FINAL APPROVAL OF DISSERTATION

Doctor of Philosophy in Medical Sciences

Brain-derived Neurotrophic Factor in Autonomic Nervous System: NicotinicAcetylcholine Receptor Regulation and Potential Trophic Effects

Submitted by

Xiangdong Zhou

In partial fulfillment of the requirements for the degree ofDoctor of Philosophy in Medical Sciences

Date of Defense:

January 7, 2005

Major AdvisorJoseph F. Margiotta, Ph.D.

Academic Advisory CommitteeLinda Dokas, Ph.D.

Marthe Howard, Ph.D.David Giovannucci, Ph.D.

Elizabeth Tietz, Ph.D.

Dean, College of Graduate StudiesKeith K. Schlender, Ph.D.

Brain-derived Neurotrophic Factor in Autonomic Nervous

System: Nicotinic Acetylcholine Receptor Regulation and

Potential Trophic Effects

Xiangdong Zhou

Medical University of Ohio

2005

ACKNOWLEDGMENTS

I want to thank my major advisor, Dr. Joseph Margiotta, who guided me through all my

research with his enthusiasm, passion and systematic training. Also, I want to thank all of

my committee members for valuable comments. I thank all of my colleagues: Phyllis Pugh,

Qiang Nai, Min Chen, Jason Dittus, Bo Hu, Xiaodong Wu, Hongbin Liu, and all other

friends who have given me encouragement and support during my research period.

ii

TABLE OF CONTENTS

Acknowledgements ii

Table of Contents iii

Introduction 1

Literature 5

Manuscript

Manuscript 1: 47

BDNF and trkB signaling in parasympathetic neurons: relevance

to regulating α7-containing nicotinic receptors and synaptic

function

Manuscript 2: 108

Depolarization promotes survival of ciliary ganglion

neurons by BDNF-dependent and independent mechanisms

Discussion/Summary 143

References 149

Abstract 226

iii

INTRODUCTION

The neurotrophin (NT) family is composed of a variety of neurotrophic factors, including

nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), and

neurotrophin-3 (NT-3). Both NTs and their specific receptors, the trypomyosin-related

kinases (Trks) are widely expressed in the neuronal and non-neuronal tissues. The NT

signaling has been implicated in various areas such as survival, differentiation, neurite

outgrowth and synaptic plasticity. Among them, BDNF is one of most studied

neurotrophins in regulating excitatory and inhibitory synapses, as well as in promoting the

neuronal survival.

Brain-derived neurotrophic factor was first purified from mammalian brain extracts, and

named for its trophic effects on promoting the survival of sensory neurons in culture

(Barde et al., 1982). Like other neurotrophins, BDNF signaling is mediated by its specific

high-affinity receptor TrkB and the pan-neurotrophin receptor p75. Three major signaling

pathways through TrkB have been identified to date: mitogen-activated protein kinase

(MAPK) pathway, phospholipase C-γ1 (PLC-γ1) pathway and phosphatidylinositol-3

kinase (PI-3K) pathway (Barbacid, 1994; Huang and Reichardt, 2001).

The BDNF has been implicated in regulating cholinergic synapses in the peripheral

nervous system (PNS). The acute application of BDNF upregulates synaptic transmission

of functional synapses in the neuromuscular junctions (NMJ) (Lohof et al., 1993;

Boulanger and Poo, 1999a). The fact that NGF, another neurotrophin family member,

1

supported the expression and function of acetylcholine receptors (AChRs) in the

sympathetic system (Henderson et al., 1994b; Yeh et al., 2001), further extended the idea

that BDNF may be involved in the regulation of cholinergic synapses and AChRs of the

parasympathetic system. The chick ciliary ganglion (CG) has been demonstrated as a good

model for such studies of the parasympathetic system. Two populations of neurons, ciliary

neurons and chroid neurons, exist in the CG, with distinct structural and functional

profiles (Dryer, 1994). The CG neuron is a classic model in the study of nAChRs because

they express diverse nAChRs with well-defined subunit composition (Vernallis et al.,

1993) and channel properties (McNerney et al., 2000; Nai et al., 2003). One nAChR type,

α7 nAChR containing only α7 subunits, is specifically recognized by α-bungarotoxin

(αBgt) and the other major AChR type, α3*-AchR containing α3, α5, β4 ± β2 subunits, is

insensitive to αBgt, but recognized by mAb35, an α5 subunit selective antibody (Conroy

et al., 1992). The αBgt-sensitive nAChRs mediate fast decaying whole-cell nicotinic

currents, while α3*-nAChRs are responsible for slow decaying currents (Ullian et al.,

1997; McNerney et al., 2000; Nai et al., 2003).

Previous studies concluded that BDNF was irrelevant to CG neuronal survival. First,

exogenous BDNF failed to promote CG neuron survival in culture. Second, mRNA

encoding TrkB, the major specific receptor for BDNF signaling, was undetectable in the

ganglion (Rohrer and Sommer, 1983; Dechant et al., 1993b). However, it was possible that

the detection methods were insufficiently sensitive and that BDNF may regulate other

2

neuronal properties besides neuronal survival. To have a better understanding of the role

of BDNF in the parasympathetic system, we used CG neuronal culture to assess its effects.

Contrary to previous findings, we demonstrated the expression of TrkB receptor and

BDNF in developing CG neurons. The BDNF application upregulated the αBgt surface

binding sites and mRNA level of the α7 nAChR subunits, indicating an increase in both

mRNA level and protein level. Moreover, BDNF elevated the amplitude of α7 nAChR

mediated whole cell current, as well as the frequency of spontaneous excitatory

postsynaptic currents (sEPSCs). The BDNF-induced acute effects on synaptic

transmission, however, were not mediated through α7 nAChRs, suggesting an alternative

pathway activated by BDNF/TrkB, e.g., PLC-γ1 pathway activation.

More strinkingly, BDNF is required for the depolarization-induced survival of CG

neurons in culture as well. Both the synthesis and the release of chicken BDNF was

increased following the depolarization in culture. Application of BDNF antibody to block

the endogenous BDNF function significantly decreased the survival rates of CG neurons

in culture induced by the depolarization, indicating the requirement of such neurotrophin

in the survival-promoting process. The coincidence between the decrease in the BDNF

expression level and the decline in the survival rates of CG neurons from E8 to E14 further

implies the potential role of BDNF in regulating the CG neuronal survival in vivo. It is the

first time that BDNF was shown to regulate the AChR expression and function, the

synaptic activity in AChRs-containing synapses, and neuronal survival of chicken CGs,

3

which may contribute to our better understanding of the development and regulation of

this system during the embryogenesis.

4

LITERATURE

Identification of Neurotrophic Factors and Their Receptors

Neurotrophins (NTs)

The NT family consists of NGF, BDNF, NT3, NT4/5, NT6 and NT7. The NGF, the first

member identified in the early 1950s, provided neurotrophic supports and induced the

fiber outgrowth on sympathetic neurons, as well as on sensory neurons. (Bueker, 1948;

Levi-Montalcini and Hamburger, 1951, 1953). The fact that NGF is highly concentrated in

mouse salivary glands as a soluble factor made it possible to produce a specific NGF

antibody, which greatly facilitated subsequent studies on this molecule. It has been

demonstrated that in supporting the sensory and sympathetic neuron survival, endogenous

NGF is produced by their target cells (Davies et al., 1987), and the presence of NGF is

essential for the survival of these neurons in the peripheral nervous system (Cohen, 1960;

Johnson et al., 1980). Cloning of mouse and human NGF (Scott et al., 1983; Ullrich et al.,

1983) was accomplished after new molecular techniques were introduced, and so was the

characterization of the NGF receptor (Levi-Montalcini, 1987; Barbacid, 1994; Ultsch et

al., 1999). About two decades after the NGF discovery, another interesting neurotrophic

factor, now known as BDNF, was isolated from pig brain extracts. With its molecular size

similar to that of NGF, BDNF also shares the very similar function, which supports the

neuronal survival and neurite outgrowth of chick sensory neurons in the culture (Barde et

al., 1982). However, unlike NGF, BDNF supported the survival of a variety of sensory

neuron populations that are unresponsive to NGF, and also failed to support sympathetic

or parasympathetic (e.g., CG) neuronal survival (Lindsay et al., 1985b; Davies et al.,

5

1986b). Other members of the neurotrophin family such as NT-3 (Hohn et al., 1990) and

NT-4/5 (Berkemeier et al., 1991; Hallbook et al., 1991) also were identified by molecular

cloning techniques in the 1990s. More recently, NT6, found in the teleost fish

Xiphophorus, distinguishes itself from the other members in the NT family as a protein

molecule not found in the medium of producing cells (Gotz et al., 1994), while another

neurotrophin homolog NT-7 was identified in fish by different groups recently (Lai et al.,

1998; Nilsson et al., 1998; Dethleffsen et al., 2003).

All genes except for NT-6 and NT-7 have been found in amphibians, reptiles and

mammals (Hallbook et al., 1991). Homologous sequences to NGF, BDNF, NT-3 and

NT4/5 also have been isolated in fishes such as salmon, zebrafish (Gotz et al., 1992;

Hallbook et al., 1998; Dethleffsen et al., 2003). All mammalian NT genes encoding for NT

family members appear to derive from the same ancestor NT gene. This gene underwent

two subsequent duplications during the evolution, which finally caused the differentiation

and formation of the gene family (Hallbook et al., 1998). The amino acide sequence

among them (NGF, BDNF, NT-3 and NT4/5) shares high degree of homology and around

50% amino acid residues are common within all the neurotrophin genes. In avian species,

genes of NGF, BDNF and NT-3 were identified so far, and chicken and mammalian

BDNF share all but seven amino acid residues distributed along the whole sequence

(Meier et al., 1986; Isackson et al., 1991; Maisonpierre et al., 1992a; Hallbook et al.,

1993).

6

Mature monomer NT (118-129 amino acids, 14kDa) derives from a precursor protein

called pro-neurotrophin (approximately 240-260 amino acids long) that undergoes the

cleavage at dibasic amino acid residues (Angeletti and Bradshaw, 1971; Maisonpierre et

al., 1990a). Common features of the NT family include: 1) a signal peptide following the

initiation codon (Rosenthal et al., 1990; Ip et al., 1992); 2) a pro-region, including an

N-linked glycosylation site and proteolytic cleavage site (Bresnahan et al., 1990; Seidah et

al., 1996); 3) a distinctive three-dimensional domain formed by two pairs of anti-parallel

β-strands, and six cystine residues forming three S-S bridges (Sun and Davies, 1995;

Ibanez, 1998). Pro-region, containing ~120 amino acids located at the N-terminal, is

cleaved by the so-called pro-protein convertases such as PC1/3, PC2 and furin (Khatib et

al., 2002). The process of the cleavage happens in the either trans-Golgi apparatus by furin

or secretory granules by other pro-protein convertases to form mature forms of

neurotrophins (Seidah et al., 1996). Further studies on the pro-region of neurotrophins

suggest that it may be involved in the intracellular sorting, receptor trafficking and/or

secretion of neurotrophins (Egan et al., 2003). Three S-S bridges and connecting residues

form a cystine knot motif, which constitutes the core structure of neurotrophins

(McDonald and Hendrickson, 1993). Due to its presence, NTs are able to form stable

non-covalent homodimers with each other (active form, 28kDa). Evidence also shows

that heterodimers can be formed between different NTs (Radziejewski and Robinson,

1993). The heterodimers comprised of BDNF and NT-3 is highly stable and

indistinguishable from either BDNF or NT-3 homodimer in the ability of inducing the

7

neurite outgrowth of chicken DRG explants and the phosphorylation of Trk receptors

(Arakawa et al., 1994).

NT Receptors

Two types of NT receptors have been identified so far: trypomyosin-related kinase

receptor (Trk, known as TrkA, TrkB and TrkC) and p75 receptor (Chao, 1994; Bothwell,

1995). The TrkA receptor gene was first identified as a proto-oncogene coding a 140kDa

membrane glycoprotein. Two related genes were named subsequently in the mammalian

brain as TrkB (Klein et al., 1989) and TrkC (Lamballe et al., 1991). Each neurotrophin

binds with high affinity to a specific Trk receptor: NGF binds to TrkA, BDNF and NT4/5

bind to TrkB, and NT3 mainly binds to TrkC but can bind also to TrkA and TrkB with

lower affinity in biochemical assays (Hempstead et al., 1991; Klein et al., 1991a, b;

Squinto et al., 1991; Klein et al., 1992; Urfer et al., 1995). The Trk receptor structure

includes an extracellular ligand-binding domain, a transmembrane anchoring segment,

and an intracellular domain with the protein-kinase activity (Haniu et al., 1997;

Patapoutian and Reichardt, 2001). The extracellular domain contains a leucine-rich motif

flanked by two cysteine-rich motifs, followed by two immunoglobulin (Ig)-like motifs.

Based on previous studies of the NGF-TrkA binding, it is suggested that the second Ig

motif is involved in the binding of neurotrophins to Trks with high affinities (Urfer et al.,

1995; Holden et al., 1997), and the leucine repeat motif may also be involved (Windisch et

al., 1995). The binding of neurotrophins to Trks leads to the receptor dimerization and

autophosphorylation of tyrosine residues in the receptor intracellular domain

8

(Schlessinger and Ullrich, 1992). Active Trk receptor then recognizes and binds to

src-homology-2 (SH-2) or phosphotyrosine-binding (PTB) motifs of some intracellular

adapter proteins (Pawson and Nash, 2000). These target proteins coupled with Trk

receptors trigger intracellular signaling cascades, which include Ras/ERK (extracellular

signal-regulated kinase, also known as MAPK pathway (Boulton et al., 1991; Loeb et al.,

1992), PLC-γ1 pathway (Stephens et al., 1994) and PI-3K pathway (Ohmichi et al., 1992).

Activation of these pathways triggers other downstream molecules, for example,

calcium/calmodulin-dependent kinase (CaMK) (Blaquet and Lamour, 1997) and cyclic

AMP response element-binding protein (CREB) (Finkbeiner et al., 1997).

The p75 receptor belongs to the tumor necrosis factor receptor (TNFR) superfamily and

shares no homology with Trk receptors (Smith et al., 1994). It consists of four consecutive

extracellular cystine-rich extracellular repeats (CRR), one transmembrane domain, and

one unique intracellular motif also known as “death domain” that lacks the tyrosine kinase

activity. p75 receptor is believed to bind neurotrophins through CRR2 and CRR3

domains. All mature neurotrophin molecules can be recognized by the p75 receptor with

lower affinity (Kd=10-9M), compared to relatively high affinity by the Trk receptor

(Kd=10-11M) (Sutter et al., 1979; Rodriguez-Tebar and Barde, 1988; Rodriguez-Tebar et

al., 1992; Dechant et al., 1993b). Unexpectedly, pro-neurotrophins showed high affinity to

bind p75 receptors, and are considered as one of the apoptotic ligands involved in the

p75-mediated apoptosis (Lee et al., 2001). It is now demonstrated that the p75 receptor

modulates TrkA and TrkB receptors (Verdi et al., 1994; Vesa et al., 2000) probably by

9

binding to the Trk receptors. Moreover, activation of the p75 receptor induces a

apoptosis/survival-related signaling cascade (Dechant and Barde, 1997)., which may

involve the activation of sphingomyelinase (Dobrowsky et al., 1994), NFκB (Carter et al.,

1996) or c-jun N-terminal kinase (JNK) (Casaccia-Bonnefil et al., 1996).

Different from the full length Trk receptors with the intrinsic tyrosine kinase activity,

several isoforms of TrkB and TrkC, such as TrkB.T1 and TrkB.T2, lack tyrosine kinase

domains (Klein et al., 1990; Tsoulfas et al., 1993; Valenzuela et al., 1993; Middlemas et

al., 1994). Shortly after the detection of mammalian TrkB and TrkC isoforms, chicken

TrkB and TrkC isoforms also were identified, respectively (Okazawa et al., 1993; Garner

et al., 1996). The distinctive expression pattern of those Trk isoforms suggests their

different roles in the specific period of the development. For example, full length TrkB is

predominantly expressed during the embryogenesis, while TrkB.T1 is the most abundant

isoform expressed in mammalian adult brains (Allendoerfer et al., 1994; Escandon et al.,

1994; Armanini et al., 1995). Studies suggested that truncated Trk receptors mediate

neurotrophin-dependent signaling cascades (Baxter et al., 1997), regulate neuron dendrite

outgrowth (Yacoubian and Lo, 2000) or serve as dominant negative suppressors to the

TrkB or TrkC signaling (Eide et al., 1996; Ninkina et al., 1996; Palko et al., 1999). The

TrkA isoform, TrkA II, is a TrkA gene splicing variant that only has six amino acids less

located at the extracellular domain compared to the full length TrkA gene. Function

studies suggested that the two TrkA isoforms have similar biological properties in binding

to NGF in fibroblast and PC12 cell lines (Klein et al., 1991a), but TrkA II has a

10

predominant expression pattern over TrkA I in neuronal cells while the latter has a unique

expression pattern in non-neuronal cells (Barker et al., 1993).

Other Neurotrophic Factors

Although neurotrophin signalings have been implicated in promoting neuronal survivals

in various systems, it is considered irrelevant to CG neuronal survival. Previous studies

have demonstrated that the survival of CG neuron requires the activity of some other

neurotrophic factors, such as ciliary neurotrophic factor (CNTF) and glial cell line-derived

neurotrophic factor (GDNF). Chicken and mammalian CNTF were identified so far, with

most of the studies performed on the mammalian form and its receptor complex. Chicken

CNTF (also known as growth-promoting activity, i.e., GPA) was first purified from chick

eye tissues (iris and ciliary body) and named after its effect in supporting the survival of

embryonic chick ciliary ganglion neurons in vitro, as well as that of rodent sympathetic

and sensory neurons (Nishi and Berg, 1981; Barbin et al., 1984; Manthorpe et al., 1985).

Mammalian CNTF, purified from rat sciatic nerves, exerted similar trophic effects on

sympathetic and ciliary ganglion neurons (Manthorpe et al., 1986). The CNTF receptor,

CNTFα, widely expressed in both embryonic and adult brain, is essential for normal

development and may be involved in postnatal and adult neuronal maintenance (Sendtner

et al., 1994; MacLennan et al., 1996). The sequence of mammalian (rat, rabbit) and

chicken CNTF (Lin et al., 1989; Stockli et al., 1989; Leung et al., 1992a) displays high

homology with members of the hematopoietic cytokine superfamily such as interleukin-6

(IL6) and leukemia inhibitory factor (LIF) (Bazan, 1991), and the sequence CNTF-α also

11

shares high homology with the interleukin receptor IL-6α (Davis et al., 1991; Heller et al.,

1995). Subsequent studies showed that like LIF and IL-6 signaling cascades, CNTF needs

gp130 and LIFR, which bind to distinctive sites of this neurotrophic factor, to form

tri-receptor-complex along with CNTF−α (Davis et al., 1993a; Murakami et al., 1993).

Lacking a cytoplasmic tyrosine kinase domain, the tripartite CNTF receptor recruits the

JAK/Tyk family of intracellular tyrosine kinases, which in turn activates downstream

signaling molecules such as signal transducers and activators of transcription (STAT)

class of transcription factors (Akira et al., 1994; Stahl et al., 1994; Zhong et al., 1994).

In fact, mammalian CNTF is commonly referred as a lesion-derived regeneration factor

(Sendtner et al., 1994). The low expression level of mammalian CNTF in the peripheral

targets (muscle and skin) at the embryonic stage suggests that CNTF is unlikely involved

in the regulation of neuronal survival in the prenatal period (Manthorpe et al., 1986;

Stockli et al., 1989), In addition, lesions of the facial nerve lead to more severe motor

neuron degeneration in newborn mice compared with that in adult mice. The fact that

exogenous application of CNTF prevented almost all motor neuron degeneration indicates

that the CNTF level present in lesioned nerves determines the severity of the degeneration

(Tetzlaff et al., 1988; Sendtner et al., 1990). This idea was further extended by the

evidence that the expression levels of both CNTF and CNTF-α increased after injuries

(Sendtner et al., 1992b; Davis et al., 1993b; Ip et al., 1993b). Chicken CNTF is not simply

recognized as a mammalian CNTF homolog, despite its sequence similarity to the

mammalian form because: 1) rat CNTF is expressed in adult animals but barely detectable

12

in the embryoes, while chicken CNTF is present at both embryonic and adult stages

(Stockli et al., 1989; Leung et al., 1992a; Finn and Nishi, 1996); 2) mammalian CNTF is a

non-secreted protein while chicken CNTF could be easily secreted from transfected cells

(Lin et al., 1989; Sendtner et al., 1990; Reiness et al., 2001). Thus, chicken CNTF is

probably more involved in support of the neuronal survival than its mammalian form in

vivo.

Glial-cell-line-derived neurotrophic factor was purified and characterized in 1993 as a

growth factor promoting the survival of embryonic dopaminergic neurons of the midbrain

(Lin et al., 1993). Subsequently, it was shown that GDNF is also a trophic factor for

noradrenergic neurons and spinal motoneurons (Henderson et al., 1994a; Arenas et al.,

1995). The fact that GDNF was much more potent than neurotrophins in supporting

motorneuron survival in vitro and in vivo and noradrenergic neuron survival in the CNS in

vivo suggest that it may act as a physiological neurotrophic factor to prevent neuronal

death. In addition to the effects in the CNS, application of GDNF promoted the survival of

several PNS neuron populations in vitro, including sympathetic, parasympathetic (e.g.,

CG) and sensory neurons (Buj-Bello et al., 1995; Forgie et al., 1999; Hashino et al., 1999).

Despite the low homology in amino acid sequence, GDNF belongs to the transforming

growth factor-β (TGF-β) superfamily, and contains seven cysteine residues that are

distributed with the same relative spacing as other members of this family (Lin et al.,

1993; Ibanez, 1998), A few other family members are neurturin (NRTN) (Kotzbauer et al.,

1996), persephin (PSPN) (Milbrandt et al., 1998) and artemin (ARTN) (Baloh et al.,

13

1998), which share similar functions with GDNF. The cellular response to GDNF family

members is mainly mediated by a bi-receptor-complex composed of ret proto-oncogene

(RET) receptor tyrosine kinase (Durbec et al., 1996a; Trupp et al., 1996; Vega et al., 1996)

and glycosyl phosphatidylinositol (GPI)-linked GDNF family receptor α (GFRα), the

latter of which determines the specificity of binding with GDNF family ligand (Scott and

Ibanez, 2001). Four GPI-linked receptors have been cloned so far and designated as GFR

1 (Jing et al., 1996; Treanor et al., 1996), GFR 2 (Baloh et al., 1997; Klein et al., 1997),

GFR 3 (Jing et al., 1997; Baloh et al., 1998), and GFR 4 (Thompson et al., 1998).

Previous evidence suggested that GDNF, NRTN, ARTN, and PSPN have the highest

binding affinity for GFR 1, GFR 2, GFR 3, and GFR 4, respectively (Baloh et al., 1997,

1998; Jing et al., 1997; Thompson et al., 1998). Interestingly some recent evidence also

suggested that GDNF may initiate its signaling cascade independent of RET, e.g., GDNF

triggers Src-family kinase and ERK/MAPK activation in RET-deficient mice (Poteryaev

et al., 1999; Trupp et al., 1999). The binding of GDNF dimer to GFRα recruits the RET

receptor to the complex and triggers tyrosine phosphorylation within its specific domains

and subsequent intracellular signaling (Airaksinen et al., 1999; Baloh et al., 2000;

Airaksinen and Saarma, 2002). Like other receptor tyrosine kinases, phosphorylated RET

receptor activates a variety of downstream signaling molecules such as MAPK, PI-3K and

c-Jun N-terminal kinase (JNK) (Worby et al., 1996; Chiariello et al., 1998;

Segouffin-Cariou and Billaud, 2000). Similar pathways utilized in NT/Trk signaling

cascades are activated by RET signaling as well, including the MAP kinase pathway

involved in the neurite outgrowth and survival (Fisher et al., 2001), the PI-3K pathway

14

crucial for neuronal survival (Soler et al., 1999) and the PLC-γ1 pathway (Borrello et al.,

1996). Interestingly, the survival effects promoted by GDNF in vitro and in vivo, except

for motoneurons, requires the presence of TGF-β (Peterziel et al., 2002).

Despite the survival promoting effects induced by CNTF and GDNF in the chick CG

system, and both CNTF and GDNF are expressed in CG target tissues (Barbin et al., 1984;

Buj-Bello et al., 1995), neither of them is likely to act as the only neurotrophic factor

required in CG neuron survival in vivo for a couple of reasons: 1) the response of CG

neurons to CNTF decreased gradually with age during the embryonic stage (Buj-Bello et

al., 1995; Heller et al., 1995); 2) GDNF expression peaks and gradually decreases before

the onset of cell death at embryonic day 8 (E8), and the expression level of GFR 1

significantly decreased from E8 to E14 (Buj-Bello et al., 1995; Hashino et al., 2001).

These findings above suggest that additional neurotrophic factor(s) are required to rescue

CG neurons from the regular cell death in vivo.

15

Figure 1. Structure Illustration of Multicomponent Receptor System of Neurotrophic

Factors

(adapted from Ibanez, 1998 review in Trends in Neurosci, 21, 438-44)

Nerve growth factor (NGF) binds separately to the p75 neurotrophin receptor (p75NTR) and to TrkA. Interaction between ligand-bound TrkA and p75NTR have been proposed. GDNF binds to a complex formed by GFRα-1 and RET. In this complex, GFRα-1 is essential for ligand binding. CNTF interacts with a tripartite receptor complex formed by CNTFα and two signal-transducing β-component, LIF- β and gp130.

16

Neurotrophin Expression and Regulation

Expression Pattern

Mature neurotrophins are expressed in a variety of tissues, including both nervous system

and peripheral tissues. The NGF and BDNF expression have been shown not only in the

CNS region such as hippocampus and cortex, but also in spleen and heart as well (Tirassa

et al., 2000). The NT-3 mRNA is not only consistently expressed in the hippocampal area

of adult rat brain, but also present transiently in the cingulate cortex in the first 2 wk of the

embryogenesis, suggesting its potential role in the neurogenesis and differentiation

(Friedman et al., 1991). NT-4 mRNA as well as BDNF mRNA is detectable in

hippocampus, cortex, cerebellum, brainstem and peripheral tissues (heart, lung and

kidney) in rats (Timmusk et al., 1993b). As the first identified neurotrophin member from

brain extracts, BDNF mRNA and protein are widely expressed in the CNS, such as the

hippocampal formation, amygdaloid complex, claustrum, cerebral cortex, cerebellum,

spinal cord, and retinal ganglion cells/optic tectum (Phillips et al., 1990; Herzog et al.,

1994; Herzog and von Bartheld, 1998; Nishio et al., 1998; Ferrer et al., 1999;

Soontornniyomkij et al., 1999), and the expression level increases gradually until reaching

the maximum after the birth (Schecterson and Bothwell, 1992). In the PNS, BDNF is

present in dorsal root ganglia (Ernfors et al., 1990), which is believed to contribute to the

survival of these source neurons, respectively (Schecterson and Bothwell, 1992).

Although the expression pattern of neurotrophins in mammalian species is strikingly

similar, variance occurs in some non-mammalian species, for example, BDNF, in place of

17

NT3, predominates in avian cochlea and is believed to support neuronal survival and

development in such regions (Pirvola et al., 1997).

The presence of TrkA mRNA is confined to the sensory cranial (trigeminal, superior,

jugular) and dorsal root ganglia (DRG) of neural crest origin in mouse embryos

(Martin-Zanca et al., 1990), suggesting that TrkA plays an important role in the

neurogenesis. TrkB and TrkC mRNAs are widely expressed throughout the brain regions,

such as hippocampus, neocortex, brainstem nuclei, spinal cord motorneuron, olfactory

formation, while TrkA mRNAs are expressed in more restricted areas such as cholinergic

neurons in basal forebrain (Merlio et al., 1992). Interestingly, TrkB and TrkC mRNA

expression in the embryonic CNS have both overlapping and exclusive patterns compared

to each other. A wide expression pattern of TrkB protein also was observed in rat CNS,

implying a broad role of TrkB (Yan et al., 1997). In the peripheral nervous system (PNS),

TrkB and TrkC mRNAs are much less abundant in DRG and trigeminal neurons in the

early development compared to TrkA mRNA expression (Martin-Zanca et al., 1990;

Carroll et al., 1992). More importantly, Kokaia and colleagues used in situ hybridization

to show mRNAs of BDNF and TrkB were coexpressed in hippocampal and cortical

neurons (Kokaia et al., 1993). Similar results demonstrated the mRNA colocalization of

p75 receptor with NGF/BDNF/NT3, TrkA with NGF and TrkB with BDNF in cerebral

cortex, hippocampal formation, anterior and lateral hypothalamus regions, implying the

potential autocrine and/or paracrine interaction between NTs and Trk receptors (Miranda

et al., 1993).

18

Table I. Expression of Neurotrophins in Mammalian Central Nervous System.

Reference list for Table I:

a.(Martin-Zanca et al., 1990) b.(Arumae et al., 1993) c.(Huang et al., 1999a) d.(Ozdinler et al., 2005) e.(Obata et al., 2004) f.(Wetmore and Olson, 1995) g.(Rifkin et al., 2000) h.(Josephson et al., 2001) i.(Wyatt et al., 1999) j.(MacLennan et al., 1996) k.(Palmada et al., 2002) l.(Yamashita et al., 1999c) m.(Ip et al., 1993b) n.(Escandon et al., 1994) o.(Johnson et al., 1999) p.(Tirassa et al., 2000) q.(Moore et al., 2004) r.(Shelton et al., 1995) s.(Miranda et al., 1993) t.(Fagan et al., 1996) u.(Yan et al., 1997) v.(Zhou and Rush, 1994) w.(Friedman et al., 1991)

Activity-Dependent Expression

It is well established that both neurotrophin and Trk expression are activity-dependent.

The expression of NGF and BDNF in the brain was upregulated significantly following

the administration of kainic acid or a high concentration of extracellular KCl to increase

the neuronal activity (Zafra et al., 1990; Ballarin et al., 1991; Gall et al., 1991). In addition

to long-duration seizures, brief focal hippocampal seizures induced by the electrical

kindling stimulation leads to an increase in the level of NGF and BDNF mRNA in the

hippocampus and amygdaloid complex (Ernfors et al., 1991). Non-NMDA receptors were

demonstrated to be responsible for the upregulation of BDNF mRNAs in the basal

forebrain area, since NBQX, a non-NMDA receptor antagonist, partially blocked the

effect. No significant change occurred after the application of MK-801 (NMDA receptor

19

specific antagonist) following induced ischemia (Lindvall et al., 1992) or the

administration of kainic acid, a non-NMDA receptor agonist (Zafra et al., 1990). In

hippocampus, however, application of MK-801 in vitro and in vivo both significantly

decreased BDNF mRNA level and NGF mRNA and protein expression (Zafra et al.,

1991). The evidence above suggested the involvement of both NMDA and non-NMDA

receptors in the regulation of BDNF expression, while the contradictory results

concerning the role of non-NMDA receptor may be explained as the difference between

the physiological condition and the experimental condition. Confirmatory results

demonstrated the increase in the level of NGF and BDNF protein induced by seizures

(Bengzon et al., 1992; Nawa et al., 1995; Smith et al., 1997). The cholinergic activation

also plays an important role in regulating NGF and BDNF expression levels. Application

of muscarinic AChR agonists increased the expression of both NGF and BDNF in rat

hippocampal neurons in vitro (Zafra et al., 1990). Intraperitoneal injection of pilocarpine,

a muscarinic receptor agonist, increased BDNF and NGF mRNA level in postnatal rat

hippocampus, and the effects were blocked by the administration of cholinergic receptor

antagonist scopolamine (Berzaghi et al., 1993; Knipper et al., 1994a). Removal of

cholinergic inputs from septum to hippocampus also decreased the level of BDNF and

NGF mRNA in hippocampus, implying the involvement of the cholinergic system in the

regulation of neurotrophin expressions (Berzaghi et al., 1993; Lapchak et al., 1993).

Inhibition of gamma-aminobutyric acid (GABA) receptor GABAA with bicuculline or

pentylenetetrazol increased BDNF mRNA levels in hippocampal neurons in culture (Zafra

et al., 1991; Humpel et al., 1993); while when GABAA receptors act as an excitatory

20

transmission system at the embryonic stage, both GABA and the GABAA receptor agonist

muscimol induced the increase of BDNF mRNA in rat hippocampal neurons in vitro

(Berninger et al., 1995). These results above suggest that activation of glutamergic and/or

cholinergic systems upregulates the neurotrophin mRNA level while enhanced

GABAergic transmission may suppress the neurotrophin expression.

As for the underlying mechanism for the activity-dependent BDNF expression, Timmusk

and colleagues discovered that for the rat BDNF gene, four short untranslated 5’ exons and

one 3’ exon encoding the mature BDNF are present with a separate promoter upstream of

each 5’ exons, respectively. Promoter I, II and III are mainly present in the brain while

promoter IV is more active in the peripheral tissues such as lung and heart. The BDNF

mRNAs transcribed from promoter I-III are upregulated in hippocampal neurons and

cortical neurons following neuronal activations (Metsis et al., 1993; Timmusk et al.,

1993a; Kokaia et al., 1994). Confirmatory results demonstrated that different promoter

regions are responsible for the tissue specific distribution and regulation of different

BDNF transcripts in vivo (Timmusk et al., 1995). The existence of multiple BDNF

promoters may be involved in controlling BDNF transcription, mRNA stability,

translation and post-translational modification, subcellular location, and hence BDNF

function. An increase in the intracellular Ca2+ concentration has been suggested to play an

essential role in regulating BDNF expression (Zafra et al., 1992; Ghosh et al., 1994;

Berninger et al., 1995), possibly caused by the calcium influx through L-type Ca2+

channels and/or NMDA receptors (Zafra et al., 1991; Shieh et al., 1998; Tao et al., 1998).

21

Consistent with that idea, two elements upstream of promoter III, called cyclic

AMP-responsive element (CRE) and Ca2+-responsive sequence 1 (CaRE1) were identified

recently (Shieh et al., 1998; Tao et al., 2002). The binding of CREB to CRE, which is

initiated by the activation of CaM-kinase IV following the calcium influx, and binding of a

novel transcription factor CaRF to CaRE1, are implicated in the activity-regulated BDNF

expression.

Subsequent work demonstrated that long-term potentiation induced by electrical

stimulation also increased BDNF and NGF mRNA expression in hippocampal formation

(Castren et al., 1993; Dragunow et al., 1993; Bramham et al., 1996). Moreover, it is also

clearly indicated that other types of sensory stimulation caused an increase in BDNF

mRNA expression in the corresponding target regions of the brain. For example, the light

activation upregulated BDNF expression in rat visual cortex (Castren et al., 1992) and the

whisker stimulation induced a change in BDNF expression in somatosensory cortex

(Rocamora et al., 1996). Furthermore, neurotrophin expression was modified by insults,

including an increased expression in NGF and BDNF following ischemia and

hypoglycemic coma (Lindvall et al., 1992; Merlio et al., 1993) and lesions in the

peripheral and central nervous system (Meyer et al., 1992; Berzaghi et al., 1993).

The regulation of NGF and BDNF mRNA levels may require different signaling cascades.

It has been reported that NBQX partially blocked the increase of BDNF mRNA level but

not that of NGF (Lindvall et al., 1992). The application of cytokines increased NGF

22

mRNA and protein levels in non-neuronal cells but induced no significant changes in the

level of BDNF mRNA (Zafra et al., 1992). Moreover, the time-course and spatial pattern

of BDNF mRNA expression were distinctly different from those of NGF mRNA after

sciatic nerve lesions in the PNS (Meyer et al., 1992). Unlike the activity-dependent pattern

of NGF and BDNF expression, NT3 mRNA expression showed mixed results following

increased neuronal activities (Lindvall et al., 1992; Patterson et al., 1992; Berzaghi et al.,

1993; Castren et al., 1993; Bramham et al., 1996). Notably, NT3 was demonstrated to

have an activity-dependent expression pattern in the muscle cells of neuromuscular

junction in vitro after the electrical stimulation or ACh application, implying its potential

role in the development of neuromuscular synapses (Xie et al., 1997).

