Acute septicaemic pasteurellosis in Vietnamese pigs

Acute septicaemic pasteurellosis in Vietnamese pigs

Kirsty M. Townsenda,*, Denise O'Boylea, To Thi Phanb,Tran Xuan Hanhb, Thula G. Wijewardanac, Ian Wilkiea,

Nguyen Tien Trungb, Alan J. Frosta

a Division of Veterinary Pathology and Anatomy, University of Queensland, Brisbane, 4072 Qld., Australiab NAVETCO, Ho Chi Minh City, Viet Nam

c Veterinary Research Institute, Gannoruwa, Peradeniya, Sri Lanka

Received 6 February 1998; accepted 9 April 1998

Abstract

Sixteen isolates of Pasteurella multocida were cultured from cases diagnosed as acute

septicaemic pasteurellosis in Vietnamese pigs. The HSB±PCR assay provided rapid presumptive

determination of 10 isolates of P. multocida identified as haemorrhagic septicaemia (HS) causing

type B cultures (B:2, B:5, B:2,5). Serological designation using the Carter and Heddleston typing

systems confirmed these findings, and identified the six HSB±PCR negative cultures as either A:1,

A:3 or D:3,4. Biochemical fermentation and REP±PCR revealed phenotypic and genotypic identity

between P. multocida type A:1 isolated from Vietnamese pigs and poultry. Marked homogeneity

was also demonstrated among HSB±PCR positive swine isolates, which were shown to possess

genotypic identity with P. multocida type B:2 from buffaloes diagnosed with HS. # 1998 Elsevier

Science B.V. All rights reserved.

Keywords: Pasteurella multocida; Acute swine pasteurellosis; Serotyping; REP±PCR

1. Introduction

Acute septicaemic pasteurellosis is generally considered to be an uncommon disease in

pigs (Carter, 1975), although sporadic outbreaks have been reported in India (Murty and

Kaushik, 1965; Pillai et al., 1986; Verma and Saxena, 1987; Verma, 1988; Sriraman et al.,

1994) and Sri Lanka (Gamage et al., 1995). In all cases, clinical symptoms and pathology

Veterinary Microbiology 63 (1998) 205±215

* Corresponding author. Tel.: +61-7-3365-2667; fax: +61-7-3365-1355; e-mail:[email protected]

0378-1135/98/$ ± see front matter # 1998 Elsevier Science B.V. All rights reserved.

PII: S 0 3 7 8 - 1 1 3 5 ( 9 8 ) 0 0 2 3 3 - 8

were characteristic of those consistently observed in haemorrhagic septicaemia (HS) of

cattle and buffalo. However, few reports determined the serotype of the isolated

Pasteurellae. Murty and Kaushik (1965) described an outbreak of acute septicaemic

pasteurellosis in pigs due to Pasteurella multocida type B, with the isolated organism

later found to be not only pathogenic to pigs, but also to buffaloes, goats, rabbits, mice

and guinea-pigs. Interestingly, this organism was shown to ferment arabinose, a finding

usually associated with P. multocida subspecies gallicida found frequently in wildfowl

(Hirsh et al., 1990) but also recently reported in pigs (Cameron et al., 1996; Blackall

et al., 1997).

P. multocida is frequently isolated as a secondary pathogen from swine (Farrington,

1986), and its primary importance may be discounted if concurrent infection with another

organism is observed. Nasal carriage of types A and D P. multocida is relatively common

in pigs (Lariviere et al., 1992), whereas identification of type B:2 is more likely to

implicate P. multocida as the primary pathogen as this serotype is rare in swine and

principally associated with HS of cattle or buffalo. The ability to perform rapid typing of

the isolated Pasteurellae may be crucial in determining whether the organism is a primary

or secondary pathogen. Current serotyping methods, particularly somatic typing, are

time-consuming and it is often difficult to make and maintain specific reference antisera.

Once specific oligonucleotide primers are established, polymerase chain reaction (PCR)

technology can provide rapid, sensitive and type-specific identification with relatively

uncomplicated methodology.

A Malaysian survey of 20 P. multocida isolates of pig origin reported 20% were

serotyped as type A, 35% as type B and 45% as serotype D (Chandrasekaran and Yeap,

1982). P. multocida isolated from cases of severe septicaemia were identified as type B.

