 mg L−1 of CdCl2 (Fig. 3b) and the out-comes were essentially the same (112.6 nm at 0 min and 123.5 nmat 120 min), with no changes in dispersion (size distribution) in thepresence of CdCl2 in ASW. Time-resolved DCS data were obtained

96 C. Della Torre et al. / Journal of Hazardous Materials 297 (2015) 92–100

FT liQ an

aDc

3

3

gpCmoial[ihTasuaClw

d

3

s

ig. 2. Size distribution by UV–vis.ime-dependent UV–vis analysis of 1 mg L−1 suspensions of nano-TiO2 in ASW, Mil

t 10 mg L−1 nano-TiO2 in ASW, since it was not possible to performCS at lower concentrations due to background noise perhaps as aonsequence of particle instability in ASW.

.2. Biological responses in gills

.2.1. ABC transporters gene expression and activityIn gill biopsies exposed in vitro, no alteration in ABC transporter

ene transcription was observed in any experimental group com-ared to controls (Fig. 4a). On the contrary, both nano-TiO2 anddCl2, alone and in co-exposure, significantly decreased the accu-ulation of RhB compared to controls (Fig. 4b). The protective role

f ABC transporters against CdCl2 has been already pointed outn M. galloprovincialis [31]. In mammalian models, nano-TiO2 canttenuate the function of the P-gp, thus potentially affecting cel-ular disposition of pollutants as well as of endogenous substrates39,40]. Our results confirm that in vitro both CdCl2 and nano-TiO2nduced significant reduction in RhB accumulation in gills biopsies;owever, no interactive effects were observed with the mixture.he increased efflux activity was not paralleled by abcb1 m-RNAbundance in any experimental group, this probably due to thehort-term exposure conditions. A different effect was observedpon in vivo exposure. While nano-TiO2 did not affect significantlybcb1 gene transcription, a significant increase was induced bydCl2 alone (up to 2.8-folds with respect to controls), while abcc-

ike gene resulted slightly down-regulated (Fig. 4c). Such increaseas not observed in co-exposure conditions (Fig. 4c).

These results further support the role of P-gp in the CdCl2efense response and suggests an antagonistic effect by nano-TiO2.

.2.2. mt-20 gene expression and Metallothionein contentIn vivo exposure to nano-TiO2 did not affect mt-20 gene tran-

cription in mussel’s gills. A significant up-regulation of mt-20 with

Fig. 3. Size distribution by DCS. DCS analysis of 10 mg L−1 suspensions

d NSW (a) and with the addition of 0.1 mg L−1 of CdCl2 (b).

respect to controls was observed in the gills of mussels exposed toboth CdCl2 alone and combined with nano-TiO2 (Fig. 5a). A simi-lar trend was also observed for MT protein level; nano-TiO2 alonedid not affect MT content, whereas, a significant increase (up to 4folds) was induced by CdCl2, either alone and in combination withnano-TiO2 (Fig. 5b).

The similar trend observed in mt-20 gene expression and MTtotal protein content in gills of mussel exposed to CdCl2 but alsoin those in co-exposure confirmed the active response towardCdCl2 exposure, in line with classical metal-induced transcriptionalresponses in Mytilus [41]. However also in the gills co-exposed,nano-TiO2 did not affect the metal induced defense response, aspreviously demonstrated in hemocytes and digestive gland in sim-ilar experimental conditions [27].

3.2.3. GST activity and NO productionGST activity and NO production were evaluated as biochemi-

cal responses that reflect the gill function. Mussel gills have a highpotential for phase II biotransformation through GST, whose activ-ity has been shown to be modulated by certain types of NPs [16].Nano-TiO2 did not affect GST activity, whereas, a large increase wasinduced by exposure to CdCl2 (about +50% with respect to controls;p ≤ 0.05). However, stimulation of GST was not observed in the gillsof mussels co-exposed to nano-TiO2 and CdCl2 (Fig. 6a). At lowerconcentrations, nano-TiO2 has been shown to decrease GST activityin mussel digestive gland, with specific effects on transcription ofthe GST-� isoform [25]. The antagonistic effect of nano-TiO2 andCdCl2 on total GST activity could be partly due to distinct effectsof either contaminant on different GST isoforms, that could not be

identified by the enzymatic assay using CDNB as a substrate, thatmeasures the overall enzyme activity.