Like neurotrophins, Trk receptor expression also could be regulated by bioelectrical

activities, hypoxia-ischemia and axotomy. Studies have shown increases in TrkB mRNA

level and TrkB protein-like immunoreactivity in the injured rat and cat spinal cord (Frisen

et al., 1992), upregulation of TrkB mRNA and protein in the hippocampus after kindling-

induced seizure and cerebral ischemia (Merlio et al., 1993), and rapid increase of TrkB

and TrkC mRNA level following the long-term potentiation (LTP) induction (Bramham et

al., 1996). Besides full length Trk receptors, truncated TrkB receptor mRNA and/or

protein expression also was upregulated by neuronal activities or injuries (Beck et al.,

1993; Merlio et al., 1993).

23

Interestingly, BDNF expression in chicken is also regulated by activities, similar to that in

mammalians. The mRNA expression of BDNF in chicken retinal ganglion cells (RGCs)

and optic tectum was upregulated by the intraocular injection of kainic acid but was

blocked by the application of tetrotoxin (Herzog et al., 1994; Karlsson and Hallboos,

1998). Also, BDNF mRNA level was significantly upregulated in avian hypothalamus

slices following the exposure to high concentration of potassium choloride (Viant et al.,

2000), indicating the activity-dependent pattern present both in vivo and in vitro. However,

most of the studies on the regulation of BDNF expression in chicken focused on the visual

system, it is still unclear whether this pattern applies in other systems as well.

Neurotrophin/Trk Signaling Pathways

Most of the neurotrophin-induced signaling cascades go thorugh Trk receptors. The

binding of neurotrophin homodimer to Trks causes the receptor dimerization, and

autophosphorylation on tyrosine residues in the activation loop within the Trks (Heldin,

1995; Cunningham et al., 1997). Phosphorylated tyrosine residues as docking sites then

recruit downstream signaling molecules such as MAPK, PI-3K and PLC-γ1, which are

essential for a variety of neurotrophin-induced functions (Segal and Greenberg, 1996b;

Huang and Reichardt, 2001).

In the MAPK pathway, upon neurotrophin binding, the adaptor protein Shc binds to one

specific phosphorylated tyrosine residue within Trk, which recruits Grb2 and the son of

sevenless (SOS), an exchange factor for Ras (Nimnual et al., 1998), at the membrane, and

24

hence, leads to the activation of Ras and a series of downstream signaling molecules such

as Raf, p38 MAPK, and PI-3K (Stephens et al., 1994; Xing et al., 1996; Klesse and Parada,

1998; Atwal et al., 2000). The activation of ERK1 and ERK2 requires the sequential

activation of MEK1 and/or MEK2 by Raf, followed by the ERK1/ERK2 phosphorylation

induced by MEK1/MEK2 (Robinson and Cobb, 1997). Another adaptor protein, fibroblast

growth factor receptor substrate-2 (FRS-2), binds to the same tyrosine residue where Shc

adaptor protein binds. The FRS-2 provides binding sites for additional signaling

molecules including Grb2, Crk and Shp2, the last of which is essential for NGF-dependent

activation of the MAPK pathway (Wright et al., 1997). Binding of FRS-2 to Trk,

associated with Crk, results in the activation of guanyl nucleotide exchange factor, C3G,

followed by Rap1 activation, which stimulates the downstream MAPK cascade and is

involved in sustained MAPK activity (York et al., 1998; Nosaka et al., 1999). Compared

with the Ras-Raf-MEK-ERK pathway which mediates transient activation of MAPK and

leads to the cell proliferation, FRS-2-C3G-Rap1-MAPK pathway is more likely to induce

the cell differentiation (Kouhara et al., 1997; Meakin et al., 1999). The activation of Ras,

first neurotrophin-activated small GTP-binding protein shown to support neuronal

survival, regulates a variety of cell signaling events, such as cell survival, differentiation

and synaptic plasticity, through the activation of MAPKs (Xia et al., 1995; English and

Sweatt, 1997; Impey et al., 1998). Increased Ras activity as a result of NF1 (Ras

regulatory inhibitor) deletion, allowed neurons in the PNS to survive with no need of

neurotrophins (Vogel et al., 1995), whereas inhibition of Ras activity decreased the

survival rate of most populations of sympathetic neurons (Borasio et al., 1993; Nobes and

25

Tolkovsky, 1995). Ras does not directly act to promote survival; however, it functions

through downstream signaling molecules such as ERKs (mainly ERK1/2) to support the

survival of certain populations of neurons against insults (Xia et al., 1995; Meyer-Franke

et al., 1998; Anderson and Tolkovsky, 1999; Hetman et al., 1999). Besides the

involvement of well-studied ERK1/2 pathway, one novel neurotrophin signaling pathway

through ERK-5 was recently demonstrated in the neurotrophin-induced neuroprotection of

cortical, cerebellar and DRG neurons (Cavanaugh et al., 2001; Watson et al., 2001; Liu et

al., 2003; Shalizi et al., 2003). It is believed that MAPK pathway induces the cell survival

by stimulating the activity or the expression of anti-apoptotic proteins such as Bcl-2 and

CREB. The inactivation of Bcl-2 induced the occurrence of progressive degeneration in

motorneurons, sensory and sympathetic neurons (Michaelidis et al., 1996) which also

suppressed the BDNF-induced survival response (Allsopp et al., 1995). The evidence that

the expression level of this anti-apoptotic protein increased upon NGF treatment complies

with its support role in mediating the neurotrophin-induced neuronal survival (Aloyz et al.,

1998). The CREB, a cAMP and calcium regulated transcription factor (Finkbeiner et al.,

1997), is also a crucial factor in the neurotrophin-induced survival because the disruption

of either CREB phosphorylation or CREB binding sites to DNA lead to a significant

decrease in the survival induced by NGF and BDNF (Bonni et al., 1999; Riccio et al.,

1999). More importantly, Bcl-2 expression is regulated by CREB activity in NGF-induced

survival of sympathetic neurons, suggesting a potential MAPK-CREB-Bcl-2 pathway

(Riccio et al., 1999).

26

Besides the MAPK signaling pathway, PI-3K/Akt pathway activated by neurotrophins has

an essential role in supporting neuronal survival as well. PI-3K was first identified as a

regulator involved in the NGF-promoted PC12 cell survival (Yao and Cooper, 1995). The

activation of PI-3K occurs through either Ras-dependent or Ras-independent pathways

(Huang and Reichardt, 2001). To date plenty of evidence has shown the intimate

connection between Ras and PI-3K: Ras directly interacted with PI-3K and the inhibition

of Ras knocked down the PI-3K activity induced by neurotrophins (Rodriguez-Viciana et

al., 1994); moreover, introduction of Ras mutants, which selectively activate the PI-3K

pathway, induced neuronal survival in the sympathetic system while Ras-mediated

survival was blocked by the PI-3K inhibitor, LY294002 (Klesse and Parada, 1998;

Mazzoni et al., 1999). In addition the PI-3K pathway was activated by a Ras-independent

pathway, which involves a Shc-Grb2 complex containing insulin receptor substrates 1

(IRS-1), IRS-2 and Grb-associated binder-1 (Gab-1) (Nguyen et al., 1997; Yamada et al.,

1997). The complex induces the association and activation of PI-3K that in turn stimulates

downstream molecules at the inner membrane as a result of ligand-regulated

protein-protein interaction. Within this complex, Gab-1 as an adapter protein binds and

activates PI-3K (Holgado-Madruga et al., 1997) and overexpression of Gab-1 potently

stimulated the cell survival independent of NGF (Korhonen et al., 1999). Phospholipids

generated by active PI-3K recruits serine/threonine kinases 3-phosphoinositide-dependent

kinase-1 (PDK1) (Alessi et al., 1997) and a region of protein kinase C-related kinase-2

(PRK-2) (Balendran et al., 1999) to the plasma membrane, which phosphorylates and

activates downstream protein kinase B (PKB, i.e., Akt) (Bellacosa et al., 1991; Jones et al.,

27

1991). Active Akt, in turn, phosphorylates substrates that regulate neuronal survival, such

as Bcl-2 antagonist of cell death (BAD), caspase 9, IκB kinase, glycogen synthase kinase

3-β (GSK3β), and forkhead transcription factor (FKHRL1) (Datta et al., 1997; del Peso et

al., 1997; Cardone et al., 1998; Brunet et al., 1999; Kane et al., 1999; Hetman et al., 2000;

Brunet et al., 2002). For example, phosphorylation on BAD by Akt disrupts the original

interaction between BAD and Bcl-XL and the release of Bcl-XL suppresses the activity of

Bax, a proapoptotic protein. The phosphorylation of IκB releases active NF-κB, which

forms a complex with IκB in the basal condition, and in turn activates the expression of

genes responsible for supporting the cell survival (Foehr et al., 2000; Wooten et al., 2001).

Phosphorylation of FKHRL1 by Akt forms a complex with 14-3-3, which is exported

from the nucleus to the cytoplasm and suppresses the ability of FKHRL1 to promote the

expression of proapoptotic proteins. Although both MAPK/ERK and PI-3K/Akt pathways

are involved in supporting the neuronal survival, it is believed that the activation of PI-3K

is required for the basal survival while the MAPK pathway is involved in neuroprotections

under insults (Hetman et al., 1999). As the major signaling pathway responsible for

supporting the neuronal survival, PI-3K/Akt activation has been implicated in supporting

as much as 80% of neurotrophin-regulated neuronal survival in cerebellar, cortical,

sympathetic and sensory systems (D'Mello et al., 1997; Dudek et al., 1997; Crowder and

Freeman, 1998; Klesse and Parada, 1998; Hetman et al., 1999; Vaillant et al., 1999).

Moreover, some additional signaling molecules are activated by PI-3K/PDK1, such as p70,

an enzyme critical for the cell-cycle progression through the G1 phase, implying that it

28

regulates other cellular events besides merely supporting the neuronal survival (Alessi et

al., 1998).

The phosphorylation and activation of PLC-γ1 has been reported following the

neurotrophin treatment on PC12 cells and primary neuronal culture in the early 1990s

(Vetter et al., 1991; Widmer et al., 1993). PLC-γ1 was found to bind at phospho-tyrosine

residue 785 or 490 of TrkA receptor (Obermeier et al., 1993; Stephens et al., 1994;

Yamashita et al., 1999a). and phospho-tyrosine residue 816 in the juxtamembrane domain

of TrkB receptor (Middlemas et al., 1994; Minichiello et al., 1998). Active PLC-γ1 is

known to increase the production of inositol tris-phosphate (IP3) and DAG. Binding of

IP3 to IP3 receptors induces calcium release from the endoplasmic reticulum (ER), the

internal calcium store, to the cytoplasm, which initiates a series of calcium-dependent

signaling cascades, such as activation of CaMK and camodulin; while DAG activates

PKC signaling pathways (Patapoutian and Reichardt, 2001). Both calcium/calmodulin and

Ras/MAPK pathways are able to activate the transcription factor CREB (Bito et al., 1996;

Deisseroth et al., 1996; Finkbeiner et al., 1997), CREB has been implicated in the gene

expression and long lasting regulation of synapses (Silva et al., 1998; West et al., 2001).

PLC-γ1 itself has been implicated in quite a few areas as well, such as

neurotrophin-mediated neurotrophin release, depolarization-evoked glutamate release

(Canossa et al., 1997; Matsumoto et al., 2001), growth cone guidance (Ming et al., 1999)

and synaptic plasticity (Minichiello et al., 2002)

29

Besides its crucial role in mammalians, BDNF has been implicated in a variety of

developmental process in chickens as well. For example, BDNF/TrkB signaling is

essential for the survival of embryonic motorneurons and sensory neurons (Lindsay et al.,

1985b; Kalcheim et al., 1987; Oppenheim et al., 1992; Becker et al., 1998) and the

maturation of sensory neurons (Wright et al., 1992). However, few lines of evidence has

elucidated the specific downstream molecules involved in the chicken BDNF/TrkB

signaling (Borasio et al., 1993; Becker et al., 1998; Dolcet et al., 1999), especially in the

parasympathetic system. Thus it is interesting to explore more into this unknown area in

avians for better understanding of BDNF signaling cascade and the regular development

of chicken embryoes.

Neurotrophin Function

Neuronal Survival

Sympathetic Ganglia

Neurotrophins were named after their effects in promoting the neuronal survival. Cohen

and colleagues first demonstrated that the application of NGF antibody impaired the

survival of sympathetic neurons (Cohen, 1960), and subsequent studies in vitro further

demonstrated the essential role of NGF in the survival, development and differentiation of

sympathetic neurons (Chun and Patterson, 1977; Coughlin et al., 1977). Knockout of

either NGF or TrkA genes in mice confirmed the survival-promoting effects of NGF/TrkA

signalings on sympathetic neurons in vivo (Crowley et al., 1994; Smeyne et al., 1994;

Fagan et al., 1996). The NGF was believed to be synthesized in target sites and

30

retrogradely transported back the cell body to exert its neurotrophic effects, in both

rodents (Hendry et al., 1974; Stockel et al., 1974; Claude et al., 1982) and avian

(Brunso-Bechtold and Hamburger, 1979). Interestingly at early stages of the

embryogenesis, only TrkC is expressed in sympathetic ganglions, while at later stages,

postmitotic neurons express TrkA and require NGF to support the neuronal survival

(Fagan et al., 1996). Consistent with the finding that TrkA and TrkC expression are

reciprocally regulated, it is not surprising that NT-3 rather than NGF was able to rescue

about half of the cell loss of sympathetic neurons in culture, possibly through TrkC

receptors, before they became NGF-dependent (Birren et al., 1993; Dechant et al., 1993c).

In accord with in vitro evidence, the removal of NT3 gene function by either the knockout

technique or the application of NT3 antisera caused the significant cell loss of

symapathetic neurons, indicating the requirement of endogenous NT-3 to support the

neuronal survival in vivo (Ernfors et al., 1994b; Farinas et al., 1994; Zhou and Rush, 1995;

Francis et al., 1999). Thus, these data above indicate that NT-3 and NGF are both required

for the survival of sympathetic neurons. Surprisingly TrkC-/- mice displayed no

significant changes in cell numbers of sympathetic ganglia, possibly under the mechanism

that NT3 initiates its signaling cascade mediated by TrkA and/or TrkB receptors (Fagan et

al., 1996; Tessarollo et al., 1997). The CNTF and GDNF, two other members of the

neurotrophic factor family, both support sympathetic neuronal survival in vitro (Barbin et

al., 1984; Saadat et al., 1989; Eckenstein et al., 1990; Buj-Bello et al., 1995; Trupp et al.,

1995) but display very different functions in vivo. For example, the injection of CNTF

directly into animals had no effects on rescuing sympathetic neuron loss, while

31

GDNF-deficient mice had 35% fewer neurons present in sympathetic ganglia at birth

(Oppenheim et al., 1991; Moore et al., 1996). Consistenly mice lacking GDNF receptor

Ret nearly lost all the neurons of superior cervical ganglion (SCG) (Durbec et al., 1996b).

Sensory Ganglia

As one of the extensively studied neuron populations regarding the survival-promoting

effects of neurotrophins, sensory neurons contain different subtypes of cells that display a

specific neurotrophin-dependency. Among them DRG have been very useful in

correlating different neurotrophins to subpopulations of neurons based on their

physiological properties and connections. The application of NGF supported chick DRG

and trigeminal (neural crest-derived) sensory neurons in culture (Davies and Lindsay,

1984). Consistently the disruption of NGF or TrkA gene functions in the animal models

caused severe deficiency in both of these neuron populations. In DRG neurons, the

injection of NGF antibody induced major cell death in small diameter neurons that

presumably serve in the nociception and thermoreception (Ruit et al., 1992). This was

confirmed by the findings that both trkA-/- and ngf-/- mice showed severe cell loss of same

subpopulations of DRG neurons, lacked afferents to both peripheral and central targets,

and were insensitive to pain (Crowley et al., 1994; Smeyne et al., 1994; Indo et al., 1996).

The BDNF was first identified by its survival-promoting effects on subpopulations of

sensory neurons which did not respond to NGF (Barde et al., 1982). It has been

demonstrated that neurons derived from neural placodes (neurons of the ventrolateral

portion of the trigeminal ganglion and the entire neuronal population of the vestibular,

32

geniculate, petrosal and nodose ganglia) are largely unresponsive to NGF throughout the

embryogenesis (Lindsay et al., 1985a). Knockout mice carrying mutations in the BDNF or

TrkB gene showed different extents of cell loss in such neuronal subpopulations (Ernfors

et al., 1994a; Jones et al., 1994), in accord with the findings in vitro (Lindsay et al., 1985b;

Davies et al., 1986a; Avila et al., 1993). Neurotrophin-4, which shares the same Trk

receptor with BDNF, was suggested to support the survival of some types of the sensory

ganglia (nodose-petrosal and geniculate ganglia) (Conover et al., 1995; Liu et al., 1995).

The BDNF and TrkB null mutations are lethal, whereas NT4-/- animals are viable,

implying the distinct physiological roles of BDNF and NT4 in vivo. In accordance with

such an idea, bdnf-/- animals lacked slow adapting mechanoreceptors while nt4-/- mice

demonstrated severe impairments in down-hair receptors on cutaneous sensory neurons

(Carroll et al., 1998; Stucky et al., 1998). The neurotrophin-dependency switch also occurs

in trigeminal sensory ganglia, similar to that in sympathetic ganglia. Neurons were

transiently dependent on BDNF and NT-3 for the survival before they switched to

NGF-dependent (Buchman and Davies, 1993; Buj-Bello et al., 1994). The application of

NT3 rescued some types of primary sensory neurons in vitro (Hohn et al., 1990;

Maisonpierre et al., 1990a; Rosenthal et al., 1990; Hory-Lee et al., 1993). The mutation in

NT-3 gene demonstrated dramatic cell loss in sensory neuron populations, largely in

cochlear ganglia, trigeminal ganglia, and DRG (Farinas et al., 1994; Liebl et al., 1997),

most of which, except for cochlear ganglia, demonstrated severe cell loss in bdnf-/- and

trkB-/- mice as well. Neurons missing in DRG were mostly proprioceptive neurons

expressing TrkC receptors, and it is not surprising that NT3 mutants had abnormal limb

33

postures showing the apparent deficiency in the sense of position. Mice mutated in the

TrkC gene, however, showed less severe impairments in sensory ganglia compared with

NT-3 mutants (Liebl et al., 1997), possibly due to compensatory signaling pathways

mediated by TrkA and/or TrkB receptors (Davies et al., 1995; Farinas et al., 1998).

Motor Neurons

Both BDNF and NT3 are expressed in the developing motor muscles. Motor neurons

express both TrkB and TrkC receptors, suggesting the potential role of both neurotrophins

in the developing motor system (Maisonpierre et al., 1990b; Henderson et al., 1993;

Koliatsos et al., 1993; Yan et al., 1993). The survival of motor neurons was supported by

BDNF, NT4/5 and NT3 in culture (Henderson et al., 1993), and the application of BDNF

was able to rescue avian and rat motor neurons from the cell death after the axotomy in

vivo (Oppenheim et al., 1992; Sendtner et al., 1992a; Koliatsos et al., 1993). In knockout

mice, BDNF and TrkB mutants displayed distinct phenotypes: no difference was shown in

the motor neuron number and muscle innervation between wild-type animals and bdnf-/-

animals. On the other hand, TrkB mutation caused dramatic cell loss in the facial motor

nucleus and spinal cord, and severe deficiency in the feeding activity (Klein et al., 1993;

Jones et al., 1994), suggesting that TrkB may act as a receptor for neurotrophins other than

BDNF in the regulation of motor neurons in vivo. The mutation in NT4 gene displayed no

significant decrease in the cell number of motor neurons (Conover et al., 1995; Liu et al.,

1995), as well as the mutation in NT3 gene (Farinas et al., 1994), which may be explained

as the functional redundancy of neurotrophins on this single neuron population. In

34

addition, most homozygous mutants in NT3 or TrkC gene lacked Ia afferents projections

from sensory ganglia to spinal motor neurons (Ernfors et al., 1994b; Klein et al., 1994;

Tessarollo et al., 1994), indicating that sensory ganglia dependent on NT3/TrkC may play

the role in proprioception, the sense of position and movements of limbs. Further study

supported this idea by demonstrating that following the limb bud deletion at the

embryonic stage, the application of NT3 exogenously rescued some of DRG neurons from

the cell death, the subpopulation having central projections characteristic of muscle

spindle afferents (Oakley et al., 1997). The injection of CNTF, considered as a

physiological neurotrophic factor, supported the survival of spinal motor neurons

compared with no effects on any of the sensory or sympathetic neurons in vivo

(Oppenheim et al., 1991).

Parasympathetic Ganglia

Most of the previous studies demonstrated that neurotrophins such as NGF and BDNF had

no survival-promoting effects on parasympathetic neurons in vitro (Collins and Dawson,

1983; Rohrer and Sommer, 1983; Lindsay et al., 1985b) and these neurons were not

affected by mutations in any of the neurotrophin or Trk genes. Instead, CNTF and GDNF

have both been implicated in supporting the survival of chicken CG neurons. The CNTF

messager RNA and protein are present in the target tissues during the period when ciliary

neurons are dependent on target inputs for the survival (Leung et al., 1992a; Finn and

Nishi, 1996), and high-affinity CNTF receptors are expressed on the surface of CG

neurons (Heller et al., 1995; Koshlukova et al., 1996). The application of CNTF in vitro

35

rescued parasympathetic neurons from the cell death. The overexpression of chick CNTF

gene at CG target tissues supported the neuronal survival, further indicating the essential

role of CNTF in vivo (Barbin et al., 1984; Stockli et al., 1989; Finn et al., 1998a). The

GFRα2 subunit and c-Ret of GDNF receptors are both expressed in the developing

parasympathetic neurons (Widenfalk et al., 1997; Hashino et al., 1999). Consistent with

their expression pattern, mutations in either Ret or GFRα2 lead to the severe deficiency in

the development of parasympathetic neurons (Durbec et al., 1996a; Rossi et al., 1999)

whereas the mutation in GFRα1 gene did not (Cacalano et al., 1998; Enomoto et al.,

1998).

Neuronal Populations in the CNS

Studies of CNS neurons have generally been more problematic compared with those of

PNS neurons, because for the most part, results can be only obtained from heterogeneous

cultures of neurons and non-neuronal cells, which made it difficult when the potential

effects of neurotrophins on one specific population of CNS neurons need to be identified.

Although TrkA receptors are abundantly expressed in basal forebrain cholinergic neurons

(Holtzman et al., 1992), and both exogenous application of NGF in culture and NGF

injection intraventricularly supported the survival of such neuronal population (Hefti,

1986; Hartikka and Hefti, 1988), ngf-/- and trkA-/- mice surprisingly had normal

differentiated basal cholinergic neurons with similar cell numbers to those in the wild-type

animals prenatally (Crowley et al., 1994; Smeyne et al., 1994). However, decreased

staining in cholinergic fibers projecting out from these neurons suggested a role of

36

NGF/TrkA signaling either in fiber outgrowth or in the maintenance of the cholinergic

phenotype. Accordingly, postnatal atrophy of NGF-dependent cholinergic neurons in the

basal forebrain area of heterozygous knockout mice (ngf+/-), associated with measurable

deficits in the learning and memory, suggested some dependence on this neurotrophin

molecule in the adult stage (Chen et al., 1997). The application of BDNF or NT3, but not

NGF, supported the survival of hippocampal neurons in cultures (Ip et al., 1993a). In

particular, granule neurons in the dentate gyrus of the hippocampal formation became

dependent on TrkB and TrkC receptors shortly after the natural “cell death” period,

suggesting their important roles in supporting postmitotic neurons. This idea is further

verified by the evidence that there was an increase in the postnatal apoptosis of

hippocampal neurons and cerebellar granule cells in TrkB and TrkC knockout mice

(Minichiello and Klein, 1996; Alcantara et al., 1997). These results strongly suggest that

the survival supports from neurotrophins are more postnatal in the CNS compared to

prenatal in the PNS, although it is not clear yet whether the cell death directly results from

the knockout of neurotrophins/Trk receptors or is sequentially caused by severe

deficiencies present in the peripheral system.

The above results clearly indicate that neurotrophins are required for the survival of

sympathetic, sensory, parasympathetic ganglia and motor neurons in the PNS and some

types of neurons in the CNS. The presence of neurotrophins and their respective receptors

are essential for the normal development and maturation of a variety of neuronal

populations. It is speculated that the convergence of different neurotrophins on TrkC

37

receptors may account for the less effect of TrkC gene knockout on the sensory and

sympathetic neuron survival. The BDNF, our most interested molecule, was demonstrated

its essential role in supporting the survival of various neuronal populations; however, it is

considered irrevelant to the survival of parasympathetic neurons based on the previous

studies.

Synaptic Plasticity

The neurotrophin expression is upregulated by the increased neuronal activity (Zafra et al.,

1990, 1991; Ernfors et al., 1991; Lindvall et al., 1992), and the induction of LTP (Castren

et al., 1993; Dragunow et al., 1993; Bramham et al., 1996), Moreover, activity-stimulated

release of NGF and BDNF has been demonstrated in both hippocampal slices and primary

cultures of hippocampal neurons (Blochl and Thoenen, 1995; Goodman et al., 1996),

Those imply that the neurotrophin itself may play an important role in the regulation of

synapse plasticities. The pioneering report from Lohof and colleagues demonstrated that

the application of NT-3 and BDNF acutely potentiated both spontaneous and

impulse-evoked synaptic activity of Xenopus neuromuscular junctions in vitro (Lohof et

al., 1993). The application of CNTF increased synaptic activity as well (Stoop and Poo,

1995), and the coapplication of CNTF with BDNF even showed synergistic effects on

regulating the neuromuscular synapse function (Stoop and Poo, 1996). The acute effects

of neurotrophins on the neuronal activity and synaptic transmission have been observed in

various studies. Several groups have demonstrated that the acute application of BDNF was

able to induce the enhancement of glutamatergic synaptic transmissions in the embryonic

38

rat hippocampal neuron culture (Levine et al., 1995), in different excitatory pathways

(CA1, CA3 region and dentate gyrus) of adult hippocampal slices (Kang and Schuman,

1995, 1996; Scharfman, 1997) and in slices of young rat visual cortex (Akaneya et al.,

1997; Carmignoto et al., 1997). TrkB-mediated signaling is required and essential for

BDNF-induced potentiation in all cases, while the activation of low-affinity neurotrophin

receptor p75 is not required. In addition to the acute effects on the excitatory synapse

transmission, neurotrophin (BDNF and NT3) application also inhibited GABAergic

inhibitory transmission in rodent cortical neurons and cerebellar granule cells (Kim et al.,

1994; Tanaka et al., 1997; Cheng and Yeh, 2003).

The acute effects of neurotrophins preferentially focus on active synapses (McAllister et

al., 1996; Gottschalk et al., 1998), and may be facilitated by the presence of cAMP or

activation of adenosine receptor A2A (Boulanger and Poo, 1999b; Diogenes et al., 2004).

Such regulation requires a cascade of protein phosphorylation (Liu et al., 1999; He et al.,

2000; Yang et al., 2001) and is independent of new protein synthesis (Stoop and Poo,

1995; Chang and Popov, 1999). The induction of neurotransmitter/neurotrophin release

from presynaptic sites may be implicated in the acute effects induced by neurotrophins,

due to triggered calcium influx and/or the induced regulation on synaptic vesicle proteins

(Kruttgen et al., 1998). In the CNS, Knipper and colleagues showed that NGF and BDNF

enhanced high K+-induced release of acetylcholine from hippocampal synaptosomes

(Knipper et al., 1994a). Subsequent studies demonstrated that acute neurotrophin

application was able to trigger the release of other neurotransmitters such as glutamate and

39

dopamine as well (Knipper et al., 1994b; Blochl and Sirrenberg, 1996; Jovanovic et al.,

2000). The application of BDNF or NT-3 to hippocampal neurons in culture lead to an

acute increase of intracellular Ca2+ concentration which mainly came from the internal

Ca2+ stores (Berninger et al., 1993; Canossa et al., 1997), and an increase in the

presynaptic Ca2+ concentration was observed in the neuromuscular junction as well (Stoop

and Poo, 1996). Such elevation of intracellular Ca2+ could, in turn, enhance the

neurotransmitter release from presynaptic sites. In addition, several lines of evidence also

imply that the enhanced secretion resulted from the direct modification on synapse vesicle

proteins. Studies have shown the MAPK dependent phosphorylation of synapsin I, a

membrane-bound vesicle protein, in hippocampal and cortical neurons after the acute

application of neurotrophins (Knipper et al., 1994b; Jovanovic et al., 1996). Mice lacking

synapsin I and/or synapsin II displayed the attenuation of glutamate release by BDNF in

the preparation of synaptosome (Jovanovic et al., 2000), indicating the indispensable role

of synapsins in the BDNF-enhanced neurotransmitter release. In addition to synapsin, the

expression level of two other synaptic proteins, synaptobrevin and synaptophysin,

increased following the acute treatment of BDNF in the synaptosome preparation from

BDNF knockout mice, implying that BDNF may also affect synaptic activity by the

enhancement of synaptic protein docking (Pozzo-Miller et al., 1999). Alternatively,

neurotrophin-triggered neurotrophin release, which may occur at both dendritic and

axonal sites, could be accounted for the activity-dependent neuronal activity (Canossa et

al., 1997; Kruttgen et al., 1998). Similar to the activity-dependent expression of

neurotrophins, acute effects induced by neurotrophins require an increase in the

40

intracellular Ca2+ concentration from presynaptic sites and may act through an autocrine

loop to modulate the synapse efficacy. Judged by the analysis of paired-pulse facilitation,

of the amplitude and the frequency of miniature synaptic currents, and of synaptic failure

rates, the neurotrophin-induced acute enhancement is originated from presynaptic sites

(Lohof et al., 1993; Kang and Schuman, 1995; Carmignoto et al., 1997; Gottschalk et al.,

1998). Consistent with such idea, the depolarization on presynaptic sites extensively

facilitated the BDNF-induced potentiation, and null mutation of TrkB gene specifically at

presynaptic sites but not at postsynaptic sites attenuates the acute effects (Boulanger and

Poo, 1999a; Xu et al., 2000). Moreover, BDNF has been shown to enhance not only the

neurotransmitter release from presynaptic sites, but also the postsynaptic transmission

through NMDA receptors on hippocampal neurons in the culture condition (Levine et al.,

1995; Levine et al., 1998). Also BDNF induced the phosphorylation of postsynaptic

NMDA receptor subunit 1 and 2B (Suen et al., 1997; Lin et al., 1998). Such results imply

that postsynaptic modification may be involved somehow, if at all, in

neurotrophin-induced acute effects.

Moreover, BDNF has been shown involved in the onset and maintenance of LTP as well.

The LTP at hippocampal neuronal synapses was greatly reduced in BDNF homozygous

and heterozygous knockout mice although the brain morphology, basal synaptic

transmission, and behavior appeared normal in these mice (Korte et al., 1995). In TrkB

conditional knockout mice, LTP in hippocampal CA1 region was impaired as well

accompanied with learning and memory defects (Minichiello et al., 1999). The defective

41

LTP could be rescued by the prolonged application of BDNF (2-4 hr) exogenously on

hippocampal slices (Patterson et al., 1996) or by the overexpression of BDNF gene in the

hippocampal CA1 region (Korte et al., 1996), suggesting that the absence of BDNF rather

than cumulative developmental defects is responsible for the LTP impairment in

BDNF-knockout mice. Consistent with these results, the application of TrkB-IgG fusion

protein, anti-TrkB antisera or BDNF function-blocking antibody lead to impaired

theta-burst stimulated LTP in hippocampal slices (Figurov et al., 1996; Kang et al., 1997;

Chen et al., 1999). The incubation with TrkB-IgG fusion protein prior to and 30 min after

the induction of LTP both showed defective LTP, indicating that BDNF/TrkB signaling is

required for the initiation and maintenance of such events in a time-dependent manner

(Kang et al., 1997). Acute application of BDNF enhanced the tetanus-induced LTP in

hippocampal and cortical slices (Figurov et al., 1996; Akaneya et al., 1997), and

attenuated the long-term depression (LTD) in both hippocampus and visual cortex regions

(Akaneya et al., 1996; Huber et al., 1998; Ikegaya et al., 2002). Interestingly,

microinfusion of BDNF directly into dentate gyrus of adult rats in vivo triggered a robust

and lasting strengthening of synaptic transmission (termed BDNF-LTP) at perforant path

to granule cell synapses (Messaoudi et al., 1998; Ying et al., 2002). In contrast to previous

results that BDNF triggered the new protein synthesis from existing mRNAs located at

dendritic sites (Kang and Schuman, 1996; Aakalu et al., 2001), BDNF-LTP requires the

protein synthesis as well as mRNA transcription (Messaoudi et al., 2002; Ying et al.,

2002).

42

In addition to their acute enhancement of synaptic activity and transmission,

neurotrophins also exert long-term regulation on synapse development and function. The

BDNF and other neurotrophins have been shown to modulate the axon and dendritic

branching in the brain such as in the visual and sensory system (Cohen-Cory and Fraser,

1995; McAllister et al., 1995, 1996; Lentz et al., 1999). TrkB receptor signaling is

responsible for dendritic growth in vivo and in vitro (Lom and Cohen-Cory, 1999;

Yacoubian and Lo, 2000), indicating an essential role in the formation of synaptic

network. Long-term application of BDNF and NT-3 (2-3 d) resulted in a sustained

increase in quantal size, synaptic protein expression and a more reliable impulse-evoked

synaptic transmission in Xenopus nerve-muscle culture (Wang et al., 1995). The

application of CNTF along with BDNF or NT3 had synergistic effects on the

neurotrophin-induced modification on synapses, as it did in the manner of short-term

(Liou et al., 1997). In addition, postsynaptic receptor clusters in muscle fibers were

disrupted in TrkB knockout mice, indicating an important role of BDNF/TrkB signaling in

the formation and maturation of functional synapses at neuromuscular junctions both in

vitro and in vivo (Gonzalez et al., 1999). Besides in PNS, neurotrophins are essential for

establishing neuronal connectivity in the CNS as well. Neurotrophins were demonstrated

to be involved in activity-dependent synaptic competition and formation of ocular

dominance columns in the visual cortex. The infusion of NT-4/5 or BDNF into cat primary

visual cortex inhibited the column formation within the immediate vicinity of the infusion

site but not other neurotrophins (Cabelli et al., 1995). Interestingly, an earlier expression

of BDNF in rat visual cortex accelerated the column maturation and induced an early

43

termination of the critical period responsible for the ocular dominance plasticity (Huang et

al., 1999b). Compared with in vivo effects, BDNF was able to influence the maturation of

both glutamatergic and GABAergic synapses in an activity-dependent manner in vitro.

The BDNF application induced an increased synapse formation for both excitatory and

inhibitory transmission in hippocampal neuronal cultures (Vicario-Abejon et al., 1998;

Elmariah et al., 2004) while it inhibited inhibitory synapse formation and function in

cortical and cerebellar neuron cultures (Rutherford et al., 1998; Seil and Drake-Baumann,

2000). Furthermore, synaptic vesicle protein expression and the density of synaptic

innervations were regulated by chronic BDNF application, e.g., increased expression of

synaptic proteins such as synaptophysin and synapsin-I (Wang et al., 1995) and an

elevation in vesicle numbers were observed in the presynaptic sites (Tyler and

Pozzo-Miller, 2001). Long-term treatment of neurotrophins also can alter the synaptic

transmission indirectly by regulating the neuronal excitability (Gonzalez and Collins,

1997; Lesser et al., 1997) and/or directly by modulating unitary synaptic properties (Wang

et al., 1995; Rutherford et al., 1998). Enhancements of both excitatory synaptic

transmission mediated by non-NMDA receptors and inhibitory transmission occurred

after the chronic treatment without affecting synapse numbers and cell excitabilities

(Sherwood and Lo, 1999; McLean Bolton et al., 2000). Interestingly, it is reported that

long-term treatment of BDNF induced the modification of synapse transmission by

protein-independent or -dependent signaling pathways (Tartaglia et al., 2001). Treatment

of BDNF on hippocampal slice cultures increased the vesicle protein expression, some of

which could not be blocked by the application of protein synthesis inhibitor. The above

44

results support the idea that neurotrophins are required for the synapse formation and

stabilization (Katz and Shatz, 1996; Snider and Lichtman, 1996), and may modulate

synapses at multiple levels.

