Ava i l ab l e on l i ne a t www.sc i enced i r ec t . com

ScienceDirect

www.e l sev i e r . com / l oca te / s c r

Stem Cell Research (2014) 13, 144–153

Fumarylacetoacetate hydrolase deficientpigs are a novel large animal model ofmetabolic liver disease☆

Raymond D. Hickeya,b,1, Shennen A. Maoa,1, Jaime Gloriosoa,1,Joseph B. Lillegardc,1, James E. Fisher a, Bruce Amiot a,Piero Rinaldod, Cary O. Hardinge, Ronald Marler f,Milton J. Finegold g, Markus Grompeh, Scott L. Nyberga,⁎

a Division of Transplant Surgery, Department of Surgery, Mayo Clinic, Rochester, MN, USAb Department of Molecular Medicine, Mayo Clinic, Rochester, MN, USAc Children's Hospital of Philadelphia, Department of Pediatric General Thoracic and Fetal Surgery, Philadelphia, PA, USAd Division of Laboratory Genetics, Department of Laboratory Medicine and Pathology, Mayo Clinic, Rochester, MN, USAe Department of Molecular and Medical Genetics, Oregon Health & Science University, Portland, OR, USAf Department of Comparative Medicine, Mayo Clinic, Scottsdale, AZ, USAg Department of Pathology, Texas Children's Hospital, Baylor College of Medicine, Houston, TX, USAh Oregon Stem Cell Center, Oregon Health and Science University, Portland, OR, USA

Received 2 May 2014; accepted 5 May 2014Available online 14 May 2014

Abstract Hereditary tyrosinemia type I (HT1) is caused by deficiency in fumarylacetoacetate hydrolase (FAH), an enzymethat catalyzes the last step of tyrosine metabolism. The most severe form of the disease presents acutely during infancy, and ischaracterized by severe liver involvement, most commonly resulting in death if untreated. Generation of FAH+/− pigs waspreviously accomplished by adeno-associated virus-mediated gene knockout in fibroblasts and somatic cell nuclear transfer.Subsequently, these animals were outbred and crossed to produce the first FAH−/− pigs.FAH-deficiency produced a lethal defect in utero that was corrected by administration of 2-(2-nitro-4-trifluoromethylbenzoyl)-1,3cyclohexanedione (NTBC) throughout pregnancy. Animals on NTBC were phenotypically normal at birth; however, the

Abbreviations: HT1, Hereditary tyrosinemia type I; FAH, Fumarylacetoacetate hydrolase; NTBC, 2-(2-Nitro-4-trifluoromethylbenzoyl)-1,3cyclohexanedione; FAA, Fumarylacetoacetate; AAV, Adeno-associated virus; SCNT, Somatic cell nuclear transfer; CFTR, Cystic fibrosistransmembrane conductance regulator.☆ Financial support: S. Nyberg was funded by the National Institutes of Health (grant R01-DK56733 and R41 DK092105), the MarriottFoundation, the Wallace H. Coulter Foundation, the American Society of Transplant Surgeons/Pfizer Collaborative Scientist Grant, and theAmerican Society of Transplant Surgeons/National Kidney Foundation Folkert Belzer Award. M. Grompe was supported by the NationalInstitutes of Health (grant DK048252).⁎ Corresponding author at: William J. von Liebeg Center for Transplantation and Clinical Regeneration, Mayo Clinic, 200 First Street SW,

Rochester, MN 55905, USA. Fax: +1 507 266 2810.E-mail address: Nyberg.Scott@mayo.edu (S.L. Nyberg).

1 These authors contributed equally to this work.

http://dx.doi.org/10.1016/j.scr.2014.05.0031873-5061/© 2014 The Authors. Published by Elsevier B.V. This is an open access article under theCCBY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/3.0/).

145FAH-deficient pigs are a novel large animal model of metabolic liver disease

animals were euthanized approximately four weeks after withdrawal of NTBC due to clinical decline and physicalexamination findings of severe liver injury and encephalopathy consistent with acute liver failure. Biochemical andhistological analyses, characterized by diffuse and severe hepatocellular damage, confirmed the diagnosis of severe liverinjury. FAH−/− pigs provide the first genetically engineered large animal model of a metabolic liver disorder. Futureapplications of FAH−/− pigs include discovery research as a large animal model of HT1 and spontaneous acute liver failure,and preclinical testing of the efficacy of liver cell therapies, including transplantation of hepatocytes, liver stem cells, andpluripotent stem cell-derived hepatocytes.

© 2014 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license(http://creativecommons.org/licenses/by-nc-nd/3.0/).

Introduction

Hereditary tyrosinemia type I (HT1; OMIM #276700) is anautosomal-recessive inborn error of metabolism causedby deficiency in fumarylacetoacetate hydrolase (FAH), anenzyme that catalyzes the last step of tyrosine metabolism(de Laet et al., 2013; Grompe, 2001; Sniderman King et al.,1993; Lindblad et al., 1977). The absence of FAH causesaccumulation of the toxic metabolite fumarylacetoacetate(FAA) in hepatocytes and renal proximal tubules, the twomajor cell types that express FAH (Endo and Sun, 2002;Jorquera and Tanguay, 1997; Kubo et al., 1998). Clinically,individuals with HT1 commonly develop symptoms withinthe first few weeks of life; however, presentation isoften variable, even within a family (Sniderman King et al.,1993). Acute onset of HT1 is characterized by severe liverinvolvement (Russo and O'Regan, 1990), most frequentlyleading to death, if untreated. The most common treatmentfor HT1 is a low-tyrosine diet combined with administrationof 2-(2-nitro-4-trifluoromethylbenzoyl)-1,3 cyclohexanedione(NTBC) (Lindstedt et al., 1992), a potent inhibitor of4-hydroxyphenylpyruvate dioxygenase (Fig. S1).