Taken together, the results obtained for abcb1 gene expressionand GST activity support the hypothesis of an antagonistic effect

of nano-TiO2 in ASW (a) and with the addition of 0.1 mg L−1 of CdCl2 (b).

C. Della Torre et al. / Journal of Hazardous Materials 297 (2015) 92–100 97

Fig. 4. Effects on ABC transporters.abcb1 and abcc-like genes expression (a,c) and P-gp efflux activity (b,d) in gill biopsies exposed in vitro and in vivo to nano-TiO2 (nano-TiO2 1 mg L−1) CdCl2 (Cd 0.1 mg L−1),alone and in combination and the positive control verapamil (Ver). Data, representing the mean ± SD, were analysed by ANOVA plus Tukey’s post-test. *Significantly differentrespect to ctrl. # Significantly different respect to Cd single exposure (p < 0.05).

Fig. 5. Effects on metallothioneins.mt-20 gene expression (a) shown as fold induction vs control. Total metallothionein content (b) shown as �g/g dry weight (d.w.). Data, representing the mean ± SD, wereanalysed by ANOVA plus Tukey’s post-test. *Significantly different respect to ctrl (p < 0.05) ** (p < 0.001).

98 C. Della Torre et al. / Journal of Hazardous Materials 297 (2015) 92–100

FG were analyzed by ANOVA plus Tukey’s post-test. *Significantly different respect to ctrl( erent respect to n-TiO2 single exposure.

og

itbreca

ipoidTt

tcabslrgaf

3

gie(wttddd[tiDTm

ig. 6. GST activity and NO production.ST activity (a) and NO production (b) both shown as % of control. The mean ± SD

p < 0.05). # Significantly different respect to Cd single exposure. § Significantly diff

f the two contaminants on the detoxification pathways in musselills.

NO is an intracellular signaling molecule ubiquitously foundn animals: in molluscs, NO is mainly involved in neuromodula-ion, metamorphosis, and immune response [42]. NO productiony mussel immune cells, the hemocytes, represents a sensitiveesponse to chemical exposure, including nano-TiO2 and Cd. Theffects were mediated by activation of different kinase signalingascades (including PI3K, PKC, stress activated MAPKs) leading toctivation of NO synthase [24,25,27,43].

The results, here obtained show that in mussel gills nano-TiO2nduced a significant increase in NO production similar to thatreviously observed in hemocytes (+49%). A larger increase wasbserved with CdCl2 alone (+86%) and an even stronger effect was

nduced by co-exposure with nano-TiO2 (+131%) (Fig. 6b). Theseata indicate that the signaling pathways activated by Cd and nano-iO2 also in vivo may converge on NO synthase, thus resulting inhe observed additive effects on NO production.

Increased NO production may be partly due to hemocytes infil-rating the tissue, indicating inflammatory processes; however, NOan be also produced by dopaminergic neurons that control ciliaryctivity of mussel gills. In particular, on Mytilus, NO productiony dopaminergic neurons inhibits beating of lateral cilia [44], thaterve a vital function by generating the water currents that regu-ate gas exchange, food intake and waste removal. In this light, theesults underline how determination of NO production by musselills represents a sensitive response to nano-TiO2 and CdCl2, alonend in combination, that can reflect impairment of the physiologicalunction of the tissue.