In summary, neurotrophins exert their regulatory effects on synapses in the manner of both

short term and long term. The mechanism underlying such regulation process is quite

complicated, for example, acute effects on the synapse plasticity caused by neurotrophins

may result from the induced neurotransmitter release and phosphorylation of synapse

vesicle proteins in the presynaptic sites, and/or the regulation on neurotransmitter

receptors located at postsynaptic sites. It should be noted that neurotrophins require the

functional Trk receptors but not p75 receptors for such effect. The involvement of BDNF

in the LTP, which usually occurs in the hippocampal area, makes it a potential key player

in learning and memory, in addition to the regulation of synaptic functions and

maintanence of existing synapses in other regions of the brain and the peripheral system.

Although the identification of chicken TrkB and BDNF was reported a long time ago

(Isackson et al., 1991; Dechant et al., 1993b), and BDNF has been shown to have the

survival-supporting effects on chicken sensory neurons and motorneurons by several

groups (Lindsay et al., 1985b; Kalcheim et al., 1987; Oppenheim et al., 1992; Borasio et

al., 1993; Yin et al., 1994; Dolcet et al., 1999), it indicates that BDNF/Trk signaling is not

related to the chicken parasympathetic system. Previous wisdom believes that there was

no expression of TrkB in chick CGs (Dechant et al., 1993b; Hallbook et al., 1995), and

45

BDNF was shown unable to support the survival of parasympathetic neurons (Lindsay et

al., 1985b; Krieglstein et al., 1998). However, several lines of evidence suggest the

potential relationship between BDNF and AChRs, the major excitatory receptors present

on the surface of CG neurons. It has been reported that the acute application of BDNF

upregulated the synaptic activity in the AChR-containing synapses at neuromuscular

junctions (Lohof et al., 1993; Boulanger and Poo, 1999a); the exposure to BDNF in the

long term significantly increased the immunoreactivities of AChR clusters on the

interneurons in the hippocampal area (Kawai et al., 2002). Moreover, the disruption of

TrkB signaling abolished the AChR clusters located at neuromuscular junctions, which

further supported the idea that BDNF/TrkB signaling may be required in the regulation

and maintenance of functional synapses containing AChRs (Gonzalez et al., 1999). In

addition, the application of NGF supported the expression and regulated the function of

AChRs in the sympathetic system (Henderson et al., 1994b; Yeh et al., 2001). Thus, it is

reasonable to speculate that BDNF/TrkB may play a key role in the regulation of functions

and expression of AChRs in chicken parasympathetic system. In order to get a better

understanding of the potential role of BDNF in chick CGs, we carefully examined the

expression pattern of BDNF and TrkB receptors, and explored the relationship between

BDNF and AChRs in the first manuscript.

46

BDNF and trkB signaling in parasympathetic neurons:

relevance to regulating α7-containing nicotinic receptors

and synaptic function

47

Title: BDNF and trkB signaling in parasympathetic neurons: relevance to regulating α7-containing nicotinic receptors and synaptic function.

Abbreviated Title: BDNF signaling in ciliary ganglion neurons

Authors: Xiangdong Zhou, Qiang Nai1,2, Min Chen1,3, Jason D. Dittus,

Marthe J. Howard, and Joseph F. Margiotta

Project Address: Medical College of Ohio

Department of Anatomy & Neurobiology

Block HS, 3035 Arlington Ave.

Toledo, OH 43614-5804

Correspond. Auth: Joseph F. Margiotta, Ph.D., Medical College of Ohio, Department

of Anatomy & Neurobiology, BHS 108, 3035 Arlington Avenue,

Toledo, OH 43614-5804. Tel: 419-383-4119; Fax:

419-383-3008; E-mail: jmargiotta@mco.edu

Numbers: 42 pages, 7 Figures, 0 Tables

Key Words: Ciliary ganglion, nicotinic, acetylcholine receptor, BDNF, trkB,

patch-clamp, neurotrophin, bungarotoxin, EPSC, CREB, PACAP

Acknowledgments: Support was provided by National Institutes of Health grants

R01-DA15536 (to J.F.M.) and R01-NS40644 (to M.J.H.). We

thank Mr. Wei Han for technical assistance, Drs. Frances Lefcort

and Louis Reichardt for providing trkB and p75NTR antisera, and

48

Drs. Darwin Berg, Leslie Henderson, and Phyllis Pugh for helpful

comments on the manuscript.

Notes: 1These authors contributed equally.

2, 3Current Addresses:

2Dept. of Biology 0357, University of California, San Diego, 9500

Gilman Drive., La Jolla, CA 92093.

3Behavioral Medicine Research Institute. Ohio State University,

2187 Graves Hall, 333 W. 10th Ave., Columbus, OH 43210.

49

Abstract

Parasympathetic neurons do not require neurotrophins for survival, and are thought to lack

high-affinity neurotrophin receptors (i.e. trks). We report here, however, that mRNAs

encoding both brain derived neurotrophic factor (BDNF) and its high-affinity receptor

(trkB) are expressed in the parasympathetic chick ciliary ganglion (CG), and that

BDNF-like protein is present in the ganglion and in the iris, an important peripheral target

of ciliary neurons. Moreover, CG neurons express surface trkB and exogenous BDNF

not only initiates trk-dependent signaling, but also alters nicotinic acetylcholine receptor

(nAChR) expression and synaptic transmission. In particular, BDNF applied to CG

neurons rapidly activates cyclic AMP dependent response element binding protein

(CREB) and over the long-term selectively up-regulates expression of

α7-subunit-containing, homomeric nAChRs (α7-nAChRs), increasing α7-subunit mRNA

levels, α7-nAChR surface sites and α7-nAChR-mediated whole-cell currents. At

nicotinic synapses formed on CG neurons in culture, brief and long-term BDNF

treatments also increase the frequency of spontaneous excitatory postsynaptic currents,

most of which are mediated by heteromeric nAChRs containing α3, α5, β4, and β2

subunits (α3*-nAChRs) with a minor contribution from α7-nAChRs. Our findings

demonstrate unexpected roles for BDNF-induced, trk-dependent signaling in CG neurons,

both in regulating expression of α7-nAChRs and in enhancing transmission at

α3*-nAChR-mediated synapses. The presence of BDNF-like protein in CG and iris

target coupled with that of functional trkB on CG neurons raise the possibility that signals

50

generated by endogenous BDNF similarly influence α7-nAChRs and nicotinic synapses in

vivo.

51

Neurotrophins (NGF, BDNF, NT-3) act via high-affinity tyrosine kinase-containing

receptors (trkA, trkB and trkC, respectively) to support the survival and growth of diverse

neuron populations, and influence the form and function of chemical synapses (Lewin and

Barde, 1996; Kaplan and Miller, 2000; Huang and Reichardt, 2001). In particular, BDNF

and sometimes NT-3, exert rapid, largely presynaptic effects at central, autonomic, and

neuromuscular synapses, and produce long-term pre- and postsynaptic changes consistent

with altered gene expression (Reviewed in (Lewin and Barde, 1996; Schuman, 1999; Poo,

2001). Thus in addition to providing trophic support, neurotrophins also induce

trk-dependent acute and long-term changes that coordinately influence synaptic

interactions.

Parasympathetic neurons typified by those in the chicken CG do not require neurotrophins

for survival (Helfand et al., 1976; Rohrer and Sommer, 1982; Lindsay et al., 1985b;

Krieglstein et al., 1998). Instead, CG neurons rely on other growth factors, notably

ciliary neurotrophic factor (CNTF) (Leung et al., 1992b; Finn et al., 1998b) and glial

derived neurotrophic factor (GDNF) (Hashino et al., 2001) for trophic support.

Moreover, studies employing Nothern and RNAse protection assays failed to detect trk

mRNA in ciliary ganglia (Dechant et al., 1993a; Hallbook et al., 1995). These

observations have led to the presumption that CG neurons lack trks (e.g. (Huang and

Reichardt, 2001).

52

As with sympathetic ganglion neurons and skeletal muscle fibers, fast chemical synapses

on ciliary and other parasympathetic ganglion neurons are mediated by nAChRs. In

sympathetic neurons, NGF supports the expression of α3-nAChR subunit protein (Yeh et

al., 2001), an effect mirrored in PC12 cells where NGF increases α3, α5, α7, β2, and β4

nAChR subunit mRNAs as well as nAChR function (Henderson et al., 1994b; Takahashi

et al., 1999). Also, sympathetic neurons overexpressing BDNF display increased

preganglionic innervation density (Causing et al., 1997) indicative of long-term

presynaptic effects. BDNF acting through trkB also regulates neuromuscular junction

form and function. For example, BDNF rapidly enhances presynaptic release to increase

the frequency and amplitude of spontaneous nAChR-mediated synaptic currents in

nerve-muscle cultures (Lohof et al., 1993; Stoop and Poo, 1996; Gonzalez et al., 1999).

Over the long term, BDNF restores neuregulin levels, restricts axon sprouting, and

maintains postsynaptic architecture in muscle disrupted by activity blockade (Loeb et al.,

2002) while sustained trkB-mediated signaling is likely required to maintain postsynaptic

nAChR clusters (Gonzalez et al., 1999). These findings prompted us to speculate that

previous assays were perhaps insufficiently sensitive to detect trks expressed in ciliary

ganglia, and that neurotrophin/trk signaling while not required for trophic support, might

influence the components and function of nAChR-mediated synapses on CG neurons.

We focused on BDNF/trkB sigaling, and have demonstrated expression of BDNF-like

protein in ciliary ganglia and functional trkB on CG neurons. To explore synaptic

relevance, the impact of BDNF/trkB signaling on α7-nAChRs and α3*-nAChR mediated

synapses was assessed using CG neurons grown in cell culture. BDNF treatment

53

up-regulated expression of α7-nAChRs after several days, and increased the frequency of

spontaneous synaptic currents within minutes. The results reveal an unanticipated

relevance for BDNF/trkB signaling in parasympathetic CG neurons.

54

Methods

Neurons. CG neuron cultures were prepared under sterile conditions from embryonic

day 8 (E8) chick embryos. Dissociated neurons were plated at 1-2 ganglion equivalents

in 15 mm diameter polystyrene tissue culture wells or on 12 mm diameter glass coverslips;

both substrates were pre-coated with poly-dl-ornithine and laminin (Pugh and Margiotta,

2000; Chen et al., 2001). The standard culture medium consisted of minimum essential

medium (MEM) containing 100 U/ml penicillin, 100 µg/ml streptomycin, 2 mM

glutamine, and 10% heat inactivated horse serum (MEMhs; all components from

GIBCO-BRL, Rockville, MD) and was supplemented with 3% embryonic eye extract

(Nishi and Berg, 1981). Neurons were maintained at 37°C in 95% air, 5% CO2 for 4-7 d

and received fresh culture medium every 2-3 d, conditions that support 100% survival of

CG neurons for at least 7 d (Nishi and Berg, 1981). In test cultures the medium was

further supplemented with BDNF (50 ng/ml, unless indicated otherwise) sometimes in

conjunction with other reagents as described for individual experiments in Results. For

some studies, CG neurons were acutely dissociated from E8 or E14 ganglia as previously

described (McNerney et al., 2000; Nai et al., 2003). Neurons were plated on

acid-washed, poly-d-lysine-coated glass coverslips in electrophysiological recording

solution (RS) containing (in mM) 145.0 NaCl, 5.3 KCl, 5.4 CaCl2, 0.8 MgSO4, 5.6

glucose, and 5.0 HEPES, pH 7.4 (Dichter and Fischbach, 1977) that was supplemented

with 10% heat inactivated horse serum (RShs). Acutely dissociated neurons were

maintained in RShs at 37°C for 2-4 h prior to use.

55

Conventional RT- PCR. The presence of mRNA encoding chicken trkB, BDNF, α7,

and α3-nAChR subunits, as well as β-actin (βA) or glyceraldehyde-3-phosphate

dehydrogenase (GAPDH), was assessed by conventional reverse transcriptase-based

polymerase chain reaction (RT-PCR) as previously described (Burns et al., 1997).

Briefly, RNA was isolated from E8-E15 chick tissues or from CG neuron cultures using a

one-step kit (RNAqueous, Ambion, Austin, TX). Total tissue RNA (1 µg) was treated

with Amplification Grade RNase-free DNase (1U @ 1 U/µl, Gibco-BRL), and then

25-200 ng of DNase-treated RNA used to synthesize cDNA using Superscript II reverse

transcriptase (RT+; Gibco-BRL). The resulting cDNAs were then used as templates for

PCR amplifications in 25 µl reaction volumes containing 50 mM KCl, 20 mM Tris-HCl,

2.5 mM MgCl2, 200 µM dNTPs, 5 U/µl Taq DNA polymerase (Gibco-BRL), and 0.4 µM

forward (F) and reverse (R) oligonucleotide primers (synthesized by Marshall University

DNA Core Facility, Huntington, WV). The chicken-specific primers used were:

trkB (Dechant et al., 1993a)

F: C1156TTCAGCTGGACAACCCTAC1175,

RK+: T1868GGAAGTCCTTGCGGGCATT1849

RK-: GCCCCTCTCTCATCTT

BDNF (Maisonpierre et al., 1992b)

F: G287CAGTCAAGTGCCTTTG303,

R: G748AGCCCACTATCTTCCCC731

α7-nAChR subunit (Couturier et al., 1990a)

56

F: G1092GGGAAAAATGCCTAAAT1109,

R: G1614ACAGCCTCTACAAAGTT1597

α3-nAChR subunit (Couturier et al., 1990b)

F: A985TGCCTGTATGGGTGAGAACT1005,

R: T1226TGCCACTGAAATCGGAAAAC1206

GAPDH (Stone et al., 1985)

F: G532CCATCACAGCCACACAGAA551,

R: A980CCATCAAGTCCACAACACG961

β-actin (Genebank, 1992 #L08165)

F: A860TCTTTCTTGGGTATGGA877,

R: A1134CATCTGCTGGAAGGTCC1117

The two trkB primer pairs (F/RK+ and F/RK-) correspond to those shown previously to

amplify kinase-containing (full-length) and truncated (kinase-deleted) chicken trkB

isoforms, respectively (Garner et al., 1996). The F/RK+ pair is not predicted to hybridize

with chicken trkA (Schropel et al., 1995) or trkC (Garner and Large, 1994) cDNAs. The

α7- and α3-nAChR subunit primer pairs both amplify products within non-conserved

regions of their respective cytoplasmic domains, located between transmembrane

segments III and IV (Schoepfer et al., 1990). The trkB and AChR subunit primers were

optimized for amplification and the reactions performed in the linear range of the assay

(25-29 cycles). PCR products were separated on 1.0% agarose gels stained with

ethidium bromide. Identical reactions lacking RT served as controls for possible

57

amplification of genomic DNA and were consistently negative. Changes in the levels of

α7 and α3 mRNAs in response to BDNF treatment were estimated semi-quantitatively

after digitizing gel images using Kodak 1D Image Analysis software (Eastman Kodak,

Rochester, NY) from the ratio of PCR product intensities to those of βA from the same

cultures.

Real Time PCR. Changes in α7- and α3-nAChR subunit mRNA levels induced by

BDNF were confirmed using RT-based real time PCR. cDNA samples corresponding to

50 ng of input RNA were combined with Taqman universal PCR master mix (Roche,

Branchburg, NJ), F and R primers (0.4 µM), and Taqman probe (0.1 µM) [with 6-FAM

(carboxyfluorescein, reporter dye) and TAMRA (tetramethylrhodamine, quencher dye)

inserted at 5’ and 3’ ends, respectively]. Selection of the following primers and probes

was optimized using Applied Biosystems Primer-Express software, with α7- and

α3-nAChR subunit primers chosen to amplify regions within transmembrane segments III

and IV, and span intron-exon boundaries (Schoepfer et al., 1990):

α7-nAChR subunit (Couturier et al., 1990a)

F: C1020CATGATTATTGTTGGCCTCTCT1042,

R: T1210CGGCCCTGTTTATGTTGAC1190

Probe: A1115GAGTCATCCTTCTGAATTGGTGTGCTTGGT1145

α3-nAChR subunit (Couturier et al., 1990b)

F: G1178CAGCTGCTGCCAGTACCA1196

58

R: A1398ATGACCATGGCAACATATTTCC1376

Probe: T1216TCAGTGGCAATCTCACAAGAAGTTCCAGC1245

GAPDH (Stone et al., 1985)

F: C1795CGTCCTCTCTGGCAAAGTC1814

R: A2374ACATACTCAGCACCTGCATCTG2352

Probe: A2211TCAATGGGCACGCCATCACTATCTTCC2228

Twenty five µl PCRs were performed in triplicate using a GeneAmp 5700 sequence

detection system (Applied Biosystems, Forster City, CA). This system allows the

increase in PCR product to be monitored directly based on the threshold number of cycles

(CT) required to produce a detectable change in fluorescence (ΔF) resulting from the

release of probe. Relative levels of α7- and α3-nAChR cDNA (Rα7,Rα3) in control and

BDNF-treated cultures were calculated from the difference in CT values (ΔCT = CTcontrol

– CTBDNF) for α7 or α3 amplifications (ΔCTα7, ΔCTα3) compared with those for the

housekeeping gene, GAPDH (ΔCTGAPDH) using

Rα = (EαΔCTα ) /(EGAPDH

ΔCTGAPDH ) (1).

In Equation 1, Eα and EGAPDH are the real time PCR amplification efficiencies determined

in separate studies from the slope of CT versus input log cDNA dilution where E =

10-1/slope. E values for amplifying α7, α3, and GAPDH cDNAs were 2.10, 2.10, and 2.23,

respectively.

59

Immunocytochemistry. A polyclonal antibody generated against the extracellular

domain of chicken trkB (#R22781) that does not recognize trkA or trkC (von Bartheld et

al., 1996) was generously provided by Dr. Frances Lefcort (Montana State University).

Polyclonal antibody recognizing Ser133-phosphorylated cAMP response element binding

protein (p-CREB) was purchased from Cell Signaling Technology (Beverly, MA).

Ciliary and dorsal root ganglia (DRG) were fixed for 1-4 h in 4% paraformaldehyde

prepared in 0.15 M phosphate buffered saline at pH 7.4 (PBS), washed in PBS,

cryoprotected in PBS containing 30% sucrose, embedded in OCT (Miles Laboratories,

Elkhardt, IN), cryosectioned at 10 µm, and mounted on glass slides. After rehydration,

sections were blocked for 1 h at RT in 30 mM Tris and 150 mM NaCl containing 0.4%

Triton X100, 1% glycine, 10% goat serum, and 3% bovine serum albumin. trkB

antibody was applied to sections in blocking solution containing 4% goat serum (1:1000,

4°C, 16h), and after washing, secondary antibody (AlexaFluor594-conjugated anti-rabbit

IgG, Molecular Probes, Eugene, OR) was applied in the same solution (1:400, 22°C, 1h).

Sections were then washed, dipped in distilled water and mounted in Vectashield (Vector

Laboratories, Burlingame, CA). Acutely dissociated CG neurons or CG neuron cultures,

both on glass coverslips, were fixed for 0.5-1.0 h in 2-4% paraformaldehyde and blocked

in PBS containing 10% donkey or goat serum. Coverslips were then incubated in trkB

antibody (1:2000, 37°C, 2 h) treated with Cy3-conjugated anti-rabbit IgG (Jackson

Biolabs, Bar Harbor, ME; 1:400, 1h, 37°C) in PBS containing 5% serum, washed and

mounted. A similar protocol was followed for phospho-CREB immunostaining except

60

that the block and wash buffers contained 0.1% TritonX-100, p-CREB antibody was

applied (1:400, 4°C, 16 h) and the secondary antibody was AlexaFluor488-conjugated

anti-rabbit IgG (1:400, 22°C, 1 h).

Image Analysis. Immunostained preparations were viewed using epifluorescence

microscopy (Olympus BX50, UplanFL 40X, 0.75 N.A. objective), and images acquired

and processed using a SenSys KAF-1400 cooled digital CCD camera under the control of

IP Lab software (Version 3.6 Scanalytics; Reading, PA) as described previously (Chen et

al., 2001). Neurons were considered p-CREB positive if the mean fluorescence intensity

of pixels in an elliptical region of interest (ROI) superimposed over the nucleus exceeded

that of the ROI when placed over cytoplasm by >15%.

ELISAs. The presence of BDNF in chicken tissue homogenates and tissue culture

medium components was assessed using a commercial BDNF sandwich ELISA kit having

no significant cross-reactivity with NGF, NT4/5 or NT3 (Chemikine, Chemicon

International, Temecula, CA). The ELISA uses rabbit polyclonal antibodies (raised

against human BDNF) to capture BDNF from the sample, and a biotinylated mouse

monoclonal antibody to detect the captured BDNF. Since mammalian and chicken

BDNF share all but 7 amino acids, with the mismatches distributed along the entire length

of the peptide (Isackson et al., 1991), the kit antibodies likely recognize chicken BDNF.

Nevertheless, we refer here to detection of “BDNF-like protein”, with levels quantified

61

within the linear range of the assay (7.8 to 500 pg/ml) using recombinant human BDNF as

standard.

α−Bungarotoxin (αBgt) Binding. CG neurons were plated at 1-2 ganglion equivalents

per well and grown in culture wells for 4-5 d. Neurons in triplicate culture wells were

washed twice in MEMhs, incubated in MEMhs containing 10 nM [125I]-αBgt (Specific

activity = 130-140 Ci/mmol, Perkin Elmer, Boston, MA) for 1 h at 37°C, and then washed

3X with MEMhs. We previously showed that these conditions are sufficient to saturate

surface αBgt sites on dissociated CG neurons (McNerney et al., 2000). Nonspecific

binding was determined in parallel wells by including 100 µM d-tubocurarine with 10 nM

[125I]-αBgt. After labeling and washing, the wells were scraped in 500 µl 0.6N NaOH,

the solution collected, and [125I]-αBgt radioactivity determined using a Beckman G-5500

gamma counter (Beckman Instruments, Fullerton, CA).

Electrophysiology. Whole-cell recordings were obtained at 21-23°C from CG neurons

after 3-5 d in culture. Patch pipettes were fabricated from Corning 8181 glass tubing

(WPI, Inc., Sarasota, FL), filled with (in mM) 145.6 CsCl, 1.2 CaCl2, 2.0 EGTA, 15.4

glucose, and 5.0 Na-HEPES (pH 7.3) and had tip impedances of 2-3 MΩ. To induce

nAChR currents, neurons were bathed in RShs, held at -70 mV, and 20 µM nicotine (Nic)

applied in RS by rapid pressure miroperfusion (at 10-12 psi) from a delivery pipette (4-6

µm tip diameter) positioned ≈5-10 µm from the neuron soma. We previously showed

that fast-onset, rapidly-desensitizing α7-nAChR-mediated whole-cell currents induced by

62

20 µM Nic in this manner are indistinguishable in amplitude from those obtained using

fast piezoelectric switching (Nai et al., 2003). The fast (α7-nAChR-mediated) and

slower (α3*-nAChR-mediated) decaying current components induced by 20 µM Nic were

identified and analyzed using Clampfit (pClamp 6.0 or 8.0, Axon Instruments,

Burlingame, CA) as previously described (Nai et al., 2003). For analysis, peak

Nic-induced response component amplitudes (pA) were normalized to neuron soma

membrane capacitance (pF). To quantify BDNF effects, whole-cell Nic responses

(pA/pF) obtained from treated neurons were normalized to those for control neurons from

the same cultures. To assess synaptic function, sEPSCs were acquired at -70 mV for 2-5

min, without stimulation, as previously described (Chen et al., 2001). For these

experiments, horse serum was sometimes omitted from the recording solution, without

discernable effect on the results. Synaptic current frequency and amplitude analyses

were subsequently performed using either BASIC-23 programs written in-house, or

commercially available software (Mini Analysis 5.6.12, Synaptsoft Inc., Decatur, GA).

Briefly, sEPSC frequency values obtained from BDNF-treated neurons were normalized

to those from control neurons from the same culture platings. In addition, sEPSCs were

extracted from selected records displaying >50 non-overlapping events, and the

component amplitude and decay time constant values pooled for control and

BDNF-treated neurons.

63

Statistics. All parameter values are expressed as mean ± S.E.M. Unless indicated

otherwise, the statistical significance of paired and unpaired numerical comparisons was

determined using the appropriate two-tailed t-test (p<0.05).

Results

Expression of trkB mRNA and protein. PCR primers specific for kinase-containing

(K+) full-length trkB (Garner et al., 1996) amplified a ≈700 bp product from both E8 and

E14 CG cDNA templates (Fig. 1a, b). The CG product size was consistent with that

predicted for chicken trkB (713 bp) (Garner et al., 1996) and indistinguishable from that

obtained in amplifications from E15 DRG, previously shown to express abundant trkB

mRNA (Hallbook et al., 1995) and protein (Anderson, 1999; Rifkin et al., 2000). In

addition, trkB products from E14 CG and E15 DRG yielded identical restriction profiles

after digestion with BamHI (not shown) or HbaII (Fig. 1c) with fragment sizes as

predicted for digestion of K+ trkB cDNA (Dechant et al., 1993a). Truncated trkB

isoforms lacking the kinase domain (K-) but containing variable juxtamembrane insertions

are also expressed in the chicken nervous system (Garner et al., 1996), and K- specific

primers amplified products of expected sizes (≈ 400, 500, and 600 bp) from both DRG and

CG (Fig. 1a, b). In each case, the PCR amplifications from DRG and CG sources were

specific for cDNA in the sense that they were absent when the synthesis reaction lacked

RT (not shown). While the significance of the truncated trkB transcripts was not studied

here, the results demonstrate that both truncated and full-length trkB transcripts are

expressed in CG during E8-E14, a developmental window when nicotinic synapses

64

formed on the neurons undergo substantial structural and functional maturation

(Landmesser and Pilar, 1972, 1974a).

The presence of trkB protein on CG neurons was demonstrated by fluorescence

immunolabeling (Fig. 2) using an antibody that recognizes the extracellular domain of

chicken trkB (but not trkA or trkC; (von Bartheld et al., 1996). Specific trkB labeling,

similar to but somewhat less intense than that seen for E15 DRG sections, was evident in

both E8 and E14 CG sections (Fig. 2a, b, c, f) and was localized to the neuron surface

where it increased between the two developmental ages. In CG neuron cultures, the

somata and processes of neurons displayed specific trkB labeling that became more

extensive and intense between 8 h and 4 d in culture (Fig. 2d, e, g) a period when

functional synapses are formed and increase in activity (Chen et al., 2001). At 4 d in

culture, about 80% of CG neurons scored positive for trkB immunoreactivity. These

findings demonstrate that trkB protein is expressed by CG neurons and, because

dissociated neurons in acute and culture preparations were not permeablized, indicate that

a substantial fraction is localized on the cell surface. Taken together, the mRNA and

protein studies further suggest that catalytically-competent, high-affinity BDNF receptors

are present in the ganglion, and that their expression on CG neurons increases during

periods of synaptic differentiation both in vivo and in cell culture.

Functional relevance of BDNF and trkB. In order to be relevant in vivo, endogenous

BDNF should both be present in the CG and be able to elicit trk-dependent signaling in the

65

neurons. Since BDNF detected in spinal cord ventral horn results from both local

synthesis and retrograde transport to motor neurons from striated muscle (Koliastsos et al.,

1993) we tested for the presence of BDNF both in CG and in the iris, a ciliary neuron

target which like the ciliary body is largely striated muscle in birds (Marwitt et al., 1971).

Using a commercial ELISA, we detected BDNF-like protein in E14 iris muscle as well as

in E14 and in E8 CG (Fig. 3a). The assay failed to detect BDNF in 10% heat inactivated

horse serum or whole eye extract, routinely used at 10% and 3%, respectively, as

supplements to CG culture medium. The assay also failed to detect BDNF-like protein in

intact chicken serum. Relevant to our culture experiments, we presume that dilution of

BDNF derived from the iris and ciliary muscle during eye extract preparation reduces its

concentration below the detection limit of the assay (7.8 pg/ml). BDNF-like protein

present in E8 and E14 CG may be the source of the strong BDNF immunoreactivity

previously reported at the same developmental ages for accessory occulomotor neurons

(Steljes et al., 1999) which provide preganglionic input to the CG. In addition to arriving

by retrograde transport from the intraocular muscle targets, however, the BDNF-like

protein present in the CG may also result from local synthesis, since BDNF mRNA was

detectable by RT-PCR in E8 and E14 ganglia and in CG neurons maintained in standard

culture medium for 4 d (Fig. 3b).

To determine if the trkB protein expressed on CG neurons represents functional receptor,

we tested the ability of applied BDNF to cause phosphorylation of CREB, a cAMP- and

Ca2+-regulated transcription factor (reviewed in (Impey et al., 1996); (Greenberg and Ziff,

66

2001; Deisseroth et al., 2003) whose activation is a hallmark of trk-dependent

neurotrophin signaling (Finkbeiner et al., 1997) (Fig. 4). For this purpose, CG neurons

grown in culture for 4-5 d were challenged with BDNF (100-200 ng/ml, 10-15 min) or, as

a positive control, with pituitary adenylate cyclase activating polypeptide (PACAP, 100

nM, 10-15 min) previously shown to cause robust increases in intracellular cAMP and

Ca2+ (Margiotta and Pardi, 1995; Pardi and Margiotta, 1999) and then tested the cultures

for p-CREB immunoreactivity. A similar immunocytochemical approach was

previously shown to provide a convenient all-or-none assay for CREB activation in single

hippocampal neurons (Hu et al., 2002). After treatment with BDNF 49 ± 6% of 321 CG

neurons from 18 fields (N=321, 18) scored as p-CREB positive, compared with 99 ± 2%

(N=132, 9) after PACAP treatment, and 3 ± 2% (N=179, 10) in untreated control cultures

assayed in parallel (Fig. 4a-d, g). Consistent with a requirement for trkB signaling, the

proportion of p-CREB positive neurons induced by BDNF dropped to control levels (1 ±

1%, N=114, 6) following 1 h preincubation and 15 min co-treatment with K252a (Fig. 4e,

g), a trk-selective tyrosine kinase inhibitor (Pizzorusso et al., 2000). Preincubation (1 h)

and 15 min co-treatment with PD98059, a MEK1 inhibitor that blocks the

neurotrophin-activated, RAS-dependent signaling pathway leading to CREB activation

(Ying et al., 2002) similarly reduced the proportion of p-CREB positive neurons induced

by BDNF to 3 ± 2% (N=85, 6) (Fig. 4f, g). The observation that 51% of neurons showed

no detectable response to BDNF in this assay cannot be explained by limited CREB

availability since nearly all nuclei were immunoreactive following PACAP treatment.

The difference might instead reflect suboptimal BDNF treatment times or heterogeneity of

67

functional trkB expression levels. In either case, the protein and p-CREB assays (Figs. 3

and 4) demonstrate that an endogenous source of BDNF-like protein is present in the

parasympathetic CG where it is poised to activate functionally competent trkB receptors

present on the neurons and thereby recruit appropriate signal pathways leading to CREB

activation.

BDNF upregulates α7-nAChRs. Since neurotrophins are not required for full survival

of CG neurons, we examined possible roles for BDNF/trkB signaling in regulating the

components and function of nicotinic synapses on the neurons. α7-nAChRs were

assessed as potential targets of BDNF/trkB signaling because they can rapidly modulate

transmission (McGehee et al., 1995; Gray et al., 1996; Wonnacott, 1997; Margiotta and

Pugh, 2004), an action resembling the increased synaptic efficacy produced by BDNF

(reviewed by (McAllister et al., 1999; Schnider and Poo, 2000; Poo, 2001). αBgt binds

with high affinity to α7-nAChRs (Couturier et al., 1990a) and [125I]-αBgt was therefore

used to quantify numbers of surface α7-nAChRs on CG neurons (Fig. 5a) as previously

described (McNerney et al., 2000). In CG neuron cultures grown with BDNF for varying

times prior to assay at 5 d, [125I]-αBgt binding was unchanged relative to control cultures

after 4 h exposure, but increased nominally (24%) after 16 h. Extending the treatment

time to the full 5 day culture period resulted in levels of αBgt binding that were

significantly higher (62 ± 10%, p<0.01) in CG cultures exposed to BDNF relative to

control cultures assayed in parallel (N=10 for both). Actual levels of [125I]-αBgt bound

in control cultures and cultures treated with BDNF for 5 d were 3.9 ± 0.2 and 6.0 ± 0.4

68

fmol per CG equivalent, respectively. In principle, the increased levels of α7-nAChRs

seen after exposure to BDNF could have been caused by activation of either trkB or the

low-affinity neurotrophin receptor (p75NTR) that is also present on CG neurons (Lee et al.,

2002). The latter possibility is unlikely, however, since an identical elevation (62 ± 14%,

N=3) was observed when BDNF was co-applied for 5 d with ChEX, a polyclonal antibody

that recognizes and blocks chicken p75NTR but not trk function (Wescamp and Reichardt,

1991). The ability of long-term BDNF exposure to up-regulate α7-nAChRs may reflect

increased α7-nAChR subunit gene expression since levels of α7-nAChR subunit relative

to βA mRNA, determined by semi-quantitative RT-PCR, were elevated significantly (by

53 ± 10%) in cultures treated with BDNF for 4-5 d compared to untreated control cultures,

tested in parallel (N=6 each, Fig. 5b). As with the protein assays, BDNF also increased

α7-nAChR subunit mRNA in cultures with p75NTR blocked by co-application with ChEX

(41 ± 15%, N=3). Using real time PCR a similar 98 ± 26% (N=5) increase in α7-nAChR

subunit relative to GAPDH mRNA was observed (Fig. 5c). In both cases, the

BDNF-induced increases in α7-nAChR subunit mRNA were selective in the sense that

identical treatments failed to significantly alter α3-nAChR subunit mRNA levels (Fig 5b

and c).

Having demonstrated that BDNF induces trk-dependent increases in levels of α7-nAChR

protein and mRNA in CG neurons, we next sought to determine if the same treatments

also enhanced α7-nAChR-mediated currents. Rapid application of nicotine (Nic, 20 µM)

to CG neurons grown in culture induces a whole-cell current response featuring an initial

69

fast-desensitizing component that is blocked by αBgt (Fig. 6a) and hence mediated by

α7-nAChRs (Pardi and Margiotta, 1999; McNerney et al., 2000; Nai et al., 2003). While

65 ± 5% (N=80 neurons, 5 platings) of CG neurons grown in standard culture medium

displayed rapidly-decaying, α7-nAChR mediated currents, BDNF treatment for 3-4 d

increased the proportion to 83 ± 4% (N=76, 5). In such cases, the peak α7-nAChR

current values relative to membrane capacitance (Ifast/Cm, pA/pF) were 49 ± 14% (N=63,

5) larger for neurons from cultures treated with BDNF compared to untreated controls

(N=52, 5) tested in parallel (Fig. 6b, c). Consistent with the time course for up-regulation

of surface α7-nAChRs seen in the [125I]-αBgt binding studies, BDNF treatments for 10-30

min or 16-24 h produced only nominal increases in Ifast/Cm relative to untreated controls

tested in parallel (Fig. 6c and data not shown, p>0.05 for both). The slowly decaying

component of the Nic-induced current is mediated largely by heteromeric α3*-nAChRs

(Nai et al., 2003) that contain α3, α5, β4, and occasionally β2 subunits, but lack α7

subunits (Vernallis et al., 1993; Conroy and Berg, 1995) and are insensitive to αBgt (Fig.

6a). The ability of BDNF to increase Ifast/Cm was specific for α7-nAChRs since slow

currents (Islow/Cm) attributable to α3*-nAChRs and present in all neurons, were unchanged

following exposure to BDNF for 10-30 min, 16-24 h or 4-5 d (Fig. 6c and data not shown).

In addition, the 4-5 d BDNF treatments had no discernable effects on membrane

capacitance or the voltage sensitivity or maximal values of voltage-activated Na+ or Ca2+

currents (data not shown). In summary, the size, latency, and specificity of the increased

α7-nAChR current responses seen after chronic BDNF treatment are consistent with the

70

BDNF-activated trkB dependent up-regulation of α7-nAChR mRNA and protein that

occur over a similar time course.

BDNF increases activity at nicotinic synapses. Functional synapses form between CG

neurons in culture (Margiotta and Berg, 1982) and display spontaneous, impulse-driven

nicotinic EPSCs (sEPSCs, e.g. Fig. 7). We previously demonstrated that while

α7-nAChRs contribute to the sEPSCs, the vast majority require α3*-AChRs since

αConotoxin-MII, which blocks α3*- but not α7-nAChRs on CG neurons (Nai et al., 2003)

reduced sEPSC frequency by 95% (Chen et al., 2001). Exposure to BDNF substantially

increased the overall frequency of sEPSCs (Fig. 7), most of which display slow decay

kinetics indicative of a major contribution from α3*-nAChRs (Chen et al., 2001). After

16-24 h BDNF treatment, sEPSC frequency increased nearly 3-fold (2.69 ± 0.35, N=46)

relative to untreated control neurons from the same five cultures tested in parallel (1.00 ±

0.17, N=39), with a smaller yet significant increase seen after 4-5 d treatment (Fig. 7a, b).

