Journal of Functional Foods 2014, 8:193-203

1

Germinated Brown Rice Regulates Hepatic Cholesterol Metabolism and Cardiovascular

Disease Risk in Hypercholesterolaemic Rats

Mustapha Umar Imam1,*, Aminu Ishaka1, Der-Jiun Ooi1, Nur Diyana Md Zamri1, Nadarajan

Sarega1, Maznah Ismail1,2,*, Norhaizan Mohd Esa1,2

1 Laboratory of Molecular Biomedicine, Institute of Bioscience, Universiti Putra Malaysia,

43400, Serdang, Selangor

2 Department of Nutrition and Dietetics, Faculty of Medicine and Health Sciences, Universiti

Putra Malaysia, Serdang, Selangor 43400, Malaysia

* Corresponding authors: Laboratory of Molecular Biomedicine, Institute of Bioscience,

Universiti Putra Malaysia, 43400, Serdang, Selangor; maznahis@upm.edu.my,

mustyimam@gmail.com; phone: +603-8947-2115; fax: +603-8947-2116.

Journal of Functional Foods 2014, 8:193-203

2

Abstract

White rice (WR) is the staple food for many people around the world, but it is linked to increased

risk of cardiovascular diseases (CVD). Brown rice (BR) and germinated brown rice (GBR) are

conceived to be the healthier alternatives. The present study evaluated the effects of WR, BR and

GBR in the dietary management of CVD. Diet- induced hypercholesterolaemic rats were fed with

WR, BR and GBR, in comparison to normal, high-fat diet (HFD) and Simvastatin- treated rats.

Weight, lipid profile, plasma oxidized low-density lipoprotein (ox-LDL) and F2-isoprostane were

evaluated. GBR reduced weight gain and improved lipid parameters and oxidative stress (ox-

LDL and F2-isoprostane), partly through transcriptional regulation of hepatic lipoprotein lipase

(LPL), peroxisome proliferator-activated receptor gamma (PPARγ), adiponectin, ATP-binding

cassette, sub family A (ABCA), and v-akt murine thymoma viral oncogene homolog 1and

homolog 3 (AKT1 and AKT3). The results suggest GBR to be a potential functional food that

could ameliorate CVD risk by modulating lipid metabolism and oxidative stress.

Keywords: cardiovascular disease; Germinated brown rice; hepatic cholesterol metabolism;

oxidative stress; white rice.

Abbreviations: ABCA: ATP-binding cassette; AKT: v-akt murine thymoma viral oncogene

homolog; ASG: acylated steryl glycoside; BR: brown rice; CVD: cardiovascular disease; GABA:

gamma aminobutyric acid; GBR: germinated brown rice; HDL: high-density lipoprotein; HFD:

high-fat diet; LDL: low-density lipoprotein; LPL: lipoprotein lipase; PPARγ: peroxisome

proliferator-activated receptor gamma; ox-LDL: oxidized LDL; TC: total cholesterol; TG:

triacylglycerols; WR: white rice.

Journal of Functional Foods 2014, 8:193-203

3

1. Introduction

Cardiovascular disease (CVD) is the leading cause of mortality around the world, and it is

projected to remain so if no urgent action is taken (Go et al., 2013). Part of that urgent action

involves efforts at trying to discover newer therapies to reduce the risk of and manage CVDs. In

recent years, interest has been growing in alternative therapies for CVD because of increased

burden of CVD despite advances in conventional therapeutic tools and equipment.

Acknowledgement of diet as an important variable in causation of CVD has significantly

affected modern approaches to CVD management (Parikh et al., 2005).

Dyslipidaemia is implicated in many cases of CVD, often resulting from a combination of

factors, reflecting the complex nature of lipid metabolism and control (Leon & Bronas, 2009).

Excess low-density lipoprotein (LDL) and triacylglycerol (TG), together with low high-density

lipoprotein (HDL) are targets of therapy during management of CVDs. High HDL levels are

especially important in the reduction of CVD risk. Clearance of cholesterol by HDL involves

reverse transport, in which adenosine triphosphate-binding cassette transporter (ABCA1) plays

an important role (Oram & Vaughan, 2006). Obesity, in addition, worsens dyslipidaemia;

important regulatory mechanisms, including the effects of adipokines and peroxisome

proliferator activated receptors on metabolism are disturbed, thus further aggravating the risk of

CVD (DeClercq et al., 2013). Adiponectin, which enhances metabolism, is linked to reduced

obesity-related CVD risk when present in adequate levels (Xu & Vanhoutte, 2012). Peroxisome

proliferator-activated receptor gamma (PPARγ) is an important regulator of lipid metabolism.

Abnormalities in its regulation have been connected to disease conditions like CVD and obesity

(Lee, Olson, & Evans, 2003). Lipoprotein lipase (LPL), being an important regulator of post-

prandial hepatic cholesterol metabolism, has also been associated with CVD (Otarod & Goldberg,

2004). Commonly associated with obesity, oxidative stress increases CVD risk as well (Keaney

et al., 2003). Increased oxidized LDL (ox-LDL) is a consequence of increased oxidative stress

and inflammation (Shen et al., 2013), resulting in increased CVD risk (Holvoet, 2008). The

complex nature of the underlying metabolic perturbations in CVD makes its management using

Journal of Functional Foods 2014, 8:193-203

4

single pharmacological agents a challenge. Besides, use of multiple pharmacological agents may

in fact increase risk of adverse effects.

There are increasing calls for nutritional management of CVD in view of the significant CVD

risk conferred by dietary factors (Lichtenstein et al., 2006; Renaud, 1997; Van Horn et al., 2008).