Two Fah-knockout mouse models have been previouslydescribed: the c14CoS albino mouse and the FahΔexon5 mouse(Gluecksohn-Waelsch, 1979; Russell et al., 1979; Grompe etal., 1993). Fah-knockout mice have proven a tremendousresource for translational research related to treatment of ametabolic liver disease by various cell and gene therapyapproaches (Overturf et al., 1996; Paulk et al., 2010;Lisowski et al., 2012; Huang et al., 2011; Zhu et al., 2014).However, as has been demonstrated elegantly by thecreation of cystic fibrosis transmembrane conductanceregulator (CFTR) knockout pigs (Rogers et al., 2008), thepig is a more appropriate research model because of itssimilarity in size, anatomy, and biology to the human(Cooper et al., 2002). We have previously reported thegeneration and characterization of heterozygous FAH+/− pigs(Hickey et al., 2011) by using adeno-associated virus (AAV)and homologous recombination to target and disrupt theporcine FAH gene, located on chromosome 7 in the piggenome. An AAV vector was used to deliver a knockoutconstruct targeted to exon 5 of FAH fetal pig fibroblasts withan average knockout targeting frequency of 5.4% achieved.Targeted FAH+/− fibroblasts were used as nuclear donors forsomatic cell nuclear transfer (SCNT) to porcine oocytes, andmultiple viable FAH+/− pigs were born. FAH+/− pigs werephenotypically normal, but had decreased FAH transcrip-tional and enzymatic activity compared to FAH+/+ animals.Therefore, the goal of this study was to generate andcharacterize FAH−/− pigs in order to develop a more relevant

preclinical model of an inborn error of metabolism thancurrently exists.

Materials and methods

Animals and animal care

FAH−/− pigs were produced in a 50% Large White 50%Landrace pig. All animals received humane care in compli-ance with the regulations of the Institutional Animal Careand Use Committee at Mayo Clinic. All animals wereobserved at least daily for clinical signs and symptomsconsistent with HT1 and acute liver failure. All animalswere weighed daily until reaching a weight of 20 kg; animalswere subsequently weighed twice weekly. NTBC (Yecuris,Portland, OR) was administered to the animals orally mixedwithin a portion of daily chow rations. Pregnant sows weregiven 50–100 mg of NTBC per day for the duration ofgestation. Weaned piglets were administered 1 mg/kg NTBCper day until day 30. The animals were observed until theyconsumed the entire portion of medicated food.

PCR genotyping

Pig tissue, from ear or tail, was added to 100 μL of lysis buffer(stock lysis solution = 440 μL 0.01% SDS; 40 μL 10 mg/mLproteinase K; 20 μL 0.5 M EDTA). Following a 90-min in-cubation at 50 °C and 30-min incubation at 95 °C, 0.5 μL ofthe lysed tissue were used for each 25 μL PCR reaction usingBIOLASE DNA Polymerase (Bioline, Taunton, MA) with thefollowing three primers: WT-F: TTTCCTCCGCAGGTGACTAC;MUT-F: GGGAGGATTGGGAAGACAAT; R-GACAACATGCTGCTGGACAC. PCR conditions were as follows: 94 °C for 5 min;35 cycles of 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 30 s;72 °C for 5 min. PCR generated products of either 168 bp(wild-type allele) or 232 bp (mutant allele), which wereelectrophoresed on a 2.5% TAE agarose gel and visualized withethidium bromide staining.

FAH protein assays

For western blot analysis, liver samples were homogenizedin cell lysis buffer (Cell Signaling, Danvers, MA) and isolatedtotal protein separated by SDS-PAGE, followed by immuno-blotting onto a polyvinylidene fluoride membrane (TransBlotTurbo, BioRad, Hercules, CA). The primary antibodies againstFAH (Wang et al., 2002) and beta-Actin (#4970; Cell Signaling,Danvers, MA) were detected with a secondary HRP conjugatedanti-rabbit antibody (Cell Signaling, Danvers, MA), and imaged

Figure 1 FAH-deficiency is an in utero lethal defect in theabsence of NTBC. FAH+/− male and female pigs were bredtogether, with our without administration of NTBC in the food.No FAH−/− piglets were born in the absence of NTBC adminis-tration. 19 out of 88 piglets were FAH−/− when NTBC wasadministered to the sow throughout pregnancy.

146 R.D. Hickey et al.

using a chemiluminescent substrate for detection of HRP(Thermo Scientific, Waltham, MA). FAH enzyme assays werecarried out on a cytosolic fraction of homogenized liver asdescribed previously (Grompe et al., 1993). Absorbance at330 nm was measured every 15 s by spectrophotometry afteradditional of fumarylacetoacetate substrate.

Histopathological analysis

For liver and kidney analysis, tissue samples were fixed in10% neutral buffered formalin (Protocol, Fisher-Scientific,Pittsburgh, PA) and processed for paraffin embedding andsectioning. For hematoxylin and eosin staining, as well asperiodic acid-Schiff staining, slides were prepared usingstandard protocols. FAH immunohistochemistry using apolyclonal rabbit anti-FAH primary antibody (Wang et al.,2002) was performed with a Bond III automatic stainer(Leica, Buffalo Grove, IL) with a 20 min antigen retrievalstep using Bond Epitope Retrieval Solution 2 (Leica, BuffaloGrove, IL) and stained with diaminobenzidine (Leica, BuffaloGrove, IL).

Blood analysis

Blood was obtained via the right femoral vein using anultrasound guided percutaneous technique on a monthlybasis and juts prior to euthanasia. Serum and plasma wereseparated for analysis using standard protocols. For aminoacid analysis, blood samples were collected and dried on 903Protein Saver Cards (GE Healthcare, Pittsburgh, PA). Aminoacids and succinylacetone were measured in dried bloodspots by tandem mass spectrometry as previously described(Turgeon et al., 2008).

NTBC kinetics

Three wild-type pigs were fed an oral 1 mg/kg dose of NTBC.Blood samples were collected every 12 h and plasmaseparated for analysis prior to freezing at −20 °C. Plasmasamples were thawed and vortexed at room temperature. A100 μL aliquot was removed from each sample and combinedwith 25 μL of water:acetonitrile (1:1) and 300 μL of internalstandard (200 ng/mL of hydroxycoumarin-d4 prepared inacetonitrile). A standard curve and quality control sampleswere similarly prepared with commercially available pigplasma by spiking 25 μL of NTBC (in 1:1 water:acetonitrile)into 100 μL plasma over a range of 2.5 to 2500 ng/mL.The samples were vortexed for 5 min and centrifuged at4000 rpm for 10 min at 10 °C. 200 μL of the supernatant wastransferred to a new plate and diluted with 100 μL of water:acetonitrile (1:1) and vortexed prior to analysis. Extractedplasma samples were analyzed by LC/MS/MS with a triplequadrupole mass spectrometer in negative electrosprayionization mode. A multiple reaction monitoring methodcontaining mass transitions appropriate for both analyteand internal standard was developed. Reversed phaseHPLC was performed with a Waters Atlantis dC18 column(100 × 2.1 mm, 5 μm) using a linear binary gradient ofmobile phase A (0.1 mM ammonium acetate in water:methanol (95:5)) and mobile phase B (0.1 mM ammoniumacetate in methanol) at a flow rate of 0.750 mL/min. Initial

conditions were 30% B, held for 0.20 min then changedto 98% B over 1.80 min and held for 0.50 min. Columnre-equilibration was attained by returning to initial condi-tions for 0.50 min.

