Functional genomics of calcium channels in human melanoma cells

Tam�as Deli1, Norbert Varga2, Attila �Ad�am2, Istv�an Kenessey

2, Erzs�ebet R�as�o2, L�aszl�o G. Pusk�as3, J�ozsef T�ov�ari1,

J�anos Fodor1, M�onika Feh�er1, Gyula P. Szigeti1, L�aszl�o Csernoch1 and J�ozsef T�ım�ar2*1Department of Physiology, Research Center for Molecular Medicine, Medical and Health Science Center,University of Debrecen, Debrecen, Hungary2Department of Tumor Progression, National Institute of Oncology, Budapest, Hungary3Laboratory of Functional Genomics, Biological Research Center, Hungarian Academy of Sciences, Szeged, Hungary

Ca21-signaling of human melanoma is in the focus of intensiveresearch since the identification of the role of WNT-signaling inmelanomagenesis. Genomic and functional studies pointed to theimportant role of various Ca21 channels in melanoma, but thesedata were contradictory. In the present study we clearly demon-strate, in a number of different ways including microarray ana-lysis, DNA sequencing and immunocytochemistry, that varioushuman melanoma cell lines and melanoma tissues overexpressryanodine receptor type 2 (RyR2) and express P2X7 channel pro-teins as compared to melanocytes. These channels, although retainsome of their usual characteristics and pharmacological proper-ties, display unique features in melanoma cells, including a func-tional interaction between the two molecules. Unlike P2X7, RyR2does not function as a calcium channel. On the other hand, theP2X7 receptor has an antiapoptotic function in melanoma cells,since ATP-activation suppresses induced apoptosis, while knockdown of the gene expression significantly enhances that.' 2007 Wiley-Liss, Inc.

Key words: human melanoma; ryanodine receptor-2; P2X7 receptor;Ca21 transient; apoptosis

There is abundant information on genes and pathways involvedin melanoma development that are specific for this type of can-cer.1 Furthermore, melanogenic apparatus and pathways regulat-ing it can affect the behavior of melanoma cells2 and are very use-ful in pathologic diagnosis of melanoma.1 Most of the markersused today for differentiation between benign and malignant mela-nocytic lesions are pigmentation pathway-associated genes drivenby the microphthalmia transcription factor and include tyrosinase,TRP1/gp100, TRP2/DCT (dopachrom tautomerase), MART1/melan-A and S100b.1,2 With the invention of DNA microarraytechnology, several attempts have been made recently to identify amelanoma-specific gene signature to help improving our differen-tial diagnostic potential. Comparison of the major studies pub-lished in this area indicated that only a dozen of melanoma genescan be collected, the expression of which is repeatedly found inthe literature and include RAB33A, ErbB3, adrenergic receptorb2 and 3 kinases: MERTK, SNF1LK and ITPKB.3 The list ofthe differentially expressed genes, which are confirmed at proteinlevel, and the functional data are available and are also short.These genes include those of the signaling molecules NOTCH2,4

WNT5A,5 proliferation-associated genes topoisomerase II a6,7

and cell division cycle 2,8 fibroblast growth factor receptor9 andephrin-A3,4,10 adhesion molecules N-cadherin,11 b3 integ-rin4,5,12,13 and syndecan-4,5,14 and the cell surface antigen CD59/protectin,5 and migration inhibitory activity.1,7

WNT proteins are involved in the development of neural crestas well as in the genesis of melanoma.15 Through its receptor,Frizzled, 3 partly overlapping pathways, the b-catenin, the planarcell polarity and the Ca21 signaling pathways can be triggered byWNT. The overlap between these pathways is the G protein/Dsh/SERCA (sarco-endoplasmic reticulum calcium ATPase)—Ca21

release arm. Accordingly, Ca21-signaling may have special im-portance in the development of melanoma, but literature dataare relatively scanty on this subject.10 The significance of Ca21

in melanoma is supported by the fact that protein kinase C,

especially isoforms which depend on Ca21, is overexpressed inmelanoma.16 On the other hand, intracellular Ca21 oscillations arecritical for the survival and migration of melanoma cells.17,18 Themelanocytic linage is characterized by a special resistance to apo-ptosis, which might be even attenuated during malignant transfor-mation. It is now well established that apoptosis regulatoryproteins B-cell lymphoma/leukemia-2 gene/Bax are regulators ofthe endoplasmic reticulum (ER) Ca21 stores, and Ca21 is a keymediator of apoptosis.19 The apoptosis resistance of melanomacells is not due to the absence of ER-Ca21 channels, and calcium-release activated calcium channels are ubiquitously expressed andfunctional in the plasma membrane of human melanoma celllines.20 Furthermore, the purinoreceptors, both the ion-gated(P2X) and the G-protein-coupled forms (P2Y), were found to beexpressed in a human melanoma cell line as well as in melanomatissue.21–23 Specifically, the P2X7 receptor is considered as one ofthe regulators of apoptosis.24 Its ability to modify apoptosis canbe attributed to one or more of the 3 major consequences of theactivation of the receptor, namely the influx of calcium ions,25 theCa21-independent activation of several apoptotic enzymes,26 andthe rapid reorganization of cytoskeletal structures and membrane‘‘blebbing.’’27 However, the genetic identity of P2X7 receptorsand, more importantly, their functions have not been establishedin melanoma yet.

Based on microarray study, we demonstrate the novel findingthat human melanoma cell lines overexpress a Ca21-release chan-nel, ryanodine receptor 2 (RyR2), and 2 of its regulators. Mean-while, RyR2 does not function as a release channel in melanoma.On the other hand, we demonstrate that the P2X7 isoform of theligand-gated Ca21 channels is expressed in human melanoma celllines and melanocytes, but is fully functional as a Ca21 entry path-

Grant sponsor: Hungarian National Science Fund; Grant numbers:OTKA T049151, NK 61412, NKFP1a-0024-05; Grant sponsor: Ministryof Health; Grant numbers: ETT-425/2006, (JT), ETT-151/2006 (LCs)GVOP-3.1.1.-2004-05-0090/3.0; Grant sponsor: Hungarian Academy ofSciences; Grant number: 40.232/1/2005*Correspondence to: Department of Tumor Progression, National Insti-

tute of Oncology, R�ath Gy. u. 7-9, Budapest H-1122, Hungary.Fax:136-1-224-8706. E-mail: jtimar@oncol.huReceived 12 September 2006; Accepted after revision 11 January 2007DOI 10.1002/ijc.22621Published online 1 March 2007 in Wiley InterScience (www.interscience.

wiley.com).

This article contains supplementary material available via the Internet athttp://www.interscience.wiley.com/jpages/0020-7136/suppmat.The first four authors contributed equally.

Abbreviations: AM, acetoxymethylester; BBG, brilliant blue G; BSA,bovine serum albumine; BzATP, 20-30-O-(4-benzoylbenzoyl)-ATP; CPA,cyclopiazonic acid; DAPI, 40,6-diamidino-2-phenyindole; DEPC, diethylpyrocarbonate; dNTP, deoxynucleoside 50-triphosphate; ER, endoplasmicreticulum; FCS, fetal calf serum; FITC, fluoresceine isothiocyanate;FKBP, FK506 binding protein; HeLa (a cervical carcinoma cell line from),Henrietta Lacks; 2ME, methoxyestradiol; M-MLV, Moloney MurineLeukemia virus; MTT, 3-(4,5-dimethylthiazolyl-2)-2,5-diphenyltetrazo-lium bromide; PCR, polymerase chain reaction; RPMI, Roswell ParkMemorial Institute; Ry, ryanodine; RyR2, ryanodine receptor type 2;SCID, severe combined immune deficiency; SERCA, sarco-endoplasmicreticulum Ca21-ATPase.