Moreover, dietary management is now being studied extensively to reduce CVD risk, in response

to the realisation that CVD is mostly diet- induced and conventional pharmacological agents pose

serious risks of side effects. Statins, among the most common cholesterol- lowering medicines,

are associated with hepatotoxicity, nephrotoxicity and increased risk of diabetes (Demyen et al.,

2013). Nutraceuticals and functional foods with differing cholesterol homeostasis are gaining

popularity in preventive healthcare (Chen et al., 2011; Scicchitano et al., 2014). Functional foods

in particular have been advocated for use in prevention and management of chronic diseases like

CVD due to multiple biologically active (bioactive) components that may illicit multiple and

often cumulative functional effects (Jacobs et al., 2009). Such effects would produce better

outcomes where complex underlying metabolic perturbations are involved, like in the case of

CVD, where abnormalities of cholesterol metabolism, oxidative stress, and many others are

present. White rice (WR) is a staple food for majority of people around the world. Studies,

nevertheless, have revealed that its high glycaemic index may increase the risk of chronic

diseases like diabetes and CVD (Amano et al., 2004; Hu et al., 2012). Prolonged consumption

will further deteriorate the condition. Brown rice (BR) and germinated brown rice (GBR) are

nutrient-rich alternatives to WR, and have been shown to improve lipid profile (Imam et al.,

2013a). However, the multiple metabolic perturbations and complex regulatory mechanisms,

especially at the transcriptional level, involved in CVD development mean a more holistic

approach to CVD management must be adopted. In the present study, the effects of WR, BR and

GBR on CVD risk markers including body weight, cholesterol and oxidative stress, and

underlying transcriptional mechanisms involved in regulation of CVD risk were determined in

hypercholesterolaemic rat model.

2. Materials and Method

Journal of Functional Foods 2014, 8:193-203

5

2.1 Materials

Lipid profile kits (LDL, HDL, total cholesterol [TC], and TG) were purchased from Randox

Laboratories Ltd (Crumlin, County Antrim, UK). Ox-LDL and 8-Isoprostane kits were

purchased from Cusabio Biotech Co., Ltd. (Wuhan, China) and Cayman Chemicals (Ann Arbor,

MI, USA), respectively, while the GenomeLab™ GeXP Start Kit was from Beckman Coulter Inc

(Miami, FL, USA). Sodium chloride (NaCl) was purchased from Sigma-Aldrich (St. Louis, MO,

USA) and Hydrogen peroxide (H2O2) was from Bendosen Laboratory Chemicals (Selangor,

Malaysia). Sodium hypochlorite was purchased from Dexchem Industries Sdn. Bhd, (Penang,

Malaysia), while Simvastatin was from Pfizer (New York, NY, USA), and RCL2 Solution from

Alphelys (Toulouse, France). All solvents used were of analytical grade and were purchased

from Merck (Darmstadt, Germany).

2.2 Preparation of GBR

WR and BR (MR219 and MR220 varieties) used in this study were obtained from PadiBeras

Nasional (BERNAS) factory, Sri Tiram Jaya, Selangor. BR was germinated as reported in our

previous publication (Imam et al., 2012a).

2.3 Bioactive and Proximate Analyses

The bioactive analyses for WR, BR and GBR were reported in our previous publication (Imam et

al., 2013a). In addition, the proximate analysis of the different rice types was done as described

by Ooi et al. (2012), following the official methods of Association of Official Analytical

Chemists. Briefly, after determination of nitrogen content using micro-Kjeldahl apparatus

(KjeltechTM 2200 Auto Distillation Unit, FOSS Tecator, Hoganas, Sweden), protein content was

determined as N x 5.95. Also, the ashing process was done by incinerating the sample in a

furnace (Furnace 62700, Barnstead/Thermolyne, Dubuque, IA, USA) set at 550 C. Finally, the

carbohydrate content was determined using the following formula: (100% - protein content –

moisture content – ash content – crude fat content). All results were expressed as percentage of

dry weight (Table 1).

Journal of Functional Foods 2014, 8:193-203

6

Table 1: The nutritional values for white rice, brown rice and germinated brown rice.

Nutritional

Value* White Rice Brown Rice

Germinated Brown Rice

Crude Protein 7.32 ± 0.20a 8.33 ± 0.14b 8.25 ± 0.09b

Crude Fat 0.95 ± 0.10a 2.27 ± 0.11b 2.29 ± 0.01b

Ash 0.45 ± 0.04a 1.20 ± 0.01b 1.22 ± 0.02b

Moisture 11.76 ± 0.05a 10.72 ± 0.04b 10.69 ± 0.05b

Carbohydrate 91.24 ± 0.31a 77.41 ± 0.17b 77.52 ± 0.25b

*Nutritional values were expressed as percent dry weight (% DW). All the values are means of 4

replicates and data is reported as mean ± standard deviation (n=4). Different letters in any row indicate

statistical difference (p<0.05).

2.4 Animal handling and feeding

Thirty Sprague–Dawley rats (6-week old, male, 130-150 g) were housed in individual plastic

cages with a 12/12 h light/dark cycle, at 25–30 °C. Approval for the use of animal was sought

from the Animal Care and Use Committee (ACUC) of the Faculty of Medicine and Health

Sciences, Universiti Putra Malaysia (Project approval number: UPM/FPSK/PADS/BR-

UUH/00360), and animals were handled as stipulated by the guidelines for the use of animals.

Animals were allowed to acclimatize for 2 weeks on standard rat chow ad libitum and free access

to water. After this, 5 rats were assigned to the normal group and maintained on normal rat chow

for the entire study period. The rest of the rats were fed high fat diet (HFD) for 4 weeks to induce

hypercholesterolaemia, and were then assigned (n=5) randomly to; the control group fed with the

HFD, the Simvastatin group fed with HFD + 0.18 mg/200 g/day Simvastatin (Harini & Parama

Astirin, 2009), and the WR, BR and GBR groups fed with HFD in which 50 % of the semi-

purified diets were substituted with WR, BR and GBR powders, respectively (Imam et al.,

2012a). The rats were maintained on these diets for 5 weeks. From the start of the induction of

Journal of Functional Foods 2014, 8:193-203

7

hypercholesterolaemia to the end of the study, food intake was regulated (30 kcal/100 g body

weight/day) for the normal and all hypercholesterolaemic groups. Weights were measured

weekly, and the total amount of feed given daily (grams) was reviewed weekly based on the new

weights of the rats.

2.5 Lipid profile

Lipid profile analyses were performed in serum from blood collected at the beginning and end of

the study by cardiac puncture after an overnight fast. Samples were analyzed using Randox

analytical kits according to manufacturer’s instructions using a Selectra XL instrument (Vita

Scientific, Dieren, The Netherlands).

2.6 Plasma F2-Isoprostane and oxidized LDL measurements

Plasma from blood collected in EDTA tubes was used for measurements of F2-Isoprostane and

ox-LDL using the respective ELISA kits according to the manufacturers’ instructions.

Absorbance were read on a micro plate reader at 450 and 420 nm, respectively, and results

calculated from the respective standard curves; F2-Isoprostane (y = -35.92logx + 101.48, R² =

0.9851), Ox-LDL (y = 36.038x - 13.286, R² = 0.9336).

2.7 RNA extraction, Reverse transcription and Multiplex PCR analyses

RNA was extracted from rat livers using the Total RNA Isolation kit (RBC Bioscience

Corp.,Taiwan) according to the manufacturer’s instructions. Primer sequences were designed on

the NCBI website, except for the internal control (KanR), which was supplied by Beckman

Coulter (USA). The primers (Table 2) were supplied by Biosune (Shanghai, China), and

reconstituted in 1X TE buffer according to the protocol of the GenomeLab™ GeXP kit

(Beckman Coulter, USA). Reverse transcription and PCR were performed according to the

GenomeLab™ GeXP kit protocol (Beckman Coulter, Miami, FL, USA) in an XP Thermal

Journal of Functional Foods 2014, 8:193-203

8

Cycler (Bioer Technology, Germany). The PCR products were finally analyzed with a GeXP

genetic analysis system, and the results were normalized using eXpress Profiler software based

on the manufacturer’s instructions.

Table 2. Gene names and sequences of primers used in the multiplex panel

Gene name Forward primer sequence Reverse primer sequence

AKT 1 AGGTGACACTATAGAATATCATCAATTTCGAGCAGAAGG GTACGACTCACTATAGGGATGCTTTTTCATGGACCACC

AKT 3 AGGTGACACTATAGAATACATCAAACGTGACTTTGGTTC GTACGACTCACTATAGGGACTCAGCATAACGATCGTGGTT

LPL AGGTGACACTATAGAATAGAAGTGCGGAGATTCAACACT GTACGACTCACTATAGGGAACACGGATGAACGCTAAGCT

PPARγ AGGTGACACTATAGAATAGAGGAGATGGACTTCCGGTC GTACGACTCACTATAGGGAAGGATCTTCATGGCGTAGTAGC

Adiponectin AGGTGACACTATAGAATAGGGGAGCAGGGCTCA GTACGACTCACTATAGGGAAAAATGGCAGGGGAGGG

ABCA1 AGGTGACACTATAGAATATTCAGTCTTTGACTCAGATGCC GTACGACTCACTATAGGGAGTCAGGCTTTTCCACTCATCT

Peptidylprolyl

isomerase A*#

AGGTGACACTATAGAATACACACGGCTCACATTGCAT GTACGACTCACTATAGGGACACGAACAGCAAAGCGA

Beta actin* AGGTGACACTATAGAATAGATCATTGCTCCTCCTGAGC GTACGACTCACTATAGGGAAAAGCCATGCCAATCTCATC

Glyceraldehyde-3-phosphate dehydrogenas

e*

AGGTGACACTATAGAATAAAGGTGAAGGTCGGAGTCAA GTACGACTCACTATAGGGAGATCTCGCTCCTGGAAGATG

*Housekeeping genes. #Used for normalization. ABCA1: ATP-binding cassette 1; AKT: v-akt murine

thymoma viral oncogene homolog; LPL: lipoprotein lipase; PPARγ: peroxisome proliferator-activated

receptor gamma.

2.8 Statistical Analysis

Statistical analyses were performed using GraphPad Prism (San Diego, CA, USA) version 6.01

for Windows. Data are reported as mean ± standard deviation from five individual

determinations. Analysis of variance (ANOVA) accompanied with Tukey Multiple Comparison

test was conducted to identify the significant differences between the samples (p < 0.05).

Journal of Functional Foods 2014, 8:193-203

9

3. Results and discussion

3.1 Compositional Changes in Rice following Germination

Table 1 shows the nutritional changes in BR following germination and how they compare to

those in WR. Crude protein, crude fat, ash, moisture and carbohydrate were all significantly

different between WR and BR but germination did not produce significant changes in any of the

components. Several other studies have reported on effects of germination on BR, and results

have been varied; some studies have indicated that germination could induce changes in the

nutritional components (protein, fat, carbohydrate, ash and moisture) while others reported no

changes, similar to the present results (Imam et al., 2012b). However, it appears that the changes

in bioactive compounds due to germination confers GBR with its superior functional properties

compared to BR. Changes in bioactive compounds (acylated steryl glycoside [ASG], gamma-

aminobutyric acid [GABA], oryzanol and phenolics) after germination of BR were reported in

our earlier publication (Imam et al., 2013a; Imam & Ismail, 2013c), and results indicated that

germination potentiated the amounts of bioactives in BR (significant increases in ASG, GABA,

oryzanol and phenolics), which may have been responsible for the better functional effects of

GBR over BR. Moreover, we have been able to directly link the effects of GBR to the bioactive

compounds present in it, which suggests that the functional effects of GBR are produced mostly

as a result of the different bioactives it contains, likely through food synergy (Imam et al., 2013a;

Imam & Ismail, 2013c; Jacobs et al., 2009). It is expected, therefore, that GBR will produce

better effects than BR due to its higher bioactive contents.

3.2 Animal feeding and weight changes

In this study, daily feed was regulated for all animals (30 kcal/100 g body weight/day). Despite

the regulated food intake, there were significant differences in weights of rats over 5 weeks

(Figure 1). The normal group showed little increase in weight over the period, while the HFD

group had significantly higher weight gain. Simvastatin is a hypolipidaemic medicine used to

manage dyslipidaemia primarily. In addition to its hypocholesterolaemic effects, it has also been

reported to reduce inflammation, weight and risk of atherosclerosis (Hu et al., 2009). Its weight-

reducing effect is further proven in the present study as Simvastatin group did not have as much

weight gain in comparison to the HFD group. The weight changes due to WR were similar to

Journal of Functional Foods 2014, 8:193-203

10

those of the control and Simvastatin groups while both BR and GBR groups showed significantly

lower body weights over the 5-week experimental period. WR is known to have high glycaemic

index (Imam et al. 2012b), which could markedly increase postprandial hyperglycaemia and

hyperinsulinaemia. The fluctuations in blood glucose and insulin concentrations may cause

differences in satiety and energy partitioning, thereby promoting increased fat storage (Lennerz

et al., 2013). In contrast, BR and GBR, which possess low glycaemic load may promote satiety

and maintain insulin sensitivity by minimizing postprandial insulin secretion. In addition, the

bioactive compounds present in BR and GBR, namely GABA, ASG and oryzanol, may mediate

anti-obesity effects through regulating PPARγ gene, in accordance with our previous findings

(Imam et al., 2013b). The present study implicates that prolonged consumption of WR favours

expansion of fat stores, resulting in higher weight gain while BR and GBR would produce less

weight gain. Although obesity poses as independent risk factor for CVD, reduced weight had

been associated with reduced CVD risk (Pi-Sunyer et al., 2007) and attributed to the decrease in

inflammatory signals (Berg & Scherer, 2005).

Figure 1. Effects of different diets on body weights of rats. The body weight of

experimental rats (Mean ± SD, n=5) during the 5-week study period. Diet rich in fats was

given to the high fat diet (HFD) group, and the Simvastatin group in addition received 0.18

mg Simvastatin/200 g/day, while the white rice (WR), brown rice (BR) and germinated

Journal of Functional Foods 2014, 8:193-203

11

brown rice (GBR) groups received HFD in which 50 % was supplemented with the

respective rice diets.

3.3 Biochemical analysis (Lipid profile)

Dyslipidaemia plays a central role in CVD development and its management is considered

closely with CVD management (Schuck et al., 2013). Simvastatin is often used as a standard

therapy to manage lipid profile abnormalities. In the present study, Simvastatin produced lower

LDL, TG and TC, and increased HDL levels compared to the HFD group. The results on Table 3

demonstrated no differences in the lipid profiles of HFD and WR groups. The effects of the HFD

and WR are reflective of the natural histories of hypercholesterolaemia and consumption of WR,

respectively. Similar observations have been reported in the past (Imam et al., 2013a). Both BR

and GBR groups showed lower levels of lipid profiles as compared to HFD, Simvastatin and WR

groups after the 5-week study period. Overall, GBR produced better results than BR and even the

normal group. The hypocholesterolaemic effects of BR and GBR are believed to be due to the

presence of bioactive compounds, including GABA, γ-oryzanol, ASG, phenolic compounds,

dietary fibre, vitamins and minerals. The higher amount of the bioactives present in GBR might

contribute to its overall better effect compared to BR (Imam et al., 2013a). Reduced body

weights and improved lipid profiles in the GBR group suggested that GBR could reduce the risk

of developing CVD by improving metabolism and dyslipidemia.

Journal of Functional Foods 2014, 8:193-203

12

Table 3. Lipid profile analysis.

TC (mmol/L) TG (mmol/L) LDL (mmol/L) HDL (mmol/L)

Groups Baseline Final Baseline Final Baseline Final Baseline Final

Normal 0.94 ± 0.02 a 1.41 ± 0.02 a 0.41 ± 0.08 a 0.48 ± 0.13 a 0.36 ± 0.02 a 0.28 ± 0.07 a 0.26 ± 0.02 a 0.28 ± 0.03 a,b

HFD 1.72 ± 0.24 b 2.47 ± 0.17 b 1.05 ±0.19 b 1.46 ± 0.28 b 0.45 ± 0.05 a 0.53 ± 0.13 b 0.22 ± 0.06 a 0.22 ± 0.08 a,e

Simvastatin 1.67 ± 0.20 b 1.59 ± 0.33 a 1.0 ± 0.19 b 0.82 ± 0.12 c 0.49 ± 0.01 a,b 0.22 ± 0.10 a 0.24 ± 0.01 a 0.31 ± 0.10 a,f

WR 1.88 ± 0.17 b 2.39 ± 0.39 b 0.92 ± 0.06 b 1.67 ± 0.01 b 0.42 ± 0.16 a 0.55 ± 0.05 b 0.24 ± 0.03 a 0.15 ± 0.03 c,e

BR 1.78 ± 0.13 b 1.71 ± 0.14 a 0.87 ± 0.01 b 0.42 ± 0.11 a 0.47 ± 0.13 a,c 0.25 ± 0.08 a 0.23 ± 0.01 a 0.36 ± 0.01 b,f,g

GBR 1.96 ± 0.13 b 1.32 ± 0.38 a 1.18 ± 0.31 b 0.46 ± 0.15 a 0.63 ± 0.02 b,c 0.22 ± 0.05 a 0.24 ± 0.03 a 0.45 ± 0.04 d,g

Data represent mean ± SD (n=5). Different alphabet in each column denotes significant difference (p < 0.05) in Tukey’s multiple

comparison test. Groupings are the same as Figure 1. BR: brown rice; GBR: germinated brown rice; HFD: high fat diet; HDL: high-

density lipoprotein; LDL: low-density lipoprotein; TC: total cholesterol; TG: triacylglycerol; WR: white rice.

Journal of Functional Foods 2014, 8:193-203

13

3.4 Plasma F2-Isoprostane and Ox-LDL

Oxidative stress is implicated in the development and progression of CVD. Many management

modalities are now targeted at its effects for CVD prevention and therapy (Munzel et al., 2010;

Bernabe et al., 2013). F2-isoprostane is one of the most biologically relevant markers for lipid

peroxidation. Its formation is correlated with in vivo oxidative stress and implicated with risk

factors including diabetes mellitus, hypercholesterolaemia and obesity (Soffler et al., 2010).

Figure 2 shows the effects of different diets on F2-isoprotane. Oxidative stress was markedly

higher in the HFD group compared to the normal group as indicated by the F2-isoprostane levels.

Although the formation of F2-isoprotane was lower in Simvastatin group in comparison to the

normal group, no significant difference was observed. The effect of Simvastatin is in agreement

with the report by Delbosc et al. (2002). The higher levels of F2-isoprostane in HFD group depict

the fact that obesity is a risk factor for oxidative stress and consequently CVD (Marchi et al.,

2013). WR group produced higher levels of F2-isoprostane compared to Simvastatin group but

lower than HFD group. This suggests that consumption of WR may produce higher level of

oxidative stress than Simvastatin and normal groups, likely due to its high glycaemic index

leading to glucose- induced oxidative stress (Du et al., 2010). The levels of F2-isoprostanes in the

BR and GBR groups were similar to those of the Simvastatin group although GBR group

produced significantly lower levels of the marker. These suggest that both BR and GBR are

capable of reducing oxidative stress. The high antioxidant capacities of BR and GBR (Esa et al.,

2013; Imam et al., 2012a) might play a role in their better effects on oxidative stress compared to

the WR or HFD groups. Furthermore, oxidative stress is reported to be implicated in obesity and

CVD risk (Marchi et al., 2013). The lower body weights in the BR and GBR groups could have

contributed to the reduced levels of oxidative stress in addition to the high antioxidant capacities

of the BR and GBR. Meanwhile, the higher weight of the WR group could have promoted

oxidative stress, in addition to its high glycaemic load.

Journal of Functional Foods 2014, 8:193-203

14

Figure 2. F2-isoprostane concentrations in plasma samples (Mean ± SD, n=5) of different

rat groups. Bars with different letters denote significant difference (p < 0.05). Groupings

are the same as Figure 1.

Figure 3 shows the effects of the different diets on Ox-LDL. WR group produced the highest

levels of Ox-LDL, followed by the HFD group. However, no significant difference was observed

between the two groups. On the other hand, BR and GBR produced significantly lower levels of

Ox-LDL compared to the WR and HFD groups. No significant difference was detected among

normal, BR, GBR and Simvastatin treated groups. Ox-LDL is another important marker of CVD

risk, resulting from oxidative changes induced on LDL (Holvoet et al., 2008). Ox-LDL carries a

higher risk of CVD than LDL and its reduction is an important aspect of CVD risk management.

Antioxidants, especially from dietary source, have been reported to reduce its levels and

subsequently, CVD risk. In the present study, it is presumed that the increased oxidative stress in

the HFD and WR group may have added to the higher amounts of Ox-LDL. Conversely, the high

antioxidant capabilities of both BR and GBR may have been responsible for the reduced

oxidative stress and hence, lower levels of Ox-LDL.

Journal of Functional Foods 2014, 8:193-203

15

Figure 3. Effects of different diets on plasma oxidized low density lipoprotein (ox-LDL).

Data represent mean ± SD, n=5. Different letters denote significant difference (p < 0.05) in

Tukey’s multiple comparison test. Groupings are the same as Figure 1.

In aggregate, the findings from this study indicate that WR can lead to increase in weight,

elevated oxidative stress and Ox-LDL levels, and worsening of lipid profiles in rats. BR and

GBR, on the other hand, are capable of improving these markers. The close links between

obesity, oxidative stress and CVD are now strongly acknowledged, and the present findings

suggest that BR and GBR could reduce the risk of CVD through improving important CVD

markers (oxidative stress, excess weight and lipid profiles). As can be recalled, advocates of

nutritional management of CVD have suggested a more center stage role for diets. Already, over

half the world’s population depends on WR as staple diet, although it could lead to abnormal

metabolic outcomes. In this regard, GBR with higher amounts of bioactives than BR, if used

instead of WR may result in improved health outcomes for a significant number of people

around the world. Also, the hard texture of BR is reported to contribute to lesser patronage than

Journal of Functional Foods 2014, 8:193-203

16

WR, but improved texture following germination could mean that consumers can still benefit

from the bioactives in GBR without compromising palatability.

3.5 Effects of WR, BR and GBR on hepatic AKT, PPARγ, LPL, Adiponectin and ABCA1

mRNA levels

To have insights into mechanistic basis for the regulation of the CVD risk marke rs, the

transcriptional regulation of genes involved in hepatic cholesterol metabolism was evaluated.

PPARγ, LPL, ABCA, adiponectin, and v-akt murine thymoma viral oncogene homolog 1 and

homolog 3 (AKT1 and AKT3) were found to be regulated by BR and GBR in this study. LPL

plays an important role in fatty acid metabolism, and its elevated level in the liver has been

associated with disturbed liver metabolism including elevated TG levels (Kim et al., 2001).

Increased postprandial lipaemia as expected for a HFD is a risk factor for CVD especially with

increased LPL activity. As shown on Figure 4, elevated levels of hepatic LPL mRNA in the HFD

group may be a response to elevated levels of postprandial lipaemia. A similar level of LPL

mRNA expression was noticed in the WR group. Although both BR and GBR are able to lower

LPL mRNA levels, GBR’s LPL mRNA level was similar to those from normal and Simvastatin-

treated groups. On the long run, elevated LPL by WR may contribute to increased risks of

metabolic problems while GBR may reduce such risks.

Journal of Functional Foods 2014, 8:193-203

17

Figure 4. Changes in hepatic expression of lipoprotein lipase (LPL) and peroxisome

proliferator-activated receptor gamma (PPARγ) following different dietary interventions.

Peptidylprolyl isomerase A was used as the endogenous control for data normalization.

Data represent mean ± SD, n=5. Different letters denote significant difference (p < 0.05) in

Tukey’s multiple comparison test. Groupings are the same as Figure 1.

PPARγ is involved in the regulation of a wide range of metabolic mechanisms including lipid

metabolism, inflammation and atherogenesis. Its activation has been shown to exert anti-

hypertrophy and anti-proliferative effect as well as reduce inflammation by suppressing

production of inflammatory cytokines (Hasegawa et al., 2010). However, researches have also

revealed that lipid oxidation causes increased PPARγ expression, whereby its up regulation

stimulate lipid uptake and fat cells adipogenesis in return (Almeida et al., 2009). Figure 4 shows

the effect of the different diets on PPARγ mRNA levels. Simvastatin- treated group increased the

expression of PPARγ by around 8-fold and 2.5-fold, in comparison to the normal and HFD

Journal of Functional Foods 2014, 8:193-203

18

groups, respectively. The increased PPARγ mRNA levels due to Simvastatin could have resulted

from its direct effect on the gene (Qin et al., 2010). Both HFD and WR groups also showed

significantly higher levels of PPARγ mRNA when compared to the normal group. The

phenomenon is likely due to elevated oxidative stress and lipid oxidation in both groups. The

increased PPARγ levels might partly explain the higher body weight in both HFD and WR

groups as activation of the gene leads to differentiation of adipocyte and storage of fatty acids

(Cock et al., 2004). In the BR and GBR groups, a down regulation of the PPARγ gene, similar to

the normal group was observed, in agreement with our previous report (Imam et al., 2013b). The

reduction also suggested contribution to the anti-obesity effect of GBR (Ho et al., 2012).

Figure 5 shows the effects of the different diets on AKT expression. HFD, Simvastatin and WR

groups showed reduced levels of AKT mRNA compared to the normal group. The BR group

upregulated AKT1 but downregulated AKT3, while GBR upregulated both genes. AKT

activation by antioxidants has been reported to protect cells against apoptotic cell death (Wang et

al., 2013). The present findings suggest that upregulation of the genes by GBR could have

contributed to improved metabolism in liver cells. Figure 6 shows the effects of the different

diets on ABCA1 and Adiponectin genes. Both ABCA1 and adiponectin genes were significantly

downregulated in the HFD, Simvastatin, WR and BR groups. The GBR group showed

significantly higher levels compared to the former groups but was lower than the normal group.

Adiponectin is an adipose-derived factor that is responsible for enhancing the metabolism of

fatty acids and glucose, as well as reducing inflammation and apoptosis. Downregulation of

adiponectin has been associated with increased risk of CVD (Christou & Kiortsis, 2013). The

results from the present study, therefore, suggest that GBR may enhance metabolism better than

BR, WR, Simvastatin and HFD through adiponectin upregulation. ABCA1 is involved in reverse

cholesterol transport where it transfers cholesterol from macrophages to HDL molecules to be

transported to the liver for metabolism. The hepatic ABCA1, on the other hand, is thought to

play an important role in HDL formation (Oram & Vaughan, 2006). The results from this study

suggest that GBR may assist in HDL formation. This is reflected in the results of the lipid

profiles in Table 3. In addition, upregulation of APOA1 gene was also previously reported to be

involved in the hypocholesterolaemic effects of GBR in type 2 diabetic rats (Imam et al., 2013a).

Journal of Functional Foods 2014, 8:193-203

19

This study shows that in addition to APOA1, ABCA1 is also upregulated by GBR and could be

another important mechanism for increasing the HDL levels by GBR.

Figure 5. Relative expression changes of v-akt murine thymoma viral oncogene homolog

1and homolog 3 (AKT1 and AKT3) among different diet-treatment groups. Data was

shown as mean ± SD (n=5) and normalized against Peptidylprolyl isomerase A. Bars with

different alphabets denote significant difference (p < 0.05). Groupings are the same as

Figure 1.

Journal of Functional Foods 2014, 8:193-203

20

Figure 6. Differential expression of ATP-binding cassette, sub family A (ABCA) and

adiponectin (ADIPOQ) following different diet-treatments. Data represent mean ± SD (n=5)

and was normalized using Peptidylprolyl isomerase A as the endogenous control. Different

alphabets denote significant difference (p < 0.05) in Tukey’s multiple comparison test.

Groupings are the same as Figure 1.

Taken together, the present study demonstrates how GBR is able to improve lipid profile and

oxidative stress, regulate hepatic cholesterol metabolism and reduce the risk of CVD. As alluded

to earlier, complex metabolic perturbations underlying CVD make the prevention and

management of the disease a daunting task especially by using pharmacological agents alone. As

such, lifestyle changes, including dietary, have shown great promise in managing CVD because

of its wide-ranging and often multi-systemic effects. Also, foods with multiple bioactive

compounds that could elicit diverse functional effects in biological systems may provide better

outcomes for cardiovascular health. Moreover, it is hypothesized that food is the fundamental

Journal of Functional Foods 2014, 8:193-203

21

unit of nutrition not nutrients because the effects of foods are often times not accounted for by

the presence of any of its constituents (Jacobs & Tapsell, 2007; Jacobs et al., 2009). In the

present, the contribution of the different bioactives is not demonstrated, but previous studies

have demonstrated that the overall effects of GBR may be contributed by the different bioactives

it contains. As can be recalled, we have demonstrated previously that the hypocholesterolaemic

and antioxidant effects of GBR may be mediated by its bioactives (Imam et al., 2012a; Imam et

al., 2013a). Therefore, the effects observed in the present study may also have been contributed

by the synergistic effects of bioactives in GBR. Already, ASG, GABA, oryzanol and phenolics

were shown to transcriptionally affect the regulation of cholesterol metabolism and antioxidants

(Imam et al., 2013a; Imam et al., 2012a). In addition, GBR bioactives individually upregulated

PPARγ gene expression but in combination produced downregulation of the gene (Imam et al.,

2013b), further corroborating the hypothesis of food synergy (Jacobs & Tapsell, 2007; Jacobs et

al., 2009). The bioactives present in GBR have been shown to possess different properties

including antioxidant and hypocholesterolaemic (Imam et al., 2012b). As a whole, synergistic

effects of the different constituents in GBR likely contributed towards producing its effects,

which may not be similar to what any of the constituents will produce in isolation. Also, in view

of the multiple bioactive compounds in GBR, other transcriptional and non-transcriptional

mechanisms apart from those observed in the present study may have played a role in the

functional effects of GBR.

4. Conclusions

In this study, WR was shown to worsen lipid profiles, oxidative stress and Ox-LDL level in

hypercholesterolaemic rats. Although both BR and GBR were able to improve the above markers

better than Simvastatin, a standard drug used in the management of hypercholesterolaemia, GBR

produced better results overall. Taken together, the results show that GBR was better than BR

and WR in reducing CVD risk through transcriptional modulation of key hepatic genes involved

in regulation of metabolism. Moreover, multiple mechanisms by which GBR exerts its

hypocholesterolaemic and antioxidative effects might have been contributed by its multiple

bioactive compounds. Hence, GBR may produce better functional effects than conventional

Journal of Functional Foods 2014, 8:193-203

22

pharmacological agents, which mostly produce unwanted effects in addition to their single

pharmacological effects. These findings provide better insights into the role of functional foods

like GBR in reducing the risks of CVD potentially through the combined effects of multiple

bioactive compounds. These findings, therefore, suggest the need for a change in the approach to

management of chronic diseases like CVD through the use of diets with multiple functional

effects since they may produce better effects than pharmacological agents or supplements with

single mechanism of action. Moreover, CVD is now acknowledged to be a diet-related chronic

disease and these findings could pave way for the potential use of GBR as a functional food in

the prevention and management of CVD. The potential implication of the consumption of GBR

in place of WR for the rice-consuming populations around the world could be significant and is

worth evaluating further.

Acknowledgement

The authors thank PadiBeras Nasional Berhad (BERNAS) and Universiti Putra Malaysia (UPM)

for sponsoring this research (vote no 63536). The authors also thank the staff of the Laboratory

of Molecular Biomedicine for their assistance with this study.

Competing interests

The authors declare no conflict of interest.

References

Almeida, M., Ambrogini, E., Han, L., Manolagas, S.C., & Jilka, R. (2009). Increased lipid

oxidation causes oxidative stress, increased peroxisome proliferator-activated receptor-γ

expression, and diminished pro-osteogenic Wnt signaling in the skeleton. The Journal of

Biological Chemistry, 284(40), 27438-27448.

Journal of Functional Foods 2014, 8:193-203

23

Amano, Y., Kawakubo, K., Lee, J.S., Tang, A.C., Sugiyama, M., & Mori, K. (2004).

Correlation between dietary glycemic index and cardiovascular disease risk factors among

Japanese women. European Journal of Clinical Nutrition, 58, 1472-1478.

Berg, A.H., & Scherer, P.E. (2005). Adipose tissue, inflammation and cardiovascular disease.

Circulation Research, 96, 939-949.

Bernabe, J., Mulero, J., Cerda, B., Garcia-Viguera, C., Moreno, D.A., Parra, S., Aviles, F.,

Gil-Izquierdo, A., Abellan, J. and Zafrilla, P. (2013). Effects of a citrus based juice on

biomarkers of oxidative stress in metabolic syndrome patients. Journal of Functional Foods,

5 (3), 1031-1038.

Chen, Z.-Y., Ma, K.Y., Liang, Y., Peng, C. and Zuo, Y. (2011). Role and classification of

cholesterol- lowering functional foods. Journal of Functional Foods, 3 (2), 61-69.

Christou, G.A., & Kiortsis, D.N. (2013). Adiponectin and lipoprotein metabolism. Obesity

Reviews, 14(12), 939-949.

Cock, T.-A., Houten, S.M., & Auwerx, J. (2004). Peroxisome proliferator-activated receptor-

γ: too much of a good thing causes harm. EMBO Reports, 5(2):,142-147.

DeClercq, V., E. Enns, J., Yeganeh, A., G. Taylor, C., & Zahradka, P. (2013). Modulation of

Cardiovascular Function by Adipokines. Cardiovascular & Haematological Disorders -

Drug Targets, 13(1), 59-72.

Delbosc., S., Cristol, J.-P., Descomps, B., Mimran, A., & Jover, B. (2002). Simvastatin

prevents angiotensin II- induced cardiac alteration and oxidative stress. Hypertension, 40,

142-147.

Demyen, M., Alkhalloufi, K., & Pyrsopoulos, N.T. (2013). Lipid-Lowering Agents and

Hepatotoxicity. Clinics in Liver Disease, 17(4), 699-714.

Du, D., Shi, Y.-H., & Le, G.-W. (2010). Oxidative stress induced by high-glucose diet in

liver of C57BL/6J mice and its underlying mechanism. Molecular Biology Reports, 37(8),

3833-3839.

Journal of Functional Foods 2014, 8:193-203

24

Esa, N.M., Kadir, K.-K. A., Amom, Z., & Azlan, A. (2013). Antioxidant activity of white

rice, brown rice and germinated brown rice (in vivo and in vitro) and the effects on lipid

peroxidation and liver enzymes in hyperlipidaemic rabbits. Food Chemistry, 141(2), 1306-

1312.

Go, A.S., Mozaffarian D, Roger VL, et al. (2013). Heart disease and stroke statistics—2013

update. Circulation, 127, e6–e245.

Harini, M., & Parama Astirin, O. K. I. D. (2009). Blood cholesterol levels of

hypercholesterolemic rat (Rattus norvegicus) after VCO treatment. Nusantara

Bioscience, 1(2).

Hasegawa, H., Takano, H., & Komuro, I. (2010). Therapeutic Implications of PPARγ in

Cardiovascular Diseases. PPAR Research, 2010, 876049.

Ho, J.N., Son, M.E., Lim, W.C., Lim, S.T., & Cho, H.Y. (2012). Anti-obesity effects of

germinated brown rice extract through down-regulation of lipogenic genes in high fat diet-

induced obese mice. Bioscience, Biotechnology and Biochemistry, 76(6), 1068-1074.

Holvoet, P. (2008). Relations between metabolic syndrome, oxidative stress and

inflammation and cardiovascular disease. Verhandelingen-Koninklijke Academie voor

Geneeskunde van België, 70(3), 193.

Holvoet, P., Keyzer, D.D., & Jacobs, D.R., Jr. (2008). Oxidized LDL and the metabolic

syndrome. Future Lipidology, 3(6), 637-649.

Hu. E.A., Pan, A., Malik, V., & Sun, Q. (2012). White rice consumption and risk of type 2

diabetes: meta-analysis and systematic review. British Medical Journal, 344, e1454.

Hu, Y., Tong, G., Xu, W., Pan, J., Ryan, K., Yang, R., Shuldiner, A.R., Gong, D.W., & Zhu,

D. (2009). Anti- inflammatory effects of simvastatin on adipokines in type 2 diabetic patients

with carotid atherosclerosis. Diabetes and Vascular Disease Research, 6(4), 262-268.

Journal of Functional Foods 2014, 8:193-203

25

Imam, M.U., Azmi, N.H., Bhanger, M.I., Ismail, N., & Ismail, M. (2012b). Antidiabetic

properties of germinated brown rice: a systematic review. Evidence-Based Complementary

and Alternative Medicine, 2012, 816501.

Imam, M.U., Ismail, M., Ithnin, H., Tubesha, Z., & Omar, A.R. (2013b). Effects of

Germinated Brown Rice and Its Bioactive Compounds on the Expression of the Peroxisome

Proliferator-Activated Receptor Gamma Gene. Nutrients, 5(2), 468-477.

Imam, M.U., Ismail, M., Omar, A.R., & Ithnin, H. (2013a). The Hypocholesterolemic Effect

of Germinated Brown Rice Involves the Upregulation of the Apolipoprotein A1 and Low-

Density Lipoprotein Receptor Genes. Journal of Diabetes Research, 2013, 134694.

Imam, M.U., & Maznah, I. (2013c) Nutrigenomic effects of germinated brown rice and its

bioactives on hepatic gluconeogenic genes in type 2 diabetic rats and HEPG2 cells.

Molecular Nutrition and Food Research, 2013, 57(3), 401-411

Imam, M.U., Musa, S.N.A., Azmi, N.H., & Ismail, M. (2012a). Effects of white rice, brown

rice and germinated brown rice on antioxidant status of type 2 diabetic rats. International

Journal of Molecular Sciences, 13, 12952-12969.

Jacobs, D.R., & Tapsell, L.C. (2007). Food, not nutrients, is the fundamental unit in

nutrition. Nutrition reviews, 65(10), 439-450.

Jacobs, D.R., Gross, M.D., & Tapsell, L.C. (2009). Food synergy: an operational concept for

understanding nutrition. The American Journal of Clinical Nutrition, 89(5), 1543S-1548S.

Keaney, J. F., Larson, M. G., Vasan, R. S., Wilson, P. W., Lipinska, I., Corey, D., et al.

(2003). Obesity and systemic oxidative stress clinical correlates of oxidative stress in the

Framingham Study. Arteriosclerosis, Thrombosis, and Vascular Biology, 23(3), 434-439.

Kim, J. K., Fillmore, J. J., Chen, Y., Yu, C., Moore, I. K., Pypaert, M., et al. (2001). Tissue-

specific overexpression of lipoprotein lipase causes tissue-specific insulin

resistance. Proceedings of the National Academy of Sciences, 98(13), 7522-7527.

Journal of Functional Foods 2014, 8:193-203

26

Lee, C. H., Olson, P., & Evans, R. M. (2003). Minireview: lipid metabolism, metabolic

diseases, and peroxisome proliferator-activated receptors. Endocrinology, 144(6), 2201-2207..

Lennerz, B.S., Alsop, D.C., Holsen, L.M., Stern, E., Rojas, R., Ebbeling, C.B., Goldstein,

J.M., & Ludwig, D.S. (2013). Effects of dietary glycemic index on brain regions related to

reward and craving in men. American Journal of Clinical Nutrition, 98, 641–647.

Leon, A.S., & Bronas, U.G. (2009). Dyslipidemia and Risk of Coronary Heart Disease: Role

of Lifestyle Approaches for Its Management. American Journal of Lifestyle Medicine, 3,

257-273.

Lichtenstein, A.H., Appel, L.J., Brands, M., Carnethon, M., Daniels, S., Franch, H.A., et al.

(2006). Diet and Lifestyle Recommendations Revision 2006: A Scientific Statement from the

American Heart Association Nutrition Committee. Circulation, 114, 82-96.

Marchi, E.D., Baldassari, F., Bononi, A., Wieckowski, M.R., & Pinton, P. (2013). Oxidative

stress in cardiovascular disease and obesity: Role of p66Shc and Protein Kinase C. Oxidative

Medicine and Cellular Longevity, 2013, 564961.

Munzel, T., Gori, T., Bruno, R.M., & Taddei, S. (2010). Is oxidative stress a therapeutic

target in cardiovascular disease? European Heart Journal, 31(22), 2741-2749.

Ooi, D.-J., Iqbal, S. and Ismail, M. (2012). Proximate composition, nutritional attributes and

mineral composition of Peperomia pellucida L. (Ketumpangan Air) grown in Malaysia.

Molecules, 17, 11139-11145.

Oram, J.F., & Vaughan, A.M. (2006). ATP-Binding Cassette Cholesterol Transporters and

Cardiovascular Disease. Circulation Research, 99, 1031-1043.

Otarod, J. K., & Goldberg, I. J. (2004). Lipoprotein lipase and its role in regulation of plasma

lipoproteins and cardiac risk. Current atherosclerosis reports, 6(5), 335-342.

Parikh, P., McDaniel, M.C., Ashen, D., Miller, J.I., Sorrentino, M., Chan, V., Blumenthal,

R.S., & Sperling, L.S. (2005). Diets and Cardiovascular Disease: An Evidence-Based

Assessment. Journal of the American College of Cardiology, 45(9), 1379-1387.

Journal of Functional Foods 2014, 8:193-203

27

Pi-Sunyer, X., Blackburn, G., Brancati, F.L., et al., Look AHEAD Research Group. (2007).

Reduction in weight and cardiovascular disease risk factors in individuals with type 2

diabetes: one-year results of the Look AHEAD trial. Diabetes Care, 30,1374–1383.

Qin, Y.-W., Ye, P., He, J.-Q., Sheng, L., Wang, L.-Y., & Du, J. (2010). Simvastatin inhibited

cardiac hyperthrophy and fibrosis in apolipoprotein E-deficient mice fed a “Western-style

diet” by increasing PPAR α and γ expression and reducing TC, MMP-9, and Cat S levels.

Acta Pharmacologica Sinica, 31, 1350-1358.

Renaud, S.C. (1997). Dietary management of cardiovascular diseases. Prostaglandins,

leukotrienes and essential fatty acids, 57.4, 423-427.

Schuck, R.N., Mendys, P.M., & Simpson Jr., R.J. (2013). Beyond statins: Lipid management

to reduce cardiovascular risk. Pharmacotheraphy, 33(7), 754-764.

Scicchitano, P., Cameli, M., Maiello, M., Modesti, P.A., Muiesan, M.L., Novo, S., Palmiero,

P., Saba, P.S., Pedrinelli, R. and Ciccone, M.M. (2014). Nutraceuticals and dyslipidaemia:

Beyond the common therapeutics. Journal of Functional Foods, 6, 11-32.

Shen, Y., Yang, T., Guo, S., Li, X., Chen, L., Wang, T., & Wen, F. (2013). Increased Serum

ox-LDL Levels Correlated with Lung Function, Inflammation, and Oxidative Stress in

COPD. Mediators of Inflammation, 2013, 972347.

Soffler, C., Campbell, V.L., & Hassel, D.M. (2010). Measurement of Urinary F2-

Isoprostanes as Markers of in Vivo Lipid Peroxidation: A Comparison of Enzyme

Immunoassays with Gas Chromatography–Mass Spectrometry in Domestic Animal Species.

Journal of Veterinary Diagnostic Investigation, 22(2), 200-209.

Van Horn, L., McCoin, M., Kris-Etherton, P.M., Burke, F., Carson, J.A.S., Champagne,

C.M., et al. (2008). The evidence for dietary prevention and treatment of cardiovascular

disease. Journal of the American Dietetic Association, 108( 2), 287-331.

Wang, J., Chen, Y., Zhang, W., Zheng, G., Meng, S., Che, H., Ke, T., Yang, J., Chen, J., &

Luo, W. (2013). Akt activation protects liver cells from apoptosis in rats during acute cold

exposure. International Journal of Biological Sciences, 9(5), 509-517.

Journal of Functional Foods 2014, 8:193-203

28

Xu, A., & Vanhoutte, P.M. (2012). Adiponectin and adipocyte fatty acid binding protein in

the pathogenesis of cardiovascular disease. American Journal of Physiology - Heart and

Circulatory Physiology, 302, H1231-H1240.