Results

NTBC administration during gestation rescues inutero lethality in FAH−/− pigs

Female FAH+/− pigs, previously generated by SCNT, wereallowed to develop to maturity prior to breeding withwild-type male pigs to generate male and female FAH+/−

pigs. Upon further out-crossing to wild-type pigs to generategenetic diversity in the herd, male and female FAH+/− pigswere bred together to potentially produce the first FAH−/−

pigs (Fig. 1). Surprisingly, in the absence of NTBC duringgestation, no FAH−/− piglets were born. Next, females wereput on NTBC prior to conception and for the duration ofpregnancy (approximately 115 days). Pregnant sows wereallowed to farrow naturally by vaginal birth. NTBC adminis-tration throughout pregnancy rescued the in utero lethalityof FAH deficiency as multiple healthy FAH−/− piglets wereborn within the predicted Mendelian ratio (Fig. 1).

As no remnant or mummified fetuses were delivered bysows not on NTBC, we hypothesized that FAH-deficiency wascausing in utero lethality prior to day 35 of gestation(Christianson, 1992). To test this, a pregnant sow on NTBCwas euthanized at 30 days of gestation and fetuses werecollected for molecular analyses (Fig. 2A). Of the 17 fetusesrecovered, 7 were FAH−/− as determined by PCR genotyping(Fig. 2B). Additionally, liver tissue was collected from allanimals and FAH expression tested by Western blot analysis,revealing FAH was robustly expressed at the protein level atday 30 of gestation in FAH+/+ and FAH+/− fetal pigs, but notexpressed in FAH−/− fetal pigs (Fig. 2C). Finally, in order to

Figure 2 FAH is expressed early during pig fetal development. (A) Image of fetus harvested at day 30 of gestation. (B) Athree-primer PCR assay was designed to genotype all piglets based on the presence or absence of a wild-type (WT) or mutant FAHallele. In this litter of 17 piglets, seven were FAH−/− (H = Homozygote for mutant allele), four were FAH+/−, and six were FAH+/+.(C) Western blot analysis using an FAH antibody was performed to confirm the absence of FAH protein in FAH−/− liver homogenatecompared to FAH+/− and FAH+/+ pigs. A β-actin antibody was used as a loading control for all samples. (D) An FAH enzyme assay wasperformed on FAH−/− and FAH+/+ liver homogenates (n = 3 for each genotype). FAH−/− liver homogenate was unable to break downFAA, as measured by a decrease in absorbance at 330 nm, indicating the absence of FAH activity.

147FAH-deficient pigs are a novel large animal model of metabolic liver disease

categorically rule out the presence of another enzyme thatmay act in a compensatory mechanism in pigs to catalyze thebreakdown of FAA, a standard FAH enzyme assay was

Figure 3 FAH−/− pigs off NTBC undergo rapid clinical decline. (A) Sindicating whether or not NTBC was administered (ON/OFF NTBC).compared to a control group. *P b 0.01 for differential survival betwthree littermate pigs on NTBC at day 30 on left, compared to immedfar right had been off NTBC for 47 days.

performed on liver homogenates using FAA as a substrate.Consistent with the western blot analysis, FAA was able to bemetabolized with associated decrease in absorbance at

chematic of the two groups of FAH−/− pigs used for these studies,(B) Kaplan–Meier survival curve for two groups of FAH−/− pigseen both FAH−/− groups compared to controls. (C, D) Images ofiately prior to euthanasia on right in which the FAH−/− pig on the

148 R.D. Hickey et al.

330 nm in wild-type siblings but not in FAH−/− animals(Fig. 2D).

Effect of NTBC withdrawal in FAH−/− pigs

In humans, NTBC has been reported to have an estimatedhalf-life in serum of 54 h (Hall et al., 2001). As NTBC kineticswas unknown in pigs, we tested the half-life of NTBC after asingle administration of 1 mg/kg in three pigs and deter-mined the half-life to be 20.9 h (Fig. S2). We next set out totest the effect of NTBC withdrawal in two groups of FAH−/−

piglets (Fig. 3A). In the first group of animals, no NTBC wasadministered to either the piglets or to their nursing sowafter birth. These three animals, experienced severe failureto thrive and rapidly succumbed to complications of acuteliver failure including severe hypoglycemia, coagulopathy,encephalopathy and infection by 25 days of age (Fig. 3B). Inthe second group of pigs, four piglets received 1 mg/kgNTBC through day 30 of life. NTBC was removed from thediet at this later time point to determine the effect ofFAH-deficiency in weaned pigs. In three of these animals,weight gain ceased within seven days of NTBC withdrawal,and was accompanied by a progressive failure to thrivephenotype (Fig. 3C and D). These three animals wereeuthanized 19, 22 and 47 days after NTBC withdrawal(49, 52 and 77 days after birth) due to similar clinicalfindings of hypoglycemia, coagulopathy, and encephalopa-thy as seen in the Group 1 animals. One animal (L795)continued to slowly gain weight for 112 days prior tocessation of weight gain (Fig. S3). However, despite themodest weight gain, this animal demonstrated signs ofencephalopathy and was euthanized 145 days after NTBCwithdrawal due to an upper gastrointestinal hemorrhage.

FAH−/− pigs have multiple biochemical abnormalities

We next analyzed several biochemical parameters to furthercharacterize the phenotype of FAH−/− animals (Table 1 andFigs. S3 and S4). At the time of euthanasia, blood serumanalysis revealed a pattern of acute liver injury including

Table 1 Biochemical parameters in FAH−/− pigs at time of euthaFAH−/− Group 1, n = 2; FAH−/− Group 2, n = 3; Control, n = 4. * =applying a student 2-tailed t-test assuming equal variance by comcontrol group.