.2.4. GenotoxicityNano-TiO2 exposure did not affect DNA integrity in mussel

ill cells. On the contrary, CdCl2 induced a statistically significantncrease of DNA strand breaks compared to controls (p < 0.05). In co-xposed specimens the DNA damage was reduced to control levelFig. 7). The genotoxic and carcinogenic potential of Cd has beenidely investigated in aquatic organism [28,45,46]. Cd is known

o affect genome stability inhibiting DNA repair and unbalancinghe cell equilibrium between pro-oxidant forces and antioxidantefenses. Indeed, it is also known to induce oxidative stress byepletion of glutathione (GSH) in association with mitochondrialamage, induction of apoptosis and disruption of calcium signaling47]. Although the occurrence of oxidized bases was not evaluated,he increased DNA primary damage detected in mussels exposed

n vivo to CdCl2 might be assumed as the consequence of Cd-relatedNA oxidative damage as supported by the increase of GST activity.he ineffectiveness of nano-TiO2 exposure in term of DNA pri-ary damage induction in mussel was previously reported [11].

Fig. 7. Genotoxicity.DNA damage shown as % of tail DNA. Data represent the mean ± SD. Letters indicatedsignificant differences respect to ctrl and between experimental groups (p < 0.05).

However, the same authors documented the elevation of micronu-cleated cells, suggesting the occurrence of chromosomal alteration,as the consequence of in vivo exposure nano-TiO2.

The finding that nano-TiO2 co-exposure completely preventsthe occurrence of DNA strand breaks associated with CdCl2 expo-sure suggests that nano-TiO2 might act as antagonist toward CdCl2induced DNA damage in mussel gill cells.

3.3. Cadmium and titanium content in gills and whole soft tissues

Mussel exposure to CdCl2 resulted in large metal accu-mulation in the gills, about 150-folds with respect to con-trols (278 ± 4 �g/Cd2+/g d.w.); a slightly lower CdCl2 con-tent was observed in mussels co-exposed with nano-TiO2(237 ± 3 �g/Cd2+/g d.w.) (Fig 8a). Cd2+ accumulation was mea-sured also in whole soft tissue, indicating similar concentrationsin mussels exposed to Cd2+alone and in combination with nano-TiO2 (about 108-folds with respect to controls) (Fig. 8a). The resultsobtained in this work indicate that co-exposure with nano-TiO2 didnot increase, but rather decreased the metal content in gills. Thisobservation, together with the results on heavy metal detoxica-tion response (metallothionein induction) indicate the absence ofa Trojan horse effect of nano-TiO2 toward CdCl2 in saltwater media,confirming previous data [27].

In the gills of nano-TiO2 -exposed mussels, the Ti content

was 0.27 ± 0.02 �g/g d.w., about 2-folds with respect to controls(Fig. 8b); interestingly, co-exposed mussels showed a significantlyhigher Ti content, about 5-folds with respect to controls (up to0.8 ± 0.02 �g/Ti/g d.w,). However, no increase in Ti content was

C. Della Torre et al. / Journal of Hazardo

Fig. 8. Cadmium and titanium content.Total cadmium (a) and titanium (b) in mussel gills (white bar) and whole soft tissue(black bar). Data shown as accumulation over control samples. ANOVA plus Tukey’sprl

odw

tntcmcneiwlct

aimcettcf

4

cigb

[

[

[

[

[

ost-test.*Significantly different respect to ctrl (p < 0.05). # Significantly differentespect to single exposure. (For interpretation of the references to color in this figureegend, the reader is referred to the web version of this article.)

bserved in whole soft tissues of mussels in any experimental con-ition. Moreover, in the digestive gland, lower tissue levels of Tiere measured in mussels co-exposed with CdCl2 [27].

We have previously demonstrated that, in the same experimen-al conditions, only a minor fraction (<10%) of the nominally addedano-TiO2 is available to the mussels in the suspended form, dueo both particle sedimentation and agglomeration/adsorption pro-esses occurring in the presence organic particles produced by theussels (mucus, fecal pellets, gametes). This would explain the low

oncentrations of Ti measured in the tissues of mussels exposed toano-TiO2, alone and in combination with CdCl2. Studies on differ-nt freshwater model species highlighted the interference of metalsn NPs uptake and vice versa [12,48,49]. Nevertheless, these findings

ere often conflicting and did not consider tissue-specific accumu-ation. The results obtained in mussel gills and digestive gland inomparison with whole soft tissues, underline the importance ofissue specific accumulation of Ti.