P. multocida type B:2 has been clearly shown to be the causal agent in reports of acute

swine pasteurellosis from India (Verma, 1988) and Sri Lanka (Gamage et al., 1995), with

the suggestion that the organism may have been transmitted between pigs and cattle.

However, while there is now mounting evidence to suggest that type B P. multocida is

implicated in acute septicaemic pasteurellosis of pigs, no study to date has demonstrated

the epidemiological relationship between porcine and bovine B:2 isolates.

In recent years, discrimination of P. multocida isolates of similar serotype has been

achieved using a variety of genotyping methods including restriction endonuclease

analysis (REA), ribotyping, pulsed field gel electrophoresis (PFGE) and PCR

fingerprinting, using oligonucleotide primers directed against repetitive extragenic

palindromic (REP) sequences (REP±PCR) (Snipes et al., 1989; Wilson et al., 1992;

Townsend et al., 1997a, b). The application of REP±PCR for differentiating closely

related bacterial strains has been well-documented, and is generally regarded as a rapid,

highly discriminatory genotyping method (Versalovic et al., 1992; Woods et al., 1996).

Modifications in sample preparation has simplified the original method described by

Versalovic et al. (1991), and enabled whole cells to be used directly in the reaction

mixture (Woods et al., 1993). The ease and rapidity of whole cell REP±PCR offers a

useful alternative to time-consuming, and equally discriminating methods such as REA

and PFGE.

A total of 26 P. multocida isolates including 16 porcine strains isolated from cases

diagnosed as acute septicaemic pasteurellosis in Vietnam, were examined by phenotypic

206 K.M. Townsend et al. / Veterinary Microbiology 63 (1998) 205±215

and genotypic methods of characterisation. The aim of this study was to determine the

prevalence of type B P. multocida among field cases of acute septicaemic pasteurellosis,

and to assess the epidemiological relationship between swine and bovine B:2 P.

multocida using REP±PCR and the biotyping system of Blackall and colleagues (Fegan et

al., 1995; Blackall et al., 1997). HS-associated type B P. multocida (B:2, B:5, or B:2,5)

were identified using the type-specific HSB±PCR method (Townsend et al., 1998) using

oligonucleotide primers developed during sequence analysis of the clone 6b, a fragment

shown by Townsend et al. (1996) to be unique to HS-causing type B isolates of

P. multocida.

2. Methods

2.1. Bacteria

The bacterial strains used in this study are listed in Table 1, which included cultures

from suspected field outbreaks of acute pasteurellosis in pigs and poultry obtained from

regional farms by NAVETCO, Vietnam. Serologically related bovine, porcine and poultry

isolates of P. multocida were also examined. Field isolates of P. multocida were

transported, either as pure cultures in semi-solid agar or as freezed-dry cultures, to the

Bacteriology Laboratory, Division of Veterinary Pathology and Anatomy, School of

Veterinary Science and Animal Production, University of Queensland.

All bacteria were identified as P. multocida by standard biochemical tests (Carter,

1975). Indole production, and the presence of ornithine decarboxylase and urease activity

was determined. Carbohydrate fermentation by the test organisms was ascertained using

12 carbohydrates: D-glucose, D-arabinose, L-arabinose, dulcitol, lactose, maltose,

mannitol, D-sorbitol, sucrose, D-trehalose, D-xylose and L-xylose.

2.2. Serological tests

Serological examination of all isolates was performed at the Veterinary Research

Institute, Peradeniya, Sri Lanka using the indirect haemagglutination test (IHA) and agar

gel precipitation test (AGPT) as described by Gamage et al. (1995).

2.3. Primers

The following primers were used during PCR typing of the test organisms:

HSB±PCR : KTSP61 -50 ATCCGCTAACACACTCTC 30

: KTT72 -50 AGGCTCGTTTGGATTATGAAG 30 (Townsend et al., 1998)

K.M. Townsend et al. / Veterinary Microbiology 63 (1998) 205±215 207

2.4. Polymerase chain reaction (PCR)

All isolates were examined by the HS-causing type B-specific PCR assay (HSB±PCR)

as described by Townsend et al. (1998), and subtyped by REP±PCR (Townsend et al.,

1997b). For ease and rapidity, all PCR assays were performed directly using single

colonies grown on agar plates. A pipette tip was lightly touched onto a colony, which was

then resuspended in the PCR amplification mixture.

