Genetic Analysis of Giardia from Hoofed Farm Animals Reveals Artiodactyl-Specific and Potentially...

J. Euk. Microbiol.. 44(6). 1997 pp. 626-635 8 1997 by the Society of Protozoologists

Genetic Analysis of Giardia from Hoofed Farm Animals Reveals Artiodactyl-Specific and Potentially Zoonotic Genotypes

PETER L. EY,*,I MANDANA MANSOURI,* JAROSLAV KULDA,** EVA NOHYNKOVA,** PAUL T. MONIS,* ROSS H. ANDREWS* and GRAHAM MAYRHOFER*

*Department of Microbiology and Immunology, The University of Adelaide, North Terrace, Adelaide SA 5005, Australia, and **Department of Parasitology, Faculty of Science and Department of Tropical Medicine. First Faculty of Medicine,

Charles University, Prague, Czech Republic

ABSTRACT. Thirty one Giardia isolates, established from six species of hoofed livestock by axenic culture or growth in suckling mice, were compared genetically by analysis of DNA amplified from loci encoding variant surface proteins or the enzyme glutamate dehydrogenase and by allozyme analysis. The isolates were heterogeneous, but all showed affinity with genetic Assemblage A-one of two major assemblages defined previously by analysis of Giardia from humans. Three distinct genotypes were evident. Ten isolates (eight axenic and two established in suckling mice) from an alpaca, pig, horse, cattle and sheep were indistinguishable from human- derived G. intestinalis belonging to a previously designated genetic group (Group I). This genotype seems to have broad host specificity, including a zoonotic potential for humans. Five isolates (two axenic and three established in suckling mice) from an alpaca, a horse and sheep had close affinity with human-derived Group I and Group I1 G. inresrinalis genotypes. The other 16 isolates (comprising both axenic and suckling mouse-propagated cultures derived from cattle, sheep, alpaca, a goat and pigs in Australia and Europe) differed from all other Giardia with “duodenalis” morphology that have been examined by these methods and they segregated as a highly distinct sublineage (referred to herein as ‘Novel livestock’) within genetic Assemblage A. The predominance of ‘Novel livestock’ genotypes in the test panel and their apparent exclusive association with artiodactyl hosts indicates that they may be confined to this group of mammals. Assemblage B genotypes, which are prevalent in humans and some other animal species, were not detected.

Supplementary key words. Environment, parasite, protozoan evolution, water management.

IARDIA intestinalis, the aetiological agent of the diarrhoea1 G disease giardiasis [15], is the most common gastrointes- tinal protozoan parasite detected in humans worldwide [21, 241. Defined previously as G. duodenalis (syn. G. lamblia) on the basis of shared morphological features-in particular similar median body structures [ 171-the species includes organisms isolated from a wide range of mammalian hosts. Despite their morphological similarity, however, isolates of G. intestinalis show extreme genetic heterogeneity [2, 5, 20, 27, 29, 32, 33, 401. Two major lineages, Assemblage A and Assemblage B, have been identified by electrophoretic (allozymic) and DNA analysis of isolates from humans and animals [ 3 , 20, 27, 30, 381. Assemblage A corresponds to the ‘Polish’ group of Homan et al. [20] and it includes two clearly defined branches, genetic Groups I and I1 [2, 10-12, 14, 27, 301 which appear to correspond to groups 1 and 2 of Nash [32, 331. Assemblage B, which corresponds to the ‘Belgian’ group of Homan [20] and group 3 of Nash [33, 381, includes genetic Groups I11 and IV [ l ] as well as other genotypes [27, 301. The definition of these distinct lineages supports propositions [2, 6, 271 that G. intestinalis is a species complex.

Infectivity studies utilizing G. intestinalis (of unknown genotype) from humans and animals have shown that although cross-species transmission is possible [8, 26, 361 some isolates infect poorly, if at all, upon transfer to other host species [6, 8, 221. It is clearly important to determine whether this variability has a genetic basis and if so, to determine which genotypes are capable of zoonotic transmission. Current water management practices are based on the premise that all Giardia cysts are infectious for humans because the origin of cysts in environ- mental water samples cannot be identified with certainty and the zoonotic potential of giardiasis remains an unresolved issue. Contamination of water with cysts excreted by animals such as beavers and muskrats, which have reported carriage rates of 7- 16% and > 95% respectively [6-81, has been implicated in several epidemics in North America. However in many coun- tries a major source of Giardia cysts in surface run-off waters is likely to be agricultural livestock-for which mean Giardia sp. carriage rates of 2 30% are common [34, 411. We have

I To whom correspondence should be addressed. Telephone: 61-8- 83034153; Fax: 61-8-83034362; Email: [email protected]

therefore made efforts to establish isolates of Giardia from agricultural livestock and in this study present detailed genetic data from a comparative analysis of 21 new and 10 previously described isolates derived from various hoofed species.

MATERIALS AND METHODS

Giardia isolates. Table 1 lists the origins and methods of isolation and growth of the animal-derived Giardia examined in this study. Australian isolates Ad-1 19, Ad-127, Ad-132,

Ad-162, Ad-163 and Ad-164 were established by infection of suckling mice with cysts purified from the stools of farm animals investigated for scouring. Trophozoites were obtained from the intestines of the mice as described [28]. Czech isolates were established as axenic cultures [23], initiated with trophozoites obtained either from the upper small intestines of sacri- ficed animals (P-8, P-15, T-60538/17, G-247/1 and all sheep isolates) or by excystation of cysts [16] purified from stool specimens (P2-MER, G-EXPK). With the exceptions of P-8 and P-15 [23], none of the aforementioned isolates has been described previously. Axenic isolates from Switzerland (CH-01, CH-O2/clone 4A1 and CH-03 from sheep; CH-B1, CH-B2 and CH-B3/clone 1Al from cattle) and Canada (S1 and S2, from sheep) are described elsewhere [4, 12,351. Human-derived axenic isolates, used as standards for genetic Assemblages A and B [27, 301, were Ad-l/clone 7 (Ad-Uc7) and Ad-3/c2 (As- sembl. A, Group I), Ad-2/c2 and BRIS/83/HEPU/136 clone 2 (Bris-l36/c2) (Assembl. A, Group 11), and BAH-12, Ad-28 and Ad-52 (Assembl. B, Group I11 & Group IV-like) [2, 10-12, 14, 27, 301. DNA was purified as described [14]. Alternatively, rep- licate 11 pl samples containing 50,000 viable trophozoites in isotonic (0.22M) KCI were snap-frozen in PCR tubes by im- mersion in liquid nitrogen, mixed with 25 ~1 of digestion/PCR buffer (0.4 m g / d proteinase K, 40 mM Tris-HC1 (pH 8.3), 5 mM MgCI,, 1% Triton X-100) and incubated under oil at 56” C for 45 min. Following inactivation at 95” C (15 min), these were stored at -20” C for use in PCR. For enzyme electrophoresis [2], pellets containing 5-10 X lo6 viable trophozoites were snap-frozen in liquid nitrogen and stored at -70” C prior to analysis.

Polymerase chain reactions (PCR). Reactions (50 p1) contained, unless stated otherwise, Tris-HC1 (20 mM, pH 8.3), KCl

Ad-133, Ad-134, Ad-144, Ad-149, Ad-152, Ad-159, Ad-161,

626

EY ET AL.-ANALYSIS OF GIARDIA FROM HOOFED LIVESTOCK 627

(50 mM), MgCI, (2.5 mM), Triton X-100 (0.5%), dNTPs (dATP, dGTP, dCTP and d?TP, 0.2 mM each), 5' and 3' oli- godeoxynucleotide (oligo) primers (each 0.5 FM), 1 unit of Taq DNA polymerase (Biotech International, Perth, WA) and 50- 200 ng of purified Giardia DNA. Alternatively, dNTF's, primers and DNA polymerase were added in a 15 p1 aliquot to predi- gested trophozoites (see above).