The different cell types and physiological role might in factffect the uptake/accumulation of nano-TiO2 as already suggestedn different human cell lines. With regards to biomarker responses

easured from molecular to tissue level, the results indicate thato-exposure did not increase the [27,28]. The observed antagonisticffect of nano-TiO2 vs CdCl2 responses related to detoxifica-ion pathways may be of particular importance. Gills in fact arehe first site of contaminant entry and detoxification; therefore,o-exposure with nano-TiO2 may influence the overall disposal,ate and toxicity of contaminants in other tissues.

. Conclusions

The results of this study provide important information con-

erning the potential interference of nano-TiO2 with Cd responsesn gills of the mussel M. galloprovincialis. Our results highlightedills as target organs for both contaminants, alone and in com-ination. In light of these observations, studies investigating NPs

[

[

us Materials 297 (2015) 92–100 99

pathways of internalization, accumulation and distribution withinthe organisms are strongly recommended. Additionally biomarkerstudies on specific tissues are of utmost importance. The multi-marker approach on different tissues allowed to identify sensitivetargets of NPs toxicity that might be concealed when consideringthe effects on the whole organism.

Conflicts of interest

Authors declare that there are no conflict of interest.

Acknowledgements

This work was supported by the Italian Ministry of Research(PRIN2009FHHP2W) Marine ecotoxicology of nanomaterials: toxi-city and bioaccumulation of nano titaniun dioxide in edible speciesin the presence of metals and dioxin. We thank graduate studentCarmen Catarinella for ABC analyses.

Appendix A. Supplementary data

Supplementary data associated with this article can be found,in the online version, at http://dx.doi.org/10.1016/j.jhazmat.2015.04.072.

References

[1] C.O. Robichaud, A.M. Uyar, M.R. Darby, L.G. Zucher, M.R. Wiesner, Estimates ofupper bounds and trends in nano-TiO2 production as a basis for exposureassessment, Environ. Sci. Technol. 43 (2009) 4227–4233.

[2] A. Menard, D. Drobne, A. Jemec, Ecotoxicity of nanosized TiO2. Review of invivo data, Environ. Pollut. 159 (2011) 677–684.

[3] A.P. Gondykas, F. von der Kammer, R.B. Reed, S. Wagner, J.F. Ranville, T.Hoffmann, Release of TiO2 nanoparticles from sunscreens into surface waters:a one-year survey at the old Danube recreational Lake, Environ. Sci. Technol.48 (2014) 5415–5422.

[4] V. Matranga, I. Corsi, Toxic effects of engineered nanoparticles in the marineenvironment: model organisms and molecular approaches, Mar. Environ. Res.76 (2012) 32–40.

[5] F. Gottschalk, T. Sun, B. Nowack, Environmental concentrations of engineerednanomaterials: review of modeling and analytical studies, Environ. Pollut.181 (2013) 287–300.

[6] X.Z. Zhang, H.W. Sun, Z.Y. Zhang, Q. Niu, Y.S. Chen, J.C. Crittenden, Enhancedbioaccumulation of cadmium in carp in the presence of titanium dioxidenanoparticles, Chemosphere 67 (2007) 160–166.

[7] X. Zhu, J. Zhou, Z. Cai, TiO2 nanoparticles in the marine environment: impacton the toxicity of tributyltin to abalone (Haliotis diversicolor supertexta)embryos, Environ. Sci. Technol. 45 (2011) 3753–3758.

[8] N.B. Hartmann, S. Legros, F. Von der Kammer, T. Hofmann, A. Baun, Thepotential of TiO2 nanoparticles as carriers for cadmium uptake in Lumbricusvariegatus and Daphnia magna, Aquat. Toxicol. 118–119 (2012) 1–8.

[9] W.W. Yang, A.-J. Miao, L.Y. Yang, Cd2+ toxicity to green alga Chlamydomonasreinhardtii as influenced by its adsorption on TiO2 engineered nanoparticles,PLoS One 7 (2012) 1–8.

10] W.W. Yang, L. Yan, A.-J. Miao, L.-Y. Yang, Cd2+ toxicity as affected by bare TiO2

nanoparticdles and their bulk counterpart, Ecotoxicol. Environ. Saf. 85 (2012)44–51.

11] L. Canesi, G. Frenzilli, T. Balbi, M. Bernadeschi, C. Ciacci, S. Corsolini, C. DellaTorre, R. Fabbri, C. Faleri, S. Focardi, et al., Possible interactive effects of n-TiO2

and 2,3,7,8-TCDD on the marine bivalve Mytilus galloprovincialis,Aquat.Toxicol. 153 (2014) 53–65.

12] C. Tan, W.-X. Wang, Modification of metal bioaccumulation and toxicity inDaphnia magna by Titanium dioxide nanoparticles, Environ. Pollut. 186 (2014)34–42.

13] C. Della Torre, F. Buonocore, G. Frenzilli, S. Corsolini, A. Brunelli, P. Guidi, A.Kocan, et al., Influence of titanium dioxide nanoparticles on2,3,7,8-tetrachlorodibenzo-p-dioxin bioconcentration and toxicity in themarine fish European sea bass (Dicentrachus labrax), Environ. pollut. 196(2015) 185–193.

14] X. Hu, Q. Chen, L. Jiang, Z. Yu, D. Jiang, D. Yin, Combined effects of titaniumdioxide and humic acid on the bioaccumulation of cadmium in zebrafish,Environ. Pollut. 159 (2011) 1151–1158.

15] N.B. Hartmann, A. Baun, The nano cocktail: ecotoxicological effects ofengineered nanoparticles in chemical mixtures, Integr. Environ. Assess.Manag. 6 (2010) 311–314.

16] L. Canesi, R. Fabbri, G. Gallo, D. Vallotto, A. Marcomini, G. Pojana, Biomarkersin Mytilus galloprovincialis exposed to suspensions of selected nanoparticles

1 azardo

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

00 C. Della Torre et al. / Journal of H

(Nano carbon black, C60 fullerene nano-TiO2, nano-SiO2), Aquat. Toxicol. 100(2010) 168–177.

17] T. Galloway, C. Lewis, I. Dolciotti, B.D. Johnston, J. Moger, F. Regoli, Sublethaltoxicity of nano-titanium dioxide and carbon nanotubes in a sedimentdwelling marine polychaete, Environ. Pollut. 158 (2010) 1748–1755.

18] M. Bernadeschi, P. Guidi, V. Scarcelli, G. Frenzilli, M. Nigro, Genotoxicpotential of TiO2 on bottlenose dolphin leukocytes, Anal. Bioanal. Chem. 396(2010) 619–623.

19] C. Mouneyrac, P.-E. Buffet, L. Poirier, A. Zalouk-Vergnoux, M. Guibbolini, C.Risso-de Faverney, H. Perrein-Ettajni, J.-F. Pan, H. Thomas-Guyon, P. Reip, E.Valsami-Jones, Fate and effects of metal-based nanoparticles in two marineinvertebrates, the bivalve mollusc Scrobicularia plana and the annelidpolychaete Hediste diversicolor, Environ. Sci. Pollut. Res. 21 (2014) 7899–7912.

20] G. Frenzilli, M. Bernardeschi, P. Guidi, V. Scarcelli, P. Lucchesi, L. Marsili, M.C.Fossi, A. Brunelli, G. Pojana, A. Marcomini, M. Nigro, Effects of in vitroexposure to titanium dioxide on DNA integrity of bottlenose dolphin (Tursiopstruncatus) fibroblasts and leukocytes, Mar. Environ. Res. 100 (2014) 68–73.

21] D. Minetto, G. Libralato, A. Volpi Ghirardini, Ecotoxicity of engineered TiO2

nanoparticles to saltwater organisms: an overview, Environ. Int. 66 (2014)18–27.

22] A. Baun, N.B. Hartmann, K. Grieger, K.O. Kusk, Ecotoxicity of engineerednanoparticles to aquatic invertebrates: a brief review and recommendationsfor future toxicity testing, Ecotoxicology 17 (2008) 387–395.

23] L. Canesi, C. Ciacci, R. Fabbri, A. Marcomini, G. Pojana, Gallo Bivalve molluscsas an unique target group for nanoparticle toxicity, Mar. Environ. Res. 76(2012) 16–21.

24] L. Canesi, C. Ciacci, D. Vallotto, G. Gallo, In vitro effects of suspensions ofselected nanoparticles (C60 fullerene, TiO2 SiO2) on Mytilus hemocytes,Aquat. Toxicol. 96 (2010) 151–158.

25] C. Barmo, C. Ciacci, B. Canonico, R. Fabbri, K. Cortese, T. Balbi, A. Marcomini, G.Pojana, G. Gallo, L. Canesi, In vivo effects of n-TiO2 on digestive gland andimmune function of the marine bivalve Mytilus galloprovincialis, Aquat.Toxicol. 132–133 (132) (2013) 9–18.

26] A. D’Agata, S. Fasulo, L.J. Dallas, A.S. Fisher, M. Maisano, J.W. Readman, A.N.Jha, Enhanced toxicity of ‘bulk’ titanium dioxide compared to ‘fresh’ and‘aged’ nano-TiO2 in marine mussels (Mytilus galloprovincialis),Nanotoxicology 8 (2014) 549–558.

27] T. Balbi, A. Smerilli, R. Fabbri, C. Ciacci, M. Montagna, E. Grasselli, A. Brunelli,G. Pojana, A. Marcomini, G. Gallo, L. Canesi, Co-exposure to n-TiO2 and Cd2+

results in interactive effects on biomarker responses but not in increasedtoxicity in the marine bivalve M. galloprovincialis, Sci. Tot. Environ. 493 (2014)355–364.

28] R. Chandurvelan, I.D. Mardsen, S. Gaw, C.N. Glover, Impairment ofgreen-lipped mussel (Perna canaliculus) physiology by waterborne cadmium:relationship to tissue bioaccumulation and effect of exposure duration, Aquat.Toxicol. 124–125 (124) (2012) 114–124.

29] T.J. Baker, C.R. Tyler, T.S. Galloway, Impacts of metal and metal oxidenanoparticles on marine organisms, Environ. Pollut. 186 (2014) 257–271.

30] ASTM, International Standard guide for conducting static acute toxicity testsstarting with embryos of four species of salt water bivalve molluscs, 2004 E

724-798.

31] C. Della Torre, E. Bocci, S. Focardi, I. Corsi, Differential expression and effluxactivity of ABCB and ABCC transport proteins in gills and hemocytes of Mytilusgalloprovincialis and their involvement in cadmium response, Mar. Environ.Res. 93 (2013) 56–63.

[

us Materials 297 (2015) 92–100

32] M.W. Pfaffl, A new mathematical model for relative quantification inreal-time RT-PCR, Nucleic Acids Res. 29 (2001) e45.

33] T. Luckenbach, I. Corsi, D. Epel, Fatal attraction: synthetic musk fragrancescompromise multixenobiotic defense systems in mussels, Mar. Environ. Res.58 (2004) 215–219.

34] A. Viarengo, E. Ponzano, F. Dondero, R. Fabbri, A simple spectrophotometricmethod for metallothionein evaluation in marine organisms: an applicationto Mediterranean and Antarctic molluscs, Mar. Environ. Res. 44 (1997) 69–84.

35] C. Ciacci, B. Canonico, D. Bilanicova, R. Fabbri, K. Cortese, G. Gallo, A.Marcomini, G. Pojana, L. Canesi, Immunomodulation by different types ofN-oxides in the hemocytes of the marine bivalve Mytilus galloprovincialis,PLoS One 7 (2012) e36937.

36] L.C. Green, D.A. Wagner, J. Glogowski, P.L. Skipper, J.S. Wishnok, S.Tannenbaum, Analysis of nitrate nitrite and (15N) nitrate in biological fluids,Anal. Biochem. 126 (1982) 131–138.

37] M. Nigro, A. Falleni, I. Del Barga, V. Scarcelli, P. Lucchesi, F. Regoli, G. Frenzilli,Cellular biomarkers for monitoring estuarine environments: transplantedversus native mussels, Aquat. Toxicol. 77 (2006) 339–347.

38] G. Frenzilli, M. Nigro, V. Scarcelli, S. Gorbi, F. Regoli, DNA integrity and totaloxyradical scavenging capacity in the Mediterranean mussel, Mytilusgalloprovincialis: a field study in a highly eutrophicated coastal lagoon, Aquat.Toxicol. 53 (2001) 19–32.

39] J.J. Salomon, C. Ehrardt, Nanoparticles attenuate P-glycoprotein/MDR1function in A549 human alveolar epithelial cells, Eur. J. Pharm. Biopharm. 77(2011) 392–397.

40] E. Brun, M. Carrere, A. Mabondzo, In vitro evidence of dysregulation ofblood-brain barrier function after acute and repeated 7 long-term exposure toTiO2 nanoparticles, Biomaterials 33 (2012) 886–896.

41] F. Dondero, L. Piacentini, M. Banni, M. Rebelo, B. Burlando, A. Viarengo,Quantitative PCR analysis of two molluscan metallothionein genes unveilsdifferential expression and regulation, Gene 345 (2005) 259–270.

42] J. Torreilles, Nitric oxide: one of the more conserved and widespread signalingmolecules, Front. Biosci. 6 (2001) D1161–D1172.

43] S. Dailianis, Production of superoxides and nitric oxide generation inhaemocytes of mussel Mytilus galloprovincialis (Lmk.) after exposure tocadmium: a possible involvement of Na+/H+ exchanger in the induction ofcadmium toxic effects, Fish Shellfish Immunol. 27 (2009) 446–453.

44] K.J. Mantione, C. Kim, G.B. Stefano, Morphine regulates gill ciliary activity viacoupling to nitric oxide release in a bivalve mollusk: opiate receptorexpression in gill tissues, Med. Sci. Monit. 12 (2006) BR195–200.

45] C. Emmanouil, T.M.T. Sheehan, J.K. Chipman, Macromolecule oxidation andDNA repair in mussel (Mytilus edulis L.) gill following exposure to Cd andCr(VI), Aquat. Toxicol. 82 (2007) 27–35.

46] F. Vincent-Hubert, A. Arini, C. Gourlay-Francé, Early genotoxic effects in gillcells and haemocytes of Dreissena polymorpha exposed to cadmium, B[a]P anda combination of B[a]P and Cd, Mutat. Res. 723 (2011) 26–35.

47] F. Thévenod, Cadmium and cellular signaling cascades: to be or not to be?Toxicol. Appl. Pharmacol. 238 (2009) 221–239.

48] R.R. Rosenfeldt, F. Seiz, R. Schulz, M. Bundschuh, Heavy metal uptake andtoxicity in the presence of titanium dioxide nanoparticles: a factorial

approach using Daphnia magna, Environ. Sci. Technol. 48 (2014)6965–6972.

49] S. Pavagadhi, M. Sathishkumar, R. Balasubramanian, Uptake of Ag and TiO2

nanoparticles by zebrafish embryos in the presence of other contaminants inthe aquatic environment, Water Res. 55 (2014) 280–291.