Briefly, the amplification reactions used for HSB±PCR were performed in a final

volume of 25 ml containing 0.125 mM of each primer, 200 mM of each of four dNTP's,

1�PCR Buffer (Gibco BRL) with 2 mM MgCl2, and 0.5 U Taq DNA polymerase (Gibco

BRL). For REP±PCR, amplification reactions were performed in a final volume of 25 ml

containing 0.25 mM of each opposing primer, 200 mM of each of four dNTP's, 1�PCR

Buffer with 4 mM MgCl2 and 0.75 U Taq DNA polymerase.

All amplification reactions were performed in a FTS-320 Thermal Sequencer (Corbett

Research). Cycling conditions for HSB±PCR were as follows: an initial denaturation at

Table 1This table presents the history of all P. multocida isolates used in this study, including origin, serotype, HSB±PCR result and REP-type

Isolate Origin Species Serotype Specimen HSB±PCR REP±PCR

VP17 Australia Chicken A:4 Wattles ÿ III

VP90 Australia Pig A:1 Lung and LN ÿ V

VP91 Australia Pig A:1 Lung and LN ÿ VI

VP96 Australia Pig D:1 Lung ÿ IV

VP130 (M1404) USA Bison B:2 ± � I

VP141 (H1) Vietnam Pig B:5,6,7,16 HB and BM � I

VP142 (H2) Vietnam Pig B:5,7,8 Lung � I

VP143 (H3) Vietnam Pig B:5 HB and BM � I

VP144 (H4) Vietnam Pig B:2,5 HB � I

VP145 (H5) Vietnam Pig B:5 Lung � I

VP161 (TG1) Vietnam Chicken A:1 Spleen ÿ II

VP163 (H6) Vietnam Pig B:2 HB � I

VP164 (H8) Vietnam Pig B:2,5 HB � I

VP205 Australia Pig D:3 ± ÿ VII

VP215 (L38) Vietnam Duck A:1 Liver ÿ II

VP232 (P52) India Buffalo B:2 BM � I

VP233 (P-LA1) Vietnam Pig A:1 HB ÿ II

VP234 (P-LA2) Vietnam Pig A:1 BM ÿ II

VP235 (P-SG) Vietnam Pig B:2 HB � I

VP237 (B-DN1) Vietnam Buffalo B:2 HB & BM � I

VP247 (P-TD1) Vietnam Pig B:2 HB � I

VP248 (P-DN1) Vietnam Pig A:1 Liver & spleen ÿ II

VP346 (P-PK1) Vietnam Pig A:3 HB ÿ III

VP347 (P-TH1) Vietnam Pig B:5,6 sl, 15 sl, 16 sl HB � I

VP360 (P-PK2) Vietnam Pig A:3 HB ÿ III

VP366 (P-BC) Vietnam Pig D:3,4 HB ÿ IV

LN; lymph node, HB; heart blood, BM; bone marrow.


958C for 4 min, followed by 30 cycles of denaturation at 958C for 1 min; annealing at

558C for 1 min; extension at 728C for 1 min; with a final extension at 728C for 9 min.

Cycling conditions for REP±PCR typing were as follows: one cycle for 7 min at 958C,

1 min at 428C, 8 min at 658C; 32 cycles for 1 min at 948C, 1 min at 428C, 8 min at 658C;

and a final extension for 8 min at 658C.

Following the completion of the HSB±PCR, 5 ml of each sample was electrophoresed

in an agarose gel (2% agarose in 1�TAE) at 4 V cmÿ1 for 2 h, and stained with

1 mg mlÿ1 ethidium bromide. REP±PCR reactions were electrophoresed at 2.5 V cmÿ1

for 3 h. Bacteriophage l DNA cleaved with HindIII (Promega) and 100 bp DNA marker

(Promega) were used as molecular weight standards. DNA fragments were visualised by

UV transillumination and photographed.

3. Results

Cultures examined in this study were isolated from cases of acute septicaemic

pasteurellosis, with diagnosis based on clinical signs and isolation of P. multocida from

heart blood or bone marrow, and occasionally from liver, spleen or lung. Necropsy details

were incomplete, however findings included rapid progression to death, and gross lesions

such as haemorrhages suggestive of an acute septicaemia.