Unit FAH−/− group 1

AST U/L 205.5 ± 58.7Alkaline phosphatase IU/L 1629.5 ± 379.7Total bilirubin mg/dl 2.7 ± 0.4Ammonia μmol/L 629.0 ± 369.1INR – 1.9 ± 0.1Glucose mg/dl 8.5 ± 0.7Creatinine (blood) mg/dl 0.3 ± 0.0Creatinine (urine) mg/dl 25.2 ± 0.0*Tyrosine μM 753.0 ± 188.1Methionine μM 424.5 ± 222.7Succinylacetone (blood) μg/mL 3.0 ± 0.4Succinylacetone (urine) μM 8.3 ± 0.0*

significant elevations in alkaline phosphatase, aspartateaminotransferase, ammonia, total bilirubin and prothrombintime in FAH−/− animals compared to control animals. Fastingserum glucose levels were significantly decreased comparedto controls. Next, amino acid levels were compared toanalyze the effect of FAH-deficiency on tyrosine metabolism(Table 1). Serum analysis revealed tyrosine was significantlyelevated in FAH−/− animals compared to controls indicatinga block in tyrosine metabolism. Finally, elevation in urinarysuccinylacetone is the primary diagnostic of HT1 in humanpatients and is caused by a build-up of FAA due to FAH-deficiency. Consistent with this phenotype, succinylacetonelevels were significantly increased in FAH−/− animals at thetime of euthanasia in both blood and urine samples (Table 1,Figs. S3 and S4).

FAH−/− pigs have progressive liver injury

We next analyzed the histology of livers from FAH−/− animalsoff NTBC. We first confirmed the absence of FAH in theselivers by IHC. Whereas FAH was detected robustly in thehepatocytes of FAH+/+ or FAH+/− animals, FAH was complete-ly absent in FAH−/− livers (Fig. 4A and B). Secondly, periodicacid-Schiff (PAS) staining was performed to access glycogenlevels in the liver. Consistent with liver failure as theprimary cause of death in FAH−/− animals, PAS stainingwas markedly decreased in FAH+/− livers compared to liversfrom wild-type siblings (Figs. S5A to C). Next, a detailedhistopathological analysis revealed diffuse hepatocellularinjury, with hepatocytes exhibiting necrosis, cytoplasmicballooning degeneration, karyomegaly and prominent nucle-oli in FAH−/− animals only (Fig. 4C and D; Fig. S5D to F).

FAH−/− pigs have dysmorphic kidney morphology

As FAH is also expressed in renal proximal tubules, we nextanalyzed the kidney by histology to determine if the kidneyswere also damaged in FAH−/− animals. Whereas FAH wasdetected uniformly in the renal proximal tubules of FAH+/+

or FAH+/− pigs, FAH was completely absent in FAH−/− kidneys

nasia. Results are expressed as average ± standard deviation.n = 1. Experimental results were analyzed for significance bybining results from both FAH−/− groups and comparing to the

FAH−/− group 2 Control P value

343.7 ± 154.5 61.0 ± 19.3 0.0137918.3 ± 282.5 330.5 ± 75.2 0.0091

1.0 ± 0.7 0.1 ± 0.1 0.0266553.0 ± 561.6 64.3 ± 37.3 0.0533

1.8 ± 0.6 1.0 ± 0.1 0.011228.0 ± 22.6 108.5 ± 18.9 0.00020.4 ± 0.1 0.7 ± 0.1 0.0008

22.8 ± 18.9 47.1 ± 27.7 0.1978826.3 ± 277.5 132.0 ± 2.8 0.0102153.9 ± 138.0 44.8 ± 7.7 0.2243

2.9 ± 0.9 0.9 ± 0.2 0.00065.7 ± 4.2 0 ± 0.0 0.0322

Figure 4 FAH−/− pigs have severe liver damage after NTBC withdrawal. (A, B) FAH-immunohistochemistry in liver of FAH+/+ (left)and FAH−/− (right) pigs. FAH (stained brown) is completely absent in FAH−/− hepatocytes. Scale bar = 250 μm. (C, D) H&E staining inliver of FAH+/+ (left) and FAH−/− (right) pig. FAH−/− livers show significant hepatocyte injury, with necrosis and inflammationcompared to the control liver. Scale bar = 100 μm.

Figure 5 FAH−/− pigs have kidney abnormalities after NTBC withdrawal. (A, B) FAH-immunohistochemistry in kidneys of FAH+/+

(left) and FAH−/− (right) pigs. FAH (stained brown) is completely absent in FAH−/− renal tubular cells. Scale bar = 250 μm. (C) Grossmorphology of kidney from FAH−/− pig showing the presence of a calcium phosphate deposit in the pelvis. Scale bar = 20 mm. (D) H&Estaining in kidney of FAH−/− pig showing renal tubular injury. Scale bar = 400 μm.

149FAH-deficient pigs are a novel large animal model of metabolic liver disease

150 R.D. Hickey et al.

(Fig. 5A and B). Examination of kidneys at the time ofeuthanasia revealed conspicuous macroscopic changes (2/4animals from Group 2; 0/3 animals from Group 1) charac-terized by the presence of a yellow deposit in the renalpelvis that was determined to contain a calcium phosphatepeak upon spectral analysis (Fig. 5C). In contrast to liverdamage, kidney damage was more variable; however,kidneys from FAH−/− pigs from both groups had areas offocal acute pyelitis but kidney damage was more prominentin animals that did not receive any NTBC from birth (Group1). In addition to pyelitis, cortical kidney damage includedtubular epithelial injury with proteinaceous casts, tubulardilation, and acute pyelonephritis (Fig. 5D).

FAH−/− pigs have no other major abnormalities

As there have been isolated reports of abnormalities outsidethe liver and kidney of HT1 patients, we next performed athorough histopathological analysis of all other major organsof FAH−/− pigs. With the exception of the pancreas, nosignificant pathology was identified (normal histology notshown). However, at the time of euthanasia, there was adecrease in islet size and islet number in the pancreata ofFAH−/− pigs (2/7 pigs; Figs. S6A and B). To investigate thisfurther, we performed IHC with an antibody against FAH onpancreatic sections. Interestingly, the anti-FAH antibodylabeled pancreatic islet cells robustly in FAH+/+ animals,whereas no FAH + cells were detected in pancreata ofFAH−/− pigs (Fig. S6C and D).

Discussion

As limitations in murine models have become more appar-ent, a substantial need exists for the creation of improvedmodels of human disease (Prather et al., 2013). The adventof SCNT and improved gene targeting strategies have madethe pig the preferred choice for generating large animalmodels of human diseases (Rogers et al., 2008; Renner et al.,2010; Saeki et al., 2004). Metabolic diseases, or inbornerrors of metabolism, are caused by single gene defects inwhich the absence or dysfunction of a protein results inabnormal synthesis or metabolism of a protein, carbohy-drate, or fat. While the individual incidence of each disorderis rare, it is estimated that 10% of all pediatric livertransplants are resultant from inborn errors of metabolism(Hansen and Horslen, 2008). A potential alternative strategyto liver transplantation is hepatocyte transplantation (Fisherand Strom, 2006). Since initial preclinical experiments in arodent model for Crigler–Najjar syndrome type 1 (Matas etal., 1976), a number of small animal models of metabolicliver diseases have been treated by hepatocyte transplanta-tion, including hereditary tyrosinemia type 1 (Overturf etal., 1996), phenylketonuria (Hamman et al., 2005), Wilson'sdisease (Yoshida et al., 1996), progressive familial intrahepaticcholestasis (De Vree et al., 2000), and alpha-1 antitrypsindeficiency (Overturf et al., 1996; Matas et al., 1976; Wilson etal., 1988). These experiments in rodents have paved theway for hepatocyte transplantation in humans, including thefirst published partial correction in a patient with metabolicliver disease in 1998 (Fox et al., 1998). A major limitation ofhepatocyte transplantation in humans has been a shortage of

transplantable cells. Therefore, there has been intense in-terest in developing new methods to generate hepatocytesfrom various cell types including fetal and adult liver stem cells(Huch et al., 2013; Schmelzer et al., 2007; Haridass et al.,2009), pluripotent stem cells (Yamada et al., 2002; Yu et al.,2012; Si-Tayeb et al., 2010), and by direct reprogrammingfrom other lineages (Huang et al., 2011; Zhu et al., 2014). TheFah-knockout mouse has played a critical role in many of thesestudies by providing an essential test of in vivo efficacy ofhepatocyte function and repopulation competency (Azuma etal., 2007). However, as has been demonstrated recently bygeneration of CFTR knockout animals (Rogers et al., 2008), pigsprovide a more clinically-relevant model of human disease andshould accelerate development of regenerative therapies forvarious human disorders. We believe, therefore, that a largeanimal knockout model of FAH-deficiency will provide animportant preclinical model of metabolic liver disease andprove useful in the evaluation of novel liver cell therapies.

In this study, we report the creation of the firstgenetically modified large animal model of a metabolicliver disorder, HT1, in pigs that are deficient in FAH, anenzyme that catalyzes the last step in tyrosine metabolism(Lindblad et al., 1977). Based on the results presented here,we believe FAH−/− pigs off NTBC closely resemble thephenotype of acute-onset HT1 in humans. First, the mostcommon presentation for HT1 in infants is failure to thriveand this phenotype was represented in these pigs asevidenced by cessation of weight gain and muscle wastingwhen animals were off NTBC. Second, diagnosis of HT1in the clinic consists of detection of elevated tyrosineand succinylacetone in the blood or urine, of which bothparameters were observed in FAH−/− pigs. Confirmation ofHT1 diagnosis in the clinic is done by measuring FAH enzymeactivity, which was also performed in FAH−/− pigs to confirmFAH-deficiency. Third, liver injury is the key characteristicof acute-onset HT1 in infants. Hepatocyte damage wasthe predominant histological finding in the liver of theseanimals, presumably caused by accumulation of FAA withinthese cells caused by FAH deficiency (Jorquera and Tanguay,1997; Kubo et al., 1998). Severe liver damage was confirmedbiochemically at autopsy by elevation of AST, alkalinephosphatase, ammonia, and total bilirubin in the blood.Fourth, similar to the human phenotype (Sniderman King etal., 1993), renal tubular damage was also detected in pigsoff NTBC. In HT1, renal tubular dysfunction is caused cellautonomously by accumulation of FAA, as well as non-cellautonomously by circulating succinylacetone (Kubo et al.,1998). As a result, renal tubular injury is more pronounced inthe chronic form of human HT1, and we predict that futurestudies will reveal more extensive kidney damage in FAH−/−

pigs that survive longer than in this study.It is important to acknowledge, however, that there are

differences between FAH−/− pigs and HT1 patients. First,FAH-deficiency in humans is not believed to cause a lethaldefect in utero, even in HT1 patients with no detectableFAH activity (Grompe, 2001; Sniderman King et al., 1993).In our early experiments, pregnant sows were not adminis-tered NTBC and no FAH−/− progeny were recovered. Ascalcification occurs around day 35 of development in pigs(Christianson, 1992), and no mummified fetuses wererecovered at birth in these litters off NTBC, these resultsindicated that FAH-deficiency was causing lethality prior to

151FAH-deficient pigs are a novel large animal model of metabolic liver disease

day 35 of gestation. This hypothesis is substantiated by thefact that FAH is expressed early in the developing pig asdemonstrated by our western blot and enzyme assays. This isalso a notable difference between Fah−/− mice and FAH−/−

pigs. In mice, Fah gene expression is detected aroundday E15.5 of development in the liver (Li et al., 2009).Consequently, FAH-deficiency in mice does not produce anin utero lethal defect and mice are born, albeit with severeliver damage (Grompe et al., 1993; Ruppert et al., 1992).Less is known about FAH activity in human development;however, FAH protein has been detected by western blotin human fetal liver (Tanguay et al., 1990). Moreover,succinylacetone can be detected in the amniotic fluid of HT1fetuses at around 15–18 weeks of gestation (Sniderman Kinget al., 1993; Gagne et al., 1982), indicating FAH is active byat least this time point in human development. Additionally,confirmation of FAH-deficiency in the developing humanfetus leading to liver damage has also been shown bydetection of succinylacetone and alpha-fetoprotein in thecord blood of newborns with HT1 (Hostetter et al., 1983). Tothat point, there have been two recent reports of adminis-tration of NTBC during gestation in patients with HT1(Vanclooster et al., 2012; Garcia Segarra et al., 2010).While this approach has potential therapeutic benefit, up tonow there has been no suitable research model to test theeffect of in utero administration of NTBC to the fetus in anappropriate preclinical model. The results presented herewould strengthen the argument that a patient carrying afetus known to be at high risk of liver damage caused by theabsence of a functional FAH gene should be given NTBC forthe duration of pregnancy.

It is interesting to note, that in utero lethality in FAH−/−

pigs, which is correctable by NTBC, provides uniqueopportunities to study regenerative therapies targeted tothe fetus (MacKenzie et al., 2002). As liver injury can beinitiated by stopping NTBC at any time in development,FAH−/− pigs could be used to test efficacy of gene therapyand in utero cell transplant approaches at any point duringgestation, providing a unique disease model that is currentlyunavailable. Additionally, FAH-deficiency during develop-ment may provide a strong selective advantage for theexpansion of transplanted human hepatocytes in utero(Fisher et al., 2013), potentially allowing rapid repopulationof the FAH−/− liver with cells (Azuma et al., 2007) that couldbe used for various cell therapy approaches for myriad liverdisorders. A comparable strategy has already been demon-strated in the pig for generating exogenic pancreas in anapancreatic pig by way of blastocyst complementation(Matsunari et al., 2013). This success of this procedurewas based on the vacant pancreatic niche created byexpressing a HES1 transgene driven by the PDX1 promoterwhich resulted in an apancreatic phenotype. To this point,FAH-deficiency in the developing mouse has been alreadyexploited for liver repopulation with FAH-positive cells(Espejel et al., 2010), suggesting FAH-deficiency couldprovide a unique niche in the developing FAH−/− pig fetusfor repopulation with FAH-positive cells.

In conclusion, our data show that FAH−/− pigs representthe first genetically modified large model of a metabolicliver disease. FAH−/− pigs off NTBC die of acute liver failurecaused by severe hepatocyte dysfunction due to deficiencyof the enzyme FAH. FAH−/− pigs closely resemble the human

HT1 phenotype, although differences do exist. We anticipateFAH−/− pigs will provide a tremendous resource for preclin-ical studies aimed at developing regenerative treatments formetabolic liver disease. Additionally, it can be expectedthat FAH−/− pigs will provide a clinically relevant model fortesting efficacy of various cell therapy approaches, includinghepatocytes, liver stem cells, pluripotent stem cell-derivedhepatocytes, and induced multipotent progenitor cells.

Acknowledgments

We thank Angela Major of the NIDDK-sponsored Digestive DiseaseCore Laboratory of the Texas Medical Center (DK56338), LouAnnGross (Mayo Clinic, Rochester) and Jenny Pattengill (Mayo Clinic,Arizona) for histology support. We thank Denise Rokke (Mayo Clinic,Rochester) for elemental analysis. We thank John Bial and YecurisINC for financial support of early studies involving FAH deficientpigs.

Appendix A. Supplementary data

Supplementary data to this article can be found online athttp://dx.doi.org/10.1016/j.scr.2014.05.003.

References

Azuma, H., Paulk, N., Ranade, A., Dorrell, C., Al-Dhalimy, M., Ellis,E., Strom, S., Kay, M.A., Finegold, M., Grompe, M., 2007. Robustexpansion of human hepatocytes in Fah−/−/Rag2−/−/Il2rg−/−

mice. Nat. Biotechnol. 25, 903–910.Christianson, W.T., 1992. Stillbirths, mummies, abortions, and early

embryonic death. Vet. Clin. North Am. Food Anim. Pract. 8,623–639.

Cooper, D.K., Gollackner, B., Sachs, D.H., 2002. Will the pig solvethe transplantation backlog? Annu. Rev. Med. 53, 133–147.

de Laet, C., Dionisi-Vici, C., Leonard, J.V., McKiernan, P., Mitchell,G., Monti, L., de Baulny, H.O., Pintos-Morell, G., Spiekerkotter,U., 2013. Recommendations for the management of tyrosinaemiatype 1. Orphanet J. Rare Dis. 8, 8.

De Vree, J.M., Ottenhoff, R., Bosma, P.J., Smith, A.J., Aten, J.,Oude Elferink, R.P., 2000. Correction of liver disease by hepatocytetransplantation in a mouse model of progressive familial intra-hepatic cholestasis. Gastroenterology 119, 1720–1730.

Endo, F., Sun, M.S., 2002. Tyrosinaemia type I and apoptosis ofhepatocytes and renal tubular cells. J. Inherit. Metab. Dis. 25,227–234.

Espejel, S., Roll, G.R., McLaughlin, K.J., Lee, A.Y., Zhang, J.Y.,Laird, D.J., Okita, K., Yamanaka, S., Willenbring, H., 2010.Induced pluripotent stem cell-derived hepatocytes have thefunctional and proliferative capabilities needed for liver regen-eration in mice. J. Clin. Invest. 120, 3120–3126.

Fisher, R.A., Strom, S.C., 2006. Human hepatocyte transplantation:worldwide results. Transplantation 82, 441–449.

Fisher, J.E., Lillegard, J.B., McKenzie, T.J., Rodysill, B.R., Wettstein,P.J., Nyberg, S.L., 2013. In utero transplanted human hepatocytesallow postnatal engraftment of human hepatocytes in pigs. LiverTransplant. 19, 328–335.

Fox, I.J., Chowdhury, J.R., Kaufman, S.S., Goertzen, T.C., Chowdhury,N.R., Warkentin, P.I., Dorko, K., Sauter, B.V., Strom, S.C., 1998.Treatment of the Crigler–Najjar syndrome type I with hepatocytetransplantation. N. Engl. J. Med. 338, 1422–1426.

Gagne, R., Lescault, A., Grenier, A., Laberge, C., Melancon, S.B.,Dallaire, L., 1982. Prenatal diagnosis of hereditary tyrosinaemia:

152 R.D. Hickey et al.

measurement of succinylacetone in amniotic fluid. Prenat. Diagn.2, 185–188.

Garcia Segarra, N., Roche, S., Imbard, A., Benoist, J.F., Greneche,M.O., Davit-Spraul, A., Ogier de Baulny, H., 2010. Maternal andfetal tyrosinemia type I. J. Inherit. Metab. Dis. 33 (Suppl. 3),S507–S510.

Gluecksohn-Waelsch, S., 1979. Genetic control of morphogeneticand biochemical differentiation: lethal albino deletions in themouse. Cell 16, 225–237.

Grompe, M., 2001. The pathophysiology and treatment of hereditarytyrosinemia type 1. Semin. Liver Dis. 21, 563–571.

Grompe, M., al-Dhalimy, M., Finegold, M., Ou, C.N., Burlingame, T.,Kennaway, N.G., Soriano, P., 1993. Loss of fumarylacetoacetatehydrolase is responsible for the neonatal hepatic dysfunctionphenotype of lethal albino mice. Genes Dev. 7, 2298–2307.

Hall, M.G., Wilks, M.F., Provan, W.M., Eksborg, S., Lumholtz, B., 2001.Pharmacokinetics and pharmacodynamics of NTBC (2-(2-nitro-4-fluoromethylbenzoyl)-1,3-cyclohexanedione) and mesotrione, in-hibitors of 4-hydroxyphenyl pyruvate dioxygenase (HPPD) followinga single dose to healthy male volunteers. Br. J. Clin. Pharmacol.52, 169–177.

Hamman, K., Clark, H., Montini, E., Al-Dhalimy, M., Grompe, M.,Finegold, M., Harding, C.O., 2005. Low therapeutic threshold forhepatocyte replacement in murine phenylketonuria. Mol. Ther.12, 337–344.

Hansen, K., Horslen, S., 2008. Metabolic liver disease in children.Liver Transplant. 14, 713–733.

Haridass, D., Yuan, Q., Becker, P.D., Cantz, T., Iken, M., Rothe, M.,Narain, N., Bock, M., Norder, M., Legrand, N., Wedemeyer, H.,Weijer, K., Spits, H., Manns, M.P., Cai, J., Deng, H., Di Santo, J.P.,Guzman, C.A., Ott, M., 2009. Repopulation efficiencies of adulthepatocytes, fetal liver progenitor cells, and embryonic stem cell-derived hepatic cells in albumin-promoter-enhancer urokinase-type plasminogen activator mice. Am. J. Pathol. 175, 1483–1492.

Hickey, R.D., Lillegard, J.B., Fisher, J.E., McKenzie, T.J., Hofherr,S.E., Finegold, M.J., Nyberg, S.L., Grompe, M., 2011. Efficientproduction of Fah-null heterozygote pigs by chimeric adeno-associated virus-mediated gene knockout and somatic cellnuclear transfer. Hepatology 54, 1351–1359.

Hostetter, M.K., Levy, H.L., Winter, H.S., Knight, G.J., Haddow,J.E., 1983. Evidence for liver disease preceding amino acidabnormalities in hereditary tyrosinemia. N. Engl. J. Med. 308,1265–1267.

Huang, P., He, Z., Ji, S., Sun, H., Xiang, D., Liu, C., Hu, Y., Wang,X., Hui, L., 2011. Induction of functional hepatocyte-like cellsfrom mouse fibroblasts by defined factors. Nature 475,386–389.

Huch, M., Dorrell, C., Boj, S.F., van Es, J.H., Li, V.S.W., van deWetering, M., Sato, T., Hamer, K., Sasaki, N., Finegold, M.J.,Haft, A., Vries, R.G., Grompe, M., Clevers, H., 2013. In vitroexpansion of single Lgr5(+) liver stem cells induced by Wnt-driven regeneration. Nature 494, 247–250.

Jorquera, R., Tanguay, R.M., 1997. The mutagenicity of thetyrosine metabolite, fumarylacetoacetate, is enhanced byglutathione depletion. Biochem. Biophys. Res. Commun. 232,42–48.

Kubo, S., Sun, M., Miyahara, M., Umeyama, K., Urakami, K.,Yamamoto, T., Jakobs, C., Matsuda, I., Endo, F., 1998. Hepatocyteinjury in tyrosinemia type 1 is induced by fumarylacetoacetate andis inhibited by caspase inhibitors. Proc. Natl. Acad. Sci. U. S. A. 95,9552–9557.

Li, T., Huang, J., Jiang, Y., Zeng, Y., He, F., Zhang, M.Q., Han, Z.,Zhang, X., 2009. Multi-stage analysis of gene expression andtranscription regulation in C57/B6 mouse liver development.Genomics 93, 235–242.

Lindblad, B., Lindstedt, S., Steen, G., 1977. On the enzymic defectsin hereditary tyrosinemia. Proc. Natl. Acad. Sci. U. S. A. 74,4641–4645.

Lindstedt, S., Holme, E., Lock, E.A., Hjalmarson, O., Strandvik, B.,1992. Treatment of hereditary tyrosinaemia type I by inhibitionof 4-hydroxyphenylpyruvate dioxygenase. Lancet 340, 813–817.

Lisowski, L., Lau, A., Wang, Z., Zhang, Y., Zhang, F., Grompe, M.,Kay, M.A., 2012. Ribosomal DNA integrating rAAV-rDNA vectorsallow for stable transgene expression. Mol. Ther. 20, 1912–1923.

MacKenzie, T.C., Kobinger, G.P., Kootstra, N.A., Radu, A., Sena-Esteves, M., Bouchard, S., Wilson, J.M., Verma, I.M., Flake, A.W.,2002. Efficient transduction of liver and muscle after in uteroinjection of lentiviral vectors with different pseudotypes. Mol.Ther. 6, 349–358.

Matas, A.J., Sutherland, D.E., Steffes, M.W., Mauer, S.M., Sowe, A.,Simmons, R.L., Najarian, J.S., 1976. Hepatocellular transplan-tation for metabolic deficiencies: decrease of plasms bilirubin inGunn rats. Science 192, 892–894.

Matsunari, H., Nagashima, H., Watanabe, M., Umeyama, K., Nakano,K., Nagaya, M., Kobayashi, T., Yamaguchi, T., Sumazaki, R.,Herzenberg, L.A., Nakauchi, H., 2013. Blastocyst complementa-tion generates exogenic pancreas in vivo in apancreatic clonedpigs. Proc. Natl. Acad. Sci. U. S. A. 110, 4557–4562.

Overturf, K., Al-Dhalimy, M., Tanguay, R., Brantly, M., Ou, C.N.,Finegold, M., Grompe, M., 1996. Hepatocytes corrected by genetherapy are selected in vivo in a murine model of hereditarytyrosinaemia type I. Nat. Genet. 12, 266–273.

Paulk, N.K., Wursthorn, K., Wang, Z., Finegold, M.J., Kay, M.A.,Grompe, M., 2010. Adeno-associated virus gene repair corrects amouse model of hereditary tyrosinemia in vivo. Hepatology 51,1200–1208.