Int. J. Cancer: 121, 55–65 (2007)

' 2007 Wiley-Liss, Inc.

Publication of the International Union Against Cancer

way in melanoma exclusively. This purinoreceptor proved to bean antiapoptotic device, while RyR2 seems to function as itsregulator.

Material and methods

Melanoma cell lines and culture conditions

The HT168-M1 human melanoma cell line is a derivative of theA2058 cell line (provided by L. A. Liotta, NCI, Bethesda, MD).The HT199 melanoma cell line was established by the NationalInstitute of Oncology, Budapest, Hungary. The WM35 melanomacell line was a gift from M. Herlyn (Wistar Institute, Philadelphia,PA). All these melanoma cell lines are tumorigenic in severe com-bined immune deficiency (SCID) mice and, except WM35, aremetastatic in various metastasis models.28 Melanoma cells weremaintained in vitro as monolayer cultures in Roswell Park Memo-rial Institute (RPMI) 1640 medium (Sigma, St. Louis, MO) sup-plemented with 5% fetal calf serum (FCS, Sigma) and 50 lg/mlpenicillin/streptomycin at 37�C in a 5% CO2 atmosphere. Allexperiments were carried out on 3- to 4-day-old cultures.

Melanocyte cell culture

Primary human melanocyte cultures (kindly provided by theLymphocyte Laboratory, Clinic of Dermatology, University ofSzeged, Szeged, Hungary) were derived from skin biopsies ofnonmelanoma patients, after having their formal consent and withthe approval of the local Ethical Committee, as described earlier.29

Cells were seeded in 25-cm2 flasks and cultured in the followingcomplex medium: AIM-V serum free lymphocyte medium (100 ml),keratinocyte serum free medium (100 ml), human recombinantepidermal growth factor (1 ll), bovine pituitary extract (400 ll;each from Gibco/Invitrogen, Paisley, UK), FCS (5 ml), l-gluta-mine (58.44 mg; Sigma), supplemented with 50 U/ml penicillin,50 lg/ml streptomycin and 1.25 lg/ml fungizone (Biogal, Debre-cen, Hungary). Cultures were kept in 5% CO2 atmosphere at37�C, and passaged at 80–100% confluence every 3–6 days. Cellswere passaged for a maximum of 6 times before any experiment.

Nevus and melanoma tissues

Fresh tissues of 5 human skin nevuses and 5 human melanomashave been collected during surgery, having the formal consent ofthe patients. The protocol of ribonucleic acid (RNA) and proteinexpression analysis of nevus and melanoma tissues were approvedby the Local Ethical Committee.

Cell proliferation assay

Four thousand cells were plated in flat-bottomed, 96-well tissueculture plates in RPMI/FCS. After 24-hr attachment, cells weretreated with stimulators or inhibitors for 48 hr, and then a colori-metric assay was performed. Briefly, 0.5 mg/ml of 3-(4,5-dime-thylthiazolyl-2)-2,5-diphenyltetrazolium bromide (MTT; Sigma)was added to the wells. After 4-hr incubation at 37�C the mediumwas gently removed, the plates air-dried, and the formazan crys-tals formed in viable cells were dissolved in dimethyl sulfoxide.Absorbance at 570 nm was measured with a Bio-Rad microplatereader (Bio-Rad, Hercules, CA).

Apoptosis assay

Cell suspensions containing 3 3 105 viable HT168-M1 cells/well were plated in 6-well dishes and allowed to attach for 24 hr at37�C in 5% CO2 atmosphere in RPMI/FCS. After the medium hadbeen changed (0% FCS), the cells were exposed to 1 lM methox-yestradiol (2ME) and 180 lM ATP for 48 hr. ATP was adminis-tered to the culture twice a day. At termination, cells weredetached with 0.02% EDTA, washed with PBS, and fixed with70% ethanol. After a 2-hr incubation period with propidium-iodide and RNAse (CyStain PI Absolute T, Partec, Germany), wemeasured the DNA content of the cells by flow cytometer

(CyFlow, Partec). The percentage of the apoptotic cells was deter-mined as the subG1/G0 fraction, and analyzed using FlowMaxsoftware (CyFlow, Partec), as previously described.30

As an alternative approach, adherent cells were fixed in 70%ethanol and stained in situ with propidium iodide as mentionedearlier. Determination of the apoptotic rate was performed by mor-phologic identification and counting of the apoptotic nuclei underfluorescent microscope (Nikon Eclipse E600 or D-eclipse C1 con-focal microscope, Nikon, Tokyo, Japan). In this case, a minimumof 500 nuclei in 5 microscopic fields have been analyzed.

Microarray analysis

Construction and use of microarrays were performed asdescribed.28 Briefly, 2,215 cDNA inserts from human cDNA libra-ries were amplified and arrayed in duplicate on cDNA slides (FullMoon BioSystems, Sunnyvale, CA) by using a MicroGrid TotalArray System (BioRobotics, Cambridge, UK) spotter (spot size 5200 lm). The complete gene list and accession numbers can befound at http://chiplab.szbk.u-szeged.hu/Human_cDNAset.

For probe preparation, 4 lg of total RNA was processed usingpoly-dT-primed Genisphere Expression Array 350 detection sys-tem (Genisphere, Hatfield, PA). cDNA was hybridized ontohuman cDNA microarrays in a Ventana hybridization station(Ventana Discovery, Tucson, AR).

Each array was scanned under a green laser (543 nm for Cy3labeling) or a red laser (633 nm for Cy5 labeling) using a ScanAr-ray Lite (GSI Lumonics, Billerica, MA) scanning confocal fluores-cent scanner with 10 lm resolution (Laser power: 85% for Cy5and 90% for Cy3, Gain: 80% for Cy5 and 75% for Cy3). Scannedoutput files were analyzed using the GenePix Pro3.0 software(Axon Instruments, Foster City, CA). The average and medianpixel intensity ratios calculated from both channels and the localbackground of each spot (4 replicates) were determined. An aver-age expression ratio (MeaR, denotes the average of local back-ground corrected pixel intensity ratios) was determined for eachspot. Normalization was performed by the global Lowess method.Those data were flagged and excluded where the replicate spotsfrom a different site of the same array have more than 2-folddifferences. The same restriction was applied for the averageratios of the replica experiments.

Molecular biology of Ca21 channels

RNA and cDNA synthesis. Total RNA was prepared fromhuman melanoma cell lines, human melanocytes and nevus tissueusing RNeasy Mini Kit (Qiagen, Hilden, Germany) or the TRI Re-agent (Sigma), according to the manufacturer’s instructions.Reverse transcription reaction mixture was set up by adding 1 llof deoxynucleoside 50-triphosphate (dNTP) mix (10 mM each,Finnzyme, Espoo, Finland) and 1 ll of random primer-oligo(dT)mix (final concentration 2.5 lM each) to 1 lg (in 8 ll diethylpyrocarbonate (DEPC)-treated water) of the isolated total RNA.After incubating at 70�C for 10 min the following componentswere added: 2 ll of 103 Moloney Murine Leukemia virus(M-MLV) Reverse Transcriptase Buffer (Sigma), 1 ll of M-MLVReverse Transcriptase (200 U/ll, Sigma), 0.5 ll of RNase Inhibi-tor (40 U/ll, Promega, Madison, WI) and 6.5 ll of DEPC-treatedwater, for a final reaction volume of 20 ll. The reaction was run at37�C for 50 min, and then the enzyme was killed by incubating at85�C for 10 min. The efficiency and quality of the reverse tran-scription of the different samples was checked by a polymerasechain reaction (PCR) for b-actin.Verification of the expression of RyR2 and P2X7 by PCR and

sequencing. Expression of the RyR2 and purinergic receptorP2X7 was verified with PCR (nested PCR in case of RyR2), real-time PCR and DNA sequence analysis of the isolated amplicons.Primers for PCR and sequencing were designed by the Primer3software (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi)using the GeneBank RefSeqs (Acc: NM_001035 for RyR2,NM_002562 for P2X7), while primers for real-time PCR were