This effect is reminiscent of that seen at other synapses where BDNF increases EPSC

frequency by a presumed presynaptic mechanism (McAllister et al., 1999; Schnider and

Poo, 2000; Poo, 2001) (See below). To determine if BDNF also altered sEPSC

amplitudes, well-separated individual synaptic currents were extracted from selected

records and components mediated by α7- and α3*-nAChRs identified by their diagnostic

fast and slow decay kinetics, as previously described (Chen et al., 2001). The amplitudes

of fast, α7-nAChR-mediated sEPSCs identified in this manner increased following 16-24

h BDNF treatment (Fig. 7d), shifting by 32% from a median value of -9.6 pA in controls to

71

-12.7 pA in BDNF-treated cultures (N=4 neurons each, p<0.0004, Mann-Whitney and

Kolmogorov-Smirnov tests). The effect was selective for α7-nAChR mediated sEPSCs

since, despite increasing in frequency, slow α3*-nAChR-mediated sEPSCs displayed

amplitudes that were unchanged by BDNF treatment (Fig. 7e). Recent studies indicate

that chronic exposure to BDNF increases the proportion of postsynaptic α7-nAChR

clusters on hippocampal neurons (Kawai et al., 2002). Since α3*-nAChR mediated

sEPSC amplitudes were unchanged, a similar postsynaptic accumulation of α7-nAChRs

may also explain the larger amplitude fast sEPSCs seen here after 16-24 h exposure to

BDNF.

While significant and α7-nAChR-selective, the changes in fast sEPSC amplitudes

following 16-24 h BDNF treatment were small in comparison to the accompanying 3-fold

increase in the frequency of (largely) α3*-nAChR mediated sEPSCs. Studies in other

systems suggest that this latter, more dramatic effect is likely to be presynaptic in origin,

possibly resulting from changes in intracellular Ca2+ dynamics that alter quantal release

(Pozzo-Miller et al., 1999; Tyler et al., 2002). Interestingly, presynaptic α7-nAChRs

enhance neurotransmitter release, and are known to do so by elevating terminal Ca2+ levels

(Gray et al., 1996; Coggan et al., 1997) possibly through Ca2+-induced Ca2+-release

(CICR) recently shown to increase EPSC frequency (Sharma and Vijayaraghavan, 2003).

Since CG neurons in culture express Ca2+-permeable α7-nAChRs on neurite tips (Pugh

and Berg, 1994) and activation of CICR markedly enhances sEPSC frequency (Chen and

Margiotta, unpublished) we wondered if up-regulation of presynaptic α7-nAChRs might

72

underlie the ability of BDNF to increase sEPSC frequency. This hypothesis predicts that

BDNF applied for 10-30 min should not increase sEPSC frequency since brief exposures

were insufficient to increase surface α7-nAChR levels or somatic α7-nAChR currents

(Figs. 5 and 6). In accord with results from other systems (McAllister et al., 1999;

Schnider and Poo, 2000; Poo, 2001) however, brief exposure to BDNF induced a

significant, K252a-sensitive increase in sEPSC frequency (Fig. 7c, left), thereby

demonstrating an expected trk dependence, but arguing against a requirement for rapid

α7-nAChR modulation. Because α7-nAChRs at somatic and presynaptic sites could

differ in their acute responsiveness to BDNF, we devised a more direct test, blocking

α7-nAChRs with αBgt and comparing sEPSCs in cultures treated with or without

co-applied BDNF. Even with αBgt present to block α7-nAChRs, however, BDNF

applied for 16-24 h was still able to increase sEPSC frequency (Fig. 7c, right), with all

events now displaying slow decay kinetics indicative of α3*-nAChRs. These results

indicate that brief- (10-30 min) and intermediate-duration exposures to BDNF (16-24 h)

can increase sEPSC frequency and do so without a requirement for α7-nAChRs.

Nevertheless, α7-nAChRs are strongly implicated in long-term synaptic regulation (Role

and Berg, 1996; MacDermott et al., 1999; Liu et al., 2001; Kawai et al., 2002). Thus

since 4-5 d BDNF treatments also increased sEPSC frequency and were required to detect

significant changes in α7-nAChRs, we cannot exclude the possibility that chronic

neurotrophin exposure sustains the long-term function of neuronal nicotinic synapses in

ways that somehow depend on α7-nAChRs.

73

Discussion

Detection of trkB and BDNF

We have shown that trkB and BDNF-like proteins are present in the chick CG, a model

parasympathetic system, where both trks and neurotrophins were presumed irrelevant.

No other studies have attempted to detect trkB protein in CG, however, previous Northern

and ribonuclease protection analyses failed to detect trkB mRNA (Dechant et al., 1993a;

Hallbook et al., 1995) possibly because of the lower sensitivity of these assays compared

to RT-PCR. Standard criteria for trkB primer (Garner and Large, 1994); (Garner et al.,

1996) and antiserum specificity (von Bartheld et al., 1996), as well as controls involving

primer and primary antiserum omission (this study) support our detection of trkB mRNA

in CG, and cell surface trkB protein on CG neurons. In addition, the observations that

BDNF elicits trk-dependent signaling leading to CREB activation and trk-dependent

changes in α7-nAChRs and synaptic function further indicate that CG neurons express

functional trkB. Since the trkB antiserum used recognizes an extracellular epitope (von

Bartheld et al., 1996), and PCR amplifications using F/RK- primers revealed the presence

of isoforms lacking an intracellular kinase domain, however, some trkB immunoreactivity

may represent truncated receptor. While the role of kinase-deficient trk isoforms is

poorly understood, the notion they are expressed on CG neurons is strengthened by the

observation that in 50% of neurons BDNF application failed to induce pCREB, a process

expected to require trkB kinase activity (Finkbeiner et al., 1997; Huang and Reichardt,

2003). In such cases, full-length trkB receptors may still be present but either rendered

functionally incompetent or expressed at levels insufficient to activate CREB since

74

truncated trk isoforms have been reported to inhibit both the function and expression of

full-length receptors (reviewed by (Huang and Reichardt, 2003).

BNDF/trkB signaling up-regulates α7-nAChRs

BDNF treatment for 4-5 d induced trk-dependent increases in α7 subunit mRNA, and

surface α7-nAChRs, and enhanced α7-nAChR-mediated whole-cell currents, all without

changing levels of α3 subunit mRNA or α3*-nAChR-mediated currents. Similarly, NGF

has been shown to selectively increase expression of α7- over α3-nAChR subunit mRNA

in sympathetic neuron-like PC12 cells (Takahashi et al., 1999). Although alterations in

receptor turnover rates and mRNA stability may contribute, a straightforward

interpretation of our results is that BDNF activation of trkB leads to increased α7-nAChR

subunit transcription and protein synthesis, thereby increasing levels of assembled

cell-surface receptor. One way BDNF/trkB signaling may influence α7-nAChR subunit

transcription is through activation of transcription factors including not only CREB

(Finkbeiner et al., 1997), but also AP-1, or NF-κB, which like CREB are reported to be

stimulated by BDNF/trkB signaling (Gaiddon et al., 1996; Lipsky et al., 2001). CRE

binding sites are present in promoter-containing regions of human and bovine α7-nAChR

subunit genes, although in the chicken gene a 1298 bp 5’ segment with a basal promoter at

-406 to -230 was previously reported to lack a strong consensus CRE binding site

(Matter-Sadzinski et al., 1992; Gault et al., 1998). Within this same 5’ region, however, a

new search of two transcription factor databases (TRANSFAC; (Heinemeyer et al., 1998),

www.rwcp.or.jp/papia/ and Matinspector, www.genomatix.de) did reveal a potential (-)

75

strand CRE binding site (T-1060GACcTAA-1067) upstream from the basal promoter.

Potential binding sites for AP-1 (T-715TcACTCAG-708) and NF-kappaB

(G-176GGGgcTCCC-167) were also predicted in the 5’-flanking and basal promoter regions,

respectively. These considerations suggest that BDNF/trkB signaling can regulate the

chicken α7-nAChR subunit gene via CRE, AP-1, or NF-κB. Without experimental data,

however, it is difficult to judge the significance of these transcription factors as direct

regulators. Here, it should be noted that binding sites for Egr-1, Sp1, and Sp3,

transcription factors not associated with BDNF/trkB signaling, are thought to regulate the

activity of the rat α7-nAChR promoter (Nagavarapu et al., 2001).

BNDF increases activity at nicotinic synapses on CG neurons

BDNF increased sEPSC frequency after acute (10-30 min), intermediate (16-24 h) or

long-term (4-5 d) treatments. The increased sEPSC frequency following acute BDNF

exposure depended on trkB activation, and resembled that seen at other peripheral and

central synapses, where enhanced transmitter release from presynaptic terminals is

implicated (McAllister et al., 1999; Schnider and Poo, 2000; Poo, 2001). The basis of the

acute synaptic effects seen here and in these other systems is unknown, but seems likely to

reflect BDNF actions on Ca2+ (Berninger et al., 1993; Stoop and Poo, 1996); (Li et al.,

1998) and vesicular dynamics (Pozzo-Miller et al., 1999); Tyler et al., 2002) in

presynaptic terminals that enhance neurotransmission reliability. The compelling

possibility that Ca2+-permeable, presynaptic α7-nAChRs underlie these effects (e.g. (Gray

et al., 1996; Coggan et al., 1997; Sharma and Vijayaraghavan, 2003) is unlikely, however,

76

because acute BDNF exposure failed to modulate somatic α7-nAChR currents and, more

telling, because co-incubation with αBgt failed to block the ability of BDNF to increase

sEPSC frequency. Also unlikely are general effects on membrane excitability as seen for

PC12 cells (e.g. (Rudy et al., 1987; Lesser et al., 1997) because BDNF treatments failed to

detectably change the amplitude or voltage-sensitivity of somatic Na+ or Ca2+ currents.

In addition to increasing overall sEPSC frequency 3-fold, 16-24 h BDNF treatments

specifically increased the amplitude of α7-nAChR-mediated sEPSCs. While we cannot

exclude increased quantal release at presynaptic nerve terminals that contact only

α7-nAChR clusters, this effect seems more likely to be postsynaptic in origin. Unlike

currents induced by rapid nicotine microperfusion, which represent nAChR function

integrated over the entire soma and report only a nominal increase, sEPSCs are focal

events and an increase in their amplitude would be expected even after adding a few

functional receptors in the postsynaptic membrane. The increase in α7-nAChR-mediated

sEPSC amplitudes agrees well with the increased postsynaptic α7-nAChR clusters

previously observed in hippocampal neuron cultures (Kawai et al., 2002) and with the

nominal increase in [125I]-αBgt binding seen here after 16-24 h exposure to BDNF and the

significant increase seen after 5 d. The elevated sEPSC amplitude could reflect increased

α7-nAChR synthesis, and/or preferential insertion at existing postsynaptic sites, but we

cannot presently distinguish between these possibilities.

77

Long-term synaptic enhancement

Our findings indicate that acute- and intermediate-term BDNF treatments increased

synaptic activity without a requirement for α7-nAChRs. Chronic (4-5 d) BDNF

treatments continued to enhance synaptic activity, however, and, in parallel, significantly

increased α7-nAChR levels and whole-cell currents. α7-nAChRs have been linked to

activity-dependent neurite outgrowth and other developmental processes (reviewed by

(Margiotta and Pugh, 2004) that may normally help ensure appropriate synaptogenesis or

sustain existing functional synapses once formed (reviewed by (Role and Berg, 1996;

Broide and Leslie, 1999; Jones et al., 1999). In addition, BDNF has been shown to have

potent long-term effects on synaptic development and maintenance in other systems

(reviewed by (Poo, 2001). Thus while further experiments are needed, it remains

possible that, in contrast to short- and intermediate-term α7-nAChR-independent effects,

the ability of BDNF/signaling to sustain long-term synaptic function is related somehow

to coincident regulation of α7-nAChRs.

In-vivo relevance?

Our results do not directly address the relevance of signals generated by BDNF through

trkB for CG neurons in vivo. That targets and target-derived factors influence the

survival, growth and differentiation of input neurons, however, has been recognized for

decades (Berg, 1984; Levi-Montalcini, 1987). Specific to this report, previous studies

demonstrated that synapses on CG neurons undergo patterned maturation between E8 and

78

E18, and that normal neuron survival and ganglionic transmission require connection to

the intraocular muscle targets (Landmesser and Pilar, 1974a, b). More recent

experiments indicate that α7-subunit mRNA, and α7-nAChR protein and currents all

increase during the same developmental period (Corriveau and Berg, 1993; Blumenthal et

al., 1999) and that severing peripheral target connections reduces levels of α7-mRNA and

protein (Brumwell et al., 2002). Given the importance of target connections in sustaining

α7-nAChRs and synapses, the presence of BDNF-like protein in the iris target suggests it

may influence synaptic properties of CG neurons during development in vivo. The

precise spatial and temporal patterns of BDNF and trkB expression still need to be

determined. Our PCR and ELISA results suggest, however, that BDNF is both

synthesized within the CG, perhaps by the neurons themselves, and transported to the

ganglion from the iris muscle. Such local BDNF expression and retrograde transport

from the target are consistent with the arrangement in spinal cord (Koliastsos et al., 1993)

and would concentrate BDNF in the iris and CG relative to its levels in eye extract, as was

observed here. In addition to BDNF, NGF and NT-3 signaling may also be important in

the CG system since recent findings indicate mRNAs for trkA and trkC are expressed in

the ganglion, and CG neurons express trkA and trkC immunoreactivity (Dittus et al.,

2002). Experiments are in progress to reassess the ability of NGF, NT-3, and BDNF to

promote CG neuronal survival, and to identify their respective roles in regulating nAChR

expression and nicotinic synaptic differentiation on these parasympathetic neurons.

79

References

Anderson DJ (1999) Lineages and transcription factors in the specification of vertebrate

primary sensory neurons. Current Opinion in Neurobiology 9:517-524.

Berg DK (1984) New neuronal growth factors. Annu Rev Neurosci 7.

Berninger B, Garda DE, Inagaki N, Hahnel C, Lindholm D (1993) BDNF and NT-3

induce intracellular Ca2+-elevation in hippocampal neurons. Neuroreport

4:1303-1306.

Blumenthal EM, Shoop RD, Berg DK (1999) Developmental changes in the nicotinic

responses of ciliary ganglion neurons. J Neurophysiol 81:111-120.

Broide RS, Leslie FM (1999) The a7 nicotinic receptor in neuronal plasticity. Molecular

Neurobiology 20:1-16.

Brumwell CL, Johnson JL, Jacob MH (2002) Extrasynaptic a7-nicotinic acetylcholine

receptor expression in developing neurons is regulated by inputs, targets, and

activity. J Neuroscience 22:8101-8109.

Burns AL, Benson D, Howard MJ, Margiotta JF (1997) Chick ciliary ganglion neurons

contain transcripts coding for acetylcholine receptor-associated protein at synapses

(Rapsyn). J Neurosci 17:5016-5026.

Causing CG, Gloster A, Aloyz R, Bamji SX, Chang E, Fawcett J, Kuchel G, Miller FD

(1997) Synaptic innervation density is regulated by neuron-derived BDNF.

Neuron 18:257-267.

80

Chen M, Pugh P, Margiotta J (2001) Nicotinic synapses formed between chick ciliary

ganglion neurons in culture resemble those present on the neurons in vivo. J

Neurobiol 47:265-279.

Coggan JS, Paysan J, Conroy WG, Berg DK (1997) Direct recording of nicotinic

responses in presynaptic nerve terminals. J Neurosci 17:5798-5806.

Conroy WG, Berg DK (1995) Neurons can maintain multiple classes of nicotinic

acetylcholine receptors distinguished by different subunit compositions. J Biol

Chem 270:4424-4431.

Corriveau RA, Berg DK (1993) Coexpression of multiple acetylcholine receptor genes in

neurons: quantification of transcripts during development. J Neurosci

13:2662-2671.

Couturier S, Erkman L, Valera S, Rungger D, Bertrand S, Boulter J, Ballivet M, Bertrand

D (1990a) a5, a3, and non-a3: three clustered avian genes encoding nicotinic

acetylcholine receptor-related subunits. JBC 265:17560-17567.

Couturier S, Bertrand D, Matter J-M, Hernandez M-C, Bertrand S, Millar N, Valera S,

Barkas T, Ballivet M (1990b) A neuronal nicotinic acetylcholine receptor subunit

(a7) is developmentally regulated and forms a homo-oligomeric channel blocked

by a-Btx. Neuron 5:847-856.

Dechant G, Biffo S, Okazawa H, Kolbeck R, Pottgiesser J, Barde YA (1993) Expression

and binding characteristics of the BDNF receptor chick trkB. Development

119:545-558.

81

Deisseroth K, Mermelstein PG, Xia H, Tsien RW (2003) Signaling from synapse to

nucleus: the logic behind the mechanisms. Current Opinion in Neurobiology

13:354-365.

Dichter MA, Fischbach GD (1977) The action potential of chick dorsal root ganglion

neurones maintained in cell culture. J Physiol 267:281-298.

Dittus JJ, Pugh PC, Howard MJ, Margiotta JF (2002) Parasympathetic ciliary ganglion

neurons express trks but neurotrophins fail to fully support their survival. Society

for Neuroscience Abstracts 28.

Finkbeiner S, Tavazoie SF, Maloratsky A, Jacobs KM, Harris KM, Greenberg ME (1997)

CREB: A major mediator of neuronal neurotrophin responses. Neuron

19:1031-1047.

Finn TP, Kim S, Nishi R (1998) Overexpression of ciliary neurotrophic factor in vivo

rescues chick ciliary ganglion neurons from cell death. Journal of Neurobiology

34:283-293.

Gaiddon C, Loeffler JP, Larmet Y (1996) Brain-derived neurotrophic factor stimulates

AP-1 and cyclic AMP-responsive element dependent transcriptional activity in

central nervous system neurons. J Neurochemistry 66:2279-2286.

Garner AS, Large TH (1994) Isoforms of the avian TrkC receptor: a novel kinase

insertin dissociates transformation and process outgrowth from survival. Neuron

13:457-472.

82

Garner AS, Menegay HJ, Boeshore KL, Xie X-Y, Voci JM, Johnson JE, Large TH (1996)

Expression of TrkB receptor isoforms in the developing avian visual system. J

Neuroscience 16:1740-1752.

Gault J, Robinson M, Berger R, Drebing C, Logel J, Hopkins J, Moore T, Jacobs X,

Merriwether J, Choi MJ, Kim EJ, Walton K, Buiting K, Davis A, Breese C,

Freedman r, Leonard S (1998) Genomic organization and partial duplication of the

human a7 neuronal nicotinic acetylcholine receptor gene (CHRNA7). Genomics

52:173-185.

Gonzalez M, Ruggiero FP, Chang Q, Shi YJ, Rich MM, Kraner S, Balice-Gordon RJ

(1999) Disruption of Trkb-mediated signaling induces dissasembly of postsynaptic

receptor complexes at nueromuscular junctions. Neuron 24:567-583.

Gray R, Rajan A, Radcliffe K, Yakehiro M, Dani J (1996) Hippocampal synaptic

transmission enhanced by low concentrations of nicotine. Nature 383:713-716.

Greenberg ME, Ziff EB (2001) Signal transduction in the postsynaptic neuron. Activity

dependent regulation of gene expression. In: Synapses, pp 357-391. Baltimore,

MD: Johns Hopkins University Press.

Hallbook F, Backstrom A, Kullander K, Kylberg A, Williams R, Ebendal T (1995)

Neurotrophins and their receptors in chicken neuronal development. Int J Dev Biol

39:855-868.

Hashino E, Shero M, Junghans D, Rohrer H, Milbrandt J, Johnson EM, Jr. (2001) GDNF

and neurturin are target-derived factors essential for cranial parasympathetic

neuron development. Development 128:3773-3782.

83

Heinemeyer T, Wingender E, Reuter I, Hermjakob H, Kel AE, Kel OV, Ignatieva EV,

Ananko EA, Podkolodnaya OA, Kolpakov FA, Podkolony NL, Kolchanov NA

(1998) Databases on transcriptional regulation: TRANSFAC, TRRD, and

COMPEL. Nucleic Acids Res 26:364-370.

Helfand SL, Smith GA, Wessells NK (1976) Survival and development of dissociated

parasympathetic neurons from ciliary ganglia. Developmental Biology

50:541-547.

Henderson LP, Gdovin MJ, Liu C, Gardner PD, Maue RA (1994) Nerve growth factor

increases nicotinic ACh receptor gene expression and current density in wild-type

and kinase A-deficient PC12 cells. J Neuroscience 14:1153-1163.

Hu M, Liu Q-s, Chang KT, Berg DK (2002) Nicotinic regulation of CREB activation in

hippocampal neurons by glutamatergic and nonglutamatergic pathways. Molecular

and Cellular Neuroscience 21:616-625.

Huang EJ, Reichardt LF (2001) Neurotrophins: Roles in neuronal development and

function. Annual Review of Neuroscience 24:677-736.

Huang EJ, Reichardt LF (2003) Trk receptors: roles in neuronal signal transduction.

Annu Rev Biochem 72:609-642.

Impey S, Mark M, Villacres EC, Poser S, Chvkin C, Storm DR (1996) Induction of

CRE-mediated gene expression by stimuli that generate long-lasting LTP in area

CA1 of the hippocampus. Neuron 16:973-982.

84

Isackson PJ, Towner MD, Huntsman MM (1991) Comparison of mammalian, chicken and

Xenopus brain-derived neurotrophic factor coding sequences. FEBS Lett

285:260-264.

Jones S, Sudweeks S, Yakel JL (1999) Nicotinic receptors in the brain: correlating

physiology with function. Trends Neurosci 22.

Kaplan DR, Miller FD (2000) Neurotrophin signal transduction in the nervous system.

Current Opinion in Neurobiology 10:381-391.

Kawai H, Zago W, Berg DK (2002) Nicotinic alpha 7 receptor clusters on hippocampal

GABAergic neurons: regulation by synaptic activity and neurotrophins. J

Neuroscience 22:7903-7912.

Koliastsos VE, Clatterbuck RE, Winslow JW, Cayouette MH, Price DL (1993) Evidence

that brain-derived neurotrophic factor is a trophic factor for motor neurons in vivo.

Neuron 10:359-367.

Krieglstein K, Farkas L, Unsicker K (1998) TGF-beta regulates the survival of ciliary

ganglionic neurons synergistically with ciliary neurotrophic factor and

neurotrophins. Journal of Neurobiology 37:563-572.

Landmesser L, Pilar G (1972) The onset and development of transmission in the chick

ciliary ganglion. J Physiol 222:691-713.

Landmesser L, Pilar G (1974a) Synaptic transmission and cell death during normal

ganglionic development. J Physiol 241:737-749.

Landmesser L, Pilar G (1974b) Synapse formation during embryogenesis on ganglion

cells lacking a periphery. J Physiol 241:715-736.

85

Lee VM, Sechrist JW, Bronner-Fraser M, Nishi R (2002) Neuronal differentiation from

postmitotic precursors in the ciliary ganglion. Dev Biology 252:312-323.

Lesser SS, Sherwood NT, Lo DC (1997) Neurotrophins differentially regulate

voltage-gated ion channels. Mol Cell Neurosci 10:173-183.

Leung DW, Parent AS, Cachianes G, Esch F, Coulombe JN, Nickolies D, Eckenstein FP,

Nishi R (1992) Cloning, expression during development, and evidence for release

o a trophic factor for ciliary ganglion neurons. Neuron 8:1045-1053.

Levi-Montalcini R (1987) The nerve growth factor: thirty-five years later. EMBO J

6:1145-1154.

Lewin GR, Barde YA (1996) Physiology of the neurotrophins. Annual Review of

Neuroscience 19:289-317.

Li Y-X, Zhang Y, Lester HA, Schuman EM, Davidson N (1998) Enhancement of

Neurotransmitter Release Induced by Brain-Derived Neurotrophic Factor in

Cultured Hippocampal Neurons. J Neurosci 18:10231-10240.

Lindsay RM, Thoenen H, Barde YA (1985) Placode and neural crest-derived sensory

neurons are responsive at early developmental stages to brain-derived neurotrophic

factor. Dev Biology 112:319-328.

Lipsky RH, Xu K, Zhu D, Kelly C, Terhakopian A, Novelli A, Marini AM (2001) Nuclear

factor kappaB is a critical determinant in N-methyl-D-aspartate receptor mediated

neuroprotection. J Neurochemistry 78:254-264.

86

Liu Y, Ford B, Mann MA, Fischbach GD (2001) Neuregulins Increase a7 Nicotinic

Acetylcholine Receptors and Enhance Excitatory Synaptic Transmission in

GABAergic Interneurons of the Hippocampus. J Neurosci 21:5660-5669.

Loeb JA, Hmadcha A, Fischbach GD, Land SJ, Zakarian VL (2002) Neuregulin

expression at neuromuscular synapses is modulated by synaptic activity and

neurotrophic factors. Journal of Neuroscience 22:2206-2214.

Lohof AM, Ip NY, Poo M-m (1993) Potentiation of developing neuromuscular synapses

by the neurotrophins NT-3 and BDNF. Nature 363:350-353.

MacDermott AB, Role LW, Siegelbaum SA (1999) Presynaptic ionotropic receptors and

the control of transmitter release. Annu Rev Neurosci 22:443-485.

Maisonpierre PC, Belluscio L, Conover JC, Yancopoulos GD (1992) Gene sequences of

chicken BDNF and NT-3. DNA Seq 3:49-54.

Margiotta J, Pardi D (1995) Pituitary adenylate cyclase-activating polypeptide type I

receptors mediate cyclic AMP-dependent enhancement of neuronal acetylcholine

sensitivity. Mol Pharmacol 48:63-71.

Margiotta J, Pugh P (2004) Nicotinic acetylcholine receptors in the nervous system. In:

Molecular and Cellular Insights to Ion Channel Biology (Maue RA, ed), pp

269-302. Amsterdam: Elsevier B.V.

Margiotta JF, Berg DK (1982) Functional synapses are established between ciliary

ganglion neurons in dissociated cell culture. Nature 296:152-154.

Marwitt R, Pilar G, Weakley JN (1971) Characterization of two cell populations in the

avian ciliary ganglion. Brain Research 25:317-334.

87

Matter-Sadzinski L, Hernandez M, Roztocil T, Ballivet M, Matter J (1992) Neuronal

specificity of the a7 nicotinic acetylcholine receptor promoter develops during

morphogenesis of the central nervous system. EMBO J 11:4529-4538.

McAllister AK, Katz LC, Lo DC (1999) Neurotrophins and synaptic plasticity. Annu Rev

Neurosci 22:295-318.

McGehee D, Heath M, Gelber S, Devay P, Role L (1995) Nicotinic enhancement of fast

excitatory synaptic transmission in CNS by presynaptic receptors. Science

269:1692-1697.

McNerney M, Pardi D, Pugh P, Nai Q, Margiotta J (2000) Expression and channel

properties of a-bungarotoxin-sensitive acetylcholine receptors on chick ciliary and

choroid neurons. J Neurophysiol 84:1314-1329.

Nagavarapu U, Danath S, Boyd RT (2001) Characterization of a rat neuronal nicotinic

acetylcholine receptor a7 promoter. J Biological Chemistry 276:16749-16757.

Nai Q, Mcintosh JM, Margiotta JF (2003) Relating neuronal nicotinic acetylcholine

receptor subtypes defined by subunit composition and channel function. Molecular

Pharmacology 63:311-324.

Nishi R, Berg DK (1981) Two components from eye tissue that differentially stimulate the

growth and development of ciliary ganglion neurons in cell culture. Journal of

Neuroscience 1:505-513.

Pardi D, Margiotta JF (1999) Pituitary adenylate cyclase-activating polypeptide activates

a phospholipase C-dependent signal pathway in chick ciliary ganglion neurons that

selectively inhibits a7-containing nicotinic receptors. J Neurosci 19:6327-6337.

88

Pizzorusso T, Ratto GM, Putignano E, Maffei L (2000) Brain-derived neurotrophic factor

causes cAMP response element-binding protein phoshporylation in absence of

calcium increases in slices and cultured neurons from rat visual cortex. J

Neuroscience 20:2809-28016.

Poo M-m (2001) Neurotrophins as synaptic modulators. Nature Reviews Neuroscience

2:24-32.

Pozzo-Miller LD, Gottschalk W, Zhang L, McDermott K, Du J, Gopalakrishnan R, Oho

C, Sheng Z-H, Lu B (1999) Impairments in High-Frequency Transmission,

Synaptic Vesicle Docking, and Synaptic Protein Distribution in the Hippocampus

of BDNF Knockout Mice. J Neurosci 19:4972-4983.

Pugh P, Margiotta J (2000) Nicotinic acetylcholine receptor agonists promote survival and

reduce apoptosis of chick ciliary ganglion neurons. Mol Cell Neurosci 15:113-122.

Pugh PC, Berg DK (1994) Neuronal acetylcholine receptors that bind a-bungarotoxin

mediate neurite retraction in a calcium-dependent manner. J Neurosci 14:889-896.

Rifkin JT, Todd VJ, Anderson LW, Lefcort F (2000) Dynamic expression of neurotrophin

receptors during sensory neuron genesis and differentiation. Developmental

Biology 227.

Rohrer H, Sommer I (1982) Simultaneous expression of neuronal and glial properties by

chick ciliary ganglion cells during development. J Neuroscience 3:1683-1693.

Role LW, Berg DK (1996) Nicotinic receptors in the development and modulation of CNS

synapses. Neuron 16:1077-1085.

89

Rudy B, Kirschenbaum B, Rukenstein A, Greene LA (1987) Nerve growth factor

increases the number of functional Na channels and induced TTX-resistant Na

channels in PC12 pheochromocytoma cells. J Neuroscience 7:1613-1625.

Schnider AS, Poo M-M (2000) The neurotrophin hypothesis for synaptic plasticity.

Trends in Neurosci 23:639-645.

Schoepfer R, Conroy WG, Whiting P, Gore M, Lindstrom J (1990) Brain a-bungarotoxin

binding protein cDNAs and MAbs reveal subtypes of this brain of the ligand-gated

ion channel gene superfamily. Neuron 5:35-48.

Schropel A, von Schack D, Dechant G, Barde YA (1995) Early expression of the nerve

growth factor receptor ctrkA in chick sympathetic and sensory ganglia. Mol Cell

Neurosci 6:544-566.

Schuman EM (1999) Neurotrophin regulation of synaptic transmission. Current Opin in

Neurobiol 9:105-109.

Sharma G, Vijayaraghavan S (2003) Modulation of presynaptic store calcium induces

release of glutamate and postsynaptic firing. Neuron 38:929-939.

Steljes TPV, Kinoshita Y, Wheeler EF, Oppenheim RW, von Bartheld CS (1999)

Neurotrophic factor regulation of developing avian occulomotor neurons:

differential effects of BDNF and GDNF. J Neurobiology 41:295-315.

Stone EM, Rothblum KN, Alevy MC, Kuo TM, Schwartz RJ (1985) Complete coding

sequence of the chicken glyceraldehyde-3-phosphate dehydrogenase gene. PNAS

82:1628-1632.

90

Stoop R, Poo M-m (1996) Synaptic modulation by neurotrophic factors: differential and

synergistic effects of brain-derived neurotrophic factor and ciliary neurtotrophic

factor. J Neuroscience 16:3256-3264.

Takahashi T, Yamashita H, Nakamura S, Ishiguro H, Nagatsu T, Kawakami H (1999)

Effects of nerve growth factor and nicotine on the expression of nicotinic

acetylcholine receptor subunits in PC12 cells. Neuroscience Research 35:175-181.

Tyler WJ, Perrett SP, Pozzo-Miller LD (2002) The role of neurotrophins in

neurotransmitter release. Neuroscientist 8:524-531.

Vernallis AB, Conroy WG, Berg DK (1993) Neurons assemble AChRs with as many as 3

kinds of subunits while maintaining subunit segregation among subtypes. Neuron

10:451-464.

von Bartheld CS, Williams R, Lefcort F, Clary DO, Reichardt LF, Bothwell M (1996)

Retrograde transport of neurotrophins from the eye to the brain in chick embryos:

roles of the p75NTR and trkB receptors. J Neuroscience 16:2995-3008.

Wescamp G, Reichardt LF (1991) Evidence that biological activity of NGF is mediated

through a novel subclass of high-affinity receptors. Neuron 6:649-663.

Wonnacott S (1997) Presynaptic nicotinic ACh receptors. Trends Neurosci 20:92-98.

Yeh JJ, Ferreira M, Ebert S, Yasuda RP, Kellar KJ, Wolfe BB (2001) Axotomy and nerve

growth factor regulate levels of neuronal nicotinic acetylcholine receptor a3

subunit protein in the rat superior cervical ganglion. J Neurochemistry 79:258-265.

Ying SW, Futter M, Rosenblum K, Webber MJ, Hunt SP, Bliss TV, Bramham CR (2002)

Brain-derived neurotrophic factor induces long-term potentiation in intact adult

91

hippocampus: requirement for ERK activation coupled to CREB upregulation

and Arc synthesis. J Neuroscience 22:1532-1540.

92

Figure Legends 1. Detection of trkB transcripts in ciliary ganglia. (a) PCR amplifications were

conducted on cDNAs from E8 CG, E14 CG and E15 DRG using primer pairs specific

for chicken full-length trkB (K+), kinase-deleted trkB (K-), or GAPDH (GAP) and the

resulting products separated by gel electrophoresis. Arrowheads at ≈700 bp and dots

at ≈400, 500, and 600 bp (E14 CG shown) mark product sizes expected for K+ trkB

and for the truncated K- trkB isoforms, respectively. (b) Schematics of K+ and K-

trkB isoforms showing extracellular (EC), transmembrane (TM), and kinase (K)

domains. The striped bar in the lower schematic depicts the variable-length

juxtamembrane region responsible for the multiple amplification products found for

K- trkB in a. Horizontal lines indicate the trkB products expected for the K+ (713 bp)

and largest K- (≈600 bp) trkB isoforms. (c) HpaII digestion (+) of CG and DRG K+

trkB amplification products (site marked by * in b) yielded restriction fragments of

identical and predicted sizes (499 and 214 bp). Undigested K+ trkB (-). Lane

markers in a and c depict a 100 bp DNA ladder (200-1000 bp).

2. Localization of trkB protein to ciliary ganglion neurons. (a-c) Ganglion sections

obtained from E8 CG, E14 CG, and E15 DRG, displayed neuronal immunoreactivity

after labeling with primary antiserum recognizing an extracellular epitope of chicken

trkB. Both intracellular and cell-surface trkB labeling (arrows) was evident. Insets

in a and b show freshly-dissociated E8 and E14 CG neurons displaying punctate

cell-surface trkB labeling (arrowheads). (d, e) trkB labeling of E8 CG neuron

somata and processes after 8h (d) and on day 4 (d4) in culture (e). (f, g) To

93

demonstrate specificity, E14 CG sections (f) and d4 CG cultures (g) processed without

the trkB primary antiserum were unlabeled, as were E8 CG, E15 DRG,

acutely-dissociated CG neurons, and 8h CG cultures (data not shown). Scale bar in g

represents 20 µm and applies to all panels.

3. Detection of BDNF protein and mRNA. (a) ELISAs demonstrate the presence of

BDNF-like protein in tissue homogenates prepared from a ciliary neuron target, the iris

constrictor muscle (Iris, black bar), as well as from E8 and E14 CG (gray bars).

BDNF was not present at detectable levels (N.D.) in 10% eye extract (10% eye), 10%

heat inactivated horse serum (10% hs), or 10% chicken serum (10% cs). (b) PCR

primers specific for chicken BDNF (top row) amplified products consistent with the

expected size of 462 bp (arrow) from cDNA derived from E8 and E14 CG, and in

separate experiments from E8 CG neurons after 4 d growth in culture. GAPDH

amplifications (bottom row, 449 bp) were performed as positive controls in parallel

reactions from paired experiments.