Identification of Gram-negative coccobacilli as Pasteurella multocida was determined

by conventional biochemical and carbohydrate fermentation tests. All isolates produced

indole, were oxidase and ornithine decarboxylase positive and urease negative, and

fermented glucose, mannitol, sorbitol and sucrose but not D-arabinose, maltose, trehalose

and L-xylose. The majority of isolates were unable to ferment dulcitol, lactose, and D-

xylose, while acid production from L-arabinose was variable. Differential biochemical

properties allowed the identification of three common biovars among the 26 P. multocida

isolates (Table 2). The majority of isolates (18 strains) were identified as biovar 3, with

other strains assigned to biovar 8 (one strain), biovar 11 (one strain), biovar 12 (two

strains), and dulcitol negative variants of biovar 8 (four strains). Isolates matching the

latter biovar were subjected to extensive retesting, but fermentation patterns did not alter.

Presumptive determination of HS-causing type B P. multocida by the HSB±PCR assay

positively identified 10 of 16 field isolates from Vietnamese pigs (Table 1), each

generating a DNA fragment of approximately 620 bp following amplification with the

primers KTSP61 and KTT72 (Fig. 1). Serological determination using the Carter:Hed-

dleston serotyping systems confirmed these findings, with HSB±PCR positive isolates

designated as Carter type B with the dominant somatic antigen being either type 2 or 5.

Slight reactions with other somatic antisera were observed in some cases.

Swine isolates of P. multocida from Vietnam that were negative by HSB±PCR were

serotyped as either A:1, A:3 or D:3,4. Biochemical fermentation patterns identified

HSB±PCR positive cultures as biovar 3, matching the properties of the reference strain of

P. multocida subsp. multocida. Type A:1 Vietnamese swine P. multocida isolates

generally exhibited biovar 8 with some variation in dulcitol fermentation (i.e. Dulÿ

P. multocida subsp. gallicida). VP233 and VP248 however, were also unable to ferment

xylose, thus assigned to biovar 11.


PCR analysis with REP oligonucleotides generated greater discrimination of isolates,

establishing seven REP types among the 26 P. multocida cultures. REP profiles of all

isolates examined in this study are illustrated in Figs. 2 and 3. Isolates that produced an

amplification product following HSB±PCR were shown to exhibit REP type I, with the

remaining 14 isolates classified as REP types II±VII. The majority of genomic distinction

between REP types is evident among fragments less than 1.4 kb in size. REP type I can be

distinguished from type II with the lack of fragments at �460 bp and 1.2 kb, and an extra

fragment at �660 bp. The profile of REP types II and III are also similar, with the

obvious distinction of two extra fragments (�480 and 950 bp) in REP type III.

Biochemical characteristics of all REP types produced by P. multocida isolates in this

study are outlined in Table 2. Interestingly, a correlation could be drawn between biovar

and REP±PCR type, with the majority of strains classified as REP type II shown to be

dulcitol negative variants of biovar 8 (i.e. Dulÿ P. multocida subsp. gallicida). This group

of isolates included P. multocida isolates from Vietnamese pigs, chickens and ducks.

However, REP typing was more discriminative than biotyping as REP types I, III, VI and

VII all exhibited biochemical properties matching P. multocida subsp. multocida biovar 3.

Table 2This table illustrates the biochemical fermentation results for each REP±PCR group exhibited by all P. multocidaisolates examined in this study

REP±PCR

type

Type I

(13)

Type II

(3)

Type II

(2)

Type III

(3)

Type IV

(2)

Type V

(1)

Type VI

(1)

Type VII

(1)

ODC � � � � � � � �Indole � � � � � � � �Urease ÿ ÿ ÿ ÿ ÿ ÿ ÿ ÿGlucose � � � � � � � �L-Arabinose ÿ � � ÿ ÿ � ÿ ÿD-Arabinose ÿ ÿ ÿ ÿ ÿ ÿ ÿ ÿDulcitol ÿ ÿ ÿ ÿ ÿ � ÿ ÿLactose ÿ ÿ ÿ ÿ � ÿ ÿ ÿMaltose ÿ ÿ ÿ ÿ ÿ ÿ ÿ ÿMannitol � � � � � � � �Sorbitol � � � � � � � �Sucrose � � � � � � � �Trehalose ÿ ÿ ÿ ÿ ÿ ÿ ÿ ÿD-Xylose � � ÿ � � � � �L-Xylose ÿ ÿ ÿ ÿ ÿ ÿ ÿ ÿProposed biovar m g ?? m m g m m

bio 3 Dul-bio 8 bio 11 bio 3 bio 12 bio 8 bio 3 bio 3

m; P. multocida subsp. multocida.g; P. multocida subsp. gallicida.??; subspecies unknown.ODC; ornithine decarboxylase activity.REP type I�HS type B; REP type II�A:1 (VP233 and VP248 Xylose negative); REP type III�VP17, VP346,VP360; REP type IV�VP96, VP366; REP type V�VP90; REP type VI�VP91; and REP type VII�VP205. Thenumber of isolates demonstrating each REP type is illustrated in brackets. The proposed biovars weredetermined from fermentation profiles reported by Blackall and colleagues (Fegan et al., 1995; Blackall et al.,1997).


Fig. 1. This figure demonstrates an approximately 620 bp DNA fragment specifically amplified by PCR in

representative P. multocida isolates of serotype B:2, B:5 or B:2,5. Lanes 1±15 contain a negative control, VP130,

VP164, VP145, VP232, VP233, VP235, VP248, VP346, VP347, VP366, VP17, VP161, VP205 and 100 bp DNA

marker (Promega). Samples were electrophoresed at 2.5 V cmÿ1 for 2 h in a 2% agarose gel (1�TAE) and

stained with 1 mg mlÿ1 ethidium bromide.

Fig. 2. This gel demonstrates the homogeneity among bovine and swine B:2/B:5/B:2,5 P. multocida cultures

illustrated by whole-cell REP±PCR amplification, and their distinction from Australian swine isolates. Lanes 1±

15 in Gel A contain VP130, VP232, VP141, VP142, VP143, VP144, VP145, VP163, VP164, VP237, VP90,

VP91, VP96, VP205 and a molecular weight standard. Samples were separated by agarose gel electrophoresis

(2% agarose gel in 1�TAE) at 2.5 V cmÿ1 for 3 h. The molecular weight standard was Bacteriophage lambda

(l) DNA digested with EcoRI and HindIII restriction enzymes (Promega).


4. Discussion

Although there are few published reports of acute septicaemic pasteurellosis in swine

due to type B Pasteurella multocida, this is probably not a true reflection of the

prevalence or importance of the disease in those countries in which haemorrhagic

septicaemia is endemic. The difficulty in obtaining prompt and accurate serotyping of

Pasteurella isolates contributes to the underestimated incidence of the disease in swine.

The recently described HSB±PCR assay (Townsend et al., 1998) provides a rapid and

economical method to identify HS-associated serotypes in P. multocida, with serological

analysis and HSB±PCR amplification concurring in all 16 swine isolates. A higher

incidence of type B cultures (62.5%) was observed than the 35% reported by

Chandrasekaran and Yeap (1982). However, this finding is probably due to sample

selection as the present study was aimed primarily at isolates from animals which had

clinical histories or gross pathological findings consistent with acute septicaemic

pasteurellosis rather than the broad analysis of typeable P. multocida from swine

specimens.

Most authors describing the isolation of P. multocida type B from pigs have proposed

transmission of the organism between pigs and cattle, suggesting that HS in cattle and

acute swine pasteurellosis are caused by the same organism. This is the first study

however, to clearly demonstrate that the occurrence of acute septicaemic pasteurellosis in

Fig. 3. This gel exhibits the correlation of serotype and REP-type among Vietnamese P. multocida cultures, and

the identity between VP17 (an Australian chicken isolate) and two isolates from Vietnamese pigs (VP346 and

VP360). Lanes 1±14 contains a negative control, VP233, VP234, VP235, VP247, VP248, VP346, VP347,

VP360, VP366, VP17, VP161, VP215 and a molecular weight standard. Samples were separated by agarose gel

electrophoresis (2% agarose gel in 1�TAE) at 2.5 V cmÿ1 for 3 h. The molecular weight standard was the

100 bp DNA marker (Promega).


pigs is due to HS-associated type B P. multocida genotypically identical to those that

cause HS in cattle and buffalo. All type B cultures isolated from Vietnamese pigs were

shown to possess REP type I, and could be classified as P. multocida subsp. multocida

biovar 3. These findings indicate that swine type B isolates demonstrated a marked

homogeneity, similar to that previously observed among strains obtained from cases of

HS in cattle and buffalo (Townsend et al., 1997a, b). It is important to note that type B

P. multocida from Vietnamese swine also exhibited REP±PCR profiles identical to B:2

isolates from buffaloes in Vietnam (VP237) and India (VP232). Therefore, not only was

there a marked homogeneity of HS-associated type B P. multocida from pigs, but also

between isolates from pigs and buffalo.

The isolation and identification of type A:1 P. multocida (3 strains) from Vietnamese

pigs that resemble cultures isolated from outbreaks of fowl cholera in Vietnam (VP161

and VP215) is of particular interest. While variation was observed with dulcitol and

xylose fermentation among the Vietnamese A:1 isolates, similar variation has been

observed with the reference strain for P. multocida subsp. gallicida in this laboratory

(data not shown) and by Fegan et al. (1995). However, subsp. gallicida isolates from

Australian pigs do not demonstrate this phenotypic variation (Cameron et al, 1996;

Blackall et al., 1997). Despite this variation, the most notable feature of type A:1

Vietnamese P. multocida was that all cultures ferment L-arabinose and exhibit REP type

II. The genetic similarity among these isolates suggests that transmission of the fowl

cholera-associated serotype may occur between pigs and poultry.

While REP±PCR profiles produced in this study were more complex than those

reported previously (Townsend et al., 1997b), it appears that the cause lies in inter-

laboratory variation. Previously published profiles were consistent with the present study,

with the main amplified fragments possessing similar size and distribution. The observed

variation is most likely due to different sensitivities of thermal cyclers used, with

fragments amplified with greater intensity in the present study. However, if adequate

controls are used, false variation should not occur.

In conclusion, we have shown PCR assays to be rapid, practical and reliable methods to

assess the prevalence and genetic relatedness of HS-associated serotypes of P. multocida

(B:2, B:5 or B:2,5) from suspected cases of acute septicaemic pasteurellosis in

Vietnamese pigs. The HSB±PCR method also simplifies characterisation of type B

isolates by detecting all three HS-associated serotypes in a single process. The versatility

of this assay will enable the technique to be used for routine diagnosis in countries not

currently able to perform conventional serotyping. The equipment and experience

required to perform these techniques is becoming readily available in countries such as

Vietnam, with the ease and rapidity of PCR amplification providing a marked advantage

over current methods of identification.

This study also represents the first documentation of P. multocida isolated from swine

exhibiting phenotypic and genotypic identity to HS and fowl cholera associated

P. multocida serotypes. These findings suggest that transmission to pigs from bovines and

poultry may occur, although the nature of this remains to be determined. Detection of

P. multocida serotypes normally associated with bovine HS from pigs throughout

southern Vietnam indicated that acute septicaemic pasteurellosis in pigs may be more

common than previously perceived.


Acknowledgements

We would like to thank Sally Grimes for her assistance during the processing of all

P. multocida isolates sent to the Bacteriology Laboratory, Division of Veterinary

Pathology and Anatomy, The University of Queensland. Our appreciation also goes to Dr.

Pat Blackall, Animal Research Institute, Yeerongpilly, QLD for providing his most recent

list of P. multocida biovars. All work presented in this study was funded by the Australian

Centre for International Agricultural Research.

References

Blackall, P.J., Pahoff, J.L., Bowles, R., 1997. Phenotypic characterisation of Pasteurella multocida isolates from

Australian pigs. Vet. Microbiol. 57, 355±360.

Cameron, R.D.A., O'Boyle, D., Frost, A.J., Gordon, A.N., Fegan, N., 1996. An outbreak of haemorrhagic septi-

caemia associated with Pasteurella multocida subsp. gallicida in a large pig herd. Aust. Vet. J. 73, 27±29.

Carter, G.R., 1975. In: Krieg, N.R. (Ed.), Bergey's Manual of Systematic Bacteriology. Genus 1. Pasteurella.

Williams and Wilkins, Baltimore, MD, p. 552±558.

Chandrasekaran, S., Yeap, P.C., 1982. Pasteurella multocida in pigs: The serotypes and the assessment of their

virulence in mice. Br. Vet. J. 138, 332±336.

Farrington, D.O., 1986. Diseases of Swine, 6th ed. Iowa State University Press, Ames, IA, pp. 436±444.

Fegan, N., Blackall, P.J., Pahoff, J.L., 1995. Phenotypic characterisation of Pasteurella multocida isolates from

Australian poultry. Vet. Microbiol. 47, 281±286.

Gamage, L.N.A., Wijewardana, T.G., Bastiansz, H.L.G., Vipulasiri, A.A., 1995. An outbreak of acute

pasteurellosis in swine caused by serotype B:2 in Sri Lanka. S. L. Vet. J. 42, 15±19.

Hirsh, D.C., Jessup, D.A., Snipes, K.P., Carpenter, T.E., Hird, D.W., McCapes, R.H., 1990. Characteristics of

Pasteurella multocida isolated from waterfowl and associated avian species in California. J. Wildl. Dis. 26,

204±209.

Lariviere, S., Leblanc, L., Mittal, K.R., Martineau, G.-P., 1992. Characterization of Pasteurella multocida from

nasal cavities of piglets from farms with or without atrophic rhinitis. J. Clin. Microbiol. 30, 1398±1401.

Murty, D.K., Kaushik, R.K., 1965. Studies on an outbreak of acute swine pasteurellosis due to Pasteurella

multocida type B (Carter, 1955). Vet. Rec. 77, 411±416.

Pillai, A.G.R., Katiyar, A.K., Awadhiya, R.P., Vegad, J.L., 1986. An outbreak of pasteurellosis in swine. Indian

Veterinary Journal. 63, 527±529.

Snipes, K.P., Hirsh, D.C., Kasten, R.W., Hansen, L.M., Hird, D.W., Carpenter, T.E., McCapes, R.H., 1989. Use

of an rRNA probe and restriction endonuclease analysis to fingerprint Pasteurella multocida isolated from

turkeys and wildlife. J. Clin. Microbiol. 27, 1847±1853.

Sriraman, P.K., Reddy, K.K., Choudhuri, P.C., Sreenivasul, D., 1994. An outbreak of pasteurellosis in swine. Ind.

J. Anim. Sci. 64, 130±131.

Townsend, K.M., Dawkins, H.J.S., Zeng, B.J., Watson, M.W., Papadimitriou, J.M., 1996. Cloning of a unique

sequence specific to isolates of type B:2 Pasteurella multocida. Res. Vet. Sci. 61, 199±205.

Townsend, K.M., Dawkins, H.J.S., Papadimitriou, J.M., 1997a. Analysis of haemorrhagic septicaemia-causing

isolates of Pasteurella multocida by ribotyping and field alternation gel electrophoresis (FAGE). Vet.

Microbiol. 57, 383±395.

Townsend, K.M., Papadimitriou, J.M., Dawkins, H.J.S., 1997b. REP-PCR analysis of Pasteurella multocida

isolates that cause haemorrhagic septicaemia. Res. Vet. Sci. 63, 151±155.

Townsend, K.M., Frost, A.J., Lee, C.W., Papadimitriou, J.M., Dawkins, H.J.S., 1998. Development of

polymerase chain reaction (PCR) assays for species- and type-specific identification of Pasteurella

multocida. J. Clin. Microbiol. 36, 1096±1100.

Verma, N.D., 1988. Pasteurella multocida B:2 in haemorrhagic septicaemia outbreak in pigs in India. Vet. Rec.

123, 63.


Verma, N.D., Saxena, S.C., 1987. An outbreak of swine pasteurellosis on an organized farm of North-Eastern

Hills Region. Ind. J. Anim. Sci. 57, 528±532.

Versalovic, J., Koeuth, T., Lupski, J.R., 1991. Distribution of repetitive DNA sequences in eubacteria and

application to fingerprinting of bacterial genomes. Nucleic Acids Res. 19, 6823±6831.

Versalovic, J., Koeuth, T., Zhang, Y.-H., McCabe, E.R.B., Lupski, J.R., 1992. Quality control for bacterial

inhibition assays: DNA fingerprinting of microorganisms by rep-PCR. Screening. 1, 175±183.

Wilson, M.A., Rimler, R.B., Hoffman, L.J., 1992. Comparison of DNA fingerprints and somatic serotypes of

serogroup B and E Pasteurella multocida isolates. J. Clin. Microbiol. 30, 1518±1524.

Woods, C.R., Koeuth, T., Estabrook, M.M., Lupski, J.R., 1996. Rapid determination of outbreak-related strains

of Neisseria meningitidis by repetitive element-based polymerase chain reaction genotyping. J. Infect. Dis.

174, 760±767.

Woods, C.R., Versalovic, J., Koeuth, T., Lupski, J.R., 1993. Whole-cell repetitive element sequence-based

polymerase chain reaction allows rapid assessment of clonal relationships of bacterial isolates. J. Clin.

Microbiol. 31, 1927±1931.


Acute septicaemic pasteurellosis in Vietnamese pigs

Documents

Transcript of Acute septicaemic pasteurellosis in Vietnamese pigs