56 DELI ET AL.

designed by Array Designer software (PREMIER Biosoft Interna-tional, Palo Alto, CA). The primers used for sequencing were as fol-lows: RYR2-1 forward ACGGCACCATAGACAGTTCC, RYR2-2reverse TCGGTGAGTCTTGCAGAATG, RYR2-3 reverse CCACC-CAGACATTAGCAGGT, RYR2-4 forward ACAGCATGGCCCTT-TACAAC, RYR2-5 reverse TTGGCTTTCTCTTT GGCTGT, RYR2-6 forward CAACCGGACTCGTCGTATTT, P2X7-1 forward GGA-CGCTCTGTTCCTCTGAC, P2X7-2 reverse AGTCGGAAAATGG-GACACTG, P2X7-3 forward CTGTCCCCA GGAAGTTGTGT,P2X7-4 reverse GCGAGTCTGGTCTTGGAC TC. The following pri-mers were used for real-time PCR: RYR2-7 forward TTCACTGA-CAACTCCTTCCTCTA, RYR2-8 reverse CAGCACGAACTCCAA-CATACAT, P2X7-5 forward AGAATGGAGTGAAGAAGTTGG-TG, P2X7-6 reverse TTCTTGATGAGCACAGTGAAGTT, P2X7-7forward GGACAACCAGAGGAGATACAGC, P2X7-8 reverse CCC-TTCACTCTTCGGAAACTCT.

The PCR was carried out on a Palm-Cycler (Corbett Research,Sydney, Australia) thermal cycler with the following parameters:94�C 3 min, [94�C 1 min, 59�C 1:10 min, 72�C 1:20 min]330,72�C 5 min. The reaction mixture contained the following compo-nents: 2 ll of the reverse transcription reaction mixture as tem-plate, or in case of the heminested PCR. Two microliters from thereaction mix of the PCR with the outer primers (or water for no-template controls), 2.5 ll of 103 PCR Buffer (final Mg21 concen-tration 1.5 mM), 2 ll of dNTP mix (2.5 mM each), 2.5 ll each offorward and reverse primers (1 lM final concentration for each),0.4 ll of DNA Polymerase (DyNAzyme, Finnzyme) and distilledwater up to a final volume of 25 ll. The PCR products were elec-trophoresed on 1.8% agarose gel, stained with EtBr, and isolatedwith High Pure PCR Product Purification Kit (Roche, Mannheim,Germany) according to the manufacturer’s protocol. PCR-baseddideoxy dye-terminator DNA sequencing was performed fromboth directions, and the sequence was analyzed on an ABI PRISM3100 Genetic Analyzer (Applied Biosystems, Foster City, CA).

Real-time PCR and data analysis was performed on Bio-Rad’sMyiQ Single-Color Real-Time PCR Detection System (Bio-Rad)using the following conditions/reaction parameters: 95�C 3:00,[95�C 0:30, 64�C 0:30, 72�C 1:00]340, 95�C 1:00, 55�C 1:00,melt-curve analysis between 55 and 95�C with 0.5�C steps, 0:10each. Amplification kinetics was detected by monitoring the fluo-rescence of SYBR Green that was added with the master mixSYBR Green JumpStart Taq Ready Mix (Sigma). Each 25 ll reac-tion contained 12.5 ll master mix, 0.5 ll of the forward andreverse primers (200 nM final concentration each), respectively, 2ll cDNA template, and 9.5 ll DEPC-treated water. CT values werecalculated automatically by the software, using the autothreshold fit.Starting quantities were defined from the CT values on the basis ofstandard 5-fold dilution series (13 to 6253) made from HT168 M1cDNA. Relative RYR2 and P2X7 expressions were determined bynormalizing the starting quantities to the housekeeping gene b-actincoamplified from the same cDNA sample (b-actin primers were BS1forward TCTGGCACCACACCTTCTAC, BA4 reverse CTCCTTAA-TGTCACGCACGATTTC).

Immunocytochemistry.� Ryanodine receptor 2: Melanoma cells were fixed in metha-nol for 10 min. After washing in PBS for 3 3 5 min, slideswere blocked with 1% bovine serum albumine (BSA; Sigma)and goat serum (9:1) for 2 hr in room temperature, and incu-bated with monoclonal anti-Ry receptor 2 IgG1 (Sigma) for60 min at 37�C (dilution 1:10). Cells were washed in PBSsolution for 6 3 10 min, and incubated with the secondarybiotin-conjugated anti-mouse IgG (Amersham) for 40 min atroom temperature (dilution 1:100). After washing in PBS for3 3 5 min, cells were incubated in Streptavidin-Texas Red(Amersham, dilution 1:100) for 40 min at room temperature.Negative controls were prepared by replacing the primaryantibody with isotype-matched nonimmune IgG. Cryostatsections of 5 fresh human skin nevus and 5 melanoma

samples were also processed as mentioned earlier, but insteadof Texas Red, an fluoresceine isothiocyanate (FITC)-conju-gate was used. Cell nuclei were stained with propidiumiodide (red fluorescence).

� Purinergic receptors: Melanoma cells and melanocytes werefixed in acetone for 5 min and then permeabilized by 0.1% Tri-ton-X-100 (Sigma) in PBS for 10 min. After washing in PBSand blocking in 1% BSA in PBS for 30 min, cells were incu-bated with the primary antibodies: anti-P2X1,2,4,7 and anti-P2Y1,2,4 (Alomone Laboratories, Jerusalem, Israel) for 60 min(dilution 1:500). Slides were washed 3 times in PBS and thenincubated with FITC-conjugated secondary antibodies (VectorLaboratories, Burlingame, CA) for 60 min (dilution 1:200). Thenuclei of cells were visualized using 40,6-diamidino-2-phenyin-dole (DAPI; Sigma) or propidium iodide. Slides were coveredwith Vectashield (Vector Laboratories), and cells were exam-ined on a fluorescent microscope. Negative controls were madeby omitting the primary antibodies.

Western blotting

Cells were harvested and then disrupted by sonication on ice.The protein content of samples was measured by a modified bicin-choninic acid protein assay (Pierce, Rockford, IL). Total celllysates were mixed with sodium dodecyl sulfate–polyacrylamidegel electrophoresis (SDS-PAGE) sample buffer and boiled for 10min at 70�C and subjected to SDS-PAGE. Gels (7.5%) wereloaded with 50 mg protein per lane and transferred to nitrocellu-lose membranes (Bio-Rad, Vienna, Austria). Membranes werethen blocked with 5% dry milk in PBS and probed with the appro-priate rabbit anti-P2X7 receptor primary antibodies (Alomone),diluted 1:50 in blocking solution. Horse-radish peroxidase-conju-gated goat anti-rabbit IgG (Bio-Rad) secondary antibody was thenapplied, and the immunoreactive bands were visualized by aSuperSignal West Pico Chemiluminescent Substrate SystemWestern blotting detection kit (Pierce) using a LAS-3000 imagingsystem and software (Fujifilm, Tokyo, Japan).