Amplification of 0.52-kb segmentsfiom the tsa417 and tspll genes (PCR assay I). This assay uses primer sequences that are common to the homologous 3' portions of the variant-specific surface protein (VSP) genes tsa417 [18] and tspl l f13] identified originalis in Group I G. intestinalis. Group I and Group LI isolates possess both genes [9, 111 and the 0.52-kb DNA amplified using oligos 432 and 433 is a mixture of products derived from both loci. The tsa417 (locus 1) product contains restriction sites for Cla I, Pst I and Kpn I, whereas the tspl l (locus 2) product contains sites for Cla I and HindIII. Group I and Group I1 genotypes can be differentiated by use of Pst I, which detects a novel restriction fragment length polymorphism (RFLP) specific to an additional tspll -like gene (locus 3) identified in genetic Group I1 isolates [12]. Assemblage B genotypes yield no product or trace amounts of a 0.37-kb product in this assay [lo, 301.

Locus-specijic amplification of tsa417, tspl 1 and vsp1267 genes (assays 2 4 ) . DNA comprising 8 6 8 7 % of the tsa417 or tspl l coding sequence was amplified using locus-specific forward primers (726 or 727, corresponding to the nucleotide (nt) sequence preceding the initiation codon of each respective gene, see [ 121) in combination with the consensus reverse primer (oligo 433) used to amplify the 0.52-kb segments mentioned above. Detection of the vsp1267 gene [31] utilized an equivalent vspl267-specific forward primer (oligo 733) in combination with a consensus anti-sense primer (oligo 731) which comple- ments a conserved segment located at the 3' terminus of all characterized VSP genes [12]. For all three assays, samples were denatured at 95" C for 1.5 min, then subjected to ten cycles of amplification (45 sec, 94" C; 30 sec, 56" C; 3 min, 72" C), followed by 20 cycles comprising 30 sec at 94" C, 30 sec at 60" C and 3.5 min at 72" C, with a final 10 min elongation step at 72" C.

Amplification of a 1.2-kb segment from the glutamate dehydrogenase gene. We have described the design of oligos 578 and 579 and their use as PCR primers to amplify (in the presence of 5% dimethyl sulphoxide) a 1.2-kb segment of the glutamate dehydrogenase (GDH) gene from G. intestinatis 1301. Samples were denatured (95" C, 2 min) and then subjected to 30 cycles of amplification (30 sec at 94" C, 30 sec at 56" C, 2.5 min at 72" C), followed by a final 6 min elongation step at 72" C.

Detection of restriction fragment length polymorphisms. Cleavage of amplified DNA by restriction endonucleases (over- night incubation) was assessed by electrophoresis in 1% aga- rose (tris-borate-EDTA buffer) and staining with ethidium bro- mide. Fragment sizes were calculated from electrophoretic mo- bilities by regression analysis.

Cloning of amplified DNA and analysis of nucleotide sequences. The heterogeneous 0.52-kb products amplified in assay 1 were cloned into pGEM-7Zf(+) and constructs containing tsa417 or tspll-like inserts (Cla I S a c I, 0.43 kb) were identified by hybridization andor restriction analysis as described [ll]. These were sequenced using M13 universal primers and Taq DNA polymerase in the presence of dideoxynucleotide chain terminators (ABI Dye Primer Sequencing kit; Perkin-Elmer, Fos- ter City, CA). In the case of gdh PCR products, the homogeneous 1.2-kb amplified DNA was purified using BresaClean (Bresatech Ltd, Adelaide, SA) and used directly in reactions employing flu-

orescent dideoxynucleotides (ABI Prism Ready Reaction Dye Deoxy Terminator Cycle sequencing kit) and gdh-specific primers 578 [30], 862 (5'-AGTACGCGACGCTGGGATACT-3'), 913 (5'-ATGACCGAGCT-(Clr)CAGAGGC-3'), 914 (5'-TGAAC-

CCACCCCTC(CR)GT-3') or 1052 (5'-CGTr'GAA(C/G)CC(A/ G)TCClT(A/G)TCG-3'). Sequences were determined using an ABI 373A DNA sequencer, collated using SeqEd , and aligned using CLUSTAL V [19]. Alignment gaps were repositioned where necessary by comparison with the aligned amino acid sequences. Phylogenetic analyses were performed using version 1.02 of MEGA [25].

Enzyme electrophoresis. Cell sonicates were tested for a total of 20 enzymes as described [ l , 2, 271. Axenized G. intestinalis trophozoites, representing Groups I (isolate Ad- l/c7) or I1 (isolates Ad-2/c2, Bris-136Ic2) of Assemblage A and Group 111 (isolate BAH-12) of Assemblage B [2, 271, were included in each electrophoretic run as standards and an isolate of G. muris (Ad-120 [27]) was used as an outgroup. Cluster analyses [2] involved calculating the number and proportion of fixed differences from pairwise comparisons between isolates, then constructing phenograms by the Unweighted Pair Group Meth- od of Analysis (UPGMA) using the percentage of loci showing 'fixed' allelic differences as a measure of genetic distance.

TCGTTCCT(A/G/C/T)AGGCG-3'), 1051 (5'-CT(C/T)CGCm-

RESULTS Amplification and FWLP analysis of VSP genes. Analysis of homologous 0.52-kb tsa417 and tspll-like PCR

products. In an initial screen using PCR assay 1, genomic DNA from all of the 32 Giardia samples in the test panel (31 unique isolates, plus isolate G-EXPK; Table 1) produced amplified 0.52-kb DNA in high yield. This established each isolate as belonging to genetic Assemblage A. RFLP analyses showed that the amplified DNA was in each case a mixture of tsa417 (locus 1) and tspll-like (locus 2 andor locus 3) sequences. Hind I11 was diagnostic, distinguishing 21 isolates (for which all of the amplified DNA was resistant to cleavage-Table 1) from the others which, like Group I and Group I1 genotypes, yielded a mixture of Hind 111-susceptible (locus 2-like) and Hind 111-resistant (locus 1, locus 3-like) 0.52-kb products. Pst I, which differentiates Group I and Group I1 isolates [l 11, was less informative although isolates Ad-127 (from sheep), Ad- 159 (horse) and Ad-164 (alpaca) were distinguished by the detection of Pst I-susceptible tsa417 and locus 3 products typical of Group I1 isolates [11, 121.

Locus-specific amplification of VSP genes. The use of locus- specific primers to amplify homogeneous DNA from tsall7, tspl l and vsp1267 (PCR assays 2-4), combined with RFLP analysis of the amplified DNA, allowed three groups to be distinguished (Table 1). In the first group, the amplified products were identical to those amplified from Group I genotypes- namely a 1.8-kb tsa417 (assay 2) product, a 1.8-kb tspll (assay 3) product containing conserved sites for Kpn I, Xba I and HindIII [12], and a 1.8-kb vsp1267 (assay 4) product. These isolates comprised Ad-161 (alpaca), B1, B2 and B3-1A1 (calves), Ad-162 (horse), G-EXPK (from a goat infected ex- perimentalis with pig isolate P2-MER), and sheep-derived isolates 0 1 , S1 and S2-all of which had also yielded Group I-like 0.52-kb DNA in assay 1.

The second group, comprising isolates Ad- 159 (horse), Ad-164 (alpaca) and isolates Ad-127, 02-4A1 and 0 3 (sheep), yielded 1.9 kb tsa417 products in assay 2 that were identical (by RFLP analysis) to the equivalent product from Group I isolates. However these 5 isolates were distinguished, in assay 3, by the amplification of similar 1.8 kb tspll-like products with an RFTP profile (Kpn I-, Xba I+, HindIII-) distinct from

628 J. EUK. MICROBIOL., VOL. 44, NO. 6 , NOVEMBER-DECEMBER 1997

Axenic Canada +

Table 1. Genotypes deduced from PCR amplification and RFLP analysis of rsa417, tspll-like or vsp1.267 VSP genes in Giardia from hoofed livestock.

+ + +

ISOLATE DETAILS 0.52-kba GENE-SPECIFIC PCR" Deduced Type of Country Nin dIII TSA 417 TSP I1 VSP 1267 genotype Host Isolate

origin code(s) culture of origin cleavage (1.9-kb) (l.&kb) (1.8-kb) (Group) ----

ALPACA Ad-149,Ad-163 SuckLmice Australia L - 1 Unknown Suckl. mice Australia ~ I , Ad-161

Ad- I 6 4 Suckl. mice Australia UII-like

Unknown Unknown

CATTLE Ad-119, Ad-I33 Suckl. mice Australia Ad-I44 Suckl. mice Australia

Unknown Czech R. I - I - T-60538117 Axenic B 1 ,B2,B3-lA1 Axenic Switz. + + + + I

GOAT G-24711 Axenic CzechR. 1-1 - Unknown

HORSE Ad-I59 Ad-162

Suckl. mice Australia MI-like Suckl. mice Australia

PIG Ad- 1 32 Suckl. mice Australia Unknown G-EXPK' Pig to goat Czech R. I

Czech R. P2-MER Axenic P-8, P-15 Axenic CzechR. fl - Unknown

SHEEP Ad-134, Ad-I52 J-I 7110, J99/9 1-245 (mix)* J-865112, J- 1001570 Ad-127 (mix)d 02-4Al. 0 3 O l b SI, s 2

~

nd nd

Suckl. mice Australia Axenic Czech R. Axenic Czech R. nd nd . Axenic Czech R. Suckl. mice Australia Axenic switz. Axenic switz. +

Unknown Unknown Unknown Unknown LAI-like UII-like

I I

a (+) = Detectable cleavage of 0.52-kb DNA product(s), or detection of amplified 1.8-1.9 kb DNA. (-) = No cleavage (0.52-kb DNA) or no amplification of 1.8-1.9 kb DNA. nd, Not determined.

Detailed VSP gene RFLP data for isolates B1, B2, B3-IA1, 0 1 , 02-4Al and 0 3 are described in [IZ]. Recovered from a goat infected experimentally with isolate P2-MER. Heterogeneous cultures, evident from gdh nucleotide sequence data (5-245) or from allozymic analysis and t s p l l sequence data (Ad- 127).

that of the equivalent Group I (see above) or Group II (Kpn I-, Xba I-, HindIII-) products [12]. They were also distinguished, in assay 4 (vspl267-specific), by the failure to produce any product similar to the 1.8 or 1.6-kb DNA obtained using tem- plate DNA from Group I or Group I1 isolates respectively (Ta- ble 1). The 0.52-kb DNA amplified in assay 1 from these isolates (preceding section) was wholly resistant to cleavage by HindIIT, whilst incubation with Pst I produced fragments typical of either the Group I genotype (in the case of 02-4A1 and 0 3 ) or Group I1 (Ad-127, Ad-159 and Ad-164) (results not shown). Isolates Ad-127, Ad-159 and Ad-159 therefore seem similar to the Group I/II-like genotype defined previously by isolates 02-4A1, 0 3 and CH-H3 (from a human) in Switzerland [12].

The third group of isolates was discerned easily from the others (Table l), firstly because no 1.8-1.9 kb DNA was amplified in assays 2, 3 or 4, and secondly because no HindIII- susceptible product was detected within the 0.52-kb amplified DNA (preceding section). The failure, using locus-specific forward primers, to amplify tsa417 or tspll-like sequences from these isolates (which, on the basis of yielding 0.52-kb PCR products in assay 1, belong to genetic Assemblage A) was ex- ceptional and revealed genotype(s) distinct from any reported previously.

Sequence analysis of cloned tsa417 and tspZZ-like 0.52-kb PCR products.

Multiple sequence alignments. TO obtain nt sequences for comparison with data already available for human-derived Group I and Group I1 isolates [9, PLE, unpubl. data], we cloned, for representative livestock isolates, 0.43-kb segments of the 0.52-kb DNA that had been amplified in assay 1. For some isolates, two kinds of cloned insert were identified and one of each type was sequenced. For other isolates, where only a single type of insert was detected, several clones were ana- lyzed and these proved in each case to be identical. Alignment of these sequences against the sequences of tsa417 and tspll from Group I and Group I1 isolates showed that all had significant homology with one or other of these genes and that on this basis they could be divided into two major clusters.

Four 'type' sequences were evident from the aligned tsa417 segments (Fig. 1). The first (row 1, from sheep isolate 01 ) is identical to nts 1438-1837 of the tsa417 gene of the Group I isolate WB [18], as well as to the DNA amplified from this locus in all other Group I isolates that we have examined (PLE, unpubl. data). The second type (row 2) represents the sequence amplified from the Group VII-like isolate, 0 2 . In row 3 is the type sequence amplified from all genetic Group I1 isolates, whilst in row 4 is the consensus sequence of tsa417-like products derived from sheep- and pig-derived isolates established in Australia (Ad- 132, Ad-134, Ad-152) or the Czech Republic (J-865/12, P-8, P-15). These latter six sequences were poly-


8 0

Human Group I. Sheep 0 1

Sheep 0 2 Human Group I t Novel livestock group

C T GA G T G C G C C A C A A C G A C A GA A T A T C C T C A A A A T G G C G T C T G T G C A C C A A A G G C T A G T . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G . . . . . . . . . . . . . . . . .

. . G . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . . . . . G . . . . . T . . . G T . G A C . . . . . G . . C. . C. . . . . C . . A . . . . . . . . G . . . . . A . . . . A

Human Group I, Sheep 01 Sheep 02 Human Group II Novel livestock group

Human Group 1% Sheep 01 Sheep 0 2 Human Group I1 Novel livestock group

Human Group I, Sheep 01

Sheep 0 2 Human Group II Novel livestock group

Human Group I. Sheep 01 Sheep 0 2 Human Group II Novel livestock group

1 6 0

C C G C G C C A C A C C T A C G T G C A A C G A C T C G C C T A T T C A G A A T G G T G T T T G T G G A A C G T G T G C C G A T A A C T A C T T T A A G A T G A

. . . . . . T . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A . . . . . . . . . . . . . . . . . . . A . . . . . . . . . . . . . . . T . . T C . . . . . . . . . . C . . A . . . . G . . . . . . A . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

2 4 0

A C G G A G G G T G C T A T G A A A C A G T C A A G T A T C C C G G T A A G A C G G T T T G C A T T A G T G C A C C A A A T G G T G G T A C G T G T C A A A A A . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C . . . . . . . . . . . . . . . . G . T . . A , . . . . . . . . C . . A . . C A . .

. ( K p n 1 ) 3 2 0

A A G G A A T G T G C T A G C A G T A C C G A . . . . . . . . . A . C . . . . . . . . . . . . . . . . . A . C . . . . . . . . . . . . . . . . . . . . . . . . . T l r I . .

4 0 0

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T T . C .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A . . . . . . . . . . . . . . T T T C. A . . C . . . . . A . . . A . . . . . A .

C T G T A C T A C G T G T C T G G A C G G A T A T G T A A A G A G T G C A A G T G C G T G C A C A A A G T G T G A C G C T A

A . . . A . G . . G A T A . . T . . . . . . . . . . . .I.. .

Fig. 1. Nucleotide sequences of cloned DNA amplified from the Giardia fsa417 locus using PCR assay 1. ‘Human Group I’ and ‘Human Group 11’ refer to sequences derived from Group I and Group I1 reference isolates respectively, ‘Sheep 01’ and ‘Sheep 02’ to those from isolates 0 1 and 02-4A1. ‘Novel livestock’ group sequences, possessing an additional Kpn I site at nt 313-318, were derived from randomly chosen isolates Ad-132, P-8 and P-15 (from pigs) and Ad-134, Ad-152 and J-865/12 (from sheep). Polymorphisms (R = A or G; Y = C or T) were detected at positions 9 (= G, except for Ad-152), 215 (= C, except for Ad-134) and 379 (= T (Ad-132, P-8, P-15) or C (Ad-134, Ad-152, J-865/ 12)). Dots indicate identity with the Group I sequence (top row). The final two nt (TG) correspond to the 3’ terminus of primer 433. Conserved recognition sites for CZa I, Psr I and Kpn I are boxed. Sequences are available from the N.C.B.I. GenBank database under accession numbers M33641 (Group I), L16974 (Group 11) and U47630 (‘Novel livestock’ group).

morphic at only 3 nt positions, but differed by substitutions at 72 sites (18.0% gross difference) from the Group I tsa417 sequence (row 1) and at 65 sites (16.2% difference) from the Group I1 fsa417 sequence (row 3). In comparison, the sequences of the Group I and Group I1 alleles differed at only 13 sites (3.2%) and both differed at only 7 sites (1.7%) from the 02-4A1 allele (row 2). The row 4 sequence therefore appeared to define a novel tsa417 allele that characterizes a unique G. intestinalis genotype.

The tspl l sequences shown aligned in Fig. 2 are derived from two homologous loci (locus 2 and locus 3, see M&M) and their interpretation is more complex. The first two sequences correspond to the f s p l l gene (locus 2) [13] from isolates belonging to genetic Groups I (row 1) or I1 (row 2) respectively (PLE, unpubl. data). A cloned amplification product identical to the ‘Group I’ allele was obtained from the sheep-derived isolate, 01 . However, all of the other sequences corresponded to the tspll-like ‘type 3’ (locus 3) product detected previously only in Group I1 isolates [ l l , 121 and shown in row 3 as a ‘type’ sequence (Group 11, L3). Sequences from isolates Ad-127 (row 4) and 0 2 (row 5 ) differed from this reference at 9 sites (2.2% difference) and 27 sites (6.6% difference) respectively, and from each other at 28 sites (6.9% difference). All of the remaining sequences, representing samples amplified from Giardia isolated from calves (Ad-119, Ad-144), pig (P-8) and sheep (Ad-134, Ad-152, J-865/12), differed from each other at only nine positions (5 1.7% pairwise difference). Like the cor- respondingly derived locus 1 (fsa417) sequences of Fig. 1, these constituted a unique but coherent subset represented by a consensus allelic sequence (row 6) that differed by substitutions at 70 sites (17.2% gross difference) from the ‘Group 11’ allele (row 3) and by more extensive differences, at 116 sites (28.5% gross difference) and 135 sites (33.2% gross difference) re-

spectively, from the locus 2 (tspll) sequences of Group I and Group I1 isolates (rows 1 and 2).

Phylogenetic analyses. The aligned locus 1 (Fig. 1) and locus 2Aocus 3 (Fig. 2) sequences were subjected to phylogenetic analysis. For each locus, pair-wise Tamura-Nei distance esti- mates were calculated for all nt sites and trees were constructed by the Neighbour-Joining method [25]. Robustness of tree topologies was assessed by bootstrap analysis. Maximum Parsi- mony analysis (Branch and Bound, 50% majority rule; not shown) yielded trees with topologies for the major clusters that were essentially identical to those obtained by Neighbour-Join- ing analysis.

In the case of the rsa417 (locus 1) sequences (Fig. 3, upper section), two clades were evident. The first was comprised en- tirely of the novel sequences derived from isolates Ad-132, Ad-134, Ad-152, 5-865/12, P-8 and P-15. Although these isolates differed in host origin (sheep, pigs), country of origin (Australia, Czech Republic) and type of culture (axenic, suckling mice), the rsa417 sequences derived from them differed at < 3% of nt sites-significantly less than the 18% mean difference (corresponding to 0.2 substitutions per nt site) which distinguished them from the allelic sequences in the second clade (derived from the Group I and Group I1 reference isolates and sheep isolates 01 (Group I) and 02-4A1 (Group MI-like)).

Analysis of the rspll-like (locus 3) sequences (Fig. 3, lower section) showed a similar major dichotomy, with all of the novel sequences derived from isolates Ad- 1 19, Ad- 134, Ad- 144, Ad-152, 5-865/12 and P-8 forming one clade. These differed by approximately 0.23 substitutions per nt site from those in the second clade, which comprised the locus 3 reference sequence (from Group I1 isolates) and allelic sequences from isolates Ad-127 and 02-4A1 differing by 5 0.078 substitutions per site. The detection of two similar sequences from Ad-127

630 J. EUK. MICROBIOL., VOL. 44, NO. 6 , NOVEMBER-DECEMBER 1997

80 A A A T G A A T A T C C T C A A A A T G G G A T C T G T A C T T C A A C G A C C G C

C CG.A CG G.... T.ATAG G.CA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . A . . . . C.CC . . . ACG.CA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T...

C.CA..G..C..I..G..m..AG ..G.m..GG.C..T..

( P S f I ) 160 Group la, Sheep 0 1 [El T C G T A CTTGTAAG A A C G T T G C C A A T G G C A T A T G T A G C T C A T G T A C C A A T G G A T T T C T T C G T A T G A Group II’ [El AA.A. . A . .C. .T . . TC . . . G.TCC . . TG.T . . . . ATA . . . . . G . . . . . . . TC.C . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . .

Sheep Ad-127

Group II‘ [L3] . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . . . ....................... Sheep Ad-127 IL31 . . . . . . . . . . . . c . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . c.....c.... Sheep 02 [L3] . . . . . . . . C . . . . . . . . . . . . . . . C.A . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C . . . . . C . . . . . . . . . . . . . . . . Novellivestockgroupa [L3] C . . . G. C. CA. . C. . . . . . . . . . CCG. . . . . . . . . . T . . A . . . GCG . . C .m. . . . . C. . . . . C . . . . . C . . C . . . . . . .

240 GroupI’,SheepOI [L2] A C G G A G G C T G C T A T G A G A C G A C C A A G T T T C C G G G A A A G A G C G T C T G C G A A G G T G C A A A C G C A G A C G C A G A C A C G T G C A A A Group II’ [LP] . . . . . . . . . . . . . . . . A . . . . . . . . . . . . . ........................... Group 11’ (L3] T C . . . . . . . . T . . . . . . . A . . . C.C . . . . . . . T..T..T.... CC Sheep Ad-127 [L3] C T . . . . . . . A . . . C.C . . . . . . . T..T..T.... CC

. . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . Sheep 02 (L31 . . . . . . . . . . . . . c . . . . . . . . . . . . . . . . A . . . C . C . . . . T . . T . . T . . T . . . . C C Novet livestock groupb [L3] . . . . G . . . . . . . a . . . . . . . . c. A . . . CAC . . . G.A.T . . . . . T.... CC

320 Group 1’. Sheep 01 C T T G T G A T G T G C T C T A A G G G C T G T G A C A C G T G C A G C G A C G C

AG.T G AGAA CTACTT. Group II‘ [L3] T.GGTAAC.T C..TT.TA.T..C.GTA.T.G . . . . Sheep Ad-127 [L3] T. GGTAAC. T C . . T T . T A . T . . C . G T A . T . G T A A C . . G.T . . . C . . G.T . . . . . . . CAGAA . . . . CTACT T. Sheep 02 [L3] T . GGTAA. . T C . . T T . T A . T . . C . G T A . T . G T A A C . . G.T . . . . . . G.T . . . . . . . CAGAA . . . . CTACTT.

G.T . . . . . . G.T . . . . . . . CAGAT . . . . CTAC.C.

[LZ] G C A C C T G T T C C A GG T T A C A A AG T A G A GGC AGG A A A Group 11‘ [LZ] A.G . . . AC . . . G . . . . . . . . . . . . . . . . . G..... . . . . . T.C. . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . .

Novel livestock groupa [L3] T , . A T G . C . T ...I T.TA.T..C.GTA.T..TAAC..

400 GroupI‘,SheepOI [LP] A A C T A C T T G T A C A A A A T G T G G A G A T G G A T A C A C A A A A A T T G A A A A C A G C C A A A C A T G C A C A A A G T G T G A T T C C A G C T G T G Group 11’ [LP] . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G . . G . . . . . . . . . . . . . . . . . . . . . C G . T . . . . . . . Group IV [L3] . . G.G . . . . C . . G.C . . . . A A . . . . . . . . . T..........G..G.. . . . . . . . T . . . . . . . . . . . . . . . . . . . . . . Sheep Ad-127 [L3] . . G.G . . . . . . . G.C . . . . A A . . . . . . . . . . . . . . . . . . . . G . . G.. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Sheep 02 [L3] .GG.GA . . . C . . G . C . . . C A A . . . . . . . . . T . . . . . . . . . A G . G G . . . . . . . . . . . . . . . . . . . . . . . . C G . T . . . . . . . Novel livestockgroupb [L3] . . G C . . . . . C . . . . C . . . C A A . . . . . . . . . T . . . . . . . . . . G G . G . G . . . . . . . . . . T . . . . .I. . . . . C C . T . . . . . . . Fig. 2. Aligned sequences of cloned DNA amplified in PCR assay 1 from the tspll (locus 2) or tspll-like (locus 3) gene. Rows 1 and 2

show tspll (locus 2 [L2]) sequences of Group I or Group I1 isolates respectively. Shown in rows 3-6 are zspll-like (locus 3 [L3]) sequences from Group I1 isolates (reference L3 sequence, row 3); isolates Ad-127 and 02-4A1 (rows 4 and 5) , and ‘Novel livestock’ isolates (row 6). A Pst I site (boxed) at nt 86-92 is diagnostic for this locus in Group I1 genotypes [l 11. For other details, see Fig. 1. Codon gaps (-) were positioned by comparison with alignments of the inferred polypeptide sequences. Polymorphisms were detected at positions 9 (R = A, except P-8), 51 (M = C , except Ad-I34 & J-865112 [=A]), 57 (Y = T, except P-8), 69 (Y = C , except Ad-I44 & Ad-152), 131 (R = G, except P-8), 132 (Y = C , except P-g), 180 (R = G, except J-865/12), 258 (Y = C, except J-865/12) and 384 (R = G, except Ad-119). GenBank accession numbers for these sequences are M95814 (Group I: L2), L16972 (Group 11: L2), L16973 (Group 11: L3) and U47631 (‘Novel livestock’ group: L3).

was supported by allozymic data indicating that this uncloned isolate contained two closely related genotypes. The consistent segregation, into a unique clade, of all sequences (tsa417, or tspll-like) derived from isolates that had been distinguished previously on the basis of PCR assays 1-4 and RFLP analyses (Table I) as ‘novel’, provided unambiguous support for placing these isolates into a distinct but largely coherent genetic groupdesignated herein as ‘Novel livestock’.

Analysis of the glutamate dehydrogenase locus. Data were obtained for this locus from most of the isolates in the test panel. Each 1.2-kb gdh PCR product was tested initially for FWLP which enable differentiation of Assemblage A and B genotypes [30]. The results (Table 2) revealed two distinctive profiles. The first, characterized by resistance to Apa I and susceptibility at single sites to BspH I, EcoR I, Kpn I and Sac I, was identical to that observed for DNA amplified from the GDH gene of Group I and Group I1 (Assemblage A) organisms isolated from humans (Table 2). In each case, cleavage occurred at the same conserved sites. Products of this type were recovered from isolates Ad-161 and Ad-164 (alpaca), Ad-159 (horse), G-EXPWZ-MER (pig), and Ad- 127, J-245, 0 1, 02-4A1, 0 3 , S1 and S2 (sheep). The second profile, characterized by susceptibility to Apa I, BspHI and EcoRI but resistance to Kpn I and Sac I, differed from both Group UII (Assemblage A) and Assemblage B profiles at three out of the five sites tested

(the Assemblage A and B profiles differ at four of these sites). Products of this novel second type were obtained from 15 of the 27 isolates tested in this assay, namely Ad-163 (alpaca), Ad-1 19, Ad-133, Ad-144 and T-60538/17 (calves), G-247/1 (goat), Ad-132, P-8 and P-15 (pigs), and Ad-134, Ad-152, J-17/ 10, J-865/12, 5-99/9 and J-100/570 (sheep). All of these latter isolates could also be assigned to the ‘Novel livestock’ group on the basis of VSP gene data.

To determine more precisely how ‘Novel livestock’ genotypes are related to the other characterized genotypes of Assem- blages A and B, DNA amplified from the gdh locus of several livestock-derived Giardia was subjected to sequence analysis (Fig. 4). As was found for the VSP genes, the sequences from some isolates (Ad-127, Ad-159, Ad-161, 5-245 and P2-MER) were identical with those obtained from the Group I reference isolates-in the case of Ad-127, over the entire 690 bp segment examined (nt 175-864 of the gdh coding sequence); for the other isolates, over a shorter 544 bp segment (nt 310-799) determined using primers 1051 and 1052. Six products possessing the ‘Novel livestock’ group RFLP profile (from isolates Ad-119, Ad-132, Ad-152, G-247/1, J-17/10 and P-15) showed near-identity, differing at 5 7 polymorphic sites (5 1.3% difference). Over the 608 bp segment examined (nt 175-782), the sequences determined for this group of isolates differed by substitutions at 37 sites (97% synonymous; 6.1% gross difference)

EY ET AL.-ANALYSIS OF GZARDIA FROM HOOFED LIVESTOCK 63 1

+ - + Human (B) I Ad-28. Ad-52

tsa 41 7 (locus 1)

tspII-like (locus 3)

Ad- 132

f ;:;5 Ad-I52 Ad- I34 J-865/12

0.105

W: 0.02 substitutions per nuclwtide site

Sheep

HUMAN Sheep HUMAN

Sheep

1

Ad-134 J-865/12 I Sheep

Ad-119 , - P-8 Ptg

Ad.144 I 0.101

1 (9s)<plI HUMAN

0.072 Ad-I27 I

Fig. 3. Relationships between Giardia isolated from livestock and humans, inferred by phylogenetic analysis of tsa4Z7 (locus 1, top) and tspZZ-like (locus L3, bottom) nt sequences. The dendrograms were constructed by Neighbour-Joining analysis of Tamura-Nei distances (calculated for all sites shown in Fig. l , 2) using MEGA [25]. Inter-nodal branch lengths (mean number of substitutions per nt site) are shown, together with bootstrap values (96, from 5,000 iterations; in parentheses) for the major clusters.

from the consensus sequence determined for Assemblage A (Group I and Group 11) isolates and at 56 sites (9.2%) from that of Assemblage B isolates. For comparison, the Group I and Group TI gdh sequences differed at only four sites (0.7%), with each differing from the Assemblage B sequence at 62 sites (10.2%). All of the sequences obtained from amplified gdh DNA appeared homogeneous, except that from isolate 5-245. The latter sequence, despite overall identity with Group I, showed unambiguous evidence of a second product (double nt peaks, confined to sites at which mutations characterizing the ‘Novel livestock’ genotype are found). The identity of the mi- nor nt detected at each of these positions confirmed that the second sequence was of the latter type. Phylogenetic analyses using both Neighbour-Joining (Fig. 5 ) and Maximum Parsi- mony (not shown) revealed three major lineages. Mid-point rooting suggested that the ‘Novel livestock’ lineage forms a clade with genetic Groups I and 11.

Allozyme electrophoresis. Some isolates, including several identified as ‘Novel livestock’, were examined by enzyme electrophoresis and the allelic profiles were compared with those obtained from G. muris and from Assemblage A (Group I, Group 11) or Assemblage B standards (Fig. 6). Fixed allelic differences ranged from 0% (S1 v S2) to 84% (G. muris [Ad- 1201 versus all other isolates). Group I and Group I1 isolates were separated from each other and from the Assemblage B isolate by fixed allelic differences at approximately 40% and 80% of loci respectively. The ‘Novel livestock’ isolates formed a separate cluster, differing at approximately 62% of loci from the Assemblage A standards and at 79% of loci from the As- semblage B representatives. This supported the affinity of the ‘Novel livestock’ genotypes with Assemblage A but also confirmed their clear separation from the Group I and Group I1 human isolates that originally defined this Assemblage. Within the ‘Novel livestock’ cluster, isolates P- 15 and Ad- 132 (derived from pigs and differing at 10% of loci) exhibited fixed allelic

Table 2. Restriction sites detected in 1.2-kb GDH gene segments amplified by PCR from Giardia isolated from livestock and from humans.

Host species Isolate ApaI BspHl EcoRl KpnI Sac1

Ad-161, Ad-164

Ad-I63

Ad-119. Ad-I33

I

Horse I I

Alpaca

I Ad-144, T-60538/17 Calf

Goat I G-241/1

Ad-I59 Ad-162

Ad-132, P-8, P-15

G-EXPK. P2-MER

Pig

Sheep Ad-134, Ad-I52 J- 17/10, J-99/9 1-100/570, J-865/12 Ad-I27 (mix), 01 0 2 - 4 A 1 , 0 3 J-245 (mix), S1, S2

I -a I +a

+ nda

+ + nd +

+ +

: + + + + r?J :

nd + 1 : : j + + + + + + + 1-1

: + + +

+ + + + + + + + + t

a + = cleaved (at a single site); - = not cleaved; nd = not determined.

Axenic isolates representative of the Group I (A-I) or Group I1 (A-11) sublineages of Assemblage A, or of genetic Assemblage B (B).

differences from the other five isolates (Ad-133, Ad-152, Ad-119, Ad-I34 and Ad-144-from calves and sheep) at 34% of loci. Variation between the latter five isolates ranged from 5% between Ad-144 and Ad-134 to 16.5% between Ad-133 and Ad-152, Ad-119, Ad-134 or Ad-144.

DISCUSSION In this study, isolates of Giardia originating from farm ani-

mals on three continents were compared with representatives of the two major assemblages and subgroups discerned previously among human- and animal-derived G. intestinalis [2, 20, 27, 30, 33, 381. The divergence of VSP genes was used to identify and elucidate relationships between similar organisms, whilst the more conserved gdh locus was used to investigate relationships between more divergent isolates. Allozyme data, reflect- ing differences among a broad spectrum of 22 ‘housekeeping’ genes, provided independent support for the genetic relationships deduced by direct analysis of the VSP and GDH genes. Because of the consistency between these various analyses, we are confident that the deduced relationships reflect the ancestry of the organisms rather than a particular ‘gene tree’.

Sixteen isolates, representing 52% of the test panel, shared similarities of genotype that in all of the assays employed set them apart from the previously described Group I, Group I1 and Group I/II-like genotypes and showed them to be representatives of a distinct (‘Novel livestock’) lineage within genetic Assemblage A. These organisms define a genetically cohesive group that is separated from the aforementioned Assemblage A genotypes by fixed allelic differences at approximately 62% of enzyme loci (allozymic analysis) and by mean nt sequence differences of 0.07, 0.21 and 0.23 substitutions per nt site at the

632 J. EUK. MICROBIOL., VOL. 44, NO. 6, NOVEMBER-DECEMBER 1997

m i 8 0 200 2 5 0 ( A p e I ) AssemblageA.GroupI' A T C T T C C G C G T G C C C T G G A T G G A T G A C G C T G G A C G C A T C A A C G T C A A C C G C G G C T T C C G T G T C C A G T A C A A C T C T G C T C T C G G C C C C T A C A A G G G T G G C ~ Assembiage A, Group lla . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Assemblage BD Novelliveslockgmup . . . . . . . . . . . . . . . . . . . . . . . . . . C . .

. . G . . . . . T..C. . . . . . . . . . . . FP-1052 ========> 3 0 0 3 5 0

AssemblageA.Group1' T C C G C T T C C A C C C C T C T G T C A A T C T T T C G A T T C T C A A G T T C C T C G G T T T C G A G C A G A T C C T G A A G A A C T C C C T C A C C A C G C T C C C G A T G G G C G G C G G C A A Assemblage A, Group 11* . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Novel livestock group . . . . . . . . . . . . . . c. . . . . . . . . . . . . . . . . Assemblage €3' . . . .C . . . . . C..T...........C..T...............

4 0 0 . B s p H I S a c 1 Assemblage A, Group Is GGGC GACTTT TCCGACAACGAGGTCATGCGC TCCT CAGAGGCACGTCGGCGCCGAC Assemblage A, Group Ila . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Novel livestock group . . . . . . . . . . . . T . . . . . . . . . . . . . . . . . T . . . . . . . . . . . . . . . T..G..T... Assemblage BD . . . . . . . . . . . . . . . C . . T . . T . . . . . . . . . . . G . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . . . . . . . l . . . . . . . . . . . . . . G . . T . . .

500 . K p n l . 5 5 0 Assemblage A, Group l a ACT G ACG T T CC T GC CGGCG AC CGTCGGCGCCCGCGAG T G T A C G G A C A G T A C A A G C G C C T G A G G A A C G A G T T C A C A G G C G T C C T C A Assemblage A. Group Ila . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Novel livestock gmup . . . . . T . . . . . . . . . . . . . . . . . . . . . . . . T... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T..G . . . . . . . . . . Assemblage 8' . .c . . GT . . . . . . . . . . . T..T....TT.. .T . . . . . . . . C . . . . . . . . . . . L 1 . . G . . . . . . . . . .

6 0 0 6 5 0 AssemblageA,Gioupla C A G G C A A G A A C G T C A A G T G G G G C G G G T C T T T C A T C A G G C C G G A G G C C A C G G G C T A T G G C G C T G T C T A C T T C C T G G A G G A G A T G T G C A A G G A C A A C A A C A C

Novelliveslockgmup .G . . . . . . . . . . . . . . . . . . . . . . . . . . C . . . . . . . . . . . . . . . . . . . . A . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Assemblage ED .G . . . . . . . . . A.......... C A . . A . . . . . . . . A . . G . . . . . A . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . . . . . . . .

Assemblage A. Group Ila . . . . . . . . . . . . . . . . . . . . . . . . . . . . C . . . . . . . . . . . . . . . . . T . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . .

7 0 0 7 5 0 AssemblageA,Groupla T G T G A T C A G G G G T A A G A A C G T C C T T C T T T C T G G C T C C G G C A A C G T T G C C C A G T T T G C T T G C G A G A A G C T C A T T C A G C T C G G C G C A A A G G T C C T C A C C T T C

Novel tneslockgroup Assemblage A. Group 11' . . . . . . . . . . . . . . . . . . . . . . . . C . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . . . . . . . . . . .

Assemblage ED C . . A . . . . . . . . C . . . . . . . . . . . C . . C . . . . . . . . T . . . . . . . . . . . T . . . . A C . . G . . . . . . . . . . . . C . C . . . . . . . . T . . G . . . . . . . . . . . . . . . . . . A . . . . . . . . C . . . . . . . . . . . C . ................... C . .I. . A . . . . . . . . T . . . . . .

Fig. 4. Aligned nt sequences of GDH gene PCR products. Assemblage NGroup I, Assemblage A/Group I1 and Assemblage B are 'type' sequences derived from isolates belonging to Groups I or I1 of Assemblage A, or to genetic Assemblage B, respectively [30]. Numbers represent distance from the initiation codon. Restriction sites used to determine RFLP profiles (Table 2) are boxed. Products derived from livestock-derived isolates were either identical to those from Group I isolates (for Ad-127, Ad-159. Ad-161, 5-245, P2-MER) or nearly identical with products obtained from other 'Novel livestock' isolates (for Ad-1 19, Ad-132, Ad-152, G-247, J-17/10, P-15). Sequences from the latter isolates differed at 2 7 polymorphic sites (c.f. Fig. 1; K = G or T, S = C or G). The segment corresponding to sequencing primer 1051 (nt 274-293) is indicated. GenBank accession numbers are L40509 (Group I), L40510 (Group II), L40508 (Assemblage B) and U47632 ('Novel livestock' group).

I P2-MER Pig I Ad-159 Horse

Fig. 5 . Relationships between isolates of Giardia, inferred by phylogenetic analysis of nt sequences derived from the gdh locus. The den- drogram was constructed from Neighbour-Joining analysis of Tamu- ra-Nei distances (calculated for a11 sites) using MEGA [25]. Inter-nodal branch lengths (mean number of substitutions per nt site) and bootstrap values (%, from 2,000 iterations, in parentheses) for the major clusters are indicated.

Assemblage A

0.020

(88%) 4 Ad-2 I HUMAN Group I1 Bris- 136

Ad-132 Pig Pig

5-17/10 Sheep (99%) Ad-152 Sheep

G-247/1 Goat Ad-119 Calf

Ad- 19 Ad-28 Ad-52

Assemblage B 0.063

( 100%) - &&e: 0.01 substitutions

per nucleotide site

'Novel livestock'

group

HUMAN


s1, 52 (s)

‘Novel Livestock

group’

L .

Ad-127 (S)

Assemblage Ad- 144 (C)

Ad-134 (S)

Ad-1 19 (c) Ad- 1 52 ( 5 ) Ad- 1 33 ( C)

P-15 (PI Ad-l32(p)

Assemblage I

C. muris (mouse) Ad-120

0 20 40 60 80 100

Percent Fixed Genetic Differences l l i I l 1 1 ~ ~ 1 1

Fig. 6. Phenogram constructed by allozymic interpretation and cluster analysis of enzyme electrophoresis data obtained for representative isolates of Giardia. Samples included human-derived reference isolates of G. intestinalis, representative of Groups I (Ad-llc7) and I1 (Ad-Uc2, Bris-136lc2) of Assemblage A and Group I11 (BAH-12) of Assemblage B [28]. An isolate of G. muris (Ad-120), a morphologically distinct species, was included as an outgroup. The origin of each livestock- derived isolate is indicated: calf (c). pig (p), sheep (s).

gdh, tsa417 and tspll-like loci respectively. The latter differences are approximately sevenfold greater than those which dis- tinguish genetic Groups I and 11, indicating that the branchpoint of the ‘Novel livestock’ and Group I/Group I1 lineages is rel- atively ancient compared to that of Groups I and 11.

The prevalence of ‘Novel livestock‘ genotypes amongst samples isolated axenically or by growth in suckling mice from geographically diverse localities around the world indicates that they are ubiquitous in the five artiodactyl species investigated herein. Moreover, their association with cloven-hoofed animals (even-toed, Order Artiodactyla) appears to be unique. Analysis of more than 150 Giardia isolates from humans and about 30 isolates from non-hoofed animals (established by either technique) has not identified any with similarity to the ‘Novel livestock’ genotype(s) [2, 12, 27, 301, making it unlikely (from a statistical viewpoint) that these organisms infect humans or nonartiodactyl animals. These findings thus represent the first clear indication of restricted host range by a defined subpopu- lation of G. intestinalis, which contrasts with evidence of a broad host range (encompassing all known large mammals) for Group I isolates.

Ten Giardia samples (excluding G-EXPK) were indistinguishable from genetic Group I isolates. These comprised organisms isolated by awenic culture from sheep, cattle and a pig in Europe or North America, and isolates established from an alpaca and a horse in Australia by growth in suckling mice. Isolate J-245 (sheep) was a mixture of two genotypes, a ‘Novel livestock’ genotype being detected in addition to the dominant

Group I genotype by gdh nt sequence analysis. The isolation, from humans and various animal species including domesticat- ed livestock, of these genetically monomorphic organisms (= group 1 of Nash [30, 331) by axenic culture and by growth in suckling mice makes a strong case that Group I is a recently derived clone and that its members have broad host specificity. The remaining five isolates (from sheep, a horse and an alpaca) had very close genetic affinities with organisms belonging to Groups I or I1 and showed similarity to a Group MI-like genotype identified previously in Switzerland [ 121. The inclusion within this subset of a human-derived isolate (CH-H3, ref. [12)] indicates that they may be capable of zoonotic transmission to humans.

Surprisingly, no Assemblage B genotypes were identified. We consider this highly significant, as organisms belonging to Assemblage B (equivalent [30] to the ‘Belgian’ genotype of Homan [20] and to group 3 of Nash [33]) are prevalent worldwide not only among isolates from humans [3, 20, 27, 30, 33, 381 but also in small sample sets (I 5 isolates) from various animals. For example, from a separate panel of 18 animal-derived axenic isolates that we have examined, ten (from chin- chillas, rats, dogs, beavers, a slow loris and a siamang) be- longed to Assemblage B [30; PLE, JK & JI-R, unpubl. data]. The remainder-from beavers, cats, a dog, a loris and a guinea pig-were Group I (Assemblage A) organisms [12, 30; RHA, GM & PLE, unpubl. data]. Because the technique of isolation via suckling mice 1281 seems to favor growth of Assemblage B genotypes [2, 271, the absence from the current test panel (which included 13 isolates established by this method) of organisms belonging to this genetic assemblage suggests that they are not infectious for hoofed livestock. If so, this would con- stitute the first evidence of a boundary to the very broad apparent host range of Assemblage B organisms.

If Giardia has a clonal structure [37], the most likely expla- nation for the origins of the dichotomies now evident within G. intestinalis [27, 30; this study] is that they are due to ‘founder’ effects (spatial segregation of clonal ancestors), either in new hosts or in isolated biogeographical areas. The contemporary population structure of G. intestinalis can thus be viewed as rooted in a nested series of ancient and genetically isolated clones. The ‘Novel livestock‘ group appears to derive from one such clone, which is itself rooted in the common ancestor of genetic Assemblage A. Continued accumulation of genetic data on new isolates should help to define more clearly the natural distribution of these different G. intestinalis genotypes in various host populations. However, cross-transmission trials are now warranted to assess the infectivity of each major genotype for different hosts. These should preferably utilize cloned trophozoite populations and verified parasite-free adoptive hosts, and include a comparison of the genotype(s) recovered after growth in an adoptive host with the organism(s) given in the infective inoculum. This would test the validity of presumed host ranges (deduced from epidemiological data) and determine whether verified zoonotic genotypes are equally virulent in different susceptible host species. In a preliminary trial the porcine isolate PZ-MER (identified in this study as a Group I genotype) has been transmitted successfully to a goat, being recovered as isolate G-EXPK (Table 1; JK & Koudela, B., unpubl. data).

With respect to animal husbandry and human public health there is, on balance, a sufficiently strong case that Giardia are transmissible between different species of domestic livestock that the possibility should be considered when tracing sources of infection or organizing quarantine measures. There is also reason for concern that some human giardiasis could be ac- quired from domestic livestock, either by direct contact or by contamination of water catchments. The latter appears not to be

634 J. EUK. MICROBIOL., VOL. 44, NO. 6, NOVEMBER-DECEMBER 1997

given serious attention by water management authorities. Two points can be made with conviction. Firstly, any outbreak of giardiasis caused by organisms belonging to genetic Assem- blage B is most unlikely to have arisen from water contami- nated by farm livestock. Secondly, animals carrying only ‘Nov- el livestock’ genotypes are most unlikely to transmit their infections to humans, whereas those infected with Group I or Group MI-like organisms (Group I1 organisms have yet to be detected in animals) are almost certainly a potential source of infection for humans.

ACKNOWLEDGMENTS

We thank Jocelyn Darby and John Mackrill for expert tech- nical assistance, Michael O’Callaghan (Primary Industries S. A., Adelaide) and Drs. I. Pavlasek (National Veterinary Insti- tute, Prague) and B. Koudela (Institute of Parasitology, ASCR., Ceske Budejovice) for providing Giardiu-infected animals and fecal specimens. Dr. J. Isaac-Renton (University of British Co- lumbia, Vancouver, Canada) kindly provided isolates S 1 and S 2 , and Professor €? Kohler (University of Zurich, Zurich, Switzer- land) provided DNA from Swiss Giurdia isolates. This work was supported by grants from the National Health and Medical Research Council of Australia, the University of Adelaide Fac- ulty of Medicine Research Committee and by Grant 2061951 0638 of the Grant Agency of the Czech Republic.

LITERATURE CITED

1. Andrews, R. H., Chilton, N. B. & Mayrhofer, G. 1992. Selection of specific Giardia intestinalis by different growth conditions. Parasi- tology, 105:375-386.

2. Andrews, R. H., Adams, M., Boreham, F! E L., Mayrhofer, G. & Meloni, B. P. 1989. Giardia intestinalis; electrophoretic evidence for a species complex. In?. J . Parasitof., 19:183-190.

3. Baruch, A. C., Isaac-Renton, J. & Adam, R. D. 1996. The molecular epidemiology of Giardia lambfia: a sequence-based approach. J. Infect. Dis.. 174:233-236.

4. Buret, A., den Hollander, N., Wallis, l? M., Befus, D. & Olson, M. E. 1990. Zoonotic potential of giardiasis in domestic ruminants. J . Infect. Dis., 162:23 1-237.

5. De Jonckheere, J. E, Majewska, A. C. & Kasprzak, W. 1990. Giardia isolates for primates and rodents display the same molecular polymorphism as human isolates. Mof. Biochem. Parasitol., 39:23-28.

6. Erlandsen, S. L. 1994. Biotic transmission-Is Giardiasis a zoo- nosis? In: Thompson, R. C. A., Reynoldson, J. A. & Lymbery, A. J. (ed.), Giardia: From Molecules to Disease. CAB International, Wal- lingford, UK. Pp. 83-97.

7. Erlandsen, S. L., Sherlock, L. A., Bemrick, W. J., Ghobrial, H. & Jakubowski, W. 1990. Prevalence of Giardia spp. in beaver and muskrat populations in northeastern states and Minnesota: detection of intestinal trophozoites at necroscopy provides greater sensitivity than detection of cysts in fecal samples. Appl. Environ. Microbiof. 56:3 1-36.

8. Erlandsen, S. L., Sherlock, L. A., Januscka, M., Schaefer, E W., Jakubowski, W. & Bemrick, W. J. 1988. Cross-species transmission of Giardia spp.: inoculation of beavers and muskrats with cysts of human, beaver, mouse, and muskrat origin. Appl. Environ. Microbiol. 542771- 2785.

9. Ey, P. L. & Mayrhofer, G. 1993. Two genes encoding homologous 70-kDa surface proteins are present within individual trophozoites of the binucleate protozoan parasite Giardia intestinalis. Gene, 129:257- 262.

10. Ey, l? L., Andrews, R . H. & Mayrhofer, G. 1993. Differentiation of major genotypes of Giardia intestinalis by polymerase chain reaction analysis of a gene encoding a trophozoite surface antigen. Parasitology. 106:347-356.

11. Ey, P L.. Andrews, R. H., Mayrhofer, G. & Darby, J. M. 1993. Giardia intestinalis: detection of major genotypes by restriction analysis of gene amplification products. In?. J. Parasitol.. 23:591-600.

12. Ey, P L., Bruderer, T., Wehrli, C. & Kohler, l? 1996. Comparison of genetic groups determined by molecular and immunological analyses

of Giardia isolated from animals and humans in Switzerland and Aus- tralia. Parasitol. Res., 82:52-60.

13. Ey, €? L., Khanna, K., Manning, F? A. & Mayrhofer, G. 1993. A gene encoding a 69-kilodalton major surface protein of Giardia intes- tinafis trophozoites. Mol. Biochem. Parasitol., 58:247-258.

14. Ey, P. L., Khanna, K., Andrews, R. H., Manning, l? A. & Mayr- hofer, G. 1992. Distinct genetic groups of Giardia intestinalis distinguished by restriction fragment length polymorphisms. J. Gen. Micro- biol., 138:2629-2637.

15. Farthing, M. J. G. 1994. Giardiasis as a disease. In: Thompson, R. C. A., Reynoldson, J. A. & Lymbery, A. J. (ed.), Giardiu: From Molecules to Disease. CAB International, Wallingford, UK. Pp. 15-37.

16. Feely, D. E. 1986. A simplified model for in vitro excystation of Giardia muris. J . Parasitol., 72:474-475.

17. Filice, E I? 1952. Studies on the cytology and life history of Giardia from the laboratory rat. Univ. Calif: Pubf. Zool., 57:53-146.

18. Gillin, E D., Hagblom, I?, Harwood, J., Aley, S. B., Reiner, D. S., McCaffery, M., So, M. & Guiney, D. G. 1990. Isolation and ex- pression of the gene for a major surface protein of Giardia lamblia. Proc. Natf . Acad. Sci. USA, 87:4463-4467.

19. Higgins, D. G., Bleasby, A. J. & Fuchs, R. 1992. CLUSTAL V improved software for multiple sequence alignment. Comput. Appf. Biosci., 8: 189-1 91.

20. Homan, W. L., van Enckevort, E H. J., Limper, L., van Eys, G. J. J. M., Schoone, G. J., Kasprzak, W., Majewska, A. C. & van Knapen, E 1992. Comparison of Giardia isolates from different laboratories by isoenzyme analysis and DNA probes. Parasitof. Res., 78:316-323.

21. Kappus, K. D., Lundgren, R. G. -Jr., Juranek, D. D., Roberts, J. M. & Spencer, H. C. 1994. Intestinal parasitism in the United States: update on a continuing problem. Am. J. Trop. Med. Hyg., 50:705-713.

22. Kirkpatrick, C. E. & Green, G. A. -1V. 1985. Susceptibility of domestic cats to infections with Giardia lamblia cysts and trophozoites from human sources. J. Clin. Microbiol., 21:678-680.

23. Koudela, B., Nohgnkova, E., Vitovec, J., Pakandl, M. & Kulda, J. 1991. Giardia infection in pigs: detection and in vitro isolation of trophozoites of the Giardia intestinalis group. Parasitology, 102: 163- 166.

24. Kulda, J. & Nohgnkovi, E. 1996. Giardia in humans and animals. In: Kreier, J. l? (ed.), Parasitic Protozoa, 2nd ed. Academic Press, San Diego. 10:225-422.

25. Kumar, S., Tamura, K. & Nei, M. 1994. MEGA: molecular evo- lutionary genetics analysis software for microcomputers. Comput. Appf. Biosci., 10: 189-1 95.

26. Majewska, A. C. 1994. Successful experimental infections of a human volunteer and Mongolian gerbils with Giardia of animal origin. Trans. R. SOC. Trop. Med. Hyg . , 88:360-362.

27. Mayrhofer, G., Andrews, R. H., Ey, I? L. & Chilton, N. B. 1995. Division of Giardia isolates from humans into two major Assemblages by electrophoretic analysis of enzymes encoded at 27 loci and comparison with Giardia muris. Parasitology. 111:ll-17.

28. Mayrhofer, G., Andrews, R. H., Ey, I? L., Albert, M. J., Grim- mond, T. R. & Merry, D. J. 1992. The use of suckling mice to isolate and grow Giardia from mammalian faecal specimens for genetic analysis. Parasitology, 105:255-263.

29. Meloni, B. P., Lymbery, A. J. & Thompson, R. C. A. 1995. Genetic characterization of isolates of Giardia duodenalis by enzyme electrophoresis: implications for reproductive biology, population structure, taxonomy, and epidemiology. J. Parusitof., 81:368-383.

30. Monis, P T., Mayrhofer, G., Andrews, R. H., Homan, W. L., Limper, L. & Ey, €? L. 1996. Moleular genetic analysis of Giardia intestinalis isolates at the glutamate dehydrogenase locus. Parasitology, 112:l-12.

31. Mowatt, M. R., Aggarwal, A. T. & Nash, T E. 1991. Carboxy- terminal sequence conservation among variant-specific surface proteins of Giardia famblia. Mol. Biochem. Parasitof., 49:215-228.

32. Nash, T. E. 1992. Surface antigen variability and variation in Giardia lamblia Parasitol. Today, 8:229-234.

33 . Nash, T E. & Mowatt, M. R. 1992. Identification and characterization of a Giardia famblia group-specific gene. Exp. Parasitof., 75: 3 69 -37 8.

34. Ruest, N., Couture, Y. & Faubert, G. 1995. Pathogenic potential of Giurdiu infection in cattle. Furusitof. Today, 11: 184.

35. Strand&, A. M., Eckert, J. & Kohler, l? 1990. Electrophoretic


characterization of Giardia isolated from humans, cattle, sheep, and a dog in Switzerland. J. Parasitol., 76:660-668.

36. Taminelli, V., Eckert, J. , Sydler, T., Gottstein, B., Corboz, L. & Hoffman, M. 1989. Experimental infection of calves and lambs with bovine Giardia isolates. Schweiz. Arch. Tierheilk., 131:551-564.

37. Tibayrenc, M., Kjellberg, E Clr Ayala, E J. 1990. A clonal theory of parasitic protozoa: the population structures of Entamoeba, Giardia, Leishmania, Naegleria, Plasmodium, Trichomonas, and Trypanosoma and their medical and taxonomical consequences. Proc. Nad. Acad. Sci. USA, 87:24 14-24 18.

38. van Keulen, H., Homan, W. L., Erlandsen, E. L. & Jarroll, E. L. 1995. A three nucleotide signature sequence in small subunit rRNA divides human Giardio into two different genotypes. J. Euk. Microbiol., 42:392-394.

39. Wallis, F? M. 1994. Abiotic transmission-Is water really significant? In: Thompson, R. C . A., Reynoldson, J. A. & Lymbery, A. J. (ed.), Giardia: From Molecules to Disease. CAB International, Wal- lingford, UK. Pp. 99-122.

40. Weiss, J. B., van Keulen, H. & Nash, T. E. 1992. Classification of subgroups of Giardia lamblia based upon ribosomal RNA gene sequence using the polymerase chain reaction. Mol. Biochem. Parasitol., 54:73-86.

41. Xiao, L. 1994. Giardia infection in farm animals. Parasitol. Today, 10:436-438.

Received 12-6-96, 4-9-97, 7-24-97; accepted 8-5-97

Genetic Analysis of Giardia from Hoofed Farm Animals Reveals Artiodactyl-Specific and Potentially...

Documents

Transcript of Genetic Analysis of Giardia from Hoofed Farm Animals Reveals Artiodactyl-Specific and Potentially...