4. BDNF induction of CREB phosphorylation indicates trkB receptors on CG neurons

are functional. (a-c) Nearly all CG neuron nuclei (labeled by DAPI staining in a)

displayed detectable p-CREB immunoreactivity after treatment with 100 nM PACAP

(b) whereas p-CREB immunoreactive neuronal nuclei were virtually absent in

untreated cultures (c). (d-f) After incubation with BDNF, many neuron nuclei

displayed detectable p-CREB immunoreactivity (d), which was absent in cultures

co-treated with 50 ng/ml BDNF and 200 nM K252a (e) or 50 µM PD98059 (f). Scale

94

bar indicates 20 µm and applies to all panels. Arrowheads and dots mark neuronal

nuclei scoring as p-CREB positive and negative, respectively. (g) Summary of

treatment results. Bars represent the mean percent of neurons per field with p-CREB

immunoreactive nuclei following the indicated treatments (N=85-321 neurons in 6-18

fields from 2 experiments). Asterisks indicate a significant difference (p<0.001,

unpaired t-test) from untreated cultures tested in parallel.

5. BDNF increases α7-nAChR surface sites and α7-nAChR subunit mRNA. (a)

α7-nAChR levels were determined by quantifying [125I]-αBgt surface binding sites in

CG neuron cultures maintained for 5 d. Data points indicate mean (± S.E.M) fmoles

[125I]-αBgt bound per ganglion equivalent relative to control cultures after exposure to

BDNF for 0h (N=12), 4 h (from day 5, N=3), 16 h (from day 4, N=6) or 5 d (from day

0, N=10). The open circle depicts relative [125I]-αBgt binding levels for cultures

treated with both BDNF and ChEX (N=3). Asterisk indicates a significant increase

in [125I]-αBgt binding after 5 d exposure compared to untreated control cultures from

the same platings (p<0.05) and applies to BDNF incubations with and without ChEX.

(b) Separate PCR amplifications were conducted on cDNAs isolated from control or

BDNF-treated (4-5 d) CG neuron cultures (with or without ChEX) on d 4 or d 5 using

primer pairs specific for the indicated chicken nAChR subunit or βA. (b, left) The

resulting products were separated by gel electrophoresis and had sizes appropriate for

and βA (275 bp), α7-nAChR subunit (522 bp) (arrows) and α3-nAChR subunit (252

bp, not shown). In the example shown note that the intensity of α7-nAChR subunit

95

relative to βA product was higher for BDNF-treated cultures (with or without ChEX)

than for controls. (b, right) Summary of mean (± S.E.M.) relative α7-nAChR and

α3-nAChR subunit product fluorescence intensity under different treatment

conditions. In this gel-based assay, the relative levels of α7-nAChR subunit mRNA

were 53 ± 10% higher in BDNF-treated (black bar) compared to control cultures

(white bar) within the same experiments (*, p<0.01, N=6, paired t-test) and a similar

increase (41 ± 15%) persisted when BDNF was applied in the presence of CHEX

(hatched bar) to block p75NTR (p<0.05, N=3). By contrast, the BDNF treatments

failed to significantly change mRNA levels for α3-nAChR subunit (p>0.05, N=5).

(c) For confirmation, real-time PCR amplifications were conducted on cDNAs

isolated from control or BDNF-treated (4-5 d) CG neuron cultures using primer pairs

specific for the indicated chicken nAChR subunit or GAPDH. Using this approach,

the levels of α7-nAChR subunit mRNA were 98 ± 26% higher in BDNF-treated (gray

bar) compared to control cultures (white bar) (*, p<0.02, N=5, unpaired t-test) while

mRNA levels for α3-nAChR subunit were unchanged (p>0.1, N=4).

6. BDNF enhances α7-nAChR currents. CG neurons were held at –70 mV, and

whole-cell nAChR currents induced by pressure microperfusion with 20 µM Nicotine

(2 sec, 10-15 psi). (a) Example records showing that α7-AChRs mediate the initial fast

current component (Ifast, top trace) since this component was absent in neurons

incubated with αBgt (60 nM, 30 min, middle trace). Ifast was enhanced after treating

CG neuron cultures with BDNF (4 d, 50 ng/ml, lower trace). Calibration: 100 msec

96

and 200 pA. (b) Summary of αBgt and BDNF effects on α7-nAChR currents. Left:

Ifast normalized for membrane capacitance (Ifast/Cm, black bars) was absent, but Islow/Cm

reduced only slightly (white bars) in cultures treated with αBgt (+, N=8) relative to

control neurons tested in parallel (-, N=12). Right: In neurons with detectable Ifast,

3-4 d BDNF treatment signifcantly increased Ifast/Cm by 49 ± 14% (N=63) relative to

untreated controls tested in parallel (N=52). In the same records, Islow/Cm, the

α3*-nAChR-mediated current component was not significantly different (p=0.08) for

control, and BDNF-treated neurons (N=80 and 76, respectively). Shorter treatment

times of 10-30 min (0.2 h, N=9) or 16-24 h (not shown) failed to detectably alter either

fast, α7- or slow, α3*-nAChR mediated currents. (c) 3-4 d exposure to BDNF

increased the proportion of neurons with detectable Ifast from 65 ± 5% (N=80) in

control cultures to 83 ± 4% (N=76) in treated cultures. Asterisks indicate a significant

difference from untreated controls tested in parallel (p<0.05).

7. BDNF enhances function at nicotinic synapses. (a) Example records of sEPSCs

obtained on day 5 from control and BDNF-treated (16 h, 50 ng/ml BDNF) CG neurons

from the same cultures. Calibrations, 25 pA and 100 ms. (b) BDNF treatment effects

on sEPSC frequency. Values indicate mean (± S.E.M) sEPSC frequency in neurons

assessed on day 4 or day 5 after exposure to BDNF (black bars) for 10-30 min (0.2 h,

N=71), 16-24 h (16 h, N=46), or 4-5 d (80 h, N=29) relative to that for control neurons

not exposed to BDNF (white bars, N=74, 37, 21, respectively) tested in parallel. (c)

Tests for trk and α7-nAChR involvement in BDNF-enhanced synaptic function. The

97

ability of BDNF to increase sEPSC frequency (black bars) is abolished by 10-30 min

co-incubation with 200 nM K252a to block trks (gray bar, left) but unaffected by

16-24 h co-incubation with αBgt to block α7-nAChRs (hatched bar, right). In both b

and c, asterisks indicate a significant increase sEPSC frequency for the indicated

conditions compared to untreated control cultures from the same platings (p<0.05).

(d, e) Summary of BDNF treatment effects on α7- and α3*-nAChR mediated sEPSC

amplitudes. Cumulative amplitude distribution histograms are shown for

fast-decaying sEPSCs mediated by α7-nAChRs (d) and slow-decaying sEPSCs

mediated by α3*-nAChRs (e) in control neurons (open circles) and in neurons treated

with 50 ng/ml BDNF for 16-24 h (filled circles). BDNF treatment resulted in a

significant shift in fast sEPSC amplitudes (d) from a median of –9.6 pA (N=137) for

control neurons to –12.7 pA (N=139) for BDNF-treated neurons (p<0.0004,

Mann-Whitney and Kolmogorov-Smirnov tests). By contrast slow sEPSC amplitudes

(e) were unaffected by the treatment, with median amplitudes of –15.0 pA (N=220) and

–14.5 pA (N=180) for control and BDNF-treated neurons, respectively (p>0.06, same

tests). Insets show examples of fast and slow sEPSCs with amplitudes close to the

median values for control (top) and BDNF treatment (bottom, with dot) conditions.

Calibration bars indicate 10 pA and 2 msec.

98

Figure 1.

99

Figure 2.

100

Figure 3.

101

Figure 4.

102

Figure 5.

103 103

Figure 6.

104

Figure 7.

105

In the previous manuscript, the results that BDNF upregulated the expression and function

of neuronal AChRs on chicken CG neurons were discussed. Since both BDNF and TrkB

were expressed in chicken CG neurons during the embryogenic stage, BDNF/TrkB

signaling may be potentially involved in regulating other cellular process of CG neurons.

Although previous evidence demonstrated that the application of BDNF in vitro had no

effects on supporting the survival of ciliary ganglion neurons (Rohrer and Sommer, 1983;

Lindsay et al., 1985b), it should be noted that neurons in the culture were exposed to a

concentration at which both TrkB and p75 receptors, which were also expressed on the

surface of CG neurons (Allsopp et al., 1993; Yamashita et al., 1999a), were activated by

BDNF based on the knowledge of their binding affinities (Rodriguez-Tebar and Barde,

1988; Dechant et al., 1993b). Since it is well known that the activation of p75 receptors is

involved in the apoptosis (Dechant and Barde, 1997), the conclusion that BDNF was

irrevelant to the survival of parasympathetic neurons may be incomplete due to the

interference of p75 receptors. Interestingly recent work from Dr. Pugh has demonstrated

that the exposure to BDNF at low concentration supported partial survival of ciliary

ganglion neurons (Pugh et al., submitted), which confirmed our previous concern.

Depolarization has been shown to support the full survival of CG neurons (Schmidt and

Kater, 1995; Pugh and Margiotta, 2000). It was also well known that

depolarization-induced activities upregulated the expression of BDNF in other systems

(Zafra et al., 1990; Ernfors et al., 1991; Zafra et al., 1991; Lindvall et al., 1992) and the

increased release of BDNF may be responsible for the survival of certain neuronal

106

population (Hansen et al., 2001). Considering the recent defined role of BDNF in

supporting the CG neuronal survival, we speculate that BDNF, in addition to regulate the

AChRs on the CG neurons, may also be involved in the depolarization-induced survival.

In the following manuscript we explored the expression pattern of BDNF in CG neurons

and tested such theory.

107

Depolarization promotes survival of ciliary ganglion neurons

by BDNF-dependent and independent mechanisms

108

Title: Depolarization promotes survival of ciliary ganglion neurons by

BDNF-dependent and independent mechanisms

Authors: Xiangdong Zhou*, Phyllis C. Pugh, and Joseph F. Margiotta

Project Address: Medical University of Ohio

Department of Neurosciences

Block HS 108, 3035 Arlington Ave.

Toledo, OH 43614

Corresponding Author: Joseph F. Margiotta, Ph.D., Medical University of Ohio,

Department of Neurosciences, BHS 108,

3035 Arlington Avenue, Toledo, OH 43614

Tel: 419-383-4119; Fax: 419-383-3008

E-mail: jmargiotta@meduohio.edu

*Present Address: Lerner Research Institute, Cleveland Clinic Foundation, 9500

Euclid Ave., NC-30, Cleveland OH 44195

109

ABSTRACT

Membrane activity upregulates brain derived neurotrophic factor (BDNF) expression and

coordinately supports neuronal survival in many systems. In parasympathetic ciliary

ganglion (CG) neurons, activity mimicked by KCl-depolarization supports nearly full

survival. BDNF had been considered unable to support CG neuronal survival, but we

recently found conditions that unmask its trophic actions. Here we show that BDNF is

expressed during CG development and participates in activity-induced neuronal survival.

KCl-depolarization increased BDNF mRNA and protein in CG neurons. Moreover,

application of anti-BDNF blocking antibody or mitogen activated protein kinase (MAPK)

kinase inhibitor, attenuated depolarization-supported survival, implicating canonical

BDNF signaling. Ca2+-Calmodulin kinase II (CaMKII) was also required since CaMKII

inhibition combined with anti-BDNF or MAPK kinase inhibitor abolished or greatly

reduced the trophic effects of depolarization. Membrane activity may support CG

neuronal survival both by inducing BDNF release to activate MAPK and by recruiting

CaMKII. This mechanism could have relevance late in development in vivo as

ganglionic transmission becomes reliable and the effectiveness of other growth factors has

diminished.

Key Words: TrkB, neurotrophin, CREB, MAPK, CaMKII, synapse, p75NTR

110

INTRODUCTION Neuronal survival involves integration of signals produced by membrane electrical

activity and trophic molecules from target, autocrine, and input sources. Activity is

crucial since silencing neurons reduces survival (Lipton, 1986; Furber et al., 1987;

Meriney et al., 1987; Catsicas et al., 1992; Galli-Resta et al., 1993) and since

KCl-depolarization can support survival without added neurotrophic factors (Scott and

Fisher, 1970; Gallo et al., 1987). Ca2+ influx through voltage-dependent Ca2+ channels

(VDCCs) provides a critical messenger for depolarization-induced survival (Scott and

Fisher, 1970; Gallo et al., 1987; Franklin et al., 1995) by activating downstream signaling

effectors such as mitogen activated protein kinase (MAPK) and Ca2+-Calmodulin kinase II

(CaMKII) (Hanson and Schulman, 1992; Hack et al., 1993; Rosen et al., 1994; Farnsworth

et al., 1995; Hansen et al., 2001; Borodinsky et al., 2002). In conjunction with activity,

protein growth factors, including neurotrophins (NTs, i.e. nerve growth factor, NGF; brain

derived neurotrophic factor, BDNF; and neurotrophin-3, NT3), ciliary neurotrophic factor

(CNTF) and glial cell line derived neurotrophic factor (GDNF) promote neuronal survival

through their high-affinity receptors (Trks, CNTFα/gp130/LIFR, and GFRα1/Ret for NTs,

CNTF, and GDNF, respectively) (Huang and Reichardt, 2001; Segal, 2003). NTs, as

well as GDNF, promote neuronal survival through MAPK and PI3-K/Akt signaling

pathways (Yao and Cooper, 1995; Dudek et al., 1997; Bonni et al., 1999; Airaksinen and

Saarma, 2002), while CNTF promotes neuronal survival through activation of JAK/STAT

signaling (Ip and Yancopoulos, 1996; Segal and Greenberg, 1996a).

111

Chick ciliary ganglion (CG) neurons are a useful model for identifying requirements for

parasympathetic neuron survival. Normally, 50% of CG neurons die between E8 and E14

in vivo (Landmesser and Pilar, 1974a). Removing peripheral targets prior to innervation

increases neuronal death, indicating that developmental interactions with peripheral

targets are necessary for survival (Landmesser and Pilar, 1974b, 1978; Wright, 1981). In

cell culture, nearly all CG neurons can survive in media supplemented with neurotrophic

factors, such as CNTF (or its avian orthologue, growth promoting activity, GPA), GDNF,

or with elevated [KCl] (Nishi and Berg, 1981; Eckenstein et al., 1990; Leung et al., 1992a;

Buj-Bello et al., 1995; Pugh and Margiotta, 2000). While CNTF, GPA and GDNF are

expressed in CG target tissue (Barbin et al., 1984; Leung et al., 1992a; Buj-Bello et al.,

1995; Hashino et al., 2001) they are unlikely to support full CG neuronal survival

throughout development in vivo. First, although GPA receptors (GPARα) mediating the

effects of GPA and CNTF are present throughout CG development (Heller et al., 1995),

the ability of CNTF to promote survival is substantially reduced for neurons at stages later

than E12 (Buj-Bello et al., 1995) (PC Pugh and JF Margiotta, unpublished results).

Similarly, GDNF potency and efficacy drop significantly for neurons after E10, and

expression of GDNF and its high affinity receptor, GFRα1/Ret, decline in parallel well

before the end of CG neuron cell death at E14 (Buj-Bello et al., 1995; Hashino et al.,

2001). These findings suggest that neurotrophic factors other than CNTF, GPA or

GDNF may protect CG neurons during and after the period of programmed ganglionic cell

death in vivo.

112

Despite previous reports discounting a relevance for NT signaling in CG neurons (Rohrer

and Sommer, 1983; Lindsay et al., 1985b; Dechant et al., 1993b; Hallbook et al., 1995),

we recently detected BDNF in the CG, and found that the neurons express TrkB receptors

that trigger signals able to modulate nicotinic synapses and alter nicotinic receptor

expression (Zhou et al., 2004). Ongoing studies further indicate that BDNF supports

long-term survival of most CG neurons in culture when applied at sufficiently low

concentration to preferentially activate TrkB (Pugh et al., 2005). In other systems

depolarization rapidly stimulates NT release, and increases both NT synthesis (Zafra et al.,

1990; Castren et al., 1993; Balkowiec and Katz, 2000) and expression levels of

catalytically active Trks (Meyer-Franke et al., 1998; Kingsbury et al., 2003). In cortical

and spiral ganglion neurons, the increased synthesis and release of BDNF following

chronic KCl-depolarization and VDCC activation, indicates that activity enhances

neuronal survival, possibly by autocrine regulation of BDNF expression (Ghosh et al.,

1994; Hansen et al., 2001). Other studies indicate that depolarization and NTs converge

on the same MAPK and PI3-K/Akt pathways to regulate neuron survival (Vaillant et al.,

1999). These considerations, and the developmental appearance of BDNF in CG suggest

a causal relationship between depolarization and BDNF expression/release that could

provide trophic support to the neurons. In testing this hypothesis we found that chronic

KCl depolarization dramatically increased both BDNF mRNA and protein levels in CG

cultures. Moreover, depolarization-induced survival utilized both TrkB-dependent

(MAPK) and -independent (CaMKII) signaling effectors. The results suggest that

113

activity-regulated BDNF expression and release participates with BDNF-independent

processes to promote CG neuronal survival during embryogenesis in vivo.

114

Methods

Cell Culture

CG neuron cultures were prepared under sterile conditions as previously described (Pugh

and Margiotta, 2000; Chen et al., 2001; Zhou et al., 2004). Briefly, CG were dissected

from embryonic day 8 (E8) chicken embryos, digested with trypsin (0.025%, 15 min) and

dissociated by mechanical trituration. Dissociated neurons were plated at 2 ganglion

equivalents per 12-mm-diameter glass coverslip (in 15 mm diameter multiwell plates) or

35 mm-diameter polystyrene tissue culture dish; both surfaces were precoated with

poly-DL-ornithine and laminin (Pugh and Margiotta, 2000; Chen et al., 2001). The basal

culture medium consisted of minimum essential medium containing 100 U/ml penicillin,

100 µg/ml streptomycin, 2 mM glutamine, and 10% heat inactivated horse serum (MEMhs;

all components from Invitrogen, Rockville, MD). Depending on the experiment, MEMhs

was supplemented with one or more of the following: KCl (10-20 mM; final KCl

concentration 15-25 mM), BDNF (5 ng/ml), anti-BDNF (10 µg/ml, mAb 35928.11, EMD

Biosciences, San Diego, CA), PD98059 (7 µM, EMD Biosciences), or embryonic eye

extract (3% v/v). MEMhs containing 3% eye extract (MEMhs/eye) or 25 mM KCl

(MEMhs/K) was previously shown to support 100% and 50-100% survival of CG neurons

for at least 7 d in culture (Nishi and Berg, 1981). In all cases, neurons were maintained at

37°C in 95% air and 5% CO2 for 4-7 d and received fresh culture medium every 2-3 d

(Nishi and Berg, 1981).

Survival Assay

115

Neuronal survival was determined by established morphological criteria, with CG neurons

scoring as alive if they displayed large, phase-bright somata that extended processes 2-3 h

after plating (Pugh and Margiotta, 2000). For each growth condition, 9-12 fields on 2-3

coverslips were evaluated at 200X magnification using an inverted phase-contrast

microscope (Axiovert 10, Zeiss, Thornwood, NY) and the average number of neurons per

field per coverslip determined. Neuron counts were repeated at 1, 2 and 4 d after plating

and survival expressed as percent of the initial number of neurons present per field per

coverslip 2-3h after plating (D0).

Real-Time RT-PCR

Changes in BDNF mRNA levels induced by depolarization were measured using

RT-based real-time PCR. cDNA samples corresponding to 25-50 ng of input RNA were

combined with Taqman universal PCR master mix (Roche, Branchburg, NJ), forward (F)

and reverse (R) primers (0.4 µM), and Taqman probe (0.1 µM) [with 6-FAM

(carboxyfluorescein, reporter dye) and TAMRA (tetramethylrhodamine, quencher dye)

inserted at 5' and 3' ends, respectively]. Selection of the following primers and probes was

optimized using Applied Biosystems (Foster City, CA) Primer-Express software:

BDNF (Genbank, M83377):

F,: G290TCAAGTGCCTTTGGAACCC309;

R,: A420CAGACGCTCAGTTCCCCAC401;

Probe: C325TCGAGGAGTACAAAAACTACCTGGATGCTGC356;

GAPDH (Stone et al., 1985):

116

F,: C1795CGTCCTCTCTGGCAAAGTC1814;

R,: A2374ACATACTCAGCACCTGCATCTG2352;

Probe: A2211TCAATGGGCACGCCATCACTATCTTCC2228

Twenty-five microliter PCRs were performed in triplicate using a GeneAmp 5700

sequence detection system (Applied Biosystems). This system allows the increase in

PCR product to be monitored directly based on the threshold number of cycles (C)

required to produce a detectable change in fluorescence (ΔF) resulting from the release of

probe. Relative levels of BDNF (RB) in control and KCl-treated cultures were calculated

from the difference in C values (ΔC = C

B

Control - CKCl) for BDNF amplification (ΔC B)

compared with those for the housekeeping gene, GAPDH (ΔC G) using

RB = (EBΔCB ) /(EG

ΔCG ) (1).

In Equation 1, EB and EB G are the BDNF and GAPDH cDNA amplification efficiencies

determined in separate studies from the slope of C versus input log cDNA dilution where

E = 10 (Zhou et al., 2004). E-1/slopeBB and EG values obtained in this manner were both 1.8.

ELISA

The presence of BDNF in ciliary ganglia and neuron cultures was assessed using a

commercial BDNF sandwich ELISA kit having no significant cross-reactivity with NGF,

NT4/5, or NT3 (Chemikine; Chemicon, Temecula, CA) as previously described (Zhou et

117

al., 2004). Levels of BDNF-like protein were quantified within the linear range of the

assay (7.8 to 500 pg/ml) using recombinant human BDNF as standard.

Statistics

All parameter values are expressed as mean ± SEM (or SD where noted). Statistical

significance was set at p<0.05, and determined by unpaired, two-tailed t-test when

comparing two datasets, or by one-way ANOVA combined with Bonferroni post-hoc

multiple comparison testing for three or more datasets using Prism 4.0 (GraphPad

Software, San Diego, CA).

118

Results and Discussion

BDNF is expressed during CG development. BDNF protein was detected in ciliary

ganglia throughout the developmental period from E8 to E17, with levels (in pg/mg

ganglionic wet weight) declining about 50% from E8 to E14 and remaining stable

thereafter (Fig. 1). Since 50% of CG neurons normally die between E8 and E14 due to

programmed cell death in the ganglion (Landmesser and Pilar, 1974b) levels of BDNF are

seen to remain relatively constant on a per neuron basis during the developmental period

examined. We recently found that BDNF is present in E14 iris muscle, the in vivo target

of ciliary neurons (Zhou et al., 2004) such that a loss of peripheral target contacts may

contribute to the decline in absolute levels of BDNF. Opposing this loss, however,

BDNF levels could be maintained by local ganglionic synthesis since BDNF mRNA is

present in both E8 and E14 ganglia, as well as in CG neuron cultures (Zhou et al., 2004).

Depolarizing activity increases BDNF expression and release. Since BDNF mRNA and

protein levels are increased by depolarization and subsequent Ca2+ elevation in neurons

that express BDNF (Zafra et al., 1990; Ghosh et al., 1994; Goodman et al., 1996), we

reasoned that levels of BDNF might display a similar activity-dependence in CG neurons.

This possibility was tested by exposing CG neurons to elevated KCl concentrations in cell

culture as a means of mimicking sustained depolarizing activity (Fig. 2). When CG

neurons were grown for 3-4 d in MEMhs/eye containing 25 mM KCl, BDNF mRNA levels

assessed by real-time RT-PCR were 23.4 ± 5.7 fold higher than in parallel control cultures

grown in standard MEMhs/eye containing 5 mM KCl (n=3 test and control cultures,

119

p<0.05). Shorter exposure times appeared less effective; in two experiments, exposing

cultures to 25 mM KCl overnight increased levels of BDNF mRNA by 8.3 fold compared

to controls maintained in MEMhs/eye containing 5 mM KCl for 4 d (data not shown).

Supplementing MEMhs/eye with nicotine (20 µM, 3-4 d) to activate nAChRs and depolarize

CG neurons also significantly increased BDNF mRNA levels. The magnitude of the

nicotine effect was much smaller (1.5 ± 0.1 fold, n=4, p<0.05), however, than seen with

KCl, presumably because nAChRs desensitize thereby limiting the amount of sustained

depolarization and subsequent elevation of intracellular Ca2+. In accord with the

upregulation in BDNF mRNA, levels of BDNF-like protein were also dramatically

increased by chronic depolarization. In cell extracts from two cultures grown in

MEMhs/eye containing 25 mM KCl, BDNF levels were 419 ± 3 pg/ml (mean ± SD)

compared with nearly undetectable amounts (8 ± 3 pg/ml) seen in control MEMhs/eye

(p<0.05). As in other systems (Zafra et al., 1990; Ghosh et al., 1994; Goodman et al.,

1996) activity-dependent BDNF release was also demonstrable in CG cultures, with high

levels of BDNF-like protein appearing in 25 mM KCl culture media (200 ± 64 pg/ml, n=2)

compared with undetectable levels for control cultures maintained in MEMhs/eye. These

findings indicate that activity-dependent processes can potently upregulate expression of

BDNF mRNA and protein in CG neurons, and are consistent with the somewhat smaller

5-10 fold increases in BDNF expression seen for hippocampal neurons following shorter

depolarization treatment (Zafra et al., 1990; Goodman et al., 1996). As concluded

previously for cortical neurons (Ghosh et al., 1994), depolarization may upregulate BDNF

transcription and release from CG neurons themselves, or from adjacent non-neuronal

120

cells present in the culutres. Consistent with the former (autocrine) model, other studies

have demonstrated that activity- and Ca2+-dependent mechanisms activate transcription

factors (e.g. CREB, c-fos) in CG neurons (Chang and Berg, 2001). These or other

activity-dependent transcription factors could underlie the upregulation of BDNF induced

by chronic KCl or nicotine exposure, as seen here. Regardless of its source, release of

endogenous BDNF would be expected to activate TrkB receptors, known to be present and

functional on CG neruons and thereby able to trigger intracellular signals relevant to

regulating nicotinic receptors and synaptic function (Zhou et al., 2004) and supporting

survival (Pugh et al., 2005).

Depolarization-induced survival of CG neurons is partially BDNF-dependent. KCl

depolarization provides significant trophic support to CG neurons in culture. In MEMhs

(without eye extract), only 10-20% of neurons survive for 7 d compared with 50-100% in

MEMhs containing 25 mM KCl (Scott and Fisher, 1970; Nishi and Berg, 1981; Pugh and

Margiotta, 2000). Since elevated [KCl] greatly increased BDNF expression and release

in CG cultures, we hypothesized a causal connection with depolarization-enhanced

survival. This is a reasonable hypothesis because ongoing studies indicate that MEMhs

containing BDNF, NT3 or NGF can support the survival of most CG neurons in culture

(Pugh et al., 2005). Relevant to the present study, it was found that BDNF provides

trophic support only when applied at sufficiently low concentration to minimize activation

of low-affinity NT receptors (p75NTR) linked to cell death (Huang and Reichardt, 2001;

Freidin, 2004) and present on CG neurons (Yamashita et al., 1999b) (Q Nai, XD Zhou,

121

and JF Margiotta, unpublished results) or at high concentration in the presence of a p75NTR

blocking antibody (Wescamp and Reichardt, 1991). Presumably BDNF was previously

found unable to support CG neuronal survival because it was tested at 50 ng/ml (2 X

10-9M) (Lindsay et al., 1985b), a sufficiently high concentration to activate p75NTR (Kd ≈

10-9M) (Rodriguez-Tebar and Barde, 1988). To directly test the hypothesis that BDNF

contributes to depolarization-supported survival, we used a BDNF neutralizing antibody

(anti-BDNF), which recognizes and binds to free BDNF and blocks the function of

endogenous BDNF in culture (unpublished data from EMD Biosciences, Inc., San Diego,

CA), and assessed its effects on levels of neuronal survival produced by 10 mM KCl, a

concentration supporting submaximal survival (EC50 = 8 mM, PC Pugh and JF Margiotta,

unpublished) (Fig. 3). From D1 to D4 in culture, CG neurons grown in MEMhs

containing 10 mM KCl maintained a relatively constant ≈70% level of neuronal survival

that was significantly higher on D4 (72 ± 4%, n=4) than was achieved in the same cultures

grown in MEMhs alone (20 ± 3%, p<0.001). When, in the same experiments, KCl and

anti-BDNF were coapplied from D1-D4 in culture, however, long-term survival

decreased, paralleling that seen in MEMhs and reaching 52 ± 2% (n=4) on D4,

significantly lower than that for neurons grown in MEMhs containing 10 mM KCl

(p<0.01), but greater than that achieved in MEMhs alone (p<0.001). The antibody

treatments were considered specific because, in separate control experiments (data not

shown), anti-BDNF significantly reduced survival support provided by 5 ng/ml exogenous

BDNF (p<0.05) to levels that were indistinguishable from those seen in MEMhs (p>0.05,

n=2) but had no detectable effect on survival supported by exogenous NGF. While

122

different culture conditions were used to induce BDNF release than in the survival assays,

the BDNF level released by KCl-depolarization (Fig. 2) is about 0.5 ng/ml representing a

concentration of 2 X 10-11M. Although local, relevant concentrations may be higher, this

dose is sufficient for high-affinity BDNF binding to TrkB on chicken neurons

(Kd≈10-11M) (Rodriguez-Tebar and Barde, 1988; Dechant et al., 1993b). These results

therefore suggest that survival support provided by membrane depolarization is partially

attributable to the stimulation of BDNF release from the CG cultures and subsequent

activation of TrkB signaling.

Depolarization induces survival via MAPK and CaMKII. Previous studies identify

MAPK-dependent processes in sequential calcium signaling in the nervous system (Rosen

et al., 1994). It is also known that NT activation of MAPK protects neurons from death in

various systems (Becker et al., 1998; Bonni et al., 1999; Hetman et al., 1999) including

CG neurons (Pugh et al., 2005). Since MAPK would be activated by either KCl-induced

membrane depolarization (Rosen et al., 1994) or by the accompanying release of BDNF

and TrkB activation (Pugh et al., 2005), we tested its contribution to KCl-induced CG

neuron survival using the MAPK kinase (MEK1) inhibitor PD98059, which blocks

MEK1-MAPK signaling (Fig. 4A). Coapplication of KCl (10 mM) and PD98059 (7 µM)

in MEMhs resulted in 46 ± 4% (n=6) survival on D4, a significantly lower level than that

for parallel cultures grown in MEMhs containing 10 mM KCl (75 ± 4, n=6, p<0.001), but

higher than that attained in parallel cultures maintained in MEMhs alone (18 ± 1%, n=6,

p<0.001). The lowered KCl-supported D4 survival seen with MEK1 inhibitor was

123

indistinguishable from that seen with anti-BDNF (Fig. 3) suggesting that any direct

contribution of chronic depolarization to MAPK activation (Rosen et al., 1994) is

negligible for CG neurons. Taken together, these results indicate that full KCl-supported

survival of CG neurons requires activation of MAPK, and in accord with ongoing studies

(Pugh et al., 2005) suggest that increased BDNF release supports survival by TrkB

signaling mediated via MEK1 and MAPK effectors.

The residual KCl-supported survival observed in anti-BDNF (Fig. 3) and MEK1 inhibitor

(Fig. 4A) experiments suggest that a second pathway activated by membrane

depolarization supports survival in parallel with BDNF/TrkB signaling. We speculated

that CaMKII, an effector activated by VDCC-mediated Ca2+ influx, might also influence

the KCl-supported survival of CG neurons, as it does in other systems (Hanson and

Schulman, 1992). CaMKII is coupled to changes in gene expression since blocking the

enzyme abolishes activation of the transcription factor CREB in CG neurons following

depolarization, thereby implicating interruption of CREB-mediated gene regulation

(Chang and Berg, 2001) known to have significant effects on neuronal survival (Bito and

Takemoto-Kimura, 2003). We therefore blocked CaMKII using KN93 (10 µM) to

determine if this effector, like MAPK, is required to support KCl-induced long-term CG

neuron survival (Fig. 4B). Inclusion of KN93 in MEMhs containing 10 mM KCl resulted

in significantly reduced D4 neuronal survival (43 ± 2%) compared to that for cultures

growin in MEMhs containing only 10 mM KCl (80 ± 3%, p<0.001, n=6 and 7,

respectively), indicating CaMKII activity is required for full KCl-induced survival

124

support. Interestingly, inclusion of both KN93 and anti-BDNF in MEMhs containing 10

mM KCl, abolished the trophic effect of KCl depolarization, resulting in D4 survival

levels (13 ± 2%, n=3, p<0.001) that were indistinguishable from that for neurons grown in

MEMhs alone (20 ± 2%, n=7, p>0.05). A similar result was obtained by combining

KN93 with MEK1 inhibitor (PD98059) to block both CaMKII and MAPK signaling; such

treatment decreased D4 KCl-stimulated survival to 30 ± 2% (n=6), a level significantly

less than that obtained for MEMhs containing KCl (p<0.001) or KCl plus KN93 (p<0.05),

and approaching that seen for MEMhs. These findings indicate that full survival induced

by KCl depolarization requires parallel recruitment of both NT-dependent (BDNF, TrkB,

MAPK) and independent (CaMKII) signaling pathways. We recently found that KCl

depolarization failed to augment CG neuronal survival supported by exogenous 5 ng/ml

BDNF (Pugh et al., 2005) as would be expected for a simple additive convergence of

CaMKII and TrkB/MAPK pathways. In that case, we note that 5 ng/ml BDNF (2 X

10-10M) is 13-fold higher than the Kd for binding to TrkB on chicken neurons (≈1.5 X

10-11M) (Dechant et al., 1993b) and therefore probably maximal for TrkB binding and

subsequent MAPK activation. Under such conditions, any augmentation of survival due

to activity-dependent increases in CaMKII are expected to be offset by cell death brought

about by accompanying upregulation of BDNF release activating low-affinity p75NTR

(Kd≈10-9M). In the present case, however, levels of BDNF produced by depolarization

are expected to be quite low (Fig. 2) such that the contributions from MAPK and CaMKII

effectors (Figs. 3 and 4) are expected to be additive. Overall, these results support a model

where parasympathetic CG neruon survival is influenced by levels of activity impacting

125

both CaMKII- and, via BDNF upregulation, MAPK-dependent survival pathways. The

trophic effects of sustained activity and BDNF expression could have relevance late in

development in vivo, when ganglionic synapses have acquired the ability to transmit

reliably at high frequency (Landmesser and Pilar, 1972; Chang and Berg, 1999) and the

effectiveness of other ganglionic growth factors (i.e. GNDF and CNTF; (Buj-Bello et al.,

1995; Hashino et al., 2001) has diminished.

126

FIGURE LEGENDS

Figure 1. BDNF expression is sustained during CG development. Levels of

BDNF-like protein in CG were determined at the indicated embryonic ages. Results are

expressed as picograms BDNF per milligram ganglion wet weight (gray bars, mean ± SD)

based on duplicate ELISA measurements from 13-18 ganglia for each day. The

accompanying dashed line indicates the average number of neurons per CG at each day

expressed as a percent of the ≈6300 determined at E8 (adapted from (Landmesser and

Pilar, 1974b)).

Figure 2. Chronic KCl depolarization increases levels of BDNF mRNA and protein in

CG neuron cultures. (A) Levels of BDNF relative to GAPDH mRNA were assessed using

real time RT-PCR for 3-4 d CG neuron cultures grown in normal MEMhs/eye (5 mM KCl,

black bar), or in MEMhs/eye supplemented with either 20 mM KCl (25 mM KCl total, gray

bar) or 20 µM nicotine (striped bar). Asterisks indicate significantly higher levels of

BDNF mRNA expression (p<0.05) in cultures maintained in 25 mM KCl (n = 3 cultures)

or 20 µM nicotine (n = 4) compared to companion control cultures assayed in parallel.

(B) Levels of BDNF-like protein (pg/ml) were determined by ELISA protein assay from

3-4 d CG culture extracts (Cells) and culture media (Media). Levels were compared for

cultures grown in MEMhs/eye without supplements (black bars), and in MEMhs/eye

containing 25 mM KCl (gray bars). Asterisks indicate significantly higher levels of

BDNF-like protein (p<0.05) in cell extracts or released into the media when cultures (n=2

for both) were maintained in 25 mM KCl, as compared to controls.

127

Figure 3. BDNF contributes to KCl-supported survival of CG neurons in culture. (A)

The mean percent neuronal survival in MEMhs with or without supplements is plotted for

day 0 (D0) through D4, relative to the number of neurons present on D0. MEMhs was

supplemented with 3% eye extract (Eye), 10 mM KCl (KCl), 10 mM KCl + 10 µg/ml

anti-BDNF (KCl + αBDNF) or not supplemented (None), as indicated. Error bars

represent S.E.M. (smaller than than the symbol size for KCl + anti-BDNF condition).

Results depicted were obtained from 9-12 fields per well in 4 experiments. (B) Summary

of the mean ± S.E.M. relative D4 neuronal survival replotted from A. Supplements to

MEMhs are indicated as 3% eye extract (Eye, black bar), 10 mM KCl (KCl, gray bar), 10

mM KCl + anti-BDNF (KCl+αBDNF, hatched bar) and MEMhs alone (open bar).

Asterisks to right of bars in this and subsequent figures indicate a significant difference in

D4 survival for the indicated conditions compared to MEMhs alone. The cross indicates

that D4 survival for MEMhs supplemented with KCl was significantly reduced by the

inclusion of anti-BDNF.

Figure 4. MAPK and CaMKII activation are required for full KCl-supported survival.

CG cultures were maintained for 4 d and neuronal survival assayed each day as in Fig. 3.

(A) Supplements to MEMhs were Eye, KCl, and None as in Fig. 3B, but also included 10

mM KCl + 7 µM PD98059 (KCl+PD, White striped bar) to block MEK1. The cross

indicates that inclusion of PD98059 significantly reduces KCl supported survival. (B)

Supplements to MEMhs were Eye, KCl, and None as in Fig. 3B, but also included 10 mM

128

KCl + 10 µM KN93 (KCl+KN, black striped bar), 10 mM KCl + 10 µM KN93 + 10 µg/ml

anti-BDNF (KCl+KN+αBDNF, gray hatched bar), and 10 mM KCl + 10 µM KN93 + 7

µM PD98059 (KCl+KN+PD). Top dagger (=) indicates that inclusion of KN93

significantly reduces KCl supported survival (p<0.001). Note that combination of KN93

and anti-BDNF abolishes the trophic effect of KCl (p>0.05 relative to MEMhs alone).

Lower daggers indicate that combining KN93 with PD98059 significantly reduces KCl

supported survival (right, p<0.001) and does so further than combining KN93 with KCl

(left, p<0.05).

129

ACKNOWLEDGEMENTS

Support was provided by NIH R01-DA15536. We thank Drs. Gail Adams for technical

assistance, and Marthe Howard for helpful comments on the experiments.

REFERENCES

Airaksinen M, Saarma M (2002) The GDNF family: signalling, biological functions and

therapeutic value. Nature Reviews Neuroscience 3:383-394.

Balkowiec A, Katz D (2000) Activity-dependent release of endogenous brain-derived

neurotrophic factor from primary sensory neurons detected by ELISA in situ.

Journal of Neuroscience 20:7417-7423.

Barbin G, Manthorpe M, Varon S (1984) Purification of the chick eye ciliary

neuronotrophic factor. Journal of Neurochemistry 43:1468-1478.

Becker E, Soler R, Yuste V, Gine E, Sanz-Rodriguez C, Egea J, Martin-Zanca D, Comella

J (1998) Development of survival responsiveness to brain-derived neurotrophic

factor, neurotrophin 3 and neurotrophin 4/5, but not to nerve growth factor, in

cultured motoneurons from chick embryo spinal cord. Journal of Neuroscience

18:7903-7911.

130

Bito H, Takemoto-Kimura S (2003) Ca2+/CREB/CBP-dependent gene regulation: a shared

mechanism critical in long-term synaptic plasticity and neuronal survival. Cell

Calcium 34: 425-430.

Bonni A, Brunet A, West A, Datta S, Takasu M, Greenberg M (1999) Cell survival

promoted by the Ras-MAPK signaling pathway by transcription-dependent and

-independent mechanisms. Science 286:1358-1362.

Borodinsky LN, Coso OA, Fiszman ML (2002) Contribution of

Ca2+/calmodulin-dependent protein kinase II and mitogen-activated protein kinase

kinase to neural activity-induced neurite outgrowth and survival of cerebellar

granule cells. Journal of Neurochemistry 80:1062-1070.

Buj-Bello A, Buchman V, Horton A, Rosenthal A, Davies A (1995) GDNF is an

age-specific survival factor for sensory and autonomic neurons. Neuron

15:821-828.

Castren E, Pitkanen M, Sirvio J, Parsadanian A, Lindholm D, Thoenen H, Riekkinen PJ

(1993) The induction of LTP increases BDNF and NGF mRNA but decreases

NT-3 mRNA in the dentate gyrus. Neuroreport 4:895-898.

Catsicas M, Pequinot Y, Clarke PGH (1992) Rapid onset of neuronal death induced by

blockade of either axoplasmic transport or action potentials in afferent fibers

during brain development. Journal of Neuroscience 12:4642-4650.

131

Chang K, Berg D (1999) Nicotinic acetylcholine receptors containing a7 subunits are

required for reliable synaptic transmission in situ. Journal of Neuroscience

19:3701-3710.

Chang K, Berg D (2001) Voltage-gated channels block nicotinic regulation of CREB

phosphorylation and gene expression in neurons. Neuron 32:855-865.

Chen M, Pugh P, Margiotta J (2001) Nicotinic synapses formed between chick ciliary

ganglion neurons in culture resemble those present on the neurons in vivo. Journal

of Neurobiology 47:265-279.

Dechant G, Biffo S, Okazawa H, Kolbeck R, Pottgiesser J, Barde YA (1993) Expression

and binding characteristics of the BDNF receptor chick trkB. Development

119:545-558.

Dudek H, Datta S, Franke T, Birnbaum M, Yao R, Cooper G, Segal R, Kaplan D,

Greenberg M (1997) Regulation of neuronal survival by the serine-threonine

protein kinase Akt. Science 275:661-665.

Eckenstein F, Esch F, Holbert T, Blacher R, Nishi R (1990) Purification and

characterization of a trophic factor for embryonic peripheral neurons: comparison

with fibroblast growth factors. Neuron 4:623-631.

132

Farnsworth C, Freshney N, Rosen L, Ghosh A, Greenberg ME, Feig L (1995) Calcium

activation of Ras mediated by neuronal exchange factor Ras-GRF. Nature

376:524-527.

Franklin JL, Sanz-Rodriguez C, Juhasz A, Deckwerth TL, Johnson EM, Jr. (1995)

Chronic depolarization prevents programmed death of sympathetic neurons in

vitro but does not support growth: requirement for Ca2+ influx but not Trk

activation. Journal of Neuroscience 15:643-664.

Freidin M (2004) Antibody to the extracellular domain of the low affinity NGF receptor

stimulates p75NGFR-mediated apoptosis in cultured sympathetic neurons. Journal of

Neuroscience Research 64:331-340.

Furber S, Oppenheim RW, Prevette D (1987) Naturally-occurring neuron death in the

ciliary ganglion of the chick embryo following removal of preganglionic input:

evidence for the role of afferents in ganglion cell survival. Journal of Neuroscience

7:1816-1832.

Galli-Resta L, Ensini M, Fusco E, Gravina A, Margheritti B (1993) Afferent spontaneous

electrical activity promotes the survival of target cells in the developing

retinotectal system of the rat. Journal of Neuroscience 13:243-250.

Gallo V, Kingsbury A, Balazs R, Jorgensen O (1987) The role of depolarization in the

survival and differentiation of cerebellar granule cells in culture. Journal of

Neuroscience 7:2203-2213.

133

Ghosh A, Carnahan J, Greenberg M (1994) Requirement for BDNF in activity-dependent

survival of cortical neurons. Science 263:1618-1623.

Goodman L, Valverde J, Lim F, Geschwind M, Federoff H, Geller A, Hefti F (1996)

Regulated release and polarized localization of brain-derived neurotrophic factor

in hippocampal neurons. Molecular and Cellular Neuroscience 7:222-238.

Hack N, Hidaka H, Wakefield MJ, Balazs R (1993) Promotion of granule cell survival by

high K+ or excitatory amino acid treatment and Ca2+/calmodulin-dependent

protein kinase activity. Neuroscience 57:9-20.

Hallbook F, Backstrom A, Kullander K, Kylberg A, Williams R, Ebendal T (1995)

Neurotrophins and their receptors in chicken neuronal development. Int J Dev Biol

39:855-868.

Hansen MR, Zha X, Bok J, Green SH (2001) Multiple distinct signal pathways, including

an autocrine neurotrophic mechanism, contribute to the survival-promoting effect

of depolarization on spiral ganglion neurons in vitro. Journal of Neuroscience

21:2256-2267.

Hanson PI, Schulman H (1992) Neuronal Ca/calmodulin-dependent protein kinases.

Annual Review of Biochemistry 61:559-601.

134

Hashino E, Shero M, Junghans D, Rohrer H, Milbrandt J, Johnson EM, Jr. (2001) GDNF

and neurturin are target-derived factors essential for cranial parasympathetic

neuron development. Development 128:3773-3782.

Heller s, Finn TP, Huber J, Nishi R, Geissen M, Puschel AW, Rohrer H (1995) Analysis of

function and expression of the chick GPA receptor (GPARa) suggests multiple

roles in neuronal development. Development 121:2681-2693.

Hetman M, Kanning K, Cavanaugh J, Xia Z (1999) Neuroprotection by brain-derived

neurotrophic factor is mediated by extracellular signal-regulated kinase and

phosphatidylinositol 3-kinase. Journal of Biological Chemistry 274:22569-22580.

Huang EJ, Reichardt LF (2001) Neurotrophins: Roles in neuronal development and

function. Annual Review of Neuroscience 24:677-736.

Ip N, Yancopoulos G (1996) The neurotrophins and CNTF: two families of collaborative

neurotrophic factors. Annual Review of Neuroscience 19:491-515.

Kingsbury T, Murray P, Bambrick L, BK K (2003) Ca2+-dependent regulation of TrkB

expression in neurons. Journal of Biological Chemistry 278:40744-40748.

Landmesser L, Pilar G (1972) The onset and development of transmission in the chick

ciliary ganglion. Journal of Physiology 222:691-713.

Landmesser L, Pilar G (1974a) Synaptic transmission and cell death during normal

ganglionic development. Journal of Physiology 241:737-749.

135

Landmesser L, Pilar G (1974b) Synapse formation during embryogenesis on ganglion

cells lacking a periphery. Journal of Physiology 241:715-736.

Landmesser L, Pilar G (1978) Interactions between neurons and their targets during in

vivo synaptogenesis. Federation Proceedings 37:2016-2022.

Leung D, Parent A, Cachianes G, Esch F, Coulombe J, Nikolics K, Eckenstein F, Nishi R

(1992) Cloning, expression during development, and evidence for release of a

trophic factor for ciliary ganglion neurons. Neuron 8:1045-1053.

Lindsay RM, Thoenen H, Barde YA (1985) Placode and neural crest-derived sensory

neurons are responsive at early developmental stages to brain-derived neurotrophic

factor. Developmental Biology 112:319-328.

Lipton SA (1986) Blockade of electrical activity promotes the death of mammalian retinal

ganglion cells in culture. PNAS 83:9774-9778.

Meriney SD, Pilar G, Ogawa M, Nunez R (1987) Differential neuronal survival in the

avian ciliary ganglion after chronic acetylcholine receptor blockade. Journal of

Neuroscience 7:3840-3849.

Meyer-Franke A, Wilkinson G, Kruttgen A, Hu M, Munro E, Jr HM, Reichardt L, Barres

B (1998) Depolarization and cAMP elevation rapidly recruit TrkB to the plasma

membrane of CNS neurons. Neuron 21:681-693.

136

Nishi R, Berg DK (1981) Two components from eye tissue that differentially stimulate the

growth and development of ciliary ganglion neurons in cell culture. Journal of

Neuroscience 1:505-513.

Pugh P, Margiotta J (2000) Nicotinic acetylcholine receptor agonists promote survival and

reduce apoptosis of chick ciliary ganglion neurons. Mol Cell Neurosci 15:113-122.

Pugh P, Zhou X, Nai Q, Margiotta J (2005) PACAP- and neurotrophin-generated signals

converge on MAPK to support parasympathetic neuronal survival. Submitted.

Rodriguez-Tebar A, Barde Y (1988) Binding characteristics of brain-derived neurotrophic

factor to its receptors on neurons from the chick embryo. Journal of Neuroscience

8:3337-3342.

Rohrer H, Sommer I (1983) Simultaneous expression of neuronal and glial properties by

chick ciliary ganglion cells during development. Journal of Neuroscience

3:1683-1693.

Rosen LB, Ginty DD, Weber MJ, Greenberg ME (1994) Membrane depolarizing and

calcium influx stimulate MEK and MAP kinase via activation of ras. Neuron

12:1207-1221.

Scott BS, Fisher KC (1970) Potassium concentration and number of neurons in cultures of

dissociated ganglia. Experimental Neurology 27:16-22.

137

Segal R (2003) Selectivity in neurotrophin signaling: theme and variations. Annual

Review of Neuroscience 26:299-330.

Segal R, Greenberg M (1996) Intracellular signaling pathways activated by neurotrophic

factors. Annual Review of Neuroscience 19:463-489.

Vaillant A, Mazzoni I, Tudan C, Boudreau M, Kaplan D, Miller F (1999) Depolarization

and neurotrophins converge on the phosphatidylinositol 3-kinase-Akt pathway to

synergistically regulate neuronal survival. Journal of Cell Biology 146:955-966.

Wescamp G, Reichardt LF (1991) Evidence that biological activity of NGF is mediated

through a novel subclass of high-affinity receptors. Neuron 6:649-663.

Wright L (1981) Cell survival in chick embryo ciliary ganglion is reduced by chronic

ganglionic blockade. Dev Brain Res 1:283-286.

Yamashita T, Tucker K, Barde Y (1999) Neurotrophin binding to the p75 receptor

modulates Rho activity and axonal growth. Neuron 24:585-593.

Yao R, Cooper G (1995) Requirement for phosphatidylinositol-3 kinase in the prevention

of apoptosis by nerve growth factor. Science 267:2003-2006.

Zafra F, Hengerer B, Leibrock J, Thoenen H, Lindholm D (1990) Activity dependent

regulation of BDNF and NGF mRNAs in the rat hippocampus is mediated by

non-NMDA glutamate receptor. EMBO Journal 9:3545-3550.

138

Zhou X, Nai Q, Chen M, Dittus J, Howard M, Margiotta J (2004) Brain-derived

neurotrophic factor and trkB signaling in parasympathetic neurons: relevance to

regulating alpha7-containing nicotinic receptors and synaptic function. Journal of

Neuroscience 24:4340-4350.

139

Figure 1.

Figure 2.

140

Figure 3.

141

Figure 4.

142

DISCUSSION/SUMMARY

Neurotrophin family is composed of NGF, BDNF and NT3, which are widely expressed in

nervous system and responsible for regulating survival, differentiation and synaptic

plasticity. Two types of receptors are mediating neurotrophin signaling cascades, Trk and

p75. NGF binds specifically to TrkA, BDNF binds to TrkB and NT-3 mainly requires

TrkC with a few exceptions on TrkA and TrkB (Huang and Reichardt, 2001; Segal, 2003).

The first chapter in this dissertation discusses the recent finding of novel BDNF/TrkB

signaling identified in chick CG system, indicating the regulation of BDNF on nAChR

expression, function, and synaptic activities. And the second chapter demonstrated the

involvement of endogenous BDNF in depolarization-induced CG neuron survival in

culture, suggesting a potential role for BDNF in promoting neuronal survival in vivo.

Although previous studies suggested the irrelevance of BDNF to chick CG neurons

(Rohrer and Sommer, 1983; Dechant et al., 1993b), our current results demonstrated the

expression of BDNF and TrkB on the surface of CG neurons. The contradictory results

may be explained as the difference between assay sensitivities (PCR versus Northern

blotting and RNAse protection assay). Full length and truncated forms of TrkB receptors

were identified with PCR amplification in both E8 CG and E14 CG. The function of

truncated TrkB receptor detected in CGs is not clear, which may act as a negative

regulator on the full length TrkB receptor (Baxter et al., 1997).

143

The expression of BDNF in CG neurons was confirmed with both PCR amplification for

mRNA detection and enzyme-linked immunosorbent assay (ELISA) for protein presence.

Both E8 and E14 CG express BDNF mRNA and protein. In accord with “target-derived”

theory in other systems, one of the postganglionic targets-iris, also displays the presence

of BDNF-like protein, which suggests that BDNF may be retrogradely transported back to

CG neurons and exert its effects mediated by TrkB receptors. Interestingly, recent

evidence has demonstrated that BDNF, applied at low concentration, supported survival of

CG neurons in culture (Pugh et al., submitted). The presence of BDNF at E8 and E14, both

of which flank the specific time period when natural cell death occurs within CGs, implies

the potential involvement of this neurotrophin molecule in regulating neuronal survival in

vivo.

Chronic treatment of BDNF dramatically increased α7-nAChR subunit mRNA level and

αΒgt surface binding sites, which parallels the previous result of NGF regulating

α7 subunit expression in the PC12 cells (Takahashi et al., 1999). Function blocking

antibodies to the p75 receptor, present on the surface of CG neurons (Allsopp et al., 1993),

were not capable of reducing the BDNF-induced effects, suggesting that such a process is

more likely mediated through functional TrkB receptors. Analysis of the α7 subunit

promoter region demonstrated a few potential sites including the binding sites for

transcription factor CRE and AP1, which have been implicated in BDNF-induced gene

expression and induction previously (Gaiddon et al., 1996; Finkbeiner et al., 1997).

144

In addition to regulation in expression of α7 nAChRs, BDNF also enhanced the whole cell

currents mediated by α7 nAChRs, as well as the synaptic activities characterized as

sEPSCs in CG neuron culture. Similarly the increase in the amplitude of whole cell current

is not blocked by the application of p75 receptor function blocking antibody. The elevated

synaptic activity was detected in all three treatment periods, implying that BDNF may

regulate the synaptic function at different levels. Although both BDNF/TrkB and

α7 nAChRs are able to regulate neurotransmission in an acute manner, it is surprising to

observe that coapplication of αBgt with BDNF did not block the BDNF-induced increase

in sEPSC frequency, which is an indicator of presynaptic rather than postsynaptic

regulation. This is probably due to the activation of TrkB-PLC-γ1 signaling pathway,

which increases the calcium influx and the Ach release from the presynaptic terminals.

There are more related questions which remain to be explored. For example, where is the

source of BDNF detected in CG? Since no further work was performed to demonstrate the

periodic expression pattern of BDNF, it also would be interesting to know whether BDNF

was even detectable in the earlier stage of CG development (before E8). If so, did the

presence of BDNF regulate the formation of functional chemical synapses in CG? In

addition to the presence of BDNF and TrkB in CG, both NGF and NT3 mRNAs and their

respective receptors (TrkA and TrkC) were also detected (Pugh, Zhou, Nai, Margiotta,

submitted). Whether these two NT receptor signalings are involved in regulating nAChR

function and/or expression remains elusive. Moreover, further work needs to be done

145

using specific inhibitors against downstream molecules (e.g., MAPK-PD98059,

PI-3K-LY294002), in order to elucidate the exact BDNF/TrkB pathway.

Interestingly, BDNF displays activity-dependent expression pattern in CG neuron culture.

Chronic depolarization significantly increased BDNF mRNA and protein expressions,

which is more dramatic compared to previous reports with shorter treatment period (Zafra

et al., 1990; Goodman et al., 1996). Moreover BDNF expression was also upregulated by

the activation of nAChRs induced by nicotine, implying the reciprocal regulation between

BDNF and AChRs. It is speculated that the increase in BDNF expressions was caused by

the calcium influx through voltage-gated calcium channels or α7 nAChRs. Such theory

requires further work to be confirmed, such as application of αΒgt along with nicotine, or

blockage on specific subtypes of voltage-gated calcium channels.

Depolarization-induced survival was blocked by BDNF-IgG, which acts as a neutralizing

antibody to endogenous BDNF. Contrary to previous reports (Rohrer and Sommer, 1983;

Lindsay et al., 1985b), the recent result suggests the involvement of BDNF in supporting

CG neuron survival in vitro. It is proposed that BDNF was released into culture media

induced by depolarization, in one model called “autocrine pathway” (Ghosh et al., 1994;

Hansen et al., 2001). Moreover, CaMKII also was required for supporting CG neuronal

survival in vitro. Activation of CaMKII by depolarization is believed to increase CREB

phosphorylation (Chang and Berg, 2001), which subsequently turns on the translation of

those survival-supporting genes. In addition, gradual decline in BDNF expression level

146

from E8 to E14, corresponding perfectly to the decreased survived neurons during this

specific “apoptotic” period, strongly suggested that BDNF may be the factor supporting

CG neuron survival during the development. However, further studies are still required to

demonstrate the role of BDNF in vivo. For example, by overexpression of BDNF/TrkB in

CG during the embryonic stage or injection of BDNF into CG following the axotomy of

CG peripheral nerves, CG neuronal survival will be examined to elucidate the BDNF

effects.

In summary, the results in this dissertation demonstrated that both BDNF and its specific

receptor TrkB are expressed in chicken CG neurons. Application of BDNF in CG neuronal

culture upregulated the expression and function of α7-nAChRs, but not those of

α3-nAChRs. In addition, BDNF increased the synaptic activity displayed by functional

cholinergic synapses in CG cultures as well. The expression of BDNF in CGs is

upregulated in an activity-dependent pattern in vitro, and the increase in the syntheis and

release of endogeous BDNF was shown responsible for supporting CG neuronal survival

induced by the depolarization. Combined with the detection of BDNF mRNAs and

proteins from E8 to E14 CGs, the results above implies the essential role of BDNF in

regulating the formation, maturation and maintenance of functional cholinergic synapses,

as well as neuronal survival within CGs during the embryogenesis. Such information

obtained above is pioneer in demonstrating the role of BDNF in the early developmental

stage of chicken CG neurons, and will be critical for better understanding of

147

trophic-dependency of CG neuron survival and regulation on nAChR-contained excitatory

synapses formed within CG neurons in vivo.

148

REFERENCES

Aakalu, G.; Smith, W.B.; Nguyen, N.; Jiang, C. and Schuman, E. 2001 Dynamic

visualization of local protein synthesis in hippocampal neurons. Neuron,

30:489-502.

Airaksinen, M. and Saarma, M. 2002 The GDNF family: signalling, biological functions

and therapeutic value. Nature reviews. Neuroscience., 3:383-394.

Airaksinen, M.; Titievsky, A. and Saarma, M. 1999 GDNF family neurotrophic factor

signaling: four masters, one servant? Molecular and Cellular Neuroscience,

13:313-325.

Akaneya, Y.; Tsumoto, T. and Hatanaka, H. 1996 Brain-derived neurotrophic factor

blocks long-term depression in rat visual cortex. J. Neurophysiology,

76:4198-4201.

Akaneya, Y.; Tsumoto, T.; Kinoshita, S. and Hatanaka, H. 1997 Brain-derived

neurotrophic factor enhances long-term potentiation in rat visual cortex. J.

Neuroscience, 17:6707-6716.

Akira, S.; Nishio, Y.; Inoue, M.; Wang, X.J.; Wei, S.; Matsusaka, T.; Yoshida, K.; Sudo,

T.; Naruto, M. and Kishimoto, T. 1994 Molecular cloning of APRF, a novel

IFN-stimulated gene factor3 p91-related transcription factor involved in th

egp130-mediated signaling pathway. Cell, 77:63-71.

Alcantara, S.; Frisen, J.; del Rio, J.; Soriano, E.; Barbacid, M. and Silos-Santiago, I. 1997

TrkB signaling is required for postnatal survival of CNS neurons and protects

149

hippocampal and motor neurons from axotomy-induced cell death. J.

Neuroscience, 17:3623-3633.

Alessi, D.; Deak, M.; Casamayor, A.; Caudwell, F.; Morrice, N.; Norman, D.; Gaffney, P.;

Reese, C.; MacDougall, C.; Harbison, D.; Ashworth, A. and Bownes, M. 1997

3-Phosphoinositide-dependent protein kinase-1 (PDK1): structural and functional

homology with the Drosophila DSTPK61 kinase. Current Biology, 7:776-789.

Alessi, D.; Kozlowski, M.; Weng, Q.; Morrice, N. and Avruch, J. 1998

3-Phosphoinositide-dependent protein kinase 1 (PDK1) phosphorylates and

activates the p70 S6 kinase in vivo and in vitro. Current Biology, 8:69-81.

Allendoerfer, K.; Cabelli, R.; Escandon, E.; Kaplan, D.; Nikolics, K. and Shatz, C. 1994

Regulation of neurotrophin receptors during the maturation of the mammalian

visual system. J. Neurosci., 14:1795-1811.

Allsopp, T.; Kiselev, S.; Wyatt, S. and Davies, A. 1995 Role of Bcl-2 in the brain-derived

neurotrophic factor survival response. Eur. J. Neuroscience, 7:1266-1272.

Allsopp, T.; Robinson, M.; Wyatt, S. and Davies, A. 1993 Ectopic trkA expression

mediates a NGF survival response in NGF-independent sensory neurons but not in

parasympathetic neurons. The Journal of cell biology., 123:1555-1566.

Aloyz, R.; Bamji, S.; Pozniak, C.; Toma, J.; Atwal, J.; Kaplan, D. and Miller, F. 1998 p53

is essential for developmental neuron death as regulated by the TrkA and p75

neurotrophin receptors. The Journal of cell biology., 143:1691-1703.

150

Anderson, C. and Tolkovsky, A. 1999 A role for MAPK/ERK in sympathetic neuron

survival: protection against a p53-dependent, JNK-independent induction of

apoptosis by cytosine arabinoside. J. Neuroscience, 19:664-673.

Anderson, D.J. 1999 Lineages and transcription factors in the specification of vertebrate

primary sensory neurons. Current Opinion in Neurobiology, 9:517-524.

Angeletti, R.H. and Bradshaw, R.A. 1971 The amino acid sequence of 2.5s mouse

submaxillary gland nerve growth factor. Proceedings National Academy of

Sciences USA, 68:2417-2420.

Arakawa, T.; Haniu, M.; Narhi, L.; Miller, J.; Talvenheimo, J.; Philo, J.; Chute, H.;

Matheson, C.; Carnahan, J.; Louis, J. and al, e. 1994 Formation of heterodimers

from three neurotrophins, nerve growth factor, neurotrophin-3, and brain-derived

neurotrophic factor. The Journal of biological chemistry., 269:27833-27839.

Arenas, E.; Trupp, M.; Akerud, P. and Ibanez, C. 1995 GDNF prevents degeneration and

promotes the phenotype of brain noradrenergic neurons in vivo. Neuron,

15:1465-1473.

Armanini, M.; McMahon, S.; Sutherland, J.; Shelton, D. and Phillips, H. 1995 Truncated

and catalytic isoforms of trkB are co-expressed in neurons of rat and mouse CNS.

Eur. J. Neuroscience, 7:1403-1409.

Arumae, U.; Pirvola, U.; Palgi, J.; Kiema, T.R.; Palm, K.; Moshnyakov, M.; Ylikoski, J.

and Saarma, M. 1993 Neurotrophins and their receptors in rat peripheral trigeminal

system during maxillary nerve growth. J. Cell Biol., 122:1053-1065.

151

Atwal, J.; Massie, B.; Miller, F. and Kaplan, D. 2000 The TrkB-Shc site signals neuronal

survival and local axon growth via MEK and P13-kinase. Neuron, 27:265-277.

Avila, M.; Varela-Nieto, I.; Romero, G.; Mato, J.; Giraldez, F.; Van De Water, T. and

Represa, J. 1993 Brain-derived neurotrophic factor and neurotrophin-3 support the

survival and neuritogenesis response of developing cochleovestibular ganglion

neurons. Developmental Biology, 159:266-275.

Balendran, A.; Casamayor, A.; Deak, M.; Paterson, A.; Gaffney, P.; Currie, R.; Downes,

C. and Alessi, D. 1999 PDK1 acquires PDK2 activity in the presence of a synthetic

peptide derived from the carboxyl terminus of PRK2. Current Biology, 9:393-404.

Balkowiec, A. and Katz, D. 2000 Activity-dependent release of endogenous brain-derived

neurotrophic factor from primary sensory neurons detected by ELISA in situ. J.

Neuroscience, 20:7417-7423.

Ballarin, M.; Ernfors, P.; Lindefors, N. and Persson, H. 1991 Hippocampal damage and

kainic acid injection induces a rapid increase in mRNA for BDNF and NGF in rat

brain. Experimental Neurology, 114:35-43.

Baloh, R.; Enomoto, H.; Jr, J.E. and Milbrandt, J. 2000 The GDNF family ligands and

receptors - implications for neural development. Current Opinion in Neurobiology,

10:103-110.

Baloh, R.; Tansey, M.; Golden, J.; Creedon, D.; Heuckeroth, R.; Keck, C.; Zimonjic, D.;

Popescu, N.; Jr, J.E. and Milbrandt, J. 1997 TrnR2, a novel receptor that mediates

neurturin and GDNF signaling through Ret. Neuron, 18:793-802.

152

Baloh, R.; Tansey, M.; Lampe, P.; Fahrner, T.; Enomoto, H.; Simburger, K.; Leitner, M.;

Araki, T.; Jr, J.E. and Milbrandt, J. 1998 Artemin, a novel member of the GDNF

ligand family, supports peripheral and central neurons and signals through the

GFRalpha3-RET receptor complex. Neuron, 21:1291-1302.

Barbacid, M. 1994 The trk family of neurotrophin receptors. J. Neurobiology,

25:1386-1403.

Barbin, G.; Manthorpe, M. and Varon, S. 1984 Purification of the chick eye ciliary

neuronotrophic factor. Journal of Neurochemistry, 43:1468-1478.

Barde, Y.A.; Edgar, D. and Thoenen, H. 1982 Purification of a new neurotrophic factor

from mammalian brain. EMBO J., 1:549-553.

Barker, P.; Lomen-Hoerth, C.; Gensch, E.; Meakin, S.; Glass, D. and Shooter, E. 1993

Tissue-specific alternative splicing generates two isoforms of the trkA receptor. J.

Biological Chemistry, 268:15150-15157.

Baxter, G.T.; Radeke, M.J.; Kuo, R.C.; Markrides, V.; Hinkle, B.; Hoang, R.;

Medina-Selby, A.M.; Coit, D.; Valenzuela, P. and Feinstein, S.C. 1997 Signal

transduction mediated by the truncated TrkB receptro isoforms trkB.T1 and

trkB.T2. J. Neuroscience, 17:2683-2690.

Bazan, J.F. 1991 Neuropietic cytokines in the hematopoietic fold. Neuron, 7:197-208.

Beck, K.; Lamballe, F.; Klein, R.; Barbacid, M.; Schauwecker, P.; McNeill, T.; Finch, C.;

Hefti, F. and Day, J. 1993 Induction of noncatalytic TrkB neurotrophin receptors

during axonal sprouting in the adult hippocampus. J. Neuroscience, 13:4001-4014.

153

Becker, E.; Soler, R.; Yuste, V.; Gine, E.; Sanz-Rodriguez, C.; Egea, J.; Martin-Zanca, D.

and Comella, J. 1998 Development of survival responsiveness to brain-derived

neurotrophic factor, neurotrophin 3 and neurotrophin 4/5, but not to nerve growth

factor, in cultured motoneurons from chick embryo spinal cord. J. Neuroscience,

18:7903-7911.

Bellacosa, A.; Testa, J.; Staal, S. and Tsichlis, P. 1991 A retroviral oncogene, akt,

encoding a serine-threonine kinase containing an SH2-like region. American

Association for the Advancement of Science. Science, 254:274-277.

Bengzon, J.; Soderstrom, S.; Kokaia, Z.; Kokaia, M.; Ernfors, P.; Persson, H.; Ebendal, T.

and Lindvall, O. 1992 Widespread increase of nerve growth factor protein in the

rat forebrain after kindling-induced seizures. Brain Research, 587:338-342.

Berg, D.K. 1984 New neuronal growth factors. Annu Rev Neurosci., 7.

Berkemeier, L.R.; Winslow, J.W.; Kaplan, D.R.; Nikolics, K.; Goeddel, D.C. and

Rosenthal, A. 1991 Neurotrophin-5: a novel neurotrophic factor that activates

TrkA and TrkB. Neuron, 7:857-866.

Berninger, B.; Garda, D.E.; Inagaki, N.; Hahnel, C. and Lindholm, D. 1993 BDNF and

NT-3 induce intracellular Ca2+-elevation in hippocampal neurons. Neuroreport,

4:1303-1306.

Berninger, B.; Marty, S.; Zafra, F.; Berzaghi, M.; Thoenen, H. and Lindholm, D. 1995

GABAergic stimulation stwitches from enhancing to repressing BDNF expression

in rat hippocampal neurons during maturation in vitro. Development,

121:2327-2335.

154

Berzaghi, M.P.; Cooper, J.; Castren, E.; Zafra, F.; Sofroniew, M.; Thoenen, H. and

Lindholm, D. 1993 Cholinergic regulation of brain-derived neurotrophic factor

(BDNF) and nerve growth factor (NGF) but not neurotrophin-3 (NT-3) mRNA

levels in the developing rat hippocampus. J. Neuroscience, 13:3816-3826.

Birren, S.; Lo, L. and Anderson, D. 1993 Sympathetic neuroblasts undergo a

developmental switch in trophic dependence. Development (Cambridge, England),

119:597-610.

Bito, H.; Deisseroth, K. and Tsien, R. 1996 CREB phosphorylation and

dephosphorylation: a Ca(2+)- and stimulus duration-dependent switch for

hippocampal gene expression. Cell (Cambridge), 87:1203-1214.

Blaquet, P.R. and Lamour, Y. 1997 Brain-derived neurotrophic factor increases

Ca2+/calmodulin-dependent protein kinase 2 activity in hippocampus. J.

Biological Chemistry, 272:24133-24136.

Blochl, A. and Sirrenberg, C. 1996 Neurotrophins stimulate the release of dopamine from

rat mesencephalic neurons via Trk and p75Lntr receptors. The Journal of

biological chemistry., 271:21100-21107.

Blochl, A. and Thoenen, H. 1995 Characterization of nerve growth factor (NGF) release

from hippocampal neurons: evidence for a constitutive and an unconventional

sodium-dependent regulated pathway. Eur. J. Neuroscience, 7:1220-1228.

Blumenthal, E.M.; Shoop, R.D. and Berg, D.K. 1999 Developmental changes in the

nicotinic responses of ciliary ganglion neurons. J. Neurophysiol., 81:111-120.

155

Bonni, A.; Brunet, A.; West, A.; Datta, S.; Takasu, M. and Greenberg, M. 1999 Cell

survival promoted by the Ras-MAPK signaling pathway by

transcription-dependent and -independent mechanisms. American Association for

the Advancement of Science. Science, 286:1358-1362.

Borasio, G.; Markus, A.; Wittinghofer, A.; Barde, Y. and Heumann, R. 1993 Involvement

of ras p21 in neurotrophin-induced response of sensory, but not sympathetic

neurons. The Journal of cell biology., 121:665-672.

Borodinsky, L.N.; Coso, O.A. and Fiszman, M.L. 2002 Contribution of

Ca2+/calmodulin-dependent protein kinase II and mitogen-activated protein

kinase kinase to neural activity-induced neurite outgrowth and survival of

cerebellar granule cells. J. Neurochemistry, 80:1062-1070.

Borrello, M.; Alberti, L.; Arighi, E.; Bongarzone, I.; Battistini, C.; Bardelli, A.; Pasini, B.;

Piutti, C.; Rizzetti, M.; Mondellini, P.; Radice, M. and Pierotti, M. 1996 The full

oncogenic activity of Ret/ptc2 depends on tyrosine 539, a docking site for

phospholipase Cgamma. Molecular and Cellular Biology, 16:2151-2163.

Bothwell, M. 1995 Functional interactions of neurotrophins and neurotrophin receptors.

Annu Rev Neurosci., 18:223-253.

Boulanger, L. and Poo, M. 1999a Gating of BDNF-induced synaptic potentiation by

cAMP. Science, 284:1982-1984.

Boulanger, L. and Poo, M. 1999b Presynaptic depolarization facilitates

neurotrophin-induced synaptic potentiation. Nature Neuroscience, 2:346-351.

156

Boulton, T.; Nye, S.; Robbins, D.; Ip, N.; Radziejewska, E.; Morgenbesser, S.; DePinho,

R.; Panayotatos, N.; Cobb, M. and Yancopoulos, G. 1991 ERKs: a family of

protein-serine/threonine kinases that are activated and tyrosine phosphorylated in

response to insulin and NGF. Cell (Cambridge), 65:663-675.

Bramham, C.R.; Southard, T.; Sarvey, J.M.; Herkenham, M. and Brady, L.S. 1996

Unilateral LTP triggers bilateral increases in hippocampal neurotrophin and trk

receptor mRNA expression in behaving rats: evidence for interhemispheric

communication. J. Comp. Neurol., 368:371-382.

Bresnahan, P.A.; Leduc, R.; Thomas, L.; Thorner, J.; Gibson, H.L.; Brake, A.J.; Barr, P.J.

and Thomas, G. 1990 Human fur gene encodes a yeast KEX2-like endoprotease

that cleaves pro-ß-NGF in vivo. J. Cell Biol., 111:2851-2859.

Broide, R.S. and Leslie, F.M. 1999 The a7 nicotinic receptor in neuronal plasticity.

Molecular Neurobiology, 20:1-16.

Brumwell, C.L.; Johnson, J.L. and Jacob, M.H. 2002 Extrasynaptic a7-nicotinic

acetylcholine receptor expression in developing neurons is regulated by inputs,

targets, and activity. J. Neuroscience, 22:8101-8109.

Brunet, A.; Bonni, A.; Zigmond, M.; Lin, M.; Juo, P.; Hu, L.; Anderson, M.; Arden, K.;

Blenis, J. and Greenberg, M. 1999 Akt promotes cell survival by phosphorylating

and inhibiting a Forkhead transcription factor. Cell (Cambridge), 96:857-868.

Brunet, A.; Kanai, F.; Stehn, J.; Xu, J.; Sarbassova, D.; Frangioni, J.; Dalal, S.; DeCaprio,

J.; Greenberg, M. and Yaffe, M. 2002 14-3-3 transits to the nucleus and

157

participates in dynamic nucleocytoplasmic transport. The Journal of cell biology.,

156:817-828.

Brunso-Bechtold, J. and Hamburger, V. 1979 Retrograde transport of nerve growth factor

in chicken embryo. Proceedings of the National Academy of Sciences,

76:1494-1496.

Buchman, V. and Davies, A. 1993 Different neurotrophins are expressed and act in a

developmental sequence to promote the survival of embryonic sensory neurons.

Development (Cambridge, England), 118:989-1001.

Bueker, E.D. 1948 Implantation of tumors in the hind limb field of the embryonic chick

and the developmental response of the lumbosacral nervous system. Anat. Rec.,

102:369-389.

Buj-Bello, A.; Buchman, V.; Horton, A.; Rosenthal, A. and Davies, A. 1995 GDNF is an

age-specific survival factor for sensory and autonomic neurons. Neuron,

15:821-828.

Buj-Bello, A.; Pinon, L. and Davies, A. 1994 The survival of NGF-dependent but not

BDNF-dependent cranial sensory neurons is promoted by several different

neurotrophins early in their development. Development (Cambridge, England),

120:1573-1580.

Burns, A.L.; Benson, D.; Howard, M.J. and Margiotta, J.F. 1997 Chick ciliary ganglion

neurons contain transcripts coding for acetylcholine receptor-associated protein at

synapses (Rapsyn). J. Neurosci., 17:5016-5026.

158

Cabelli, R.; Hohn, A. and Shatz, C. 1995 Inhibition of ocular dominance column

formation by infusion of NT-4/5 or BDNF. American Association for the

Advancement of Science. Science, 267:1662-1666.

Cacalano, G.; Farinas, I.; Wang, L.; Hagler, K.; Forgie, A.; Moore, M.; Armanini, M.;

Phillips, H.; Ryan, A.; Reichardt, L.; Hynes, M.; Davies, A. and Rosenthal, A.

1998 GFRalpha1 is an essential receptor component for GDNF in the developing

nervous system and kidney. Neuron, 21:53-62.

Canossa, M.; Griesbeck, O.; Berninger, B.; Campana, G.; Kolbeck, R. and Thoenen, H.

1997 Neurotrophin release by neurotrophins: implications for activity-dependent

neuronal plasticity. Proceedings of the National Academy of Sciences,

94:13279-13286.

Cardone, M.; Roy, N.; Stennicke, H.; Salvesen, G.; Franke, T.; Stanbridge, E.; Frisch, S.

and Reed, J. 1998 Regulation of cell death protease caspase-9 by phosphorylation.

American Association for the Advancement of Science. Science, 282:1318-1321.

Carmignoto, G.; Pizzorusso, T.; Tia, S. and Vicini, S. 1997 Brain-derived neurotrophic

factor and nerve growth factor potentiate excitatory synaptic transmission in the rat

visual cortex. The Journal of physiology., 498 ( Pt 1):153-164.

Carroll, P.; Lewin, G.; Koltzenburg, M.; Toyka, K. and Thoenen, H. 1998 A role for

BDNF in mechanosensation. Nature Neuroscience, 1:42-46.

Carroll, S.; Silos-Santiago, I.; Frese, S.; Ruit, K.; Milbrandt, J. and Snider, W. 1992 Dorsal

root ganglion neurons expressing trk are selectively sensitive to NGF deprivation

in utero. Neuron, 9:779-788.

159

Carter, B.D.; Kaltschmidt, C.; Kaltschmidt, B.; Offenhauser, N.; Bohm-Maththaei, R.;

Baeuerle, P.A. and Barde, Y.A. 1996 Selective activation of NFêB by nerve growth

factor through the neurotrophin receptor p75. Science, 272:542-545.

Casaccia-Bonnefil, P.; Carter, B.D.; Dobrowsky, R.T. and Chao, M.V. 1996 Death of

oligodendrocytes mediated by the interaction of nerve growth factor with its

receptor p75. Nature, 383:716-719.

Castren, E.; Pitkanen, M.; Sirvio, J.; Parsadanian, A.; Lindholm, D.; Thoenen, H. and

Riekkinen, P.J. 1993 The induction of LTP increases BDNF and NGF mRNA but

decreases NT-3 mRNA in the dentate gyrus. Neuroreport, 4:895-898.

Castren, E.; Zafra, F.; Thoenen, H. and Lindholm, D. 1992 Light Regulates Expression of

Brain-Derived Neurotrophic Factor mRNA in Rat Visual Cortex. PNAS,

89:9444-9448.

Catsicas, M.; Pequinot, Y. and Clarke, P.G.H. 1992 Rapid onset of neuronal death induced

by blockade of either axoplasmic transport or action potentials in afferent fibers

during brain development. J. Neuroscience, 12:4642-4650.

Causing, C.G.; Gloster, A.; Aloyz, R.; Bamji, S.X.; Chang, E.; Fawcett, J.; Kuchel, G. and

Miller, F.D. 1997 Synaptic innervation density is regulated by neuron-derived

BDNF. Neuron, 18:257-267.

Cavanaugh, J.; Ham, J.; Hetman, M.; Poser, S.; Yan, C. and Xia, Z. 2001 Differential

regulation of mitogen-activated protein kinases ERK1/2 and ERK5 by

neurotrophins, neuronal activity, and cAMP in neurons. J. Neuroscience,

21:434-443.

160

Chang, K. and Berg, D. 1999 Nicotinic acetylcholine receptors containing a7 subunits are

required for reliable synaptic transmission in situ. J Neurosci, 19:3701-3710.

Chang, K. and Berg, D. 2001 Voltage-gated channels block nicotinic regulation of CREB

phosphorylation and gene expression in neurons. Neuron, 32:855-865.

Chang, S. and Popov, S. 1999 Long-range signaling within growing neurites mediated by

neurotrophin-3. Proceedings of the National Academy of Sciences, 96:4095-4100.

Chao, M.V. 1994 The p75 neurotrophin receptor. J. Neurobiology, 25:1373-1385.

Chen, G.; Kolbeck, R.; Barde, Y.; Bonhoeffer, T. and Kossel, A. 1999 Relative

contribution of endogenous neurotrophins in hippocampal long-term potentiation.

J. Neuroscience, 19:7983-7990.

Chen, K.; Nishimura, M.; Armanini, M.; Crowley, C.; Spencer, S. and Phillips, H. 1997

Disruption of a single allele of the nerve growth factor gene results in atrophy of

basal forebrain cholinergic neurons and memory deficits. J. Neuroscience,

17:7288-7296.

Chen, M.; Pugh, P. and Margiotta, J. 2001 Nicotinic synapses formed between chick

ciliary ganglion neurons in culture resemble those present on the neurons in vivo. J

Neurobiol, 47:265-279.

Cheng, Q. and Yeh, H. 2003 Brain-derived neurotrophic factor attenuates mouse

cerebellar granule cell GABA(A) receptor-mediated responses via postsynaptic

mechanisms. The Journal of physiology., 548:711-721.

Chiariello, M.; Visconti, R.; Carlomagno, F.; Melillo, R.; Bucci, C.; de Franciscis, V.;

Fox, G.; Jing, S.; Coso, O.; Gutkind, J.; Fusco, A. and Santoro, M. 1998 Signalling

161

of the Ret receptor tyrosine kinase through the c-Jun NH2-terminal protein kinases

(JNKS): evidence for a divergence of the ERKs and JNKs pathways induced by

Ret. Oncogene., 16:2435-2445.

Chun, L. and Patterson, P. 1977 Role of nerve growth factor in the development of rat

sympathetic neurons in vitro. I. Survival, growth, and differentiation of

catecholamine production. The Journal of cell biology., 75:694-704.

Claude, P.; Hawrot, E.; Dunis, D. and Campenot, R. 1982 Binding, internalization, and

retrograde transport of 125I-nerve growth factor in cultured rat sympathetic

neurons. J. Neuroscience, 2:431-442.

Coggan, J.S.; Paysan, J.; Conroy, W.G. and Berg, D.K. 1997 Direct recording of nicotinic

responses in presynaptic nerve terminals. J. Neurosci., 17:5798-5806.

Cohen, S. 1960 Purification of a nerve-growth promoting protein from the mouse salivary

gland and its neuro-cytotoxic antiserum. Proceedings National Academy of

Sciences USA, 46:302-311.

Cohen-Cory, S. and Fraser, S. 1995 Effects of brain-derived neurotrophic factor on optic

axon branching and remodelling in vivo. Nature (London), 378:192-196.

Collins, F. and Dawson, A. 1983 An effect of nerve growth factor on parasympathetic

neurite outgrowth. Proceedings of the National Academy of Sciences,

80:2091-2094.

Conover, J.; Erickson, J.; Katz, D.; Bianchi, L.; Poueymirou, W.; McClain, J.; Pan, L.;

Helgren, M.; Ip, N. and Boland, P. 1995 Neuronal deficits, not involving motor

neurons, in mice lacking BDNF and/or NT4. Nature (London), 375:235-238.

162

Conroy, W.G. and Berg, D.K. 1995 Neurons can maintain multiple classes of nicotinic

acetylcholine receptors distinguished by different subunit compositions. J Biol

Chem, 270:4424-4431.

Conroy, W.G.; Vernallis, A.B. and Berg, D.K. 1992 The a5 gene product assembles with

multiple acetylcholine receptor subunits to form distinctive receptor subtypes in

brain. Neuron, 9:679-691.

Corriveau, R.A. and Berg, D.K. 1993 Coexpression of multiple acetylcholine receptor

genes in neurons: quantification of transcripts during development. J Neurosci,

13:2662-2671.

Coughlin, M.; Boyer, D. and Black, I. 1977 Embryologic development of a mouse

sympathetic ganglion in vivo and in vitro. Proceedings of the National Academy of

Sciences, 74:3438-3442.

Couturier, S.; Bertrand, D.; Matter, J.-M.; Hernandez, M.-C.; Bertrand, S.; Millar, N.;

Valera, S.; Barkas, T. and Ballivet, M. 1990a A neuronal nicotinic acetylcholine

receptor subunit (a7) is developmentally regulated and forms a homo-oligomeric

channel blocked by a-Btx. Neuron, 5:847-856.

Couturier, S.; Erkman, L.; Valera, S.; Rungger, D.; Bertrand, S.; Boulter, J.; Ballivet, M.

and Bertrand, D. 1990b a5, a3, and non-a3: three clustered avian genes encoding

nicotinic acetylcholine receptor-related subunits. J. Biol. Chem.,

265:17560-17567.

163

Crowder, R. and Freeman, R. 1998 Phosphatidylinositol 3-kinase and Akt protein kinase

are necessary and sufficient for the survival of nerve growth factor-dependent

sympathetic neurons. J. Neuroscience, 18:2933-2943.

Crowley, C.; Spencer, S.; Nishimura, M.; Chen, K.; Pitts-Meek, S.; Armanini, M.; Ling,

L.; MacMahon, S.; Shelton, D. and Levinson, A. 1994 Mice lacking nerve growth

factor display perinatal loss of sensory and sympathetic neurons yet develop basal

forebrain cholinergic neurons. Cell (Cambridge), 76:1001-1011.

Cunningham, M.E.; Stephens, R.M.; Kaplan, D.R. and Greene, L.A. 1997

Autophosphorylation of activation loop tyrosines regulates signaling by the Trk

nerve growth factor receptor. J. Biological Chemistry, 272:10957-10967.

Datta, S.; Dudek, H.; Tao, X.; Masters, S.; Fu, H.; Gotoh, Y. and Greenberg, M. 1997 Akt

phosphorylation of BAD couples survival signals to the cell-intrinsic death

machinery. Cell (Cambridge), 91:231-241.

Davies, A.; Bandtlow, C.; Heumann, R.; Korsching, S.; Rohrer, H. and Thoenen, H. 1987

Timing and site of nerve growth factor synthesis in developing skin in relation to

innervation and expression of the receptor. Nature (London), 326:353-358.

Davies, A. and Lindsay, R. 1984 Neural crest-derived spinal and cranial sensory neurones

are equally sensitive to NGF but differ in their response to tissue extracts. Brain

Research, 316:121-127.

Davies, A.; Minichiello, L. and Klein, R. 1995 Developmental changes in NT3 signalling

via TrkA and TrkB in embryonic neurons. The EMBO journal., 14:4482-4489.

164

Davies, A.; Thoenen, H. and Barde, Y. 1986a The response of chick sensory neurons to

brain-derived neurotrophic factor. J. Neuroscience, 6:1897-1904.

Davies, A.M.; Thoenen, H. and Barde, Y.A. 1986b Different factors from the central

nervous system and periphery regulate the survival of sensory neurones. Nature,

319:497-499.

Davis, S.; Aldrich, T.; Ip, N.; Stahl, N.; Scherer, S.; Farruggella, T.; DiStefano, P.; Curtis,

R.; Panayotatos, N. and Gascan, H. 1993b Released form of CNTF receptor alpha

component as a soluble mediator of CNTF responses. American Association for

the Advancement of Science. Science, 259:1736-1739.

Davis, S.; Aldrich, T.; Stahl, N.; Pan, L.; Taga, T.; Kishimoto, T.; Ip, N. and Yancopoulos,

G. 1993a LIFRb and gp130 as heterodimerizing signal transducers of the tripartite

CNTF receptor. American Association for the Advancement of Science. Science,

260:1805-1808.

Davis, S.; Aldrich, T.; Valenzuela, D.; Wong, V.; Furth, M.; Squinto, S. and Yancopoulos,

G. 1991 The receptor for ciliary neurotrophic factor. American Association for the

Advancement of Science. Science, 253:59-63.

Dechant, G. and Barde, Y.A. 1997 Signaling through the neurotrophin receptor p75NTR.

Current Opinion in Neurobiology, 7:413-418.

Dechant, G.; Biffo, S.; Okazawa, H.; Kolbeck, R.; Pottgiesser, J. and Barde, Y.A. 1993a

Expression and binding characteristics of the BDNF receptor chick trkB.

Development, 119:545-558.

165

Dechant, G.; Biffo, S.; Okazawa, H.; Kolbeck, R.; Pottgiesser, J. and Barde, Y.A. 1993b

Expression and binding characteristics of the BDNF receptor chick trkB.

Development, 119:545-558.

Dechant, G.; Rodriguez-Tebar, A.; Kolbeck, R. and Barde, Y. 1993c Specific high-affinity

receptors for neurotrophin-3 on sympathetic neurons. J. Neuroscience,

13:2610-2616.

Deisseroth, K.; Bito, H. and Tsien, R. 1996 Signaling from synapse to nucleus:

postsynaptic CREB phosphorylation during multiple forms of hippocampal

synaptic plasticity. Neuron, 16:89-101.

Deisseroth, K.; Mermelstein, P.G.; Xia, H. and Tsien, R.W. 2003 Signaling from synapse

to nucleus: the logic behind the mechanisms. Current Opinion in Neurobiology,

13:354-365.

del Peso, L.; Gonzalez-Garcia, M.; Page, C.; Herrera, R. and Nunez, G. 1997

Interleukin-3-induced phosphorylation of BAD through the protein kinase Akt.

American Association for the Advancement of Science. Science, 278:687-689.

Dethleffsen, K.; Heinrich, G.; Lauth, M.; Knapik, E.W. and Meyer, M. 2003

Insert-containing neurotrophins in teleost fish and their relationship to nerve

growth factor. Mol. Cell Neurosci., 24:380-394.

Dichter, M.A. and Fischbach, G.D. 1977 The action potential of chick dorsal root ganglion

neurones maintained in cell culture. J. Physiol., 267:281-298.

166

Diogenes, M.; Fernandes, C.; Sebastiao, A. and Ribeiro, J. 2004 Activation of adenosine

A2A receptor facilitates brain-derived neurotrophic factor modulation of synaptic

transmission in hippocampal slices. J. Neuroscience, 24:2905-2913.

Dittus, J.J.; Pugh, P.C.; Howard, M.J. and Margiotta, J.F. 2002 Parasympathetic ciliary

ganglion neurons express trks but neurotrophins fail to fully support their survival.

Society for Neuroscience Abstracts, 28.

D'Mello, S.; Borodezt, K. and Soltoff, S. 1997 Insulin-like growth factor and potassium

depolarization maintain neuronal survival by distinct pathways: possible

involvement of PI 3-kinase in IGF-1 signaling. J. Neuroscience, 17:1548-1560.

Dobrowsky, R.T.; Werner, M.H.; Castellino, A.M.; Chao, M.V. and Hannun, Y.A. 1994

Activation of the sphingomyelin cycle through the low-affinity neurotrophin

receptor. Science, 265:1596-1599.

Dolcet, X.; Egea, J.; Soler, R.M.; Martin-Zanca, D. and Comella, J.X. 1999 Activation of

Phosphatidylinositol 3-Kinase, but Not Extracellular-Regulated Kinases, Is

Necessary to Mediate Brain-Derived Neurotrophic Factor-Induced Motoneuron

Survival. Journal of Neurochemistry, 73:521-531.

Dragunow, M.; Beilharz, E.; Mason, B.; Lawlor, P.; Abraham, W. and Gluckman, P. 1993

Brain-derived neurotrophic factor expression after long-term potentiation.

Neuroscience Letter, 160:232-236.

Dryer, S.E. 1994 Functional development of the parasympathetic neurons of the avian

ciliary ganglion: a classic model system for the study of neuronal differentiation

and development. Prog. Neurobiol., 43:281-322.

167

Dudek, H.; Datta, S.; Franke, T.; Birnbaum, M.; Yao, R.; Cooper, G.; Segal, R.; Kaplan,

D. and Greenberg, M. 1997 Regulation of neuronal survival by the

serine-threonine protein kinase Akt. American Association for the Advancement

of Science. Science, 275:661-665.

Durbec, P.; Larsson-Blomberg, L.; Schuchardt, A.; Costantini, F. and Pachnis, V. 1996b

Common origin and developmental dependence on c-ret of subsets of enteric and

sympathetic neuroblasts. Development (Cambridge, England), 122:349-358.

Durbec, P.; Marcos-Gutierrez, C.; Kilkenny, C.; Grigoriou, M.; Wartiowaara, K.;

Suvanto, P.; Smith, D.; Ponder, B.; Costantini, F. and Saarma, M. 1996a GDNF

signalling through the Ret receptor tyrosine kinase. Nature (London),

381:789-793.

Eckenstein, F.; Esch, F.; Holbert, T.; Blacher, R. and Nishi, R. 1990 Purification and

characterization of a trophic factor for embryonic peripheral neurons: comparison

with fibroblast growth factors. Neuron, 4:623-631.

Egan, M.; Kojima, M.; Callicott, J.; Goldberg, T.; Kolachana, B.; Bertolino, A.; Zaitsev,

E.; Gold, B.; Goldman, D.; Dean, M.; Lu, B. and Weinberger, D. 2003 The BDNF

val66met polymorphism affects activity-dependent secretion of BDNF and human

memory and hippocampal function. Cell (Cambridge), 112:257-269.

Eide, F.F.; Vining, E.R.; Eide, B.L.; Zang, K.; Wang, X.Y. and Reichardt, L.F. 1996

Naturally occurring truncated trkB receptors have dominate inhibitory effects on

brain-derived neurotrophic factor signaling. J. Neuroscience, 16:3123-3129.

168

Elmariah, S.; Crumling, M.; Parsons, T. and Balice-Gordon, R. 2004 Postsynaptic

TrkB-mediated signaling modulates excitatory and inhibitory neurotransmitter

receptor clustering at hippocampal synapses. J. Neuroscience, 24:2380-2393.

English, J. and Sweatt, J. 1997 A requirement for the mitogen-activated protein kinase

cascade in hippocampal long term potentiation. The Journal of biological

chemistry., 272:19103-19106.

Enomoto, H.; Araki, T.; Jackman, A.; Heuckeroth, R.; Snider, W.; Jr, J.E. and Milbrandt,

J. 1998 GFR alpha1-deficient mice have deficits in the enteric nervous system and

kidneys. Neuron, 21:317-324.

Ernfors, P.; Bengzon, J.; Kokaia, Z.; Persson, H. and Lindvaill, O. 1991 Increased levels

of messenger RNAs for neurotrophic factors in the brain during kindling

epileptogenesis. Neuron, 7:165-176.

Ernfors, P.; Lee, K.; Kucera, J. and Jaenisch, R. 1994b Lack of neurotrophin-3 leads to

deficiencies in the peripheral nervous system and loss of limb proprioceptive

afferents. Cell (Cambridge), 77:503-512.

Ernfors, P.; Lee, K. and Jaenisch, R. 1994a Mice lacking brain-derived neurotrophic factor

develop with sensory deficits. Nature (London), 368:147-150.

Ernfors, P.; Wetmore, C.; Olson, L. and Persson, H. 1990 Identification of cells in rat

brain and peripheral tissues expressing mRNA for members of the nerve growth

factor family. Neuron, 5:511-526.

Escandon, E.; Soppet, D.; Rosenthal, A.; Mendoza-Ramirez, J.; Szonyi, E.; Burton, L.;

Henderson, C.; Parada, L. and Nikolics, K. 1994 Regulation of neurotrophin

169

receptor expression during embryonic and postnatal development. J. Neurosci.,

14:2054-2068.

Fagan, A.; Zhang, H.; Landis, S.; Smeyne, R.; Silos-Santiago, I. and Barbacid, M. 1996

TrkA, but not TrkC, receptors are essential for survival of sympathetic neurons in

vivo. J. Neuroscience, 16:6208-6218.

Farinas, I.; Jones, K.; Backus, C.; Wang, X. and Reichardt, L. 1994 Severe sensory and

sympathetic deficits in mice lacking neurotrophin-3. Nature (London),

369:658-661.

Farinas, I.; Wilkinson, G.; Backus, C.; Reichardt, L. and Patapoutian, A. 1998

Characterization of neurotrophin and Trk receptor functions in developing sensory

ganglia: direct NT-3 activation of TrkB neurons in vivo. Neuron, 21:325-334.

Farnsworth, C.; Freshney, N.; Rosen, L.; Ghosh, A.; Greenberg, M.E. and Feig, L. 1995

Calcium activation of Ras mediated by neuronal exchange factor Ras-GRF.

Nature, 376:524-527.

Ferrer, I.; Marin, C.; Rey, M.J.; Ribalta, T.; Goutan, E.; Blanco, R.; Tolosa, E. and Mart,

E. 1999 BDNF and full-length and truncated TrkB expression in Alzheimer's

disease. Implications in therapeutic strategies. J. Neuropathol. Exp. Neurol.,

58:729-739.

Figurov, A.; Pozzo-Miller, L.; Olafsson, P.; Wang, T. and Lu, B. 1996 Regulation of

synaptic responses to high-frequency stimulation and LTP by neurotrophins in the

hippocampus. Nature (London), 381:706-709.

170

Finkbeiner, S.; Tavazoie, S.F.; Maloratsky, A.; Jacobs, K.M.; Harris, K.M. and

Greenberg, M.E. 1997 CREB: A major mediator of neuronal neurotrophin

responses. Neuron, 19:1031-1047.

Finn, T.; Kim, S. and Nishi, R. 1998a Overexpression of ciliary neurotrophic factor in

vivo rescues chick ciliary ganglion neurons from cell death. Journal of

Neurobiology, 34:283-293.

Finn, T. and Nishi, R. 1996 Expression of a chicken ciliary neurotrophic factor in targets

of ciliary ganglion neurons during and after the cell-death phase. The Journal of

comparative neurology., 366:559-571.

Finn, T.P.; Kim, S. and Nishi, R. 1998b Overexpression of ciliary neurotrophic factor in

vivo rescues chick ciliary ganglion neurons from cell death. Journal of

Neurobiology, 34:283-293.

Fisher, C.; Michael, L.; Barnett, M. and Davies, J. 2001 Erk MAP kinase regulates

branching morphogenesis in the developing mouse kidney. Development

(Cambridge, England), 128:4329-4338.

Foehr, E.; Lin, X.; O'Mahony, A.; Geleziunas, R.; Bradshaw, R. and Greene, W. 2000

NF-kappa B signaling promotes both cell survival and neurite process formation in

nerve growth factor-stimulated PC12 cells. J. Neuroscience, 20:7556-7563.

Forgie, A.; Doxakis, E.; Buj-Bello, A.; Wyatt, S. and Davies, A. 1999 Differences and

developmental changes in the responsiveness of PNS neurons to GDNF and

neurturin. Molecular and Cellular Neuroscience, 13:430-440.

171

Francis, N.; Farinas, I.; Brennan, C.; Rivas-Plata, K.; Backus, C.; Reichardt, L. and

Landis, S. 1999 NT-3, like NGF, is required for survival of sympathetic neurons,

but not their precursors. Developmental Biology, 210:411-427.

Franklin, J.L.; Sanz-Rodriguez, C.; Juhasz, A.; Deckwerth, T.L. and Johnson, E.M., Jr.

1995 Chronic depolarization prevents programmed death of sympathetic neurons

in vitro but does not support growth: requirement for Ca2+ influx but not Trk

activation. J. Neuroscience, 15:643-664.

Freidin, M. 2004 Antibody to the extracellular domain of the low affinity NGF receptor

stimulates p75NGFR-mediated apoptosis in cultured sympathetic neurons. J.

Neuroscience Research, 64:331-340.

Friedman, W.J.; Ernfors, P. and Persson, H. 1991 Transient and persistent expression of

NT-3/HDNF mRNA in the rat brain during postnatal development. J.

Neuroscience, 11:1577-1584.

Frisen, J.; Verge, V.M.K.; Persson, H.; Fried, K.; Middlemas, D.S.; Hunter, T.; Hokfel, T.

and Risling, M. 1992 Increased levels of trkB mRNA and trkB protein-like

immunoreactivity in the injured rat and cat spinal cord. Proceedings National

Academy of Sciences USA, 89:11282-11286.

Furber, S.; Oppenheim, R.W. and Prevette, D. 1987 Naturally-occurring neuron death in

the ciliary ganglion of the chick embryo following removal of preganglionic input:

evidence for the role of afferents in ganglion cell survival. J. Neuroscience,

7:1816-1832.

172

Gaiddon, C.; Loeffler, J.P. and Larmet, Y. 1996 Brain-derived neurotrophic factor

stimulates AP-1 and cyclic AMP-responsive element dependent transcriptional

activity in central nervous system neurons. J. Neurochemistry, 66:2279-2286.

Gall, C.; Murray, K. and Isackson, P.J. 1991 Kainic acid-induced seizures increased

expression of nerve growth factor mRNA in rat hippocampus. Mol. Brain Res.,

9:113-123.

Galli-Resta, L.; Ensini, M.; Fusco, E.; Gravina, A. and Margheritti, B. 1993 Afferent

spontaneous electrical activity promotes the survival of target cells in the

developing retinotectal system of the rat. J. Neuroscience, 13:243-250.

Gallo, V.; Kingsbury, A.; Balazs, R. and Jorgensen, O. 1987 The role of depolarization in

the survival and differentiation of cerebellar granule cells in culture. J.

Neuroscience, 7:2203-2213.

Garner, A.S. and Large, T.H. 1994 Isoforms of the avian TrkC receptor: a novel kinase

insertin dissociates transformation and process outgrowth from survival. Neuron,

13:457-472.

Garner, A.S.; Menegay, H.J.; Boeshore, K.L.; Xie, X.-Y.; Voci, J.M.; Johnson, J.E. and

Large, T.H. 1996 Expression of TrkB receptor isoforms in the developing avian

visual system. J. Neuroscience, 16:1740-1752.

Gault, J.; Robinson, M.; Berger, R.; Drebing, C.; Logel, J.; Hopkins, J.; Moore, T.; Jacobs,

X.; Merriwether, J.; Choi, M.J.; Kim, E.J.; Walton, K.; Buiting, K.; Davis, A.;

Breese, C.; Freedman, r. and Leonard, S. 1998 Genomic organization and partial

173

duplication of the human a7 neuronal nicotinic acetylcholine receptor gene

(CHRNA7). Genomics, 52:173-185.

Ghosh, A.; Carnahan, J. and Greenberg, M. 1994 Requirement for BDNF in

activity-dependent survival of cortical neurons. American Association for the

Advancement of Science. Science, 263:1618-1623.

Gonzalez, M. and Collins, W.r. 1997 Modulation of motoneuron excitability by

brain-derived neurotrophic factor. Journal of Neurophysiology, 77:502-506.

Gonzalez, M.; Ruggiero, F.P.; Chang, Q.; Shi, Y.J.; Rich, M.M.; Kraner, S. and

Balice-Gordon, R.J. 1999 Disruption of Trkb-mediated signaling induces

dissasembly of postsynaptic receptor complexes at nueromuscular junctions.

Neuron, 24:567-583.

Goodman, L.; Valverde, J.; Lim, F.; Geschwind, M.; Federoff, H.; Geller, A. and Hefti, F.

1996 Regulated release and polarized localization of brain-derived neurotrophic

factor in hippocampal neurons. Molecular and Cellular Neuroscience, 7:222-238.

Gottschalk, W.; Pozzo-Miller, L.; Figurov, A. and Lu, B. 1998 Presynaptic modulation of

synaptic transmission and plasticity by brain-derived neurotrophic factor in the

developing hippocampus. J. Neuroscience, 18:6830-6839.

Gotz, R.; Koster, R.; Winkler, C.; Raulf, F.; Lottspelch, F.; Schartl, M. and Thoenen, H.

1994 Neurotrophin-6 is a new member of the nerve growth factor family. Nature,

372:266-269.

174

Gotz, R.; Raulf, F. and Schartl, M. 1992 Brain-derived neurotrophic factor is more highly

conserved in structure and function than nerve growth factor during vertebrate

evolution. J. Neurochemistry, 59:432-442.

Gray, R.; Rajan, A.; Radcliffe, K.; Yakehiro, M. and Dani, J. 1996 Hippocampal synaptic

transmission enhanced by low concentrations of nicotine. Nature, 383:713-716.

Greenberg, M.E. and Ziff, E.B. (2001) Signal transduction in the postsynaptic neuron.

Activity dependent regulation of gene expression. In: Synapses, pp 357-391.

Baltimore, MD: Johns Hopkins University Press.

Hack, N.; Hidaka, H.; Wakefield, M.J. and Balazs, R. 1993 Promotion of granule cell

survival by high K+ or excitatory amino acid treatment and

Ca2+/calmodulin-dependent protein kinase activity. Neuroscience, 57:9-20.

Hallbook, F.; Backstrom, A.; Kullander, K.; Kylberg, A.; Williams, R. and Ebendal, T.

1995 Neurotrophins and their receptors in chicken neuronal development. Int. J.

Dev. Biol., 39:855-868.

Hallbook, F.; Ibanez, C.; Ebendal, T. and Persson, H. 1993 Cellular localization of

brain-derived neurotrophic factor and neurotrophin-3 mRNA expression in the

early chicken embryo. Eur. J. Neuroscience, 5:1-14.

Hallbook, F.; Ibanez, C.F. and Persson, H. 1991 Evolutionary studies of the nerve growth

factor family reveal a novel member abundantly expressed in Xenopus overy.

Neuron, 6:845-858.

Hallbook, F.; Lundin, L.G. and Kullander, K. 1998 Lampetra fluviatilis neurotrophin

homolog, descendant of a neurotrophin ancestor, discloses the early molecular

175

evolution of neurotrophins in the vertebrate subphylum. J. Neuroscience,

18:8700-8711.

Haniu, M.; Montestruque, S.; Bures, E.J.; Talvenheimo, J.; Toso, R.; Lewis-Sand, S.;

Welcher, A.A. and Rohde, M.F. 1997 Interactions between brain-derived

neurotrophic factor and the TrkB receptor. Identification of two ligand binding

domains in soluble TrkB by affinity separation and chemical cross-linking. J.

Biological Chemistry, 272:25296-25303.

Hansen, M.R.; Zha, X.; Bok, J. and Green, S.H. 2001 Multiple distinct signal pathways,

including an autocrine neurotrophic mechanism, contribute to the

survival-promoting effect of depolarization on spiral ganglion neurons in vitro. J.

Neuroscience, 21:2256-2267.

Hanson, P.I. and Schulman, H. 1992 Neuronal Ca2+/calmodulin-dependent protein

kinases. Annu Rev Biochem, 61:559-601.

Hartikka, J. and Hefti, F. 1988 Development of septal cholinergic neurons in culture:

plating density and glial cells modulate effects of NGF on survival, fiber growth,

and expression of transmitter-specific enzymes. J. Neuroscience, 8:2967-2985.

Hashino, E.; Shero, M.; Junghans, D.; Rohrer, H.; Milbrandt, J. and Johnson, E.M., Jr.

2001 GDNF and neurturin are target-derived factors essential for cranial

parasympathetic neuron development. Development, 128:3773-3782.

Hashino, E.; Jr, J.E.; Milbrandt, J.; Shero, M.; Salvi, R. and Cohan, C. 1999 Multiple

actions of neurturin correlate with spatiotemporal patterns of Ret expression in

developing chick cranial ganglion neurons. J. Neuroscience, 19:8476-8486.

176

He, X.; Yang, F.; Xie, Z. and Lu, B. 2000 Intracellular Ca(2+) and

Ca(2+)/calmodulin-dependent kinase II mediate acute potentiation of

neurotransmitter release by neurotrophin-3. The Journal of Cell Biology,

149:783-792.

Hefti, F. 1986 Nerve growth factor promotes survival of septal cholinergic neurons after

fimbrial transections. J. Neuroscience, 6:2155-2162.

Heinemeyer, T.; Wingender, E.; Reuter, I.; Hermjakob, H.; Kel, A.E.; Kel, O.V.;

Ignatieva, E.V.; Ananko, E.A.; Podkolodnaya, O.A.; Kolpakov, F.A.; Podkolony,

N.L. and Kolchanov, N.A. 1998 Databases on transcriptional regulation:

TRANSFAC, TRRD, and COMPEL. Nucleic Acids Res., 26:364-370.

Heldin, C.H. 1995 Dimerization of cell surface receptors in signal transduction. Cell,

80:213-223.

Helfand, S.L.; Smith, G.A. and Wessells, N.K. 1976 Survival and development of

dissociated parasympathetic neurons from ciliary ganglia. Developmental Biology,

50:541-547.

Heller, s.; Finn, T.P.; Huber, J.; Nishi, R.; Geissen, M.; Puschel, A.W. and Rohrer, H.

1995 Analysis of function and expression of the chick GPA receptor (GPARa)

suggests multiple roles in neuronal development. Development, 121:2681-2693.

Hempstead, B.L.; Martin-Zanca, D.; Kaplan, D.R.; Parada, L.F. and Chao, M.V. 1991

High-affinity NGF binding requires co-expression of the Trk proto-oncogene and

the low-affinity NGF receptor. Nature, 350:678-683.

177

Henderson, C.; Camu, W.; Mettling, C.; Gouin, A.; Poulsen, K.; Karihaloo, M.; Rullamas,

J.; Evans, T.; McMahon, S. and Armanini, M. 1993 Neurotrophins promote motor

neuron survival and are present in embryonic limb bud. Nature (London),

363:266-270.

Henderson, C.; Phillips, H.; Pollock, R.; Davies, A.; Lemeulle, C.; Armanini, M.;

Simmons, L.; Moffet, B.; Vandlen, R.; Simpson LC [corrected to Simmons, L. and

al, e. 1994a GDNF: a potent survival factor for motoneurons present in peripheral

nerve and muscle. American Association for the Advancement of Science.

Science, 266:1062-1064.

Henderson, L.P.; Gdovin, M.J.; Liu, C.; Gardner, P.D. and Maue, R.A. 1994b Nerve

growth factor increases nicotinic ACh receptor gene expression and current

density in wild-type and kinase A-deficient PC12 cells. J. Neuroscience,

14:1153-1163.

Hendry, I.; Stockel, K.; Thoenen, H. and Iversen, L. 1974 The retrograde axonal transport

of nerve growth factor. Brain Research, 68:103-121.

Herzog, K.; Bailey, K. and Barde, Y. 1994 Expression of the BDNF gene in the

developing visual system of the chick. Development (Cambridge, England),

120:1643-1649.

Herzog, K. and von Bartheld, C. 1998 Contributions of the optic tectum and the retina as

sources of brain-derived neurotrophic factor for retinal ganglion cells in the chick

embryo. J. Neuroscience, 18:2891-2906.

178

Hetman, M.; Cavanaugh, J.; Kimelman, D. and Xia, Z. 2000 Role of glycogen synthase

kinase-3beta in neuronal apoptosis induced by trophic withdrawal. J.

Neuroscience, 20:2567-2574.

Hetman, M.; Kanning, K.; Cavanaugh, J. and Xia, Z. 1999 Neuroprotection by

brain-derived neurotrophic factor is mediated by extracellular signal-regulated

kinase and phosphatidylinositol 3-kinase. The Journal of biological chemistry.,

274:22569-22580.

Hohn, A.; Leibrock, J.; Bailey, K. and Barde, Y. 1990 Identification and characterization

of a novel member of the nerve growth factor/brain-derived neurotrophic factor

family. Nature (London), 344:339-341.

Holden, P.H.; Asopa, V.; Robertson, A.G.S.; Clarke, A.R. and Tyler, S., et al 1997

Immunoglobulin-like domains define the nerve growth factor binding site of TrkA

receptor. Nature Biotechnol., 15:668-672.

Holgado-Madruga, M.; Moscatello, D.; Emlet, D.; Dieterich, R. and Wong, A. 1997

Grb2-associated binder-1 mediates phosphatidylinositol 3-kinase activation and

the promotion of cell survival by nerve growth factor. Proceedings of the National

Academy of Sciences, 94:12419-12424.

Holtzman, D.; Li, Y.; Parada, L.; Kinsman, S.; Chen, C.; Valletta, J.; Zhou, J.; Long, J.

and Mobley, W. 1992 p140trk mRNA marks NGF-responsive forebrain neurons:

evidence that trk gene expression is induced by NGF. Neuron, 9:465-478.

179

Hory-Lee, F.; Russell, M.; Lindsay, R. and Frank, E. 1993 Neurotrophin 3 supports the

survival of developing muscle sensory neurons in culture. Proceedings of the

National Academy of Sciences, 90:2613-2617.

Hu, M.; Liu, Q.-s.; Chang, K.T. and Berg, D.K. 2002 Nicotinic regulation of CREB

activation in hippocampal neurons by glutamatergic and nonglutamatergic

pathways. Molecular and Cellular Neuroscience, 21:616-625.

Huang, E.J. and Reichardt, L.F. 2001 Neurotrophins: Roles in neuronal development and

function. Annual Review of Neuroscience, 24:677-736.

Huang, E.J. and Reichardt, L.F. 2003 Trk receptors: roles in neuronal signal

transduction. Annu. Rev. Biochem., 72:609-642.

Huang, E.J.; Wilkinson, G.A.; Farinas, I.; Backus, C.; Zang, K.; Wong, S.L. and

Reichardt, L.F. 1999a Expression of Trk receptors in the developing mouse

trigeminal ganglion: in vivo evidence for NT-3 activation of TrkA and TrkB in

addition to TrkC. Development, 126:2191-2203.

Huang, Z.; Kirkwood, A.; Pizzorusso, T.; Porciatti, V.; Morales, B.; Bear, M.; Maffei, L.

and Tonegawa, S. 1999b BDNF regulates the maturation of inhibition and the

critical period of plasticity in mouse visual cortex. Cell (Cambridge), 98:739-755.

Huber, K.M.; Sawtell, N.B. and Bear, M.F. 1998 Brain-derived neurotrophic factor alters

the synaptic modification threshold in visual cortex. Neuropharmacology,

37:571-579.

180

Humpel, C.; Wetmore, C. and Olson, L. 1993 Regulation of brain-derived neurotrophic

factor messenger RNA and protein at the cellular level in

pentylenetetrazol-induced epileptic seizures. Neuroscience, 53:909-918.

Ibanez, C. 1998 Emerging themes in structural biology of neurotrophic factors. Trends in

Neurosciences, 21:438-444.

Ikegaya, Y.; Ishizaka, Y. and Matsuki, N. 2002 BDNF attenuates hippocampal LTD via

activation of phospholipase C: implications for a vertical shift in the

frequency-response curve of synaptic plasticity. Eur. J. Neuroscience, 16:145-148.

Impey, S.; Mark, M.; Villacres, E.C.; Poser, S.; Chvkin, C. and Storm, D.R. 1996

Induction of CRE-mediated gene expression by stimuli that generate long-lasting

LTP in area CA1 of the hippocampus. Neuron, 16:973-982.

Impey, S.; Smith, D.; Obrietan, K.; Donahue, R.; Wade, C. and Storm, D. 1998

Stimulation of cAMP response element (CRE)-mediated transcription during

contextual learning. Nature Neuroscience, 1:595-601.

Indo, Y.; Tsuruta, M.; Hayashida, Y.; Karim, M.; Ohta, K.; Kawano, T.; Mitsubuchi, H.;

Tonoki, H.; Awaya, Y. and Matsuda, I. 1996 Mutations in the TRKA/NGF

receptor gene in patients with congenital insensitivity to pain with anhidrosis.

Nature Genetics, 13:485-488.

Ip, N.; Ibanez, C.; Nye, S.; McClain, J.; Jones, P.; Gies, D.; Belluscio, L.; Le Beau, M.;

3rd, E.R.; Squinto, S. and al, e. 1992 Mammalian neurotrophin-4: structure,

chromosomal localization, tissue distribution, and receptor specificity.

Proceedings of the National Academy of Sciences, 89:3060-3064.

181

Ip, N.; Li, Y.; Yancopoulos, G. and Lindsay, R. 1993a Cultured hippocampal neurons

show responses to BDNF, NT-3, and NT-4, but not NGF. J. Neuroscience,

13:3394-3405.

Ip, N. and Yancopoulos, G. 1996 The neurotrophins and CNTF: two families of

collaborative neurotrophic factors. Annual Review of Neuroscience, 19:491-515.

Ip, N.Y.; McClain, J.; Barrenzueta, N.X.; Aldrich, T.H.; Pan, L.; Li, Y.; Wiegand, S.J.;

Friedman, B.; Davis, S. and Yancopoulos, G.D. 1993b The alpha component of the

CNTF receptor is required for signaling and defines potential CNTF targets in the

adult and during development. Neuron, 10:89-102.

Isackson, P.J.; Towner, M.D. and Huntsman, M.M. 1991 Comparison of mammalian,

chicken and Xenopus brain-derived neurotrophic factor coding sequences. FEBS

Lett., 285:260-264.

Jing, S.; Wen, D.; Yu, Y.; Holst, P.; Luo, Y.; Fang, M.; Tamir, R.; Antonio, L.; Hu, Z.;

Cupples, R.; Louis, J.; Hu, S.; Altrock, B. and Fox, G. 1996 GDNF-induced

activation of the ret protein tyrosine kinase is mediated by GDNFR-alpha, a novel

receptor for GDNF. Cell (Cambridge), 85:1113-1124.

Jing, S.; Yu, Y.; Fang, M.; Hu, Z.; Holst, P.L.; Boone, T.; Delaney, J.; Schultz, H.; Zhou,

R. and Fox, G.M. 1997 GFRalpha -2 and GFRalpha -3 Are Two New Receptors

for Ligands of the GDNF Family. J. Biol. Chem., 272:33111-33117.

Johnson, E.J.; Gorin, P.; Brandeis, L. and Pearson, J. 1980 Dorsal root ganglion neurons

are destroyed by exposure in utero to maternal antibody to nerve growth factor.

American Association for the Advancement of Science. Science, 210:916-918.

182

Johnson, H.; Hokfelt, T. and Ulfhake, B. 1999 Expression of p75(NTR), trkB and trkC in

nonmanipulated and axotomized motoneurons of aged rats. Molecular Brain

Research, 69:21-34.

Jones, K.; Farinas, I.; Backus, C. and Reichardt, L. 1994 Targeted disruption of the BDNF

gene perturbs brain and sensory neuron development but not motor neuron

development. Cell (Cambridge), 76:989-999.

Jones, P.; Jakubowicz, T.; Pitossi, F.; Maurer, F. and Hemmings, B. 1991 Molecular

cloning and identification of a serine/threonine protein kinase of the

second-messenger subfamily. Proceedings of the National Academy of Sciences,

88:4171-4175.

Jones, S.; Sudweeks, S. and Yakel, J.L. 1999 Nicotinic receptors in the brain: correlating

physiology with function. Trends Neurosci., 22.

Josephson, A.; Widenfalk, J.; Trifunovski, A.; Widmer, H.; Olson, L. and Spenger, C.

2001 GDNF and NGF family members and receptors in human fetal and adult

spinal cord and dorsal root ganglia. The Journal of comparative neurology.,

440:204-217.

Jovanovic, J.; Benfenati, F.; Siow, Y.; Sihra, T.; Sanghera, J.; Pelech, S.; Greengard, P.

and Czernik, A. 1996 Neurotrophins stimulate phosphorylation of synapsin I by

MAP kinase and regulate synapsin I-actin interactions. Proceedings of the

National Academy of Sciences, 93:3679-3683.

183

Jovanovic, J.; Czernik, A.; Fienberg, A.; Greengard, P. and Sihra, T. 2000 Synapsins as

mediators of BDNF-enhanced neurotransmitter release. Nature Neuroscience,

3:323-329.

Kalcheim, C.; Barde, Y.; Thoenen, H. and Le Douarin, N. 1987 In vivo effect of

brain-derived neurotrophic factor on the survival of developing dorsal root

ganglion cells. The EMBO journal., 6:2871-2873.

Kane, L.; Shapiro, V.; Stokoe, D. and Weiss, A. 1999 Induction of NF-kappaB by the

Akt/PKB kinase. Current Biology, 9:601-604.

Kang, H. and Schuman, E. 1995 Long-lasting neurotrophin-induced enhancement of

synaptic transmission in the adult hippocampus. American Association for the

Advancement of Science. Science, 267:1658-1662.

Kang, H. and Schuman, E. 1996 A requirement for local protein synthesis in

neurotrophin-induced hippocampal synaptic plasticity. American Association for

the Advancement of Science. Science, 273:1402-1406.

Kang, H.; Welcher, A.; Shelton, D. and Schuman, E. 1997 Neurotrophins and time:

different roles for TrkB signaling in hippocampal long-term potentiation. Neuron,

19:653-664.

Kaplan, D.R. and Miller, F.D. 2000 Neurotrophin signal transduction in the nervous

system. Current Opinion in Neurobiology, 10:381-391.

Karlsson, M. and Hallboos, F. 1998 Kainic acid, tetrodotoxin and light modulate

expression of brain-derived neurotrophic factor in developing avian retinal

ganglion cells and their tectal target. Neuroscience, 83:137-150.

184

Katz, L. and Shatz, C. 1996 Synaptic activity and the construction of cortical circuits.

American Association for the Advancement of Science. Science, 274:1133-1138.

Kawai, H.; Zago, W. and Berg, D.K. 2002 Nicotinic alpha 7 receptor clusters on

hippocampal GABAergic neurons: regulation by synaptic activity and

neurotrophins. J. Neuroscience, 22:7903-7912.

Khatib, A.M.; Siegfried, G.; Chretien, M.; Metrakos, P. and Seidah, N.G. 2002 Proprotein

convertases in tumor progression and malignancy novel targets in cancer therapy.

Am. J. Pathol., 160:1921-1935.

Kim, H.; Wang, T.; Olafsson, P. and Lu, B. 1994 Neurotrophin 3 potentiates neuronal

activity and inhibits gamma-aminobutyratergic synaptic transmission in cortical

neurons. Proceedings of the National Academy of Sciences, 91:12341-12345.

Kingsbury, T.; Murray, P.; Bambrick, L. and BK, K. 2003 Ca(2+)-dependent regulation of

TrkB expression in neurons. J. Biological Chemistry, 278:40744-40748.

Klein, R.; Conway, D.; Parada, L.F. and Barbacid, M. 1990 The TrkB tyrosine protein

kinase gene codes for a second neurogenic receptor that lacks the catalytic kinase

domain. Cell, 61:647-656.

Klein, R.; Jing, S.Q.; Nanduri, V.; O'Rourke, E. and Barbacid, M. 1991a The trk

proto-oncogene encodes a receptor for nerve growth factor. Cell, 65:189-197.

Klein, R.; Lamballe, F.; Bryant, S. and Barbacid, M. 1992 The TrkB tyrosine kinase is a

receptor for neurotrophin-4. Neuron, 8:947-956.

Klein, R.; Nanduri, V.; Jing, S.; Lamballe, F.; Tapley, P.; Bryant, S.; Cordon-Cardo, C.;

Jones, K.; Reichardt, L. and Barbacid, M. 1991b The trkB tyrosine protein kinase

185

is a receptor for brain-derived neurotrophic factor and neurotrophin-3. Cell

(Cambridge), 66:395-403.

Klein, R.; Parada, L.F.; Coulier, F. and Barbacid, M. 1989 TrkB, a novel tyrosine protein

kinase receptor expressed during mouse neural development. EMBO J.,

8:3701-3709.

Klein, R.; Sherman, D.; Ho, W.; Stone, D.; Bennett, G.; Moffat, B.; Vandlen, R.;

Simmons, L.; Gu, Q.; Hongo, J.; Devaux, B.; Poulsen, K.; Armanini, M.; Nozaki,

C.; Asai, N.; Goddard, A.; Phillips, H.; Henderson, C.; Takahashi, M. and

Rosenthal, A. 1997 A GPI-linked protein that interacts with Ret to form a

candidate neurturin receptor. Nature (London), 387:717-721.

Klein, R.; Silos-Santiago, I.; Smeyne, R.; Lira, S.; Brambilla, R.; Bryant, S.; Zhang, L.;

Snider, W. and Barbacid, M. 1994 Disruption of the neurotrophin-3 receptor gene

trkC eliminates la muscle afferents and results in abnormal movements. Nature

(London), 368:249-251.

Klein, R.; Smeyne, R.; Wurst, W.; Long, L.; Auerbach, B.; Joyner, A. and Barbacid, M.

1993 Targeted disruption of the trkB neurotrophin receptor gene results in nervous

system lesions and neonatal death. Cell (Cambridge), 75:113-122.

Klesse, L. and Parada, L. 1998 p21 ras and phosphatidylinositol-3 kinase are required for

survival of wild-type and NF1 mutant sensory neurons. J. Neuroscience,

18:10420-10428.

Knipper, M.; da Penha Berzaghi, M.; Blochl, A.; Breer, H.; Thoenen, H. and Lindholm, D.

1994a Positive feedback between acetylcholine and the neurotrophins nerve

186

growth factor and brain-derived neurotrophic factor in the rat hippocampus. Eur. J.

Neuroscience, 6:668-671.

Knipper, M.; Leung, L.; Zhao, D. and Rylett, R. 1994b Short-term modulation of

glutamatergic synapses in adult rat hippocampus by NGF. NeuroReport,

5:2433-2436.

Kokaia, Z.; Bengzon, J.; Metsis, M.; Kokaia, M.; Persson, H. and Lindvall, O. 1993

Coexpression of neurotrophins and their receptors in neurons of the central

nervous system. Proceedings of the National Academy of Sciences, 90:6711-6715.

Kokaia, Z.; Metsis, M.; Kokaia, M.; Bengzon, J.; Elmer, E.; Smith, M.; Timmusk, T.;

Siesjo, B.; Persson, H. and Lindvall, O. 1994 Brain insults in rats induce increased

expression of the BDNF gene through differential use of multiple promoters. Eur.

J. Neuroscience, 6:587-596.

Koliastsos, V.E.; Clatterbuck, R.E.; Winslow, J.W.; Cayouette, M.H. and Price, D.L. 1993

Evidence that brain-derived neurotrophic factor is a trophic factor for motor

neurons in vivo. Neuron, 10:359-367.

Koliatsos, V.; Clatterbuck, R.; Winslow, J.; Cayouette, M. and Price, D. 1993 Evidence

that brain-derived neurotrophic factor is a trophic factor for motor neurons in vivo.

Neuron, 10:359-367.

Korhonen, J.; Said, F.; Wong, A. and Kaplan, D. 1999 Gab1 mediates neurite outgrowth,

DNA synthesis, and survival in PC12 cells. The Journal of biological chemistry.,

274:37307-37314.

187

Korte, M.; Carroll, P.; Wolf, E.; Brem, G.; Thoenen, H. and Bonhoeffer, T. 1995

Hippocampal long-term potentiation is impaired in mice lacking brain-derived

neurotrophic factor. Proceedings of the National Academy of Sciences,

92:8856-8860.

Korte, M.; Griesbeck, O.; Gravel, C.; Carroll, P.; Staiger, V.; Thoenen, H. and Bonhoeffer,

T. 1996 Virus-mediated gene transfer into hippocampal CA1 region restores

long-term potentiation in brain-derived neurotrophic factor mutant mice.

Proceedings of the National Academy of Sciences, 93:12547-12552.

Koshlukova, S.; Finn, T.; Nishi, R. and Halvorsen, S. 1996 Identification of functional

receptors for ciliary neurotrophic factor on chick ciliary ganglion neurons.

Neuroscience (Oxford), 72:821-832.

Kotzbauer, P.; Lampe, P.; Heuckeroth, R.; Golden, J.; Creedon, D.; Jr, J.E. and Milbrandt,

J. 1996 Neurturin, a relative of glial-cell-line-derived neurotrophic factor. Nature

(London), 384:467-470.

Kouhara, H.; Hadari, Y.; Spivak-Kroizman, T.; Schilling, J.; Bar-Sagi, D.; Lax, I. and

Schlessinger, J. 1997 A lipid-anchored Grb2-binding protein that links

FGF-receptor activation to the Ras/MAPK signaling pathway. Cell (Cambridge),

89:693-702.

Krieglstein, K.; Farkas, L. and Unsicker, K. 1998 TGF-beta regulates the survival of

ciliary ganglionic neurons synergistically with ciliary neurotrophic factor and

neurotrophins. Journal of Neurobiology, 37:563-572.

188

Kruttgen, A.; Moller, J.; Jr, H.J. and Shooter, E. 1998 Neurotrophins induce release of

neurotrophins by the regulated secretory pathway. Proceedings of the National

Academy of Sciences, 95:9614-9619.

Lai, K.O.; Fu, W.Y.; Ip, F.C.F. and Ip, N.Y. 1998 Cloning and expression of a novel

neurotrophin, NT-7, from carp. Mol. Cell Neurosci., 11:64-76.

Lamballe, F.; Klein, R. and Barbacid, M. 1991 trkC, a new member of the trk family of

tyrosine protein kinases, is a receptor for neurotrophin-3. Cell (Cambridge),

66:967-979.

Landmesser, L. and Pilar, G. 1972 The onset and development of transmission in the chick

ciliary ganglion. J. Physiol., 222:691-713.

Landmesser, L. and Pilar, G. 1974a Synaptic transmission and cell death during normal

ganglionic development. J. Physiol., 241:737-749.

Landmesser, L. and Pilar, G. 1974b Synapse formation during embryogenesis on ganglion

cells lacking a periphery. J. Physiol, 241:715-736.

Landmesser, L. and Pilar, G. 1978 Interactions between neurons and their targets during in

vivo synaptogenesis. Federation Proceedings, 37:2016-2022.

Lapchak, P.A.; Araujo, D.M. and Hefti, F. 1993 Cholinergic regulation of hippocampal

brain-derived neurotrophic factor mRNA expression: evidence from lesion and

chronic cholinergic drug treatment studies. Neuroscience, 52:575-585.

Lee, R.; Kermani, P.; Teng, K. and Hempstead, B. 2001 Regulation of cell survival by

secreted proneurotrophins. American Association for the Advancement of Science.

Science, 294:1945-1948.

189

Lee, V.M.; Sechrist, J.W.; Bronner-Fraser, M. and Nishi, R. 2002 Neuronal differentiation

from postmitotic precursors in the ciliary ganglion. Dev. Biology, 252:312-323.

Lentz, S.; Knudson, C.; Korsmeyer, S. and Snider, W. 1999 Neurotrophins support the

development of diverse sensory axon morphologies. J. Neuroscience,

19:1038-1048.

Lesser, S.S.; Sherwood, N.T. and Lo, D.C. 1997 Neurotrophins differentially regulate

voltage-gated ion channels. Mol. Cell. Neurosci., 10:173-183.

Leung, D.; Parent, A.; Cachianes, G.; Esch, F.; Coulombe, J.; Nikolics, K.; Eckenstein, F.

and Nishi, R. 1992a Cloning, expression during development, and evidence for

release of a trophic factor for ciliary ganglion neurons. Neuron, 8:1045-1053.

Leung, D.W.; Parent, A.S.; Cachianes, G.; Esch, F.; Coulombe, J.N.; Nickolies, D.;

Eckenstein, F.P. and Nishi, R. 1992b Cloning, expression during development, and

evidence for release o a trophic factor for ciliary ganglion neurons. Neuron,

8:1045-1053.

Levi-Montalcini, R. 1987 The nerve growth factor: thirty-five years later. EMBO J.,

6:1145-1154.

Levi-Montalcini, R. and Hamburger, V. 1951 Selective growth-stimulation effects of

mouse sarcoma on the sensory and sympathetic nervous system of the chick

embryo. J. Exp. Zool., 116:321-362.

Levi-Montalcini, R. and Hamburger, V. 1953 A diffusible agent of mouse sarcoma

producing hyperplasia of sympathetic ganglia and hyperneurotization of viscera in

the chick embryo. J. Exp. Zool., 123:233-278.

190

Levine, E.; Crozier, R.; Black, I. and Plummer, M. 1998 Brain-derived neurotrophic factor

modulates hippocampal synaptic transmission by increasing N-methyl-D-aspartic

acid receptor activity. Proceedings of the National Academy of Sciences,

95:10235-10239.

Levine, E.; Dreyfus, C.; Black, I. and Plummer, M. 1995 Brain-derived neurotrophic

factor rapidly enhances synaptic transmission in hippocampal neurons via

postsynaptic tyrosine kinase receptors. Proceedings of the National Academy of

Sciences, 92:8074-8077.

Lewin, G.R. and Barde, Y.A. 1996 Physiology of the neurotrophins. Annual Review of

Neuroscience, 19:289-317.

Li, Y.-X.; Zhang, Y.; Lester, H.A.; Schuman, E.M. and Davidson, N. 1998 Enhancement

of Neurotransmitter Release Induced by Brain-Derived Neurotrophic Factor in

Cultured Hippocampal Neurons. J. Neurosci., 18:10231-10240.

Liebl, D.J.; Tessarollo, L.; Palko, M.E. and Parada, L.F. 1997 Absence of sensory neurons

before target innervation in brain-derived neurotrophic factor-, neurotrophin 3-,

and TrkC-deficient embryonic mice. J. Neuroscience, 17:9113-9121.

Lin, L.; Doherty, D.; Lile, J.; Bektesh, S. and Collins, F. 1993 GDNF: a glial cell

line-derived neurotrophic factor for midbrain dopaminergic neurons. American

Association for the Advancement of Science. Science, 260:1130-1132.

Lin, L.; Mismer, D.; Lile, J.; Armes, L.; 3rd, B.E.; Vannice, J. and Collins, F. 1989

Purification, cloning, and expression of ciliary neurotrophic factor (CNTF).

American Association for the Advancement of Science. Science, 246:1023-1025.

191

Lin, S.Y.; Wu, K.; Levine, E.S.; Mount, H.T.; Suen, P.C. and Black, I.B. 1998 BDNF

acutely increases tryosine phosphorylation of the NMDA receptor subunit 2B in

cortical and hippocampal postsynaptic densities. Brain Research Mol. Brain Res.,

55:20-27.

Lindsay, R.; Barde, Y.; Davies, A. and Rohrer, H. 1985a Differences and similarities in

the neurotrophic growth factor requirements of sensory neurons derived from

neural crest and neural placode. Journal of cell science. Supplement., 3:115-129.

Lindsay, R.M.; Thoenen, H. and Barde, Y.A. 1985b Placode and neural crest-derived

sensory neurons are responsive at early developmental stages to brain-derived

neurotrophic factor. Dev. Biology, 112:319-328.

Lindvall, O.; Ernfors, P.; Bengzon, J.; Kokaia, Z.; Smith, M.; Siesjo, B.K. and Persson, H.

1992 Differential regulation of mRNAs for nerve growth factor, brain-derived

neurotrophic factor, and neurotrophin 3 in the adult rat brain following cerebral

ischemia and hypoglycemic coma. Proceedings National Academy of Sciences

USA, 89:648-652.

Liou, J.; Yang, R. and Fu, W. 1997 Regulation of quantal secretion by neurotrophic

factors at developing motoneurons in Xenopus cell cultures. The Journal of

physiology., 503 ( Pt 1):129-139.

Lipsky, R.H.; Xu, K.; Zhu, D.; Kelly, C.; Terhakopian, A.; Novelli, A. and Marini, A.M.

2001 Nuclear factor kappaB is a critical determinant in N-methyl-D-aspartate

receptor mediated neuroprotection. J. Neurochemistry, 78:254-264.

192

Lipton, S.A. 1986 Blockade of electrical activity promotes the death of mammalian retinal

ganglion cells in culture. Proceedings National Academy of Sciences USA,

83:9774-9778.

Liu, J.; Fukunaga, K.; Yamamoto, H.; Nishi, K. and Miyamoto, E. 1999 Differential roles

of Ca(2+)/calmodulin-dependent protein kinase II and mitogen-activated protein

kinase activation in hippocampal long-term potentiation. J. Neuroscience,

19:8292-8299.

Liu, L.; Cavanaugh, J.; Wang, Y.; Sakagami, H.; Mao, Z. and Xia, Z. 2003 ERK5

activation of MEF2-mediated gene expression plays a critical role in

BDNF-promoted survival of developing but not mature cortical neurons.

Proceedings of the National Academy of Sciences, 100:8532-8537.

Liu, X.; Ernfors, P.; Wu, H. and Jaenisch, R. 1995 Sensory but not motor neuron deficits

in mice lacking NT4 and BDNF. Nature (London), 375:238-241.

Liu, Y.; Ford, B.; Mann, M.A. and Fischbach, G.D. 2001 Neuregulins Increase a7

Nicotinic Acetylcholine Receptors and Enhance Excitatory Synaptic Transmission

in GABAergic Interneurons of the Hippocampus. J. Neurosci., 21:5660-5669.

Loeb, D.; Tsao, H.; Cobb, M. and Greene, L. 1992 NGF and other growth factors induce

an association between ERK1 and the NGF receptor, gp140prototrk. Neuron,

9:1053-1065.

Loeb, J.A.; Hmadcha, A.; Fischbach, G.D.; Land, S.J. and Zakarian, V.L. 2002

Neuregulin expression at neuromuscular synapses is modulated by synaptic

activity and neurotrophic factors. J. Neuroscience, 22:2206-2214.

193

Lohof, A.M.; Ip, N.Y. and Poo, M.-m. 1993 Potentiation of developing neuromuscular

synapses by the neurotrophins NT-3 and BDNF. Nature, 363:350-353.

Lom, B. and Cohen-Cory, S. 1999 Brain-derived neurotrophic factor differentially

regulates retinal ganglion cell dendritic and axonal arborization in vivo. J.

Neuroscience, 19:9928-9938.

MacDermott, A.B.; Role, L.W. and Siegelbaum, S.A. 1999 Presynaptic ionotropic

receptors and the control of transmitter release. Annu. Rev. Neurosci., 22:443-485.

MacLennan, A.; Vinson, E.; Marks, L.; McLaurin, D.; Pfeifer, M. and Lee, N. 1996

Immunohistochemical localization of ciliary neurotrophic factor receptor alpha

expression in the rat nervous system. J. Neuroscience, 16:621-630.

Maisonpierre, P.; Belluscio, L.; Conover, J. and Yancopoulos, G. 1992a Gene sequences

of chicken BDNF and NT-3. DNA sequence : the journal of DNA sequencing and

mapping, 3:49-54.

Maisonpierre, P.C.; Belluscio, L.; Conover, J.C. and Yancopoulos, G.D. 1992b Gene

sequences of chicken BDNF and NT-3. DNA Seq., 3:49-54.

Maisonpierre, P.; Belluscio, L.; Friedman, B.; Alderson, R.; Wiegand, S.; Furth, M.;

Lindsay, R. and Yancopoulos, G. 1990b NT-3, BDNF, and NGF in the developing

rat nervous system: parallel as well as reciprocal patterns of expression. Neuron,

5:501-509.

Maisonpierre, P.; Belluscio, L.; Squinto, S.; Ip, N.; Furth, M.; Lindsay, R. and

Yancopoulos, G. 1990a Neurotrophin-3: a neurotrophic factor related to NGF and

194

BDNF. American Association for the Advancement of Science. Science,

247:1446-1451.

Manthorpe, M.; Davies, G.E. and Varon, S. 1985 Purified proteins acting on cultured

chick embryo ciliary ganglion neurons. Fed. Proc., 44:2753-2759.

Manthorpe, M.; Skaper, S.; Williams, L. and Varon, S. 1986 Purification of adult rat

sciatic nerve ciliary neuronotrophic factor. Brain Research, 367:282-286.

Margiotta, J. and Pardi, D. 1995 Pituitary adenylate cyclase-activating polypeptide type I

receptors mediate cyclic AMP-dependent enhancement of neuronal acetylcholine

sensitivity. Mol Pharmacol, 48:63-71.

Margiotta, J. and Pugh, P. (2004) Nicotinic acetylcholine receptors in the nervous system.

In: Molecular and Cellular Insights to Ion Channel Biology (Maue RA, ed), pp

269-302. Amsterdam: Elsevier B.V.

Margiotta, J.F. and Berg, D.K. 1982 Functional synapses are established between ciliary

ganglion neurons in dissociated cell culture. Nature, 296:152-154.

Martin-Zanca, D.; Barbacid, M. and Parada, L.F. 1990 Expression of the trk

proto-oncogene is restricted to the sensory cranial and spinal ganglia of neural

crest origin in mouse development. Genes and Development, 4:683-694.

Marwitt, R.; Pilar, G. and Weakley, J.N. 1971 Characterization of two cell populations in

the avian ciliary ganglion. Brain Research, 25:317-334.

Matsumoto, T.; Numakawa, T.; Adachi, N.; Yokomaku, D.; Yamagishi, S.; Takei, N. and

Hatanaka, H. 2001 Brain-derived neurotrophic factor enhances

195

depolarization-evoked glutamate release in cultured cortical neurons. Journal of

Neurochemistry, 79:522-530.

Matter-Sadzinski, L.; Hernandez, M.; Roztocil, T.; Ballivet, M. and Matter, J. 1992

Neuronal specificity of the a7 nicotinic acetylcholine receptor promoter develops

during morphogenesis of the central nervous system. EMBO J., 11:4529-4538.

Mazzoni, I.; Said, F.; Aloyz, R.; Miller, F. and Kaplan, D. 1999 Ras regulates sympathetic

neuron survival by suppressing the p53-mediated cell death pathway. J.

Neuroscience, 19:9716-9727.

McAllister, A.; Katz, L. and Lo, D. 1996 Neurotrophin regulation of cortical dendritic

growth requires activity. Neuron, 17:1057-1064.

McAllister, A.; Lo, D. and Katz, L. 1995 Neurotrophins regulate dendritic growth in

developing visual cortex. Neuron, 15:791-803.

McAllister, A.K.; Katz, L.C. and Lo, D.C. 1999 Neurotrophins and synaptic plasticity.

Annu. Rev. Neurosci., 22:295-318.

McDonald, N.Q. and Hendrickson, W.A. 1993 A new structural superfamily of growth

factors defined by a cystine knot motif. Cell, 73:421-424.

McGehee, D.; Heath, M.; Gelber, S.; Devay, P. and Role, L. 1995 Nicotinic enhancement

of fast excitatory synaptic transmission in CNS by presynaptic receptors. Science,

269:1692-1697.

McLean Bolton, M.; Pittman, A. and Lo, D. 2000 Brain-derived neurotrophic factor

differentially regulates excitatory and inhibitory synaptic transmission in

hippocampal cultures. J. Neuroscience, 20:3221-3232.

196

McNerney, M.; Pardi, D.; Pugh, P.; Nai, Q. and Margiotta, J. 2000 Expression and channel

properties of a-bungarotoxin-sensitive acetylcholine receptors on chick ciliary and

choroid neurons. J Neurophysiol, 84:1314-1329.

Meakin, S.; MacDonald, J.; Gryz, E.; Kubu, C. and Verdi, J. 1999 The signaling adapter

FRS-2 competes with Shc for binding to the nerve growth factor receptor TrkA. A

model for discriminating proliferation and differentiation. The Journal of

biological chemistry., 274:9861-9870.

Meier, R.; Becker-Andre, M.; Gotz, R.; Heumann, R.; Shaw, A. and Thoenen, H. 1986

Molecular cloning of bovine and chick nerve growth factor (NGF): delineation of

conserved and unconserved domains and their relationship to the biological

activity and antigenicity of NGF. The EMBO journal., 5:1489-1493.

Meriney, S.D.; Pilar, G.; Ogawa, M. and Nunez, R. 1987 Differential neuronal survival in

the avian ciliary ganglion after chronic acetylcholine receptor blockade. J.

Neuroscience, 7:3840-3849.

Merlio, J.P.; Ernfors, P.; Kokaia, Z.; Middlemas, D.S.; Bengzon, J.; Kokaia, M.; Smith,

M.L.; Siesjo, B.K.; Hunter, T. and Lindvall, O. 1993 Increased production of the

TrkB protein tyrosine kinase receptor after brain insults. Neuron, 10:151-164.

Merlio, J.P.; Ernfors, P. and Persson, H. 1992 Molecular cloning of rat TrkC and

distribution of cells expressing messenger RNAs for members of the Trk family in

the rat central nervous system. Neuroscience, 51:513-532.

197

Messaoudi, E.; Bardsen, K.; Srebro, B. and Bramham, C. 1998 Acute intrahippocampal

infusion of BDNF induces lasting potentiation of synaptic transmission in the rat

dentate gyrus. Journal of Neurophysiology, 79:496-499.

Messaoudi, E.; Ying, S.; Kanhema, T.; Croll, S. and Bramham, C. 2002 Brain-derived

neurotrophic factor triggers transcription-dependent, late phase long-term

potentiation in vivo. J. Neuroscience, 22:7453-7461.

Metsis, M.; Timmusk, T.; Arenas, E. and Persson, H. 1993 Differential usage of multiple

brain-derived neurotrophic factor promoters in the rat brain following neuronal

activation. Proceedings of the National Academy of Sciences, 90:8802-8806.

Meyer, M.; Matsuoka, I.; Wetmore, C.; Olson, L. and Thoenen, H. 1992 Enhanced

synthesis of brain-derived neurotrophic factor in the lesioned peripheral nerve:

different mechanisms are respinsible for the regulation of BDNF and NGF mRNA.

J. Cell Biol., 110:45-54.

Meyer-Franke, A.; Wilkinson, G.; Kruttgen, A.; Hu, M.; Munro, E.; Jr, H.M.; Reichardt,

L. and Barres, B. 1998 Depolarization and cAMP elevation rapