of May 6, 2016.This information is current as

Repression of FADDDependent−Hypoxia-Inducible Factor-1

Induced Intestinal Epithelial Damage by−αHydroxylase Inhibition Abrogates TNF-

Debby LaukensBrigitta Brinkman, Peter Vandenabeele, Dirk Elewaut andFerdinande, Harald Peeters, Kim Olievier, Sara Bogaert, Pieter Hindryckx, Martine De Vos, Peggy Jacques, Liesbeth

http://www.jimmunol.org/content/185/10/6306doi: 10.4049/jimmunol.1002541October 2010;

2010; 185:6306-6316; Prepublished online 13J Immunol 

MaterialSupplementary

1.DC1.htmlhttp://www.jimmunol.org/content/suppl/2010/10/14/jimmunol.100254

Referenceshttp://www.jimmunol.org/content/185/10/6306.full#ref-list-1

, 19 of which you can access for free at: cites 53 articlesThis article

Subscriptionshttp://jimmunol.org/subscriptions

is online at: The Journal of ImmunologyInformation about subscribing to

Permissionshttp://www.aai.org/ji/copyright.htmlSubmit copyright permission requests at:

Email Alertshttp://jimmunol.org/cgi/alerts/etocReceive free email-alerts when new articles cite this article. Sign up at:

Print ISSN: 0022-1767 Online ISSN: 1550-6606. Immunologists, Inc. All rights reserved.Copyright © 2010 by The American Association of9650 Rockville Pike, Bethesda, MD 20814-3994.The American Association of Immunologists, Inc.,

is published twice each month byThe Journal of Immunology

by guest on May 6, 2016

http://ww

w.jim

munol.org/

Dow

nloaded from

by guest on May 6, 2016

http://ww

w.jim

munol.org/

Dow

nloaded from

The Journal of Immunology

Hydroxylase Inhibition Abrogates TNF-a–Induced IntestinalEpithelial Damage by Hypoxia-Inducible Factor-1–DependentRepression of FADD

Pieter Hindryckx,* Martine De Vos,* Peggy Jacques,† Liesbeth Ferdinande,‡

Harald Peeters,* Kim Olievier,* Sara Bogaert,* Brigitta Brinkman,x,{ Peter Vandenabeele,x,{

Dirk Elewaut,† and Debby Laukens*

Hydroxylase inhibitors stabilize hypoxia-inducible factor-1 (HIF-1), which has barrier-protective activity in the gut. Because the

inflammatory cytokine TNF-a contributes to inflammatory bowel disease in part by compromising intestinal epithelial barrier

integrity, hydroxylase inhibition may have beneficial effects in TNF-a–induced intestinal epithelial damage. The hydroxylase

inhibitor dimethyloxalylglycin (DMOG) was tested in a murine model of TNF-a–driven chronic terminal ileitis. DMOG-treated

mice experienced clinical benefit and showed clear attenuation of chronic intestinal inflammation compared with that of vehicle-

treated littermates. Additional in vivo and in vitro experiments revealed that DMOG rapidly restored terminal ileal barrier

function, at least in part through prevention of TNF-a–induced intestinal epithelial cell apoptosis. Subsequent transcriptional

studies indicated that DMOG repressed Fas-associated death domain protein (FADD), a critical adaptor molecule in TNFR-1-

mediated apoptosis, in an HIF-1a–dependent manner. Loss of this FADD repression by HIF-1a-targeting small interfering RNA

significantly diminished the antiapoptotic action of DMOG. Additional molecular studies led to the discovery of a previously

unappreciated HIF-1 binding site in the FADD promoter, which controls repression of FADD during hypoxia. As such, the results

reported in this study allowed the identification of an innate mechanism that protects intestinal epithelial cells during (inflam-

matory) hypoxia, by direct modulation of death receptor signaling. Hydroxylase inhibition could represent a promising alternative

treatment strategy for hypoxic inflammatory diseases, including inflammatory bowel disease. The Journal of Immunology, 2010,

185: 6306–6316.

Inflammatory bowel disease (IBD) comprises chronic, re-lapsing inflammatory disorders of the digestive tract (i.e.,Crohn’s disease [CD] and ulcerative colitis).

The important contribution of TNF-a to inflammation in IBDis widely recognized. This pluripotent, proinflammatory cytokinecan compromise intestinal epithelial barrier integrity, a very earlyevent in the pathogenesis of IBD, in part by enhancing intestinal

epithelial apoptosis (1–4). By exposure of the inflammatory cellswithin the lamina propria (LP) to intraluminal Ags in a non-selective way, an unspecific inflammatory response is elicited,which in turn could promote additional tissue damage or evenevolve into sustained inflammatory activity. Not surprisingly, mol-ecules that are able to protect or restore intestinal epithelial bar-rier integrity could play a pivotal role in the treatment of IBD.In this view, prolyl hydroxylase domain (PHD) inhibitors are

increasingly being explored for therapeutic purposes (5–7). In-testinal epithelial cells (IECs) have a limited baseline oxygensupply, rendering them particularly susceptible to conditions as-sociated with increased hypoxia. Chronically inflamed intestinaltissue is generally deprived of oxygen due to increased metabolicdemands and vascular dysfunction. Under such conditions, IECsmay themselves become a source of proinflammatory cytokines(including TNF-a) that promote disruption of epithelial barrierfunction and contribute to the ongoing inflammation (8–11). Theintestinal epithelium however also has a built-in protection systemagainst low-oxygen conditions, tightly governed by PHD proteins(12).PHD proteins are ubiquitously expressed and control the tran-

scriptional activity of hypoxia-inducible factor-1 (HIF-1) by hy-droxylating the HIF-1a protein subunit when sufficient amountsof oxygen are present. This hydroxylation makes HIF-1a a targetfor ubiquitination and subsequent degradation by the proteasome.In hypoxic conditions, PHD proteins are inhibited, leading to agradual increase in HIF-1a protein levels and formation of theactive, heterodimeric transcription factor HIF-1. After transloca-tion to the nucleus of the enterocyte, HIF-1 not only induces thetranscription of numerous genes involved in cell metabolism but

*Department of Gastroenterology, †Department of Rheumatology, ‡Department ofPathology, and xDepartment for Biomedical Molecular Biology, Ghent University,Ghent; and {Department for Molecular Biomedical Research, Flanders Interuniver-sity Institute for Biotechnology, Zwijnaarde, Belgium

Received for publication July 28, 2010. Accepted for publication September 13,2010.

This work was supported by the concerted Grant GOA2001/12051501 of GhentUniversity, Belgium, and by Fonds voor Wetenschappelijk Onderzoek Grant A2/5-11716 of the National Fund for Scientific Research.

Address correspondence and reprint requests to Dr. Debby Laukens, Department ofGastroenterology, Ghent University Hospital, De Pintelaan 185, 3K12IE, B-9000Ghent, Belgium. E-mail address: debby.laukens@UGent.be

The online version of this article contains supplemental material.

Abbreviations used in this paper: ARE, AU-rich element; CD, Crohn’s disease;DMOG, dimethyloxalylglycin; FADD, Fas-associated death domain protein; HIF,hypoxia-inducible factor; HRE, hypoxia-responsive element; hFADD, human FADD;hGAPDH, human GAPDH; hHIF-1A, human HIF-a; hHPRT, human hypoxanthine-guanine phosphoribosyltransferase; hSDHA, human succinate dehydrogenase com-plex subunit A; hVEGF-A, human VEGF-A; IBD, inflammatory bowel disease; IEC,intestinal epithelial cell; LP, lamina propria; mFADD, mouse FADD; mHMBS,mouse hydroxymethylbilane synthase; mTNF, mouse TNF-a; PHD, prolyl hydroxy-lase domain; qRT-PCR, quantitative real-time PCR; SDHA, succinate dehydrogenasecomplex subunit A; siRNA, small interfering RNA; VEGF, vascular endothelialgrowth factor.

Copyright� 2010 by TheAmericanAssociation of Immunologists, Inc. 0022-1767/10/$16.00

www.jimmunol.org/cgi/doi/10.4049/jimmunol.1002541

by guest on May 6, 2016

http://ww

w.jim

munol.org/

Dow

nloaded from

also of genes implicated in the preservation of intestinal epithe-lial barrier integrity (13, 14).Increased HIF-1a protein levels have been described in patients

with active IBD (15). Data on the functional role of HIF-1a inintestinal inflammation are derived from animal studies. Protectiveeffects of PHD inhibitors and HIF-1a have been reported in chem-ically induced, acute colonic injury in mice (5, 6, 14). However,these models study acute colonic inflammation, whereas humanIBD is characterized by a chronic inflammatory process (16,17). The impact of PHD inhibition on chronic intestinal in-flammation is unknown. The present study addressed this issueby evaluating the application of the PHD inhibitor dimethylox-alylglycin (DMOG) in a murine model of TNF-a–driven chronicterminal ileitis that strikingly resembles human CD. This ledto the discovery of a previously unappreciated role of HIF-1 inthe modulation of TNF-mediated intestinal epithelial apoptosisthrough direct regulation of Fas-associated death domain (FADD)transcription during (inflammatory) hypoxia.

Materials and MethodsTNFDARE/+ mice as a model for ileal CD

C57BL/6 TNFDARE/+ mice were kindly provided by Dr. George Kollias(Alexander Fleming Biomedical Sciences Research Center, Vari, Greece).TNFDARE/+ mice have a targeted disruption of the TNF AU-rich element(ARE), which is important for TNF mRNA destabilization and trans-lational repression. As a consequence, these mice chronically overproduceTNF-a, which results in spontaneous development of Crohn’s-like in-testinal inflammation by Weeks 5–6 of age, exclusively located at theterminal ileum. Clinically, these mice are characterized by severely re-duced weight gain compared with that of healthy littermate controls.Histologically, terminal ileal lesions consist of mucosal abnormalities withintestinal villous blunting, broadening, and shortening as well as mucosaland submucosal infiltration of acute and chronic inflammatory cells (18).

All of the mice were treated according to institutional animal health careguidelines, following study approval by the Institutional Review Board atthe Faculty of Medicine and Health Sciences of Ghent University.

Isolation of primary IECs for ELISA/Western blot

For use in ELISA experiments, primary terminal ileal epithelial cells wereisolated as described previously (19). Commercially available kits wereused for HIF-1a and vascular endothelial growth factor (VEGF) proteinassessment (for HIF-1a, Human/Mouse Total HIF-1a DuoSet IC ELISA;for VEGF, Quantikine Mouse VEGF; both from R&D Systems, Minne-apolis, MN).

A Western blot for FADD was performed using a 1:500 rabbit anti-FADD polyclonal primary Ab (Novus Biologicals, Littleton, CO) and asecondary alkaline phosphatase-linked anti-rabbit Ab (Cell SignalingTechnology, Beverly, MA) at a 1:2000 dilution. Equal loading was verifiedby immunodetection of b-tubulin.

Treatment of TNFDARE/+ mice and assessment of intestinalepithelial permeability

Seven-week-old, PCR-confirmed C57BL/6J TNFDARE/+ mice (n = 6)were treated for 16 d with eight injections of DMOG (8 mg in 0.5 ml ste-rile, endotoxin-free PBS, i.p.) on alternating days, a treatment protocolpreviously shown to be effective in vivo (6). Corresponding littermateTNFDARE/+ controls (n = 6) underwent the same treatment regimen butreceived vehicle alone. Healthy littermate C57BL/6J TNF+/+ mice (n = 6)were used as a negative control. Weight evolution was monitored everyother day. At Day 16 of treatment, all of the mice were sacrificed forhistological evaluation.

In a separate experiment, 10 seven-week-old mice (four DMOG-treatedTNFDARE/+, four vehicle-treated TNFDARE/+, and two healthy control mice)were used to analyze epithelial permeability of the terminal ileum after4 d of either DMOG or vehicle treatment by using the previously describedEvans blue method (20). In short, mice were anesthetized, the abdomenwas opened, and a small polyethylene tube was inserted carefully andsecured into the ileum at 5 cm from the ileocecal junction. The terminalileum was flushed with saline and subsequently infused with Evan’s blue(1% in saline; Sigma-Aldrich, St. Louis, MO) for 5 min. To wash out dyesticking to the mucus, the lumen was perfused with 6 mM acetylcysteine

(Sigma-Aldrich) for 5 min. After a final flush with saline, animals weresacrificed by cervical dislocation. Next, the terminal 1.5 cm of theileum was removed and placed in 5 ml N,N-dimethylformamide (Sigma-Aldrich). After overnight extraction, the dye concentration was measuredby spectrophotometry at a wavelength of 570 nm.

Histological assessment of intestinal inflammation

H&E-stained slides of 5 mm terminal ileal sections were blindly scoredby two observers. At least 10 fields of view were evaluated per mouse,using the following scoring system: A) villous damage: 0, normal villi; 1,blunted villi (drumstick appearance); 2, shortening of villi; and 3, completedestruction of villi; and B) inflammatory cell infiltration: 0, no increase ofinflammatory cells in LP; 1, mild increase of inflammatory cells in LP;2, moderate increase of inflammatory cells in LP; 3, strong increase ofinflammatory cells in LP; 4, mild increase of inflammatory cells in thesubmucosa; 5, moderate increase of inflammatory cells in the submucosa;and 6, strong increase of inflammatory cells in the submucosa. Total in-flammation score was calculated as the sum of A and B.

HIF-1a and FADD small interfering RNA

HT29 cells (human colon carcinoma epithelial cell line, HTB-38; AmericanType Culture Collection, Manassas, VA) were seeded at 150,000 cells perwell in a 24-well plate and transfected the next day either with small in-terfering RNA (siRNA) duplexes targeting human HIF-1a or FADD or withcontrol siRNA (Biolegio, Nijmegen, The Netherlands), using 5 ml lipofect-amine (Invitrogen, Carlsbad, CA) in 500 ml RPMI 1640 medium (21, 22).

In vitro apoptosis assay

HT29 cells were seeded in 6-well plates, each well containing 2.53 106 cells.After transfection with control or HIF-1a siRNA, cells were pretreated for24 h with the HIF-1a activator DMOG (1 mM; Echelon Biosciences, SaltLake City, UT) or vehicle alone (PBS) in culture medium (DMEM).

After pretreatment, medium was washed away and cells were incubatedwith human rTNF-a (100 mg/l; R&D Systems) and human IFN-g (100 U/ml; Invitrogen) to induce apoptosis. After 24 h, cells were harvested andapoptosis was quantified by measuring caspase-3 activity, using a highlysensitive caspase-3 assay (Genscript, Piscataway, NJ).

In vivo TNF-a–induced acute intestinal epithelial apoptosis

Four 7-wk-old healthy C57BL/6J mice were pretreated for 4 d and receivedtwo injections of DMOG (8 mg in 0.5 ml sterile, endotoxin-free PBS, i.p.)on alternating days. Littermate controls (n = 4) received vehicle alone.

After pretreatment, a single i.v. injection of murine rTNF-a (10 mg in200 ml saline; BioLegend, San Diego, CA) was administered to induceacute enteropathy, characterized by massive apoptosis of the enterocytes,as previously reported (23–25). Control animals (n = 2) received i.v. salinewithout TNF-a.

Mice were sacrificed 1 h after injection of TNF-a. Terminal ilealapoptosis was visualized by TUNEL, according to the manual instructionsof a commercial apoptosis detection kit (Genscript). Computerized semi-quantitative analysis of the TUNEL-stained sections was performed usingan Optronics Color digital camera (Olympus, Tokyo, Japan) and special-ized software (cell D; Olympus Imaging Solutions, Munster, Germany).

RNA extraction and quantitative real-time PCR

Total RNAwas extracted from HT29 cells (in vitro experiments), terminalileal specimens (mouse experiments), and human terminal ileal mucosalsamples using the RNeasy Mini Kit (Westburg, Leusden, The Netherlands)and converted to cDNA for real-time quantification.

All of the reactions were run in duplicate and normalized to stablyexpressed reference genes. Primer sequences are given in Table I. All of thehuman participants in this study gave their written informed consent.Patient characteristics are given in Table II.

HIF-1a and FADD immunohistochemistry

Immunohistochemistry for HIF-1a was performed on murine paraffin-embedded terminal ileal specimens. Immunohistochemistry for FADDwas performed on terminal ileal biopsy specimens of the above charac-terized patients (Table II). All of the sections were pretreated with citrateand blocked for endogenous peroxidase activity with 3% H2O2 in PBS.The primary Abs (for HIF-1a, 1:100 mouse HIF-1a clone H1a67; EMDChemicals, Gibbstown, NJ; for FADD, 1:200 rabbit anti-FADD clone Ser191;Abnova; Taipei City, Taiwan) were applied for 60 min. A peroxidase-basedvisualization kit was used according to the manufacturer’s protocol (linkedstreptavidin-biotin immunoperoxidase kit; DakoCytomation, Carpinteria,

The Journal of Immunology 6307

by guest on May 6, 2016

http://ww

w.jim

munol.org/

Dow

nloaded from

CA), followed by the application of 3,39-diaminobenzidine (DakoCyto-mation) for 2 min. Counterstaining was performed with hematoxylin.

HIF-1a transcription factor binding assay

Potential HIF-1a binding sites in the promoter region of FADD wereidentified by consulting the TRANSFAC database (Table III). SpecificRNA oligonucleotides for each of the putative binding sites were syn-thesized (Biolegio) and used in a HIF-1a EZ-TFA Transcription FactorAssay (Millipore, Billerica, MA), according to the manufacturer’s manual.Input DNA from DMOG-treated HT29 cells was used in the assay.

Chromatin immunoprecipitation assay

HT29 cells were placed in a hypoxic chamber (∼1% oxygen) for 24 h. Afterisolation, sheared chromatin was incubated with an anti–HIF-1a Ab (1:500rabbit polyclonal anti–HIF-1a; Millipore) or with an isotype (IgG) ir-relevant Ab. Immune complexes were precipitated, and HIF-1a bindingto the promoter of FADD was quantified by quantitative real-time PCR(qRT-PCR) (primers: sense, 59-GCACACACAAGATGTCTCCAGGGG-39; antisense, 59-ACGTCACGTGCCCTCACATCT-39), which amplified a111-bp region spanning the putative HIF-1 binding site.

Luciferase reporter assay

Genomic PCR fragments of 300 bp of the promoter region of FADD,starting at base 21 to 2155 upstream from the initiation codon and sur-rounding the putative binding site 2531, were cloned between the SacIand XhoI sites of the PGL3Enhancer and PGL3Control reporter vectors(Promega, Madison, WI). Deletion of the 17-bp predicted binding site inthese constructs was obtained by PCR. As a control for response to hyp-oxia, two tandem repeats of a known HIF-1 enhancer sequence from the 39region of the erythropoietin gene were cloned into the PGL3Enhancervector (26, 27). Construct sequences were verified by direct sequencing.The b-galactosidase-expressing pUT651 vector (Eurogentec, Seraing, Bel-gium) was used for normalizing transfection.

HEK293T cells (CRL-1573; American Type Culture Collection) wereseeded in 24-well plates at 150,000 cells per well the day before trans-fection. Cells were cotransfected with 100 ng pUT651 and 100 ng of thePGL3 constructs in 6-fold, using Metafectene Pro (Biontex Laboratories,Martinsried, Germany). Eighteen hours posttransfection, cells were exposedto normoxia or hypoxia (∼1% oxygen) for 24 h, after which they werelysed and analyzed for luciferase activity in a TopCount luminescencecounter (Packard Instrument, Meriden, CT). Luciferase activities werecorrected for b-galactosidase activity.

Statistical analysis

Statistical analyses were performed using SPSS, version 16.0, for Windows(SPSS, Chicago, IL). Continuous data are expressed as mean 6 SEM, andcategorical data as mean 6 range. Groups were compared by using theMann-Whitney U test. Weight evolution data of TNFDARE/+ mice in dif-ferent treatment groups were compared by ANOVA for repeated meas-urements. The p values ,0.05 were considered significant.

ResultsDMOG treatment stabilizes functionally active intestinalepithelial HIF-1a proteins in vitro and in vivo

Prior to our experiments, we confirmed that DMOG treatmentresulted in a stable increase of functionally active intestinal epi-thelial HIF-1a proteins in vitro and, at the terminal ileum, in vivo.In vitro, low basal HIF-1a protein levels were detected in HT29cells (ELISA). A treatment for 24 h with DMOG resulted in a 7.5-fold increase of HIF-1a protein levels (PBS versus 1 mM DMOG,p , 0.001). Similar results were obtained with cells exposedto hypoxia (1% oxygen) for the same time period (PBS versus 1%oxygen, p , 0.001; DMOG versus 1% oxygen, NS; Fig. 1A).In vivo, 4 d of treatment with DMOG (8 mg in PBS, i.p.) resultedin a 3-fold increase of HIF-1a protein levels in freshly isolatedterminal ileal enterocytes (PBS versus DMOG, p , 0.01; Fig.1B). Immunohistochemistry on terminal ileal sections showedthat DMOG treatment stabilized HIF-1a mainly in the IECs (Fig.1E).To confirm functional activity for the DMOG-induced HIF-1a

proteins, qRT-PCR (in vitro) and ELISA (in vivo) assays were per-formed using VEGF as positive control, because its gene is typi-cally HIF-1a–induced.In vitro, DMOG treatment resulted in a 6-fold increase of in-

testinal epithelial VEGF transcripts (PBS versus DMOG, p ,0.001). A total of 1% oxygen induced VEGF transcription in asimilar manner (PBS versus 1% oxygen, p , 0.001; DMOG ver-sus 1% oxygen, NS; Fig. 1C).

Table I. Sequence of used qRT-PCR primers

Gene Symbol Forward Primers (59–39) Reverse Primers (59–39)

hSDHA TGGGAACAAGAGGGCATCTG CCACCACTGCATCAAATTCATGhGAPDH TGCACCACCAACTGCTTAC GGCATGGACTGTGGTCATGAGhHPRT TGACACTGGCAAAACAATGCA GGTCCTTTTCACCAGCAAGCThVEGF-A TCCTCACACCATTGAAACCA GATCCTGCCCTGTCTCTCTGhFADD TATTAATGCCTCTCCCGCAC CTGGACACGGTTCCAACTTThHIF-1 TGCCAGCTCAAAAGAAAACA ACCAACAGGGTAGGCAGAACmHMBS AAGGGCTTTTCTGAGGCACC AGTTGCCCATCTTTCATCACTGmTNF CATCTTCTCAAAATTCGAGTGACAA TGGGAGTAGACAAGGTACAACCCmFADD TGTTCTCCCCAAACACACAA CTGATGGGAGGGATTTCTGA

hFADD, human FADD; hGAPDH, human GAPDH; hHIF-1A, human HIF-a; mHMBS, mouse hydroxymethylbilane syn-thase; hHPRT, human hypoxanthine-guanine phosphoribosyltransferase; hSDHA, human succinate dehydrogenase complexsubunit A; hVEGF-A, human VEGF-A; mFADD, mouse FADD; mTNF, mouse TNF-a.

Table II. Characteristics of patients from whom terminal ileal biopsies were obtained for analysis of FADD transcription

Group N Mean Age Medication at Moment of Biopsy

Healthy controls 16 51 (27–69) NoneCD patients, history of ileal involvement 12 37 (24–57) 6 (50%) no medication

2 (17%) immunomodulating drugs1 (8%) immunomodulating drugs + corticosteroids

1 (8%) corticosteroids2 (17%) aminosalicylates

CD patients, never had ileal involvement 6 44 (15–64) 3 (50%) no medication2 (33%) immunomodulating drugs

1 (17%) aminosalicylates

All of the patients had an endoscopically normal appearing ileum.

6308 HYDROXYLASE INHIBITION ABROGATES TNF-a–INDUCED INTESTINAL DAMAGE

by guest on May 6, 2016

http://ww

w.jim

munol.org/

Dow

nloaded from

In vivo, 4 d of DMOG treatment doubled VEGF protein levelsin terminal ileal enterocytes (vehicle versus DMOG, p , 0.05;Fig. 1D).

DMOG treatment abrogates chronic intestinal inflammation inTNFDARE/+ mice

Given the highly protective effects of DMOG in chemically in-duced models of acute colitis, we investigated the application ofthis molecule in the setting of chronic gut inflammation, using theTNFDARE/+ mouse model of ileal CD (18).We initiated treatment in the TNFDARE/+ mice when they were 7

wk of age. At that time point, TNFDARE/+ mice had a significantlylower weight as compared with that of their healthy littermatesand were expected to have clear histological signs of terminalileitis (Supplemental Fig. 1). Starting from Day 4 of treatment,TNFDARE/+ mice showed a clinical benefit from DMOG treatment,

represented by significantly improved weight gain compared withthat of littermate, vehicle-treated TNFDARE/+ mice (p , 0.01; datanot shown).After 16 d of treatment, TNFDARE/+ mice were sacrificed for

evaluation. The treatment efficiency was ensured by finding in-creased HIF-1a protein levels in terminal ileal scrapings ofDMOG-treated TNFDARE/+ mice as compared with those ofplacebo-treated TNFDARE/+ littermates (Fig. 2A). Histologically,the total inflammation score was significantly lower in theDMOG-treated group (p , 0.05) (Fig. 2C), with in-depth analysisshowing that DMOG treatment mainly prevented villous alter-ations (p , 0.01; Fig. 2D, 2F). In fact, all of the vehicle-treatedmice displayed severe destruction of villous architecture, whereasin five of six DMOG-treated corresponding littermates villi werecompletely preserved. The effect of DMOG treatment on mucosalinflammatory cell infiltration was mild (Fig. 2E).

FIGURE 1. DMOG treatment stabilizes functionally active intestinal epithelial HIF-1a proteins in vitro and in vivo. Low basal HIF-1a protein levels are

detectable by ELISA in IECs under normoxic conditions. A, An exposure for 24 h to DMOG (1 mM in DMEM) or 1% oxygen strongly augmented HIF-1a

protein levels in HT29 cells in vitro. B, In vivo, 4 d of DMOG treatment (8 mg in 0.5 ml sterile PBS, i.p., every other day) resulted in stably enhanced HIF-

1a protein levels in freshly isolated terminal ileal enterocytes. C, In vitro, DMOG and 1% oxygen strongly induced transcription of VEGF. D, In vivo,

DMOG treatment resulted in a 2-fold increase of VEGF protein in terminal ileal enterocytes. Each condition of in vitro experiments was tested 6-fold.

In vivo results are of a single experiment with n = 3–5 mice per group. E, Immunohistochemistry for HIF-1a on terminal ileal sections (original mag-

nification3200) showed that DMOG stabilized HIF-1a protein mainly in the IECs. Transcriptional activity of DMOG-induced HIF-1a protein was verified

by qRT-PCR (in vitro) and ELISA (in vivo) for VEGF, because its gene is typically HIF-1a–induced. pp , 0.05; ppp , 0.01; pppp , 0.001.

The Journal of Immunology 6309

by guest on May 6, 2016

http://ww

w.jim

munol.org/

Dow

nloaded from

At the cytokine level, terminal ileal TNF-a transcription wasdecreased significantly in DMOG-treated versus vehicle-treatedTNFDARE/+ mice (p , 0.01; Fig. 2B).

DMOG treatment rapidly restores intestinal barrier function inTNFDARE/+ mice

Because DMOG-treated TNFDARE/+ mice showed an increase inweight gain starting from Day 4 of DMOG treatment, additional

experiments focused on that specific time frame. Taking intoaccount that DMOG has been shown previously to have barrier-protective effects in the gut (6), the terminal ileal epithelialbarrier function of TNFDARE/+ mice was compared with that ofhealthy controls after 4 d of treatment with either DMOG or ve-hicle alone.Intestinal epithelial permeability (Fig. 3) was scored per cen-

timeter of terminal ileum (spectrophotometry after Evans blue

FIGURE 3. DMOG rapidly restores intestinal epi-

thelial barrier function in TNFDARE/+ mice. Terminal

ileal inflammation in TNFDARE/+ mice was associated

with dramatically increased epithelial permeability, as

detected with Evans blue. Four days of DMOG treat-

ment (8 mg in 0.5 ml sterile PBS, i.p., every other day)

restored terminal ileal barrier integrity to almost nor-

mal levels. Results are representative of two indepen-

dent experiments with n = 3–5 mice per group. pp ,0.05; ppp , 0.01; pppp , 0.001.

FIGURE 2. DMOG abrogates chronic inflammatory villous architectural alterations in TNFDARE/+ mice. Seven-week-old TNFDARE/+ mice were treated

with DMOG (8 mg in 0.5 ml sterile PBS, i.p., every other day) or vehicle alone for 16 d. A, Treatment efficacy was confirmed by detection of highly

increased HIF-1a protein levels in terminal ileal lysates of DMOG-treated versus vehicle-treated TNFDARE/+ mice at the end of treatment (Day 16). B,

Terminal ileal TNF-amRNA levels were reduced significantly in DMOG- versus vehicle-treated TNFDARE/+ mice. C–E, The total histological inflammation

score (C), subdivided into villous damage (D) and inflammatory (E) scores, was significantly lower in DMOG- versus vehicle-treated TNFDARE/+ mice. The

total inflammation score of healthy controls (wild-type mice) was zero. F, Representative histological images (H&E, original magnification 3200) show

severe villous architectural destruction in vehicle-treated TNFDARE/+ mice, whereas villi of DMOG-treated littermates were preserved nicely. Results are

representative of two independent experiments with n = 6 mice per group. pp , 0.05; ppp , 0.01; pppp , 0.001. WT, wild-type.

6310 HYDROXYLASE INHIBITION ABROGATES TNF-a–INDUCED INTESTINAL DAMAGE

by guest on May 6, 2016

http://ww

w.jim

munol.org/

Dow

nloaded from

staining). As expected, TNFDARE/+ mice showed markedly in-creased terminal ileal epithelial permeability compared with thatof their corresponding healthy littermates (vehicle TNFDARE/+

versus TNF+/+, p , 0.05). Only 4 d of DMOG treatment wassufficient to restore this barrier dysfunction to near-normal levels(DMOG TNFDARE/+ versus vehicle TNFDARE/+, p , 0.01, andDMOG TNFDARE/+ versus TNF+/+, NS).

Pretreatment with DMOG protects the intestinal epitheliumagainst TNF-a–induced apoptosis in vitro and in vivo

Enhanced intestinal epithelial apoptosis largely contributes to theimpaired intestinal barrier reported in IBD (28). Because DMOGtreatment rapidly restored barrier function in TNFDARE/+ mice,a subsequent experiment evaluated whether pretreatment withDMOG could protect IECs from TNF-a–induced apoptosis.In vitro, HT29 cells that were pretreated with DMOG (1 mM for

24 h) showed a 35–40% reduction in TNF-a–induced caspase-3activation (DMOG versus vehicle, p , 0.01; Fig. 4B). To investi-

gate the role of HIF-1a in this antiapoptotic action of DMOG,we transfected HT29 cells with siRNA against HIF-1a, whichrepressed HIF-1a transcripts 4-fold (p , 0.001; data not shown).After 24 h of DMOG treatment, HIF-1a protein levels werethree times lower in HIF-1a siRNA-transfected cells comparedwith those of control siRNA-transfected cells (p , 0.001; Fig.4A). This knockdown of HIF-1a was associated with increasedsusceptibility to TNF-a–induced apoptosis (Fig. 4B), confirminga significant role for HIF-1a in the antiapoptotic properties ofDMOG.To verify the in vivo relevance of these findings, wild-type

C57BL/6J littermates were injected (i.v.) with 10 mg rTNF-a af-ter 4 d of treatment with either DMOG or vehicle alone. One hourafter injection, massive detachment of TUNEL-positive apoptoticenterocytes was seen in vehicle-treated mice, accompanied byvillous deformation as described previously (23–25). In contrast,DMOG-treated mice were strongly protected from TNF-a–induced enterocyte apoptosis and showed general preservation ofthe villi (Fig. 4C).

FIGURE 4. DMOG protects IECs against TNF-a–induced apoptosis in an HIF-1a–dependent manner. A, B, DMOG pretreatment (1 mM in DMEM for

24 h) prevented intestinal epithelial cells against TNF-a–induced apoptosis in vitro. Transfection of HT29 cells with HIF-1a-siRNA prior to DMOG

treatment resulted in highly reduced HIF-1a protein stabilization (A) and significantly diminished protective effects of DMOG on TNF-a–induced IEC

apoptosis (B). C, Four days of pretreatment with DMOG (8 mg in 0.5 ml sterile PBS, i.p., every other day) protected C57BL/6J mice against TNF-a–

induced apoptosis in vivo. As such, DMOG-pretreated mice did not show the characteristic villous deformation due to the massive shedding of apoptotic

enterocytes seen in vehicle-treated littermates after a single i.v. injection with rTNF-a (10 mg in 200 ml saline). Representative pictures of the TUNEL-

stained section of the terminal ileum (original magnification 3200, detail magnification 3400) are given. Apoptotic cells have brown-stained nuclei (black

arrows). Each condition of in vitro experiments was tested at least three times. In vivo results are of a single experiment with n = 3–5 mice per group. pp ,0.05; ppp , 0.01; pppp , 0.001.

The Journal of Immunology 6311

by guest on May 6, 2016

http://ww

w.jim

munol.org/

Dow

nloaded from

DMOG reduces intestinal epithelial FADD both in vitro andin vivo in a HIF-1a–dependent manner

Transcriptional studies were performed to address the question ofhow pretreatment with DMOG could prevent subsequent TNF-a–induced damage in IECs. Because TNF-a induces apoptosis viaTNFR-1, we focused on critical proteins involved in this pathway.FADD was investigated as one of the potential targets of

DMOG, due to its pivotal role in TNF-mediated apoptosis (29, 30).Interestingly, a 24-h exposure to 1 mM DMOG or 1% oxygen wereboth found to reduce FADD levels 2.5- to 3-fold in vitro. (comparedwith PBS, p , 0.001 both for DMOG and 1% oxygen; Fig. 5A).Because the above results suggested a potential role for HIF-1a

in transcriptional repression of FADD, subsequent experimentswere directed to this hypothesis.First, the effect of siRNA-induced HIF-1a knockdown on the

transcriptional activity of FADD was assessed. DMOG-inducedFADD inhibition was diminished significantly (HIF-1a siRNAversus control siRNA; p = 0.01), confirming that DMOG-inducedinhibition of FADD is HIF-1a–dependent (Fig. 5B).As a next step, FADD protein levels were analyzed in vivo by

Western blot of terminal ileal mucosal scrapings from healthyC57BL/6J mice after 4 d of DMOG or vehicle treatment. FADDwas detectable in all of the vehicle-treated mice (n = 3) but not inDMOG-treated littermates (n = 5; Fig. 5C).To investigate the functional relevance of this finding, TNF-a–

induced apoptosis was compared between cells transfected with ei-ther FADD siRNA or control siRNA. FADD siRNA repressed FADDin a way similar to DMOG (Fig. 5D, 5E) and significantly protectedIECs against subsequent TNF-a–induced apoptosis (Fig. 5F).In conclusion, DMOG treatment reduced intestinal epithelial

FADD both in vitro and in vivo, rendering the enterocytes lesssusceptible to TNF-a–induced apoptosis.

The promoter of FADD contains a functional binding site forHIF-1a

It has been appreciated recently that HIF-1 is able to both in-duce and repress transcription by binding on hypoxia-responsiveelements (HREs) in the promoter of the target gene (10, 31, 32).In a subsequent experiment, we questioned whether HIF-1a was

able to regulate FADD transcription in a direct way. A search fortranscription factor binding sites using the TRANSFAC databaserevealed three putative binding sites for HIF-1a, located down-stream at 2740, 2531, and 2468 relative to the ATG initia-tion codon (Table III). All three candidate oligonucleotides werescreened for HIF-1a binding activity, using a commercially avail-able transcription factor binding assay. One of the three bind-ing sites (at 2531; Fig. 6A) was shown to bind HIF-1a. To en-sure that HIF-1a bound the capture probe in a sequence-specificmanner, competition experiments were performed by adding in-creasing amounts of an identical, unlabeled competitor oligonu-cleotide to the biotin-labeled capture probe. The competitor oli-gonucleotide dose-dependently diminished the signal intensity ofthe biotin-labeled capture probe, thereby confirming sequencebinding specificity (Fig. 6B).Effective binding of HIF-1a to the endogeneous FADD pro-

moter was confirmed by chromatin immunoprecipitation (Fig. 6C).To analyze the functional relevance of the 2531 HIF-1a bind-

ing site, two plasmids were constructed (PGL3Control-531 andPGL3Enhancer-531) containing part of the FADD promoter se-quence that surrounded the confirmed HIF-1a binding site. Whereasluciferase activity was increased significantly during hypoxia in cellstransfected with an established erythropoietin–HRE construct (foldincrease of 2.82 6 0.34; p , 0.01 as compared with that of emptyvector), a significant decrease of luciferase activity was seen in cellstransfected with the FADD promoter constructs (fold increase of

FIGURE 5. DMOG represses intestinal epithelial FADD, which renders IECs less susceptible to TNF-a-mediated apoptosis. A, Transcription of FADD

was reduced 2.5- to 3-fold in HT29 IECs by a 24-h exposure to DMOG (1 mM in DMEM) or 1% oxygen. B, Reduction of HIF-1a protein by transfecting

HT29 cells with HIF-1a siRNA prior to DMOG treatment resulted in significantly increased FADD transcription, confirming a significant role for HIF-1a

in FADD inhibition. C, In vivo, a Western blot revealed strongly reduced FADD protein levels in the terminal ileal mucosa of C57BL/6J mice after 4 d of

DMOG treatment (8 mg in 0.5 ml sterile PBS, i.p., every other day). D, FADD siRNA was used to check the functional consequences of FADD down-

regulation on TNF-a-mediated apoptosis. E, siRNA repressed FADD 2.5- to 3-fold (similar to DMOG) in HT29 cells, resulting in undetectable protein

levels by Western blot. F, FADD repression protected IECs against TNF-a-mediated apoptosis. Each condition of in vitro experiments was tested six times.

In vivo results are representative of two independent experiments with n = 3–5 mice per group. pp , 0.05; ppp , 0.01; pppp , 0.001.

6312 HYDROXYLASE INHIBITION ABROGATES TNF-a–INDUCED INTESTINAL DAMAGE

by guest on May 6, 2016

http://ww

w.jim

munol.org/

Dow

nloaded from

0.436 0.09; p, 0.001 as compared with that of empty vector) (Fig.

6D). In addition, deletion of the core nucleotides in the HIF-1a

binding sequence resulted in the loss of hypoxia-induced luciferase

repression (Fig. 6E).

Evidence for a role for FADD in ileal CD

Because TNFDARE/+ mice are representative of ileal CD, westudied the expression of FADD in the terminal ileum of patientswith CD (n = 18) versus that in healthy controls (n = 16). To

Table III. Putative binding sites for HIF-1a in the promoter region of FADD

Position Sequence (59–39) OrientationSimilarityScore Matrix Similarity

2740 GGTCCCCGCGTGCCCGG 2 1 0.9342531 GGGACAAACGTGGAAAA 2 1 0.9642468 AGCCCGAACGTCACGTG 2 1 0.914

The number of hits for HIF-1a in a 1000-bp region upstream of the initiation codon found by MatInspector (Genomatix,TRANSFAC PRO 8.4, Ann Arbor, MI) using a core matrix match of 100% and a matrix match of 75% relative to the ATGinitiation codon.

FIGURE 6. HIF-1a directly regulates promoter activity of FADD. Three putative HIF-1a binding sites were found in the FADD promoter by consulting

the TRANSFAC database. A, A transcription factor binding assay revealed only one effective binding site (FADD-531), with equal binding capacity as

compared with an established HRE. B, Addition of increasing amounts of the same but unlabeled binding site oligonucleotide sequence decreased signal

detection of HIF-1a binding in a dose-dependent way, confirming binding specificity to FADD-531. C, Binding of HIF-1a to the endogenous promoter of

FADD was verified with chromatin immunoprecipitation, coupled to detection by qRT-PCR. Results are given as a percentage of the input DNA (from

hypoxic HT29 cells) that is immunoprecipitated by beads with anti–HIF-1a and by beads with an isotype irrelevant Ab. D, Luciferase assay results showing

increased luciferase activity during hypoxia in cells transfected with a plasmid containing a known HRE sequence of the erythropoietin gene. On the

contrary, cells transfected with a plasmid containing the newly defined HRE sequence in the FADD promoter (FADD-531) showed repressed luciferase

activity during hypoxia. E, Site-specific deletion of the HIF-1a binding site in FADD-531 resulted in loss of luciferase repression during hypoxia. All of the

tests in Fig. 5 were repeated twice in independent experiments, and all of the conditions were tested six times for each experiment. pp , 0.05; ppp , 0.01;

pppp , 0.001.

The Journal of Immunology 6313

by guest on May 6, 2016

http://ww

w.jim

munol.org/

Dow

nloaded from

exclude an effect of inflammation on FADD expression, we usedbiopsy specimens of endoscopically normal appearing terminalileum. Terminal ileal FADD transcription was enhanced signifi-cantly in CD patients with inactive disease compared with that ofhealthy controls (p, 0.01; Fig. 7A). Interestingly, this finding wasonly made in patients with a history of ileal CD. CD patients thathad never had ileal involvement did not have increased FADDlevels compared with those of healthy controls (Fig. 7B). Thesame findings were made at the protein level using immunohis-tochemistry for FADD. Expression of FADD was mainly seen inthe gut epithelium and, to a lesser extent, in inflammatory cells.Increased FADD protein was detected in CD patients with a his-tory of ileal inflammation compared with that of healthy controls,despite the absence of inflammation (representative images aregiven in Fig. 7).

DiscussionIn this study, we demonstrate a beneficial effect of the prolylhydroxylase inhibitor DMOG on chronic intestinal inflammation.

We found that DMOG treatment led to very fast abrogation ofbarrier dysfunction and chronic villous architectural changes inTNFDARE/+ mice, a model of TNF-a–driven chronic ileitis thatstrikingly resembles human CD.The timeframe in which DMOG treatment was able to achieve

restoration of the intestinal epithelial barrier suggested an in-terference with processes that can rapidly influence barrier func-tion, such as IEC apoptosis. IEC apoptosis is known to be a majorfactor in TNF-a–induced barrier disruption and seems to be themost important structural correlate of barrier dysfunction in hu-man CD (28, 33–35). We could confirm the strong protective ef-fect of DMOG on TNF-a–induced IEC apoptosis both in vitro andin vivo. DMOG-pretreated HT29 cells showed a significant re-duction in TNF-a–induced caspase-3 activation, and this effectwas largely dependent on HIF-1a. To demonstrate the antiapo-ptotic action of DMOG on IECs in vivo, we used a murine modelof acute enteropathy induced by i.v. administration of a high doseof rTNF-a. DMOG pretreatment highly protected mice against themassive apoptosis and detachment of IECs induced by TNF-a,

FIGURE 7. CD Patients with a normal appearing terminal ileum have increased FADD mRNA levels compared with those of healthy controls. A, Biopsy

specimens of normal appearing terminal ileum of patients with CD and healthy controls were analyzed for mucosal FADD expression. Terminal ileal FADD

transcription was enhanced significantly in CD patients versus healthy controls. B, Subanalysis showed that this finding was only true for patients with a

history of ileal CD and not for CD patients that had never had ileal involvement. The qRT-PCR results were confirmed at the protein level by immunohis-

tochemistry. Representative images (FADD, original magnification 3100, detail magnification 3200) are given. pp , 0.05; ppp , 0.01; pppp , 0.001.

6314 HYDROXYLASE INHIBITION ABROGATES TNF-a–INDUCED INTESTINAL DAMAGE

by guest on May 6, 2016

http://ww

w.jim

munol.org/

Dow

nloaded from

thereby preventing the associated blunting and shortening ofthe intestinal villi. Interestingly, these findings correlated withthe abolishment of the villous architectural changes by DMOGtreatment in TNFDARE/+ mice. In line with our results, Marini et al.(33) found that the prevention of IEC apoptosis by anti–TNF-aAbs resulted in the restoration of the disturbed villous architecturein SAMP1/YitFc mice (another murine model that closely re-sembles CD).Strong efforts were made to clarify the mechanism underlying

the protective effects of DMOG on TNF-a–induced IEC apopto-sis. TNF-a elicits its proapoptotic effect through TNFR-1 (29).Because no changes in mucosal TNFR1 levels were detected afterDMOG treatment (data not shown), we focused on critical mol-ecules downstream to the receptor, one of them being FADD. TheFADD gene is highly conserved across all species and encodes anessential adaptor molecule of several death receptors, includingTNFR-1 (30, 36, 37). After binding of TNF, TNFR-1 is activatedand binds to the TNFR-associated death domain, which in turnrecruits several proteins to the activated receptor such as TRAF2,RIP1, and IAPs, forming complex I, which is involved in NF-kBand MAPK activation. After internalization of the TNFR1 re-ceptor, a secondary cytosolic complex II is formed involving therecruitment of the FADD adaptor protein and the proximity-induced activation of caspase-8, leading to proteolytic activationof the downstream executioner caspase-3 and caspase-7 (38). Wefound that DMOG treatment led to a .60% reduction of FADDtranscription in IECs. Moreover, we were able to find a functionalrepressive binding site for HIF-1a in the FADD promoter. Assuch, our findings revealed an innate mechanism that protectsIECs during (inflammatory) hypoxia by direct modulation of deathreceptor signaling.Because FADD is a common adaptor of several death receptor

systems, DMOG (pre)treatment is expected to reduce intestinalepithelial Fas- and TRAIL-activated IEC apoptosis as well (30, 39).For TRAIL-induced apoptosis, this already has been demonstratedin vitro (6).Interestingly, the activity of all members of the death receptor

family has been correlated positively with disease activity in IBD(40–42). The precise role of FADD in CD is unknown yet but, inour opinion, warrants further research. Our data show that in-creased FADD transcription is present in endoscopically normalappearing terminal ileum of IBD patients compared with that ofhealthy controls. Moreover, the human FADD gene is positionedat chromosome 11q13.3, in proximity to a previously establishedlocus for CD (43).It has been appreciated recently that HIF-1a is able to both

induce and repress genes, although the exact mechanism by whichHIF-1 leads to transcriptional repression remains to be estab-lished. Functional repressive HIF-1a binding sites have beenfound previously in the promoters of the equilibrative nucleosidetransporter 2 gene (10), the cystic fibrosis transmembraneconductance regulator gene (31), and the peroxisome proliferator-activated receptor a gene (32). In line with our results, a down-regulation of FADD under hypoxia in human prostate cancer cellswas found using microarray analysis, strengthening the conceptthat FADD is a hypoxia-responsive gene (44).Even though our data clearly demonstrate the importance of

HIF-1a–induced FADD repression in the protective action ofDMOG against intestinal epithelial damage, a contribution ofother HIF-1a–dependent and/or independent processes cannot beexcluded. HIF-1a is a transcription factor of numerous genes,including several genes involved in intestinal epithelial barrierfunction (e.g., intestinal trefoil peptide and mucin) and genes in-volved in dampening of inflammation (e.g., netrin-1) (13, 45, 46).

In addition, DMOG also has been shown to augment NF-kB ac-tivity, which has important interactions with HIF-1a and protectsIECs against apoptosis as well (6, 47).Prolyl hydroxylase inhibitors like DMOG seem to be a prom-

ising alternative treatment not only for IBD. Beneficial effects ofHIF-stabilizing therapy have been found for a wide variety ofischemic disorders, such as myocardial and cerebral infarction orchronic kidney failure (48–50). An important focus of future re-search will be to specify the therapeutic targets of nonspecific pan-PHD inhibitors like DMOG to develop more specific, targeteddrugs. In this light, Tambuwala et al. (51) have found recently thatthe protective action of PHD inhibition in experimental colitis isrestricted to inhibition of the PHD1 isoform.Future studies also should address the potential oncogenic con-

sequences for pharmacological HIF-1a stabilization. HIF-1a isoverexpressed in many malignancies and has been associated withtumor aggressiveness and a poor prognosis (52). Moreover, be-cause of its suppressive effects on HIF-1a, YC-1 is being de-veloped currently for clinical use as an anticancer drug (21, 53).However, the role of HIF inhibitors as a potential treatment formalignancies has been requestioned recently. Mazzone and co-workers (54) found that upregulation of HIF activity in PHD2haplodeficient mice in fact diminished tumor aggressiveness andinhibited metastasis by improving oxygenation through endothe-lial normalization.In conclusion, we showed that DMOG treatment has positive

effects in TNF-a–driven Crohn’s-like chronic ileal inflammationand propose downregulation of TNF-a–induced IEC apoptosis byHIF-1a–dependent FADD repression as at least a contributingmechanism. The direct modulation of death receptor signaling byHIF-1 represents a previously unappreciated endogenous adaptivepathway in response to hypoxia that may guide the developmentof novel therapeutics in hypoxic chronic inflammatory diseases,including IBD.

AcknowledgmentsWe thank Dr. George Kollias (Alexander Fleming Biomedical Sciences

Research Center, Vari, Greece) for kindly providing the TNFDARE/+ mice.

DisclosuresThe authors have no financial conflicts of interest.

References1. Schmitz, H., M. Fromm, C. J. Bentzel, P. Scholz, K. Detjen, J. Mankertz,

H. Bode, H. J. Epple, E. O. Riecken, and J. D. Schulzke. 1999. Tumor necrosisfactor-alpha (TNFalpha) regulates the epithelial barrier in the humanintestinal cell line HT-29/B6. J. Cell Sci. 112: 137–146.

2. Schulzke, J. D., C. Bojarski, S. Zeissig, F. Heller, A. H. Gitter, and M. Fromm.2006. Disrupted barrier function through epithelial cell apoptosis. Ann. N. Y.Acad. Sci. 1072: 288–299.

3. Irvine, E. J., and J. K. Marshall. 2000. Increased intestinal permeability precedesthe onset of Crohn’s disease in a subject with familial risk. Gastroenterology119: 1740–1744.

4. Gibson, P. R. 2004. Increased gut permeability in Crohn’s disease: is TNF thelink? Gut 53: 1724–1725.

5. Robinson, A., S. Keely, J. Karhausen, M. E. Gerich, G. T. Furuta, andS. P. Colgan. 2008. Mucosal protection by hypoxia-inducible factor prolyl hy-droxylase inhibition. Gastroenterology 134: 145–155.

6. Cummins, E. P., F. Seeballuck, S. J. Keely, N. E. Mangan, J. J. Callanan, P. G. Fallon,and C. T. Taylor. 2008. The hydroxylase inhibitor dimethyloxalylglycine isprotective in a murine model of colitis. Gastroenterology 134: 156–165.

7. Fraisl, P., J. Aragones, and P. Carmeliet. 2009. Inhibition of oxygen sensors asa therapeutic strategy for ischaemic and inflammatory disease. Nat. Rev. DrugDiscov. 8: 139–152.

8. Taylor, C. T. 2004. Regulation of intestinal epithelial gene expression in hypoxia.Kidney Int. 66: 528–531.

9. Ikeda, H., Y. Suzuki, M. Suzuki, M. Koike, J. Tamura, J. Tong, M. Nomura, andG. Itoh. 1998. Apoptosis is a major mode of cell death caused by ischaemia andischaemia/reperfusion injury to the rat intestinal epithelium. Gut 42: 530–537.

10. Morote-Garcia, J. C., P. Rosenberger, N. M. Nivillac, I. R. Coe, andH. K. Eltzschig. 2009. Hypoxia-inducible factor-dependent repression of

The Journal of Immunology 6315

by guest on May 6, 2016

http://ww

w.jim

munol.org/

Dow

nloaded from

equilibrative nucleoside transporter 2 attenuates mucosal inflammation duringintestinal hypoxia. Gastroenterology 136: 607–618.

11. Taylor, C. T., A. L. Dzus, and S. P. Colgan. 1998. Autocrine regulation of epi-thelial permeability by hypoxia: role for polarized release of tumor necrosisfactor alpha. Gastroenterology 114: 657–668.

12. Taylor, C. T., and S. P. Colgan. 2007. Hypoxia and gastrointestinal disease.J. Mol. Med. 85: 1295–1300.

13. Furuta, G. T., J. R. Turner, C. T. Taylor, R. M. Hershberg, K. Comerford,S. Narravula, D. K. Podolsky, and S. P. Colgan. 2001. Hypoxia-inducible factor1-dependent induction of intestinal trefoil factor protects barrier function duringhypoxia. J. Exp. Med. 193: 1027–1034.

14. Karhausen, J., G. T. Furuta, J. E. Tomaszewski, R. S. Johnson, S. P. Colgan, andV. H. Haase. 2004. Epithelial hypoxia-inducible factor-1 is protective in murineexperimental colitis. J. Clin. Invest. 114: 1098–1106.

15. Giatromanolaki, A., E. Sivridis, E. Maltezos, D. Papazoglou, C. Simopoulos,K. C. Gatter, A. L. Harris, and M. I. Koukourakis. 2003. Hypoxia induciblefactor 1alpha and 2alpha overexpression in inflammatory bowel disease. J. Clin.Pathol. 56: 209–213.

16. Hoffmann, J. C., N. N. Pawlowski, A. A. Kuhl, W. Hohne, and M. Zeitz. 2002-2003. Animal models of inflammatory bowel disease: an overview. Pathobiology70: 121–130.

17. Cuvelier, C., P. Demetter, H. Mielants, E. M. Veys, and M. De Vos. 2001. In-terpretation of ileal biopsies: morphological features in normal and diseasedmucosa. Histopathology 38: 1–12.

18. Kontoyiannis, D., M. Pasparakis, T. T. Pizarro, F. Cominelli, and G. Kollias.1999. Impaired on/off regulation of TNF biosynthesis in mice lacking TNFAU-rich elements: implications for joint and gut-associated immunopathologies.Immunity 10: 387–398.

19. Perreault, N., and J. F. Beaulieu. 1998. Primary cultures of fully differentiatedand pure human intestinal epithelial cells. Exp. Cell Res. 245: 34–42.

20. Ukena, S. N., A. Singh, U. Dringenberg, R. Engelhardt, U. Seidler, W. Hansen,A. Bleich, D. Bruder, A. Franzke, G. Rogler, et al. 2007. Probiotic Escherichiacoli Nissle 1917 inhibits leaky gut by enhancing mucosal integrity. PLoS One2: e1308.

21. Shin, D. H., J. H. Kim, Y. J. Jung, K. E. Kim, J. M. Jeong, Y. S. Chun, andJ. W. Park. 2007. Preclinical evaluation of YC-1, a HIF inhibitor, for the pre-vention of tumor spreading. Cancer Lett. 255: 107–116.

22. Varfolomeev, E., H. Maecker, D. Sharp, D. Lawrence, M. Renz, D. Vucic, andA. Ashkenazi. 2005. Molecular determinants of kinase pathway activation byApo2 ligand/tumor necrosis factor-related apoptosis-inducing ligand. J. Biol.Chem. 280: 40599–40608.

23. Garside, P., C. Bunce, R. C. Tomlinson, B. L. Nichols, and A. M. Mowat. 1993.Analysis of enteropathy induced by tumour necrosis factor alpha. Cytokine 5: 24–30.

24. Piguet, P. F., C. Vesin, J. Guo, Y. Donati, and C. Barazzone. 1998. TNF-inducedenterocyte apoptosis in mice is mediated by the TNF receptor 1 and does notrequire p53. Eur. J. Immunol. 28: 3499–3505.

25. Piguet, P. F., C. Vesin, Y. Donati, and C. Barazzone. 1999. TNF-inducedenterocyte apoptosis and detachment in mice: induction of caspases and pre-vention by a caspase inhibitor, ZVAD-fmk. Lab. Invest. 79: 495–500.

26. Wang, G. L., and G. L. Semenza. 1993. General involvement of hypoxia-inducible factor 1 in transcriptional response to hypoxia. Proc. Natl. Acad.Sci. USA 90: 4304–4308.

27. Christer, J. F., M. H. Yacoub, and N. J. Brand. 1998. A versatile methodfor unidirectional cloning of oligonucleotide cassettes: application to creatingconcatamerized transcription factor binding sites. Anal. Biochem. 256: 142–145.

28. Zeissig, S., C. Bojarski, N. Buergel, J. Mankertz, M. Zeitz, M. Fromm, andJ. D. Schulzke. 2004. Downregulation of epithelial apoptosis and barrier repair inactive Crohn’s disease by tumour necrosis factor alpha antibody treatment. Gut53: 1295–1302.

29. Chen, G., and D. V. Goeddel. 2002. TNF-R1 signaling: a beautiful pathway.Science 296: 1634–1635.

30. Valmiki, M. G., and J. W. Ramos. 2009. Death effector domain-containingproteins. Cell. Mol. Life Sci. 66: 814–830.

31. Zheng, W., J. Kuhlicke, K. Jackel, H. K. Eltzschig, A. Singh, M. Sjoblom,B. Riederer, C. Weinhold, U. Seidler, S. P. Colgan, and J. Karhausen. 2009.Hypoxia inducible factor-1 (HIF-1)-mediated repression of cystic fibrosis trans-membrane conductance regulator (CFTR) in the intestinal epithelium. FASEB J.23: 204–213.

32. Narravula, S., and S. P. Colgan. 2001. Hypoxia-inducible factor 1-mediatedinhibition of peroxisome proliferator-activated receptor alpha expression duringhypoxia. J. Immunol. 166: 7543–7548.

33. Marini, M., G. Bamias, J. Rivera-Nieves, C. A. Moskaluk, S. B. Hoang,W. G. Ross, T. T. Pizarro, and F. Cominelli. 2003. TNF-alpha neutralization

ameliorates the severity of murine Crohn’s-like ileitis by abrogation of intestinalepithelial cell apoptosis. Proc. Natl. Acad. Sci. USA 100: 8366–8371.

34. Fries, W., C. Muja, C. Crisafulli, G. Costantino, G. Longo, S. Cuzzocrea, andE. Mazzon. 2008. Infliximab and etanercept are equally effective in reducingenterocyte APOPTOSIS in experimental colitis. Int. J. Med. Sci. 5: 169–180.

35. Gitter, A. H., K. Bendfeldt, J. D. Schulzke, and M. Fromm. 2000. Leaks in theepithelial barrier caused by spontaneous and TNF-alpha-induced single-cellapoptosis. FASEB J. 14: 1749–1753.

36. Hua, Z. C., S. J. Sohn, C. Kang, D. Cado, and A. Winoto. 2003. A function ofFas-associated death domain protein in cell cycle progression localized toa single amino acid at its C-terminal region. Immunity 18: 513–521.

37. Zhang, J., and A. Winoto. 1996. A mouse Fas-associated protein with homologyto the human Mort1/FADD protein is essential for Fas-induced apoptosis. Mol.Cell. Biol. 16: 2756–2763.

38. Wilson, N. S., V. Dixit, and A. Ashkenazi. 2009. Death receptor signal trans-ducers: nodes of coordination in immune signaling networks. Nat. Immunol. 10:348–355.

39. Bang, S., E. J. Jeong, I. K. Kim, Y. K. Jung, and K. S. Kim. 2000. Fas- and tumornecrosis factor-mediated apoptosis uses the same binding surface of FADD totrigger signal transduction. A typical model for convergent signal transduction.J. Biol. Chem. 275: 36217–36222.

40. Yukawa, M., M. Iizuka, Y. Horie, K. Yoneyama, T. Shirasaka, H. Itou,M. Komatsu, T. Fukushima, and S. Watanabe. 2002. Systemic and local evidenceof increased Fas-mediated apoptosis in ulcerative colitis. Int. J. Colorectal Dis.17: 70–76.

41. Begue, B., H. Wajant, J. C. Bambou, L. Dubuquoy, D. Siegmund, J. F. Beaulieu,D. Canioni, D. Berrebi, N. Brousse, P. Desreumaux, et al. 2006. Implication ofTNF-related apoptosis-inducing ligand in inflammatory intestinal epithelial le-sions. Gastroenterology 130: 1962–1974.

42. Reimund, J. M., C. Wittersheim, S. Dumont, C. D. Muller, J. S. Kenney,R. Baumann, P. Poindron, and B. Duclos. 1996. Increased production of tu-mour necrosis factor-alpha interleukin-1 beta, and interleukin-6 by morpho-logically normal intestinal biopsies from patients with Crohn’s disease. Gut39: 684–689.

43. Barrett, J. C., S. Hansoul, D. L. Nicolae, J. H. Cho, R. H. Duerr, J. D. Rioux,S. R. Brant, M. S. Silverberg, K. D. Taylor, M. M. Barmada, et al; NIDDK IBDGenetics Consortium; Belgian-French IBD Consortium; Wellcome Trust CaseControl Consortium. 2008. Genome-wide association defines more than 30distinct susceptibility loci for Crohn’s disease. Nat. Genet. 40: 955–962.

44. Yamasaki, M., T. Nomura, F. Sato, and H. Mimata. 2007. Metallothionein isup-regulated under hypoxia and promotes the survival of human prostate cancercells. Oncol. Rep. 18: 1145–1153.

45. Louis, N. A., K. E. Hamilton, G. Canny, L. L. Shekels, S. B. Ho, andS. P. Colgan. 2006. Selective induction of mucin-3 by hypoxia in intestinalepithelia. J. Cell. Biochem. 99: 1616–1627.

46. Rosenberger, P., J. M. Schwab, V. Mirakaj, E. Masekowsky, A. Mager,J. C. Morote-Garcia, K. Unertl, and H. K. Eltzschig. 2009. Hypoxia-induciblefactor-dependent induction of netrin-1 dampens inflammation caused byhypoxia. Nat. Immunol. 10: 195–202.

47. Taylor, C. T. 2008. Interdependent roles for hypoxia inducible factor and nuclearfactor-kappaB in hypoxic inflammation. J. Physiol. 586: 4055–4059.

48. Tekin, D., A. D. Dursun, and L. Xi. 2010. Hypoxia inducible factor 1 (HIF-1)and cardioprotection. Acta Pharmacol. Sin. 31: 1085–1094.

49. Harten, S. K., M. Ashcroft, and P. H. Maxwell. 2010. Prolyl hydroxylase domaininhibitors: a route to HIF activation and neuroprotection. Antioxid. Redox Signal.12: 459–480.

50. Song, Y. R., S. J. You, Y. M. Lee, H. J. Chin, D. W. Chae, Y. K. Oh, K. W. Joo,J. S. Han, and K. Y. Na. 2010. Activation of hypoxia-inducible factor attenuatesrenal injury in rat remnant kidney. Nephrol. Dial. Transplant. 25: 77–85.

51. Tambuwala, M. M., E. P. Cummins, C. R. Lenihan, J. Kiss, M. Stauch,C. C. Scholz, P. Fraisl, F. Lasitschka, M. Mollenhauer, S. P. Saunders, et al. 2010.Loss of prolyl hydroxylase-1 protects against colitis through reduced epithe-lial cell apoptosis and increased barrier function. Gastroenterology In press.

52. Zhong, H., A. M. De Marzo, E. Laughner, M. Lim, D. A. Hilton, D. Zagzag,P. Buechler, W. B. Isaacs, G. L. Semenza, and J. W. Simons. 1999. Over-expression of hypoxia-inducible factor 1alpha in common human cancers andtheir metastases. Cancer Res. 59: 5830–5835.

53. Garber, K. 2005. New drugs target hypoxia response in tumors. J. Natl. CancerInst. 97: 1112–1114.

54. Mazzone, M., D. Dettori, R. Leite de Oliveira, S. Loges, T. Schmidt, B. Jonckx,Y. M. Tian, A. A. Lanahan, P. Pollard, C. Ruiz de Almodovar, et al. 2009.Heterozygous deficiency of PHD2 restores tumor oxygenation and inhibitsmetastasis via endothelial normalization. Cell 136: 839–851.

6316 HYDROXYLASE INHIBITION ABROGATES TNF-a–INDUCED INTESTINAL DAMAGE

by guest on May 6, 2016

http://ww

w.jim

munol.org/

Dow

nloaded from