Prather, R.S., Lorson, M., Ross, J.W., Whyte, J.J., Walters, E.,2013. Genetically engineered pig models for human diseases.Ann. Rev. Anim. Biosci. 1, 203–219.

Renner, S., Fehlings, C., Herbach, N., Hofmann, A., von Waldthausen,D.C., Kessler, B., Ulrichs, K., Chodnevskaja, I., Moskalenko, V.,Amselgruber, W., Goke, B., Pfeifer, A., Wanke, R., Wolf, E., 2010.Glucose intolerance and reduced proliferation of pancreatic beta-cells in transgenic pigs with impaired glucose-dependentinsulinotropic polypeptide function. Diabetes 59, 1228–1238.

Rogers, C.S., Stoltz, D.A., Meyerholz, D.K., Ostedgaard, L.S.,Rokhlina, T., Taft, P.J., Rogan, M.P., Pezzulo, A.A., Karp, P.H.,Itani, O.A., Kabel, A.C., Wohlford-Lenane, C.L., Davis, G.J.,Hanfland, R.A., Smith, T.L., Samuel, M., Wax, D., Murphy, C.N.,Rieke, A., Whitworth, K., Uc, A., Starner, T.D., Brogden, K.A.,Shilyansky, J., McCray Jr., P.B., Zabner, J., Prather, R.S., Welsh,M.J., 2008. Disruption of the CFTR gene produces a model of cysticfibrosis in newborn pigs. Science 321, 1837–1841.

Ruppert, S., Kelsey, G., Schedl, A., Schmid, E., Thies, E., Schutz, G.,1992. Deficiency of an enzyme of tyrosine metabolism underliesaltered gene expression in newborn liver of lethal albino mice.Genes Dev. 6, 1430–1443.

Russell, L.B., Russell, W.L., Kelly, E.M., 1979. Analysis of the albino-locus region of the mouse. I. Origin and viability. Genetics 91,127–139.

Russo, P., O'Regan, S., 1990. Visceral pathology of hereditarytyrosinemia type I. Am. J. Hum. Genet. 47, 317–324.

Saeki, K., Matsumoto, K., Kinoshita, M., Suzuki, I., Tasaka, Y., Kano,K., Taguchi, Y., Mikami, K., Hirabayashi, M., Kashiwazaki, N.,Hosoi, Y., Murata, N., Iritani, A., 2004. Functional expression ofa Delta12 fatty acid desaturase gene from spinach in transgenicpigs. Proc. Natl. Acad. Sci. U. S. A. 101, 6361–6366.

Schmelzer, E., Zhang, L., Bruce, A., Wauthier, E., Ludlow, J., Yao,H.L., Moss, N., Melhem, A., McClelland, R., Turner, W., Kulik, M.,Sherwood, S., Tallheden, T., Cheng, N., Furth, M.E., Reid, L.M.,2007. Human hepatic stem cells from fetal and postnatal donors.J. Exp. Med. 204, 1973–1987.

Si-Tayeb, K., Noto, F.K., Nagaoka, M., Li, J.X., Battle, M.A., Duris,C., North, P.E., Dalton, S., Duncan, S.A., 2010. Highly efficientgeneration of human hepatocyte-like cells from induced plurip-otent stem cells. Hepatology 51, 297–305.

153FAH-deficient pigs are a novel large animal model of metabolic liver disease

Sniderman King, L., Trahms, C., Scott, C.R., 1993. Tyrosinemia type 1.In: Pagon, R.A., Adam, M.P., Bird, T.D., Dolan, C.R., Fong, C.T.,Stephens, K. (Eds.), Gene Reviews (Seattle (WA)).

Tanguay, R.M., Valet, J.P., Lescault, A., Duband, J.L., Laberge, C.,Lettre, F., Plante, M., 1990. Different molecular basis forfumarylacetoacetate hydrolase deficiency in the two clinical formsof hereditary tyrosinemia (type I). Am. J. Hum. Genet. 47, 308–316.

Turgeon, C., Magera, M.J., Allard, P., Tortorelli, S., Gavrilov, D.,Oglesbee, D., Raymond, K., Rinaldo, P., Matern, D., 2008.Combined newborn screening for succinylacetone, amino acids,and acylcarnitines in dried blood spots. Clin. Chem. 54, 657–664.

Vanclooster, A., Devlieger, R., Meersseman, W., Spraul, A.,Kerckhove, K.V., Vermeersch, P., Meulemans, A., Allegaert, K.,Cassiman, D., 2012. Pregnancy during nitisinone treatment fortyrosinaemia type I: first human experience. JIMD Rep. 5, 27–33.

Wang, X., Montini, E., Al-Dhalimy, M., Lagasse, E., Finegold, M.,Grompe, M., 2002. Kinetics of liver repopulation after bonemarrow transplantation. Am. J. Pathol. 161, 565–574.

Wilson, J.M., Johnston, D.E., Jefferson, D.M., Mulligan, R.C., 1988.Correction of the genetic defect in hepatocytes from theWatanabe heritable hyperlipidemic rabbit. Proc. Natl. Acad.Sci. U. S. A. 85, 4421–4425.

Yamada, T., Yoshikawa, M., Kanda, S., Kato, Y., Nakajima, Y.,Ishizaka, S., Tsunoda, Y., 2002. In vitro differentiation ofembryonic stem cells into hepatocyte-like cells identified bycellular uptake of indocyanine green. Stem Cells 20, 146–154.

Yoshida, Y., Tokusashi, Y., Lee, G.H., Ogawa, K., 1996. Intrahepatictransplantation of normal hepatocytes prevents Wilson's diseasein Long–Evans cinnamon rats. Gastroenterology 111, 1654–1660.

Yu, Y., Liu, H., Ikeda, Y., Amiot, B.P., Rinaldo, P., Duncan, S.A.,Nyberg, S.L., 2012. Hepatocyte-like cells differentiated fromhuman induced pluripotent stem cells: relevance to cellulartherapies. Stem Cell Res. 9, 196–207.

Zhu, S., Rezvani, M., Harbell, J., Mattis, A.N., Wolfe, A.R., Benet, L.Z.,Willenbring, H., Ding, S., 2014. Mouse liver repopulation withhepatocytes generated from human fibroblasts. Nature 508, 93–97.