Fluorescent measurement of [Ca21]iChanges in the concentration of intracellular calcium ([Ca21]i)

were detected by using the membrane permeable acetoxymethy-lester (AM) form of the fluorescent dye fura-2, as detailed in ourprevious reports.31 Briefly, cells were incubated for 90 min at37�C with 15 lM fura-2 AM (Molecular Probes, Eugene, OR) inthe presence of 150 nM neostigmine (Pharmamagist, Budapest,Hungary) and 0.02% pluronic (Sigma). Coverslips were thenwashed with normal HEPES Tyrode’s solution (137 mM NaCl,5.4 mM KCl, 0.5 mM MgCl2, 1.8 mM CaCl2, 11.8 mM HEPES-NaOH, 1 g/l glucose, pH 7.4). The coverslips with the fura-2 AM-loaded cells were then placed on the stage of an inverted fluores-cent microscope (Diaphot, Nikon). Alternating excitation at 340and 380 nm was applied while emission from a single cell at atime was detected at 510 nm. [Ca21]i was calculated using in vivocalibration data.

In vitro modulation of the function of Ca21 channels

Ry (10 nM–100 lM; 120 sec), 15 mM caffeine (120 sec), 200nM digoxin (120 sec) and 200 lM thymol (120 sec) were used asagonists of the RyR2 in Ca21 measurements. Cyclopiazonic acid(CPA, 10 lM, 300–360 sec) was used as SERCA pump inhibitor.For P2X7 receptors, beside ATP, we used a stable analogue 20-30-O-(4-benzoylbenzoyl)-ATP (BzATP, 30 lM, 70 sec) as agonist,while 50 lM ZnSO4 and 200 nM brilliant blue G (BBG) wereused as selective antagonists. All RyR2, SERCA and P2X7R ago-nists, and antagonists were purchased from Sigma.

Knock down of P2X7 gene expression. Thirty percent of conflu-ent culture of HT168-M1 cells were transfected with P2X7 or con-trol (sc-37007 scrambled sequence) siRNA (both produced bySanta Cruz Biotechnology) according to the protocol of the manu-

57Ca2þ CHANNELS IN HUMAN MELANOMA

facturer. The expression of P2X7 protein in transfectants wasassessed with immunocytochemistry (see earlier) and was quanti-fied by flow cytometry.

Statistical analysis

All values are expressed as mean 6 SEM. One way ANOVA orStudent’s t test was carried out using SPSS9.0 (SPSS, Chicago,IL) to investigate the significance of differences. Significance wasdeclared at p < 0.05.

Results

Identification of overexpressed genes in human melanoma celllines compared to nevus

We used 2.2K custom-made cDNA microarray to find novelmelanoma-specific genes. For that purpose, we selected 3 geneti-cally independent human melanoma cell lines (all tumorigenic inSCID mice but unlike others, WM35 is nonmetastatic in vivo) andcompared their transcriptome to mRNA of nevus tissue. Amongthe significantly differently expressed genes (p > 0.01), we haveidentified a melanoma gene signature of 59 genes (including 8ESTs), which showed at least 2-fold change in at least one mela-noma cell line (supplementary Table I). However, only 10 upregu-lated and 4 downregulated genes composed the melanoma signa-ture, characterizing all the 3 cell lines (Table I). Concerning theupregulated genes, we have confirmed previous reports on theupregulation of cyclin E in human melanoma.32 Three out of the10 upregulated genes are involved in Ca21 signaling: the RyR2,its binding partner FK506 binding protein (FKBP12.6)/peptidyl-prolyl-cis-trans-isomerase A/calstabin-2 and the RyR2 inhibitor,sorcin. We were able to amplify RyR2 mRNA fragments from allhuman melanoma cell lines, but not from melanocytes tested withheminested PCR (Fig. 1a), and the amplicons were isolated.Sequence analysis of the RyR2 in human melanoma cell linesshowed that the PCR-amplified sequences (2 sequences at differ-ent locations) were identical to the reference sequences publishedby GeneBank (supplementary Table II). Quantitative PCR analysisconfirmed these observations (Fig. 1b). Immunohistochemicalanalysis of the RyR2 protein expression indicated that the studied5 human nevus tissues were negative (Fig. 1c, left), while theanalyzed 5 skin melanoma expressed RyR2 protein (Fig. 1c,right). Confocal microscopy demonstrated that RyR2 is mostlylocalized to cytoplasmic tubulovesicular structures in human mel-anoma cells (Fig. 1c, inset). These intracellular structureswere identified as the ER, based on double immunolabeling ofmelanoma cells with antibodies against RyR2 and the SERCACa21-pump (Fig. 1d).

Human melanoma cells were treated in vitro with the ligand ofRyR2, Ry, to determine if the receptor is functional. Ry was usedat a concentration of 25 nM, known to be within the range thatopens the channel,33 but no Ca21 transient was seen either in me-lanocytes or in nelanoma cells (Figs. 2a and 2b, respectively).Application of Ry at low concentrations (10–100 nM) gave thesame result (data not shown), and high concentrations (100 lM,Figs. 2a and 2b) known to close the channel34 were also withoutan effect on both cell types. Furthermore, different activators ofthe Ry receptor, such as 15 mM caffeine,33 demonstrated inFigures 2c and 2d, 200 nM digoxin and 200 lM thymol (Refs. 35and 36, data not shown) also remained ineffective in respect of theCa21 transient. The lack of effect of RyR activation could alsohave been the result if the cells had had empty internal calciumstores. To ascertain that this was not the case, melanocytes andHT168-M1 melanoma cells were challenged with the SERCApump inhibitor CPA (10 lM),37 which was followed by a rise in[Ca21]i (Figs. 2e and 2f). This clearly proved that the ER con-tained releasable Ca21 ions that could leak out into the cytoplasm.In the following, we tested the effect of Ry on the proliferation ofhuman melanoma cells in vitro. It came as a surprise that on thecontrary to its ineffectiveness in calcium assays, Ry stimulatedcell proliferation in various human melanoma cell lines, at a con-centration range higher than the one opening the channel (lM),and the only nonmetastatic cell line, WM35, gave the strongestproliferative response (Fig. 2g). On the other hand, a nonselectiveRyR2 inhibitor, ruthenium red, exhibited a moderate antiprolifera-tive response on certain human melanoma cell lines, except thenonmetastatic WM35 (Fig. 2h).

Melanoma cells and melanocytes express P2X7 receptors

Since RyR2 was shown not to be involved directly in intracellu-lar calcium release, we tested other options. Purinergic receptorshave lately been demonstrated to be expressed in a human mela-noma cell line and in melanoma tissue22,23; however, the expres-sion was not compared to that in melanocytes, and the calciummobilizing function was not examined. Out of the 7 subtypes ofthe ionotropic P2X receptors, only P2X7 showed strong proteinexpression by immunocytochemistry in all 3 melanoma cell linesstudied (Fig. 3a), and the expression was stronger as compared tomelanocytes, both with immunocytochemistry (where we onlyobserved some faint nuclear immunopositivity in melanocytes,Fig. 3b) and Western blotting (Fig. 3e). Confocal microscopy indi-cated the authentic plasma membrane localization of P2X7 recep-tors in melanoma cells beside a cytoplasmic reaction (Fig. 3c).P2X7 mRNA fragments were amplified from all human melanomacell lines tested, at several amplification sites with PCR (as repre-sentative, P2X7-5 is demonstrated in Fig. 3d), and the amplicons

TABLE I – EXPRESSION OF GENES SIGNIFICANTLY ALTERED IN HUMAN MELANOMA CELL LINES COMPARED TO NEVUS TRANSCRIPTOME

Cell line, acc. NumberFold-change

WM35 HT168 HT199

UpregulatedD32002 Nuclear cap binding protein 8.69 6.93 6.66X98330 Ryanodine receptor-2 7.00 4.69 4.66H15417 Glutamate receptor 6 4.48 2.31 2.98U61167 Human SH3 domain-containing protein SH3P18 4.41 4.41 3.80X52851 Peptidyl-prolyl cis-trans isomerase A (FKBP12.6) 4.15 4.14 2.85M32886 Sorcin 3.17 2.33 2.89D87075 Human mRNA for KIAA0238 gene 3.11 4.25 6.27D436 MTG8a protein 2.29 2.25 2.16AF047343 NADH:ubiquinone oxidoreductase 2.21 2.51 2.86X76057 Mannose phosphate isomerase 2.02 2.69 4.13

DownregulatedAF003837 Homo sapiens Jagged 1 (HJ1) 0.44 0.41 0.44U53468 Human NADGH:ubiquinone oxidoreductase subunit B13 0.37 0.43 0.53X02761 Fibronectin 1 0.11 0.09 0.26X7812 Glycerol kinase 2 (testis specific) 0.09 0.06 0.16

Threshold level was >2-fold increase or >50% decrease of gene expression in all the cell lines tested compared to nevus mRNA.

58 DELI ET AL.

were isolated. Sequence analysis of P2X7 expressed in human mela-noma cell lines showed that these were 100% identical to the refer-ence sequences published in GeneBank (supplementary Table III).

P2X7 receptors function as a calcium entry pathway in melanomacells but not in melanocytes

Single-cell fluorescent Ca21 measurements were carried out totest whether the P2X7 purinoreceptor detected by immunocyto-chemistry is functional and can be activated by extracellular ATP.As opposed to melanocytes which showed no response to ATP(Fig. 4a), melanoma cells repeatedly produced Ca21 transients onapplication of ATP (Fig. 4b). Not only did they lack desensitiza-tion when ATP administrations were repeated, but they increasedin amplitude, the greatest jump in the amplitude appearing whenthe second activation of the receptor took place (Fig. 4b). This ob-servation is in line with one of the previously described character-

istics of P2X7 purinoceptors, namely that its pore-forming abilityresults in sensitization to stimulation by ATP.38

Since RyR2 was suggested to interfere with purinergic signalingin Henrietta Lacks (HeLa) cells,39 we tested whether Ry had anyeffect on human melanoma cells. About 10 lM of the alkaloid,which had no effect on [Ca21]i, inhibited the Ca21 transientsevoked by ATP (Fig. 4c). As pooled data demonstrate, the ampli-tude of the Ca21 transients was decreased by roughly 50% at max-imum inhibition. The magnitude of the inhibition is, however, anunderestimation of the actual effect, since repeated applications ofATP caused a sensitization of the response if applied alone.

Modulation of P2X7 receptor in human melanoma and functionalconsequences on survival

Further single-cell Ca21 measurements were performed todetermine the pharmacological characteristics of the purinergic re-

FIGURE 1 – Expression of RyR2in human melanoma cell lines. (a)Expression of RyR2 mRNA in celllines as detected by PCR. 1CTR5positive control, H2O 5 negativecontrol, bp 5 base pair markers. (b)Quantitative PCR evaluation ofmRNA levels for RyR2 in mela-noma cells compared to melano-cytes. (c) Localization of RyR2 pro-tein in nevus, skin melanoma tissueand HT168-M1 melanoma cells,using immunocytochemistry andconfocal microscopy. Left: Frozensection of nevus tissue, labeled forRyR2 with immunohistochemistry(green fluorescence) and nuclei (redfluorescence). Note the lack of spe-cific labeling. Right: Frozen sectionof human skin melanoma, positivefor RyR2 (green fluorescence). Bar5 200 lm. Inset: RyR2 protein isconfined predominantly to cytoplas-mic tubulovesicular structures (redfluorescence) by confocal micros-copy. Merged image of phase con-trast and red fluorescence signals.Bar 5 20 lm. (d) Colocalization ofSERCA and RyR2 in HT168-M1human melanoma cells using immu-nocytochemistry. Right: RyR2 (la-beled with a green signal) is foundto colocalize in cytoplasmic tubulo-vesicular structures (yellow signal)with SERCA protein (red signal).Bar 5 20 lm. Left: nuclear label(DAPI, blue signal).

59Ca2þ CHANNELS IN HUMAN MELANOMA

ceptor that is responsible for the ATP-evoked Ca21 transients inthe melanoma cells. Besides the already mentioned sensitization(which can also be seen in Fig. 5a), it was recognized that P2Xreceptors can be activated by BzATP. Although no longer isBzATP considered a specific agonist of P2X7 receptors, rather anagonist of several receptors of the P2X family,25 data in Figure 5ashow that it is a potent agonist on melanoma cells, since the ampli-tude of the BzATP-evoked Ca21 transient was about the same asthe second ATP-evoked transient. In this case BzATP was used at30 lM, a concentration that is an order of magnitude smaller thanthat of ATP, which at this low concentration hardly had any effecton [Ca21]i (data not shown).

The strongest pharmacological evidence for the functional roleof P2X7 receptors in the ATP-evoked response was provided by 2blockers of the receptor. As the representative record in Figure 5ashows, 50 lM Zn21 or 200 nM BBG completely and reversiblyblocked the response of melanoma cells to extracellular ATP.These observations, together with the data shown in Figure 3,clearly establish that the ATP-evoked Ca21 transients were due toa calcium influx through P2X7 receptors.

Since the P2X7 receptor has been implicated in apoptosis-induction in human melanoma cells,23 we tested the effect of itsin vitro modulation on several cell lines. ATP administration tomelanoma cells did not induce apoptosis (as opposed to whatwas observed previously; Refs. 22 and 23) at the concentrations

affecting the Ca21 transients (in HT199 cell line: (2.20 60.5)%, control and (1.28 6 0.23)% ATP, respectively, inHT168-M1 cell line 3.5 6 0.4 and 2.4 6 0.2, respectively).Since the low spontaneous apoptotic rate cannot be reliably sup-pressed further, we tested P2X7-activation by ATP when weinduced extensive apoptosis in human melanoma cells in vitroby 2ME, as described earlier (Fig. 5b, Ref. 30). Within 24 hr,parallel administration of the P2X7 agonist, ATP, with 2ME at aconcentration of 180 lM significantly inhibited this process(Fig. 5c) suggesting an antiapoptotic function of the P2X7. Toexplore this possibility further, we have knocked down P2X7

expression in HT168-M1 melanoma cells using a pool of 3 tar-get-specific P2X7-siRNA, resulting in the loss of protein expres-sion (Fig. 6a). Human melanoma cells did not change theirin vitro proliferation- (Fig. 6b) or spontaneous apoptotic rates(Fig. 6c) upon downregulation of P2X7. However, when wehave induced apoptosis by 2ME treatment, P2X7-knocked downcells became significantly more sensitive to the effect of thedrug (Fig. 6c).

Discussion

Purinoceptors have been shown to regulate intracellular Ca21

homeostasis in practically every cell type.25 They regulate differ-entiation in skeletal muscle40 and control proliferation in epider-

FIGURE 2 – Effect of Ry recep-tor agonists and depletion of intra-cellular Ca21 stores. Neither 25nM and 100 lM Ry (a,b) nor 15mM caffeine (c,d) induced achange in [Ca21]i in primaryhuman melanocytes (a,c) orHT168-M1 melanoma cells (b,d).Cyclopiazonic acid (10 lM; CPA)caused a transient increase in[Ca21]i in both cell types (e,f).Effect of Ry (g) or RuRed (h) onthe proliferation of human mela-noma cell lines in vitro. Cells wereexposed to Ry or RuRed for 48 hrat various concentrations, and celldensity was determined by MTTassay. Data are expressed in %compared to untreated control cul-tures. *p < 0.05, ANOVA method.[Color figure can be viewed in theonline issue, which is available atwww.interscience.wiley.com.]

60 DELI ET AL.

mal keratinocytes.41 Most recently P2Y1, P2Y2 and P2Y6,22 and

P2X723 purinoceptors have been described in the human mela-

noma cell line, A375, of which the P2X7 receptors are of specialinterest, since they have been considered to be involved in the reg-ulation of apoptosis.24 Two questions have been raised in respectof these studies: (1) Is P2X7 expression universal among varioushuman melanoma cell lines? and (2) what is the P2X7 expressionstatus of melanocytes?

Here we have extended these studies to several geneticallyunrelated human melanoma cell lines and melanocytes. Not onlycould we prove the expression of the P2X7 receptor in severalhuman melanoma cell lines and melanocytes, but we also demon-strated that, unlike in melanocytes, it is functional in melanomacells. An important difference that distinguishes this isoform from

other members of the P2X receptor family is that repeated or pro-longed applications of its agonist, ATP, open pores that make themembrane permeable to large molecules, and the original Ca21

transient increases, that is, sensitization occurs.25 Besides demon-strating this phenomenon, we further supported the notion of func-tioning P2X7 receptors being present on our melanoma cells bytesting a specific agonist, BzATP, and antagonists, as BBG andZn21 ions.25 P2X7 is considered as a proapoptotic receptor inmany cell types.23,25 However, this seems not to be the case inmost of the human melanoma cell lines, since we have shownATP not to induce apotosis, on the contrary inhibiting the 2ME-induced apoptosis.30 Other data further supported our notion thatP2X7 in human melanoma serves as an antiapoptotic/prosurvivaldevice: siRNA knock down of P2X7 gene and protein expressions

FIGURE 3 – Expression of puri-nergic receptors in melanoma celllines and melanocytes. (a) Humanmelanoma cells (WM35, HT199and HT168-M1) were immuno-stained with antibodies against theP2X1,2,4,7 and P2Y1,2,4 receptorsand FITC-conjugated secondaryantibodies. The P2X7 receptor canbe clearly detected in all the 3 celllines. The P2X4, P2Y1 and P2Y2

subtypes show faint immunoposi-tivity in the WM35 cell line, but inall other cases the receptors aremissing. Bar 5 40 lm, expositiontime 1 sec. Nuclei were stainedwith DAPI. (b) Primary humanmelanocytes expressing P2X7 re-ceptor protein. Bar 5 100 lm. (c)Confocal microscopic imagingreveals that P2X7 receptors arelocalized to the plasma membrane(arrows) and cytoplasmic domainsof HT168-M1 melanoma cells.Bar 5 20 lm. Nuclei were stainedwith propidium iodide. Expressionof P2X7 mRNA (d) and protein (e)in human melanoma cell lines asdetected by PCR and Westernblotting, respectively. Bp 5 basepair markers, 1CTR 5 positivecontrol, MC 5 melanocyte.

61Ca2þ CHANNELS IN HUMAN MELANOMA

in HT168-M1 cells had no effect on the proliferation or spontane-ous apoptotic rates, but rendered tumor cells more sensitive todrug-induced apoptosis. Our data are contradictory to those pub-lished before on the function of P2X7 in melanoma cells as a proa-poptotic gene.23 Theoretically, overexpression of a proapoptoticgene in melanoma does not support the process of malignant trans-formation and/or progression. The unexpected function of P2X7 inhuman melanoma cells might be due to genetic changes, but our

sequencing data do not support this possibility either. It is there-fore more likely that the P2X7 pathway is modified in melanomacells.

The Ry receptor is the major Ca21 release channel in the mem-brane of internal Ca21 stores in both muscle and nonmuscle cells.While the functions of different RyR isoforms in excitable musclecells have long been established as key players in excitation–con-traction coupling, the expression of RyRs, their possible function

FIGURE 4 – Effect of extracellular ATP on [Ca21]i of melanocytes and HT168-M1 melanoma cells. (a) Extracellular ATP (180 lM) does notchange the [Ca21]i of cultured human melanocytes. (b) Repeated applications of 180 lM extracellular ATP to melanoma cells cause transientincreases in [Ca21]i that become greater in amplitude (representative record, left; pooled data, right). (c) Repeated administrations of 180 lMATP to melanoma cells are inhibited in the presence of 10 lM Ry (representative record, left; pooled data, right). Numbers in brackets show thenumber of cells examined for the given condition. *Marks significant (p < 0.05) difference from the preceding column. [Color figure can beviewed in the online issue, which is available at www.interscience.wiley.com.]

62 DELI ET AL.

and even their pharmacology is quite controversial in nonmuscletissues.42–44 Bennett et al.39 reported that the type 2 isoform ofRyR is present in HeLa epithelial cancer cells, but the receptor didnot show the pharmacological characteristics of normal RyRs.They found that Ry inhibited the increases in [Ca21]i, evoked byextracellular ATP, and they concluded that although RyR2 maynot be active in these tumor cells in the usual sense, it might pro-vide a subtle regulation of [Ca21]i responses.

Previous functional data suggested that the Ca21 permeablechannels in the sarcolemma, such as the voltage-gated Ca21 chan-nels, are overexpressed by melanoma cells, and their inhibitorsexhibited modulatory function on melanoma growth in vitro andin vivo.45,46 While data have also been presented that purinore-ceptors are expressed in human melanoma cell lines and tis-sues,22,23 relatively little is known about the Ca21 release chan-nels of the intracellular Ca21 stores (inositol 1,4,5-triphosphateand RyR) in melanoma cells.47 Our microarray study on 3 genet-ically different human melanoma lines indicated an overexpres-sion of RyR2 and 2 of its regulators, its inhibitor sorcin andFKBP12.6,48 when compared to nevus transcriptome or mela-nocytes. The differential expression of RyR2 protein betweennevus and melanoma tissues was also confirmed in surgical sam-

ples as well. RyR2 protein was demonstrated predominantly inthe endoplasmatic reticulum, colocalizing with SERCA pumps.However, RyR2 was not active as a release pathway for Ca21

upon activation by its ligand, Ry, which might be connected tothe fact that its inhibitor, sorcin is also overexpressed in mela-noma cells. Sequencing of the domains used for expression anal-ysis indicated no genetic alteration of these 2 domains (SPRYand Ry). Interestingly, RyR2 seems to function as a modifier ofthe P2X7R, decreasing the amplitude of the calcium influxthrough this channel, similarly as mentioned earlier for HeLacells.39 It could be the smaller calcium transient and the ensuingactivation of alternative signaling pathways that inverts theeffect of the receptor and turns it into an antiapoptotic protein. Itis an intriguing question whether this ability of RyR2 to inter-fere with the P2X7-dependent Ca21 transients is a commonmechanism in cells that have undergone malignant transforma-tion. It is of note that modulation of the RyR2 by its specificligand resulted in the modulation of melanoma cell proliferationin vitro, further suggesting a functional, though aberrant expres-sion. At present, we can only speculate on how RyR2 is able tomodulate the function of a surface membrane Ca21 entry chan-nel in melanoma cells. A functional interaction between the 2

FIGURE 5 – In vitro effects of P2X7 receptor modulations in HT168-M1 melanoma cells. (a) Representative record showing 4 characteristicproperties of the P2X7 purinoreceptor. Repeated application of ATP (180 lM) resulted in Ca21 transients of increasing amplitude. brilliant blueG (200 nM ;BBG) and 50 lM ZnCl2 (Zn

21) reversibly inhibited the response of the cell to ATP, and 30 lM 20-30-O-(4-benzoylbenzoyl)-ATP(BzATP) acted as an agonist of the receptor. (b) Induction of apoptosis in HT168-M1 cells with 1 lM 2ME for 48 hr. Adherent cells were fixedand stained with propidium iodide and visualized by fluorescent microscopy. Note the frequent presence of apoptotic nuclei (*). Bar 5 20 lm.(c) Effect of a P2X7 receptor agonist (ATP) on 2ME-induced apoptosis in vitro. One micromolar 2ME induced apoptosis after 48 hr, but in thepresence of 180 lM ATP, the apoptotic rate was significantly decreased. Flow cytometric determination of apoptotic nuclei (subG0/G1 fraction.Data are means (6SEM, n5 3), *p < 0.05. [Color figure can be viewed in the online issue, which is available at www.interscience.wiley.com.]

63Ca2þ CHANNELS IN HUMAN MELANOMA

proteins is possible, but morphologic studies do not completelysupport this assumption, since a significant proportion of P2X7

is associated with the plasma membrane, while that of RyR2 isassociated with cytoplasmic membrane structures in melanomacells. Other possible connections between the 2 proteins areCa21 or ATP, but we do not have data to support such a com-mon regulatory mechanism.

Melanoma is characterized by apoptosis resistance connectedto its irradiation- and chemoresistance as well.49,50 The emerg-ing role of the WNT signaling in melanoma-genesis15 may turnthe attention to the role of Ca21 in the resistance to apoptosis ofmelanoma cells. The established apoptosis-Ca21 connectionssupport the notion that Ca21 entry and release from intracellularstores19 might have an important role in the apoptosis resistanceof melanoma. Our data presented earlier on the expression of

the P2X7 ligand-gated and the RyR2 Ca21 release channels inhuman melanoma and their aberrant functions may help to eluci-date the underlying molecular mechanism of apoptosis resist-ance of melanoma cells and to explore novel targets for a moreefficient therapy.

Acknowledgements

The authors are grateful for the technical assistance of Ms. R.€Ori and Ms. I. Varga. Dr. G.P. Szigeti holds Bolyai Fellowshipfrom the Hungarian Academy of Science. Supported by grants ofNKFP1a-0024-05 (JT), OTKA T049151 and NK61412 (LC), Min-istry of Health, ETT-425/2006 (JT), GVOP-3.1.1.-2004-05-0090/3.0 (JT), Hungarian Academy of Sciences (40.232/1/2005, LGP).

References

1. Carlson JA, Ross JS, Slominski A, Linette G, Mysliborski J, Hill J,Mihm M. Molecular diagnostics in melanoma. J Am Acad Dermatol2005;52:743–75.

2. Slominski A, Tobin DJ, Shibahara S, Wortsman J. Melanin pigmenta-tion in mammalina skin and its hormonal regulation. Physiol Rev2003;10:1152–205.

3. Gyorffy B, Lage H. A web-based data warehouse on gene expressionin human malignant melanoma. J Invest Dermatol 2007;127:394–9.

4. Hoek K, Rimm DL, Williams KR, Zhao H, Ariyan S, Lin A, KlugerHM, Berger AJ, Cheng E, Trombetta ES, Wu T, Niinobe M, et al.Expression profiling reveals novel pathways in the transformation ofmelanocytes to melanomas. Cancer Res 2004;64: 5270–82.

FIGURE 6 – Effects of knocking down P2X7 gene expression in HT168-M1 cells. Tumor cells were transfected with scrambled (control, CTR)or P2X7 siRNA for 48 hr. (a) Determination of P2X7 protein expression in HT168-M1 cells by immunocytochemistry (Fig. 3) and measuredwith flow cytometry. Note that P2X7 siRNA-treated cells lost their P2X7 protein expression compared to control siRNA-treated cells, andbecame undistinguishable from the immunocytochemical negative control cells (NC). (b) Proliferation of HT168-M1 cells following 48 hrP2X7 siRNA treatment. Equal number of cells were plated onto coverglasses and were incubated with siRNA. Data are expressed as cell density,determined by counting viable adherent cells at standard microscopic fields stained with propidium iodide after ethanol fixation. Data are means(6SEM, n 5 5). (c) Effect of P2X7 siRNA treatment on the apoptosis of HT168-M1 cells. Melanoma cells were treated with control (CTR) orP2X7 siRNA for 48 hr, with or without 1 lM 2ME. After incubation, cells were fixed in situ with 70% ethanol, and the nuclei were stained withpropidium iodide as in case of Figure 5b, and the rate of apoptotic nuclei was determined under fluorescent microscope. Data are means(6SEM, n5 5), *p 5 0.005.

64 DELI ET AL.

5. Bittner M, Meltzer P, Chen Y, Jiang Y, Seftor E, Hendrix M, Rad-macher M, Simon R, Yakhini Z, Ben-Dor A, Sampas N, Dougherty E,et al. Molecular classification of cutaneous malignant melanoma bygene expression profiling. Nature 2000;406:536–40.

6. Lynch BJ. Komaromy-Hiller G. Bronstein IB. Holden JA. Expressionof DANN topoisomerase I, DNA topoisomerase II-a. and p53 in met-astatic malignant melanoma. Hum Pathol 1998;29:1240–5.

7. Ha C, Nosrati M, Sudilovsky D, Crother J, Khodabakhsh D, PulliamBl, Federman S, Miller JR, III, Allen RE, Singer MI, Leong SP, LjungBM, et al. The gene expression signatures of melanoma progression.Proc Natl Acad Sci USA 2005;102:6092–7.

8. Seykora J, Jih D, Elenitsas R, Horng WH, Elder DE. Gene expres-sion profiling of melanocytic lesions. Am J Dermatopathol 2003;25:6–11.

9. Xerri L, Battyani Z, Grob JJ, Parc P, Hassoun J, Bonerandi JJ,Birnbaum D. Expression of GFG1 and FGFR1 in human melanomatissues. Melanoma Res 1996;6:223–30.

10. Weeraratna AT, Becker D, Carr KM, Duray PH, Rosenblatt KP, YangS, Chen Y, Bittner M, Strausberg RL, Riggins GJ, Wagner U, Kallion-jemi OP, et al. Generation and analysis of melanoma SAGE libraries:SAGE advice on the melanoma transcriptome. Oncogene 2004;23:2264–74.

11. Bachmann IM, Straume O, Puntervoll HE, Kalvenes MB, Akslen LA.Importrance of P-cadherin, b-catenin and Wnt5a/Frizzled for progres-sion of melanocytic tumors and prognosis in cutaneous melanoma.Clin Cancer Res 2005;11:8606–14.

12. Albelda SM, Mette SA, Elder DE, Stewart R, Damjanovich L, HerlynM, Buck CA. Integrin distribution in malignant melanoma: associa-tion of the b3 subunit with tumor progression. Cancer Res 1990;50:6757–74.

13. Van Belle PA, Elenitsas R, Satyamoorthy K, Wolfe JT, Guerry D, IV,Schuchter L, Van Belle TJ, Albelda S, Tahin P, Herlyn M, Elder DE.Progression-related expression of b3 integrin in melanomas and nevi.Hum Pathol 1999;30:562–67.

14. Val�ery C, Grob J-J, Verrando P. Identification by cDNA microarraytechnology of genes modulated by artificial ultraviolet radiationin normal human melanocytes: relation to melanocarcinogenesis.J Invest Dermatol 2002;117:1471–82.

15. Weeraratna AT. A Wnt-er Wonderland—the complexity of Wnt sig-naling in melanoma. Cancer Metast Rev 2005;24:237–50.

16. Oka M, Kikkawa U. Protein kinase C in melanoma. Cancer MetastRev 2005;24:287–300.

17. Glass-Marmor L, Penso J, Beitner R. Ca21-induced changes in energymetabolism and viability of melanoma cells. Br J Cancer 1992;81:219–24.

18. Cox JL, Lancaster T, Carlson CG. Changes in the motility of B16F10melanoma cells induced by alterations in resting calcium influx. Mela-noma Res 2002;12:211–19.

19. Demaurex N, Distelhorst C. Apoptosis—the calcium connection. Sci-ence 2003;300:65–7.

20. Allen DH, Lepple-Wienhues A, Cahalan MD. Ion channel phenotypeof melanoma cell lines. J Membr Biol 1997;155:27–34.

21. Slater M, Scolyer RA, Gidley-Baird A, Thompson JF, Barden JA.Increased expression of apoptotic markers in melanoma. MelanomaRes 2003;13:137–45.

22. White N, Ryten M, Clayton E, Butler P, Burnstock G. P2Y purinergicreceptors regulate the growth of human melanomas. Cancer Lett2005;224:81–91.

23. White N, Butler PE, Burnstock G. Human melanomas express func-tional P2X(7) receptors. Cell Tissue Res 2005;321:411–18.

24. Chow SC, Kass GE, Orrenius S. Purines and their roles in apoptosis.Neuropharmacology 1997;36:1149–56.

25. North RA. Molecular physiology of P2X receptors. Physiol Rev2002;82:1013–67.

26. Verhoef PA, Estacion M, Schilling W, Dubyak GR. P2X7 receptor-dependent blebbing and the activation of q-effector kinases, caspases,and IL-1 b release. J Immunol 2003;170:5728–38.

27. Kim M, Jiang LH, Wilson HL, North RA, Surprenant A. Proteomicand functional evidence for a P2X7 receptor signalling complex.EMBO J 2001;20:6347–58.

28. D€ome B, R�as�o E, Dobos J, Meszaros L, Varga N, Puskas LG, FeherLZ, Lorincz T, Ladanyi A, Trikha M, Honn KV, Timar J. Parallelexpression of aIIbb3 and avb3 integrins in human melanoma cells

upregulates bFGF expression and promotes their angiogenic pheno-type. Int J Cancer 2005;116:27–35.

29. Haak-Frendscho M, Darvas Z, Hegyesi H, Karpati S, Hoffman RL,Laszl�o V, Bencsath M, Szalai C, Ferusz J, Timar J, Bata-Csorgo Z,Szabad G, et al. Histidine decarboxylase expression in human mela-noma. J Invest Dermatol 2000;115:345–52.

30. Dobos J, T�ım�ar J, Bocsi J, Burian Z, Nagy K, Barna G, Petak I,Ladanyi A. In vitro and in vivo antitumor effect of 2-methoxyestradiolon human melanoma. Int J Cancer 2004;112:771–6.

31. Szappanos H, Cseri J, Deli T, Kovacs L, Csernoch L. Determinationof depolarisation- and agonist-evoked calcium fluxes on skeletal mus-cle cells in primary culture. J Biochem Biophys Methods 2004;59:89–101.

32. Bales ES, Dietrich C, Bandyopadhyay D, Schwahn DJ, Xu W,Didenko V, Leiss P, Conrad N, Pereira-Smith O, Orengo I, MedranoEE. High levels of expression of p27KIP1 and cyclin E in invasiveprimary malignant melanomas. J Invest Dermatol 1999;113:2039–46.

33. Rousseau E, Ladine J, Liu QY, Meissner G. Activation of the Ca21

release channel of skeletal muscle sarcoplasmic reticulum by caffeineand related compounds. Arch Biochem Biophys 1988;267:75–86.

34. Meissner G. Ryanodine activation and inhibition of the Ca21 releasechannel of sarcoplasmic reticulum. J Biol Chem 1986;261:6300–6.

35. Sarkozi S, Szentesi P, Jona I, Csernoch L. Effects of cardiac glyco-sides on excitation–contraction coupling in frog skeletal musclefibres. J Physiol 1996;495:611–26.

36. Szentandrassy N, Szigeti G, Szegedi C, Sarkozi S, Magyar J, BanyaszT, Csernoch L, Kovacs L, Nanasi PP, Jona I. Effect of thymol on cal-cium handling in mammalian ventricular myocardium. Life Sci2004;74:909–21.

37. Gonczi M, Papp H, Biro T, Kovacs L, Csernoch L. Effect of proteinkinase C on transmembrane calcium fluxes in HaCaT keratinocytes.Exp Dermatol 2002;11:25–33.

38. Hibell AD, Kidd EJ, Chessell IP, Humphrey PP, Michel AD. Appa-rent species differences in the kinetic properties of P2X7 receptors. BrJ Pharmacol 2000;130:167–73.

39. Bennett DL, Cheek TR, Berridge MJ, De Smedt H, Parys JB, Mis-siaen L, Bootman MD. Expression and function of ryanodine recep-tors in nonexcitable cells. J Biol Chem 1996;271:6356–62.

40. Ryten M, Dunn PM, Neary JT, Burnstock G. ATP regulates the differ-entiation of mammalian skeletal muscle by activation of a P2X5 re-ceptor on satellite cells. J Cell Biol 2002;158:345–55.

41. Greig AV, Linge C, Terenghi G. Burnstock G. Purinergic receptorsare part of a functional signaling system for proliferation and differen-tiation of human epidermal keratinocytes. J Invest Dermatol 2003;120:1007–15.

42. Giannini G, Clementi E, Ceci R, Marziali G, Sorrentino V. Expressionof a ryanodine receptor-Ca21 channel that is regulated by TGF-b. Sci-ence 1992;257:91–4.

43. Sanchez-Bueno A, Cobbold PH. Agonist-specificity in the role ofCa21 induced Ca21 release in hepatocyte Ca21 oscillations. BiochemJ 1993;29:169–72.

44. Hakamata Y, Nishimura S, Nakai J, Nakashima Y, Kita T, Imoto K.Involvement of the brain type of ryanodine receptor in T-cell prolifer-ation. FEBS Lett 1994;352:206–10.

45. Timar J, Chopra H, Rong X, Hatfield JS, Fligiel SE, Onoda JM, Tay-lor JD, Honn KV. Calcium channel blocker treatment of tumor cellsinduces alterations in the cytoskeleton, mobility of the integrin aIIbb3and tumor-cell-induced platelet aggregation. J Cancer Res Clin Oncol1992;118:425–34.

46. Wiesner B, Roloff B, Fechner K, Slominski A. Intracellular calciummeasurements of single human skin cell after stimulation with corti-cotropin-releasing factor and urocortin using confocal laser scanningmicroscopy. J Cell Sci 2003;116:1261–8.

47. Hanson CL, Bootman MD, Roderick HL. Cell signalling: IP3 recep-tors channel calcium into cell death. Curr Biol 2004;14:933–5.

48. Valdivia HH. Modulation of intracellular Ca21 levels in the heart bysorcin and FKBP12, two accessory proteins of ryanodine receptors.Trends Pharmacol Sci 1998;19:479–82.

49. Soengas MS, Lowe SW. Apoptosis and melanoma chemoresistance.Oncogene 2003;22:3138–51.

50. Ivanov VN, Bhoumik A, Ronai Z. Death receptors and melanoma re-sistance to apoptosis. Oncogene 2003;22:3152–61.

65Ca2þ CHANNELS IN HUMAN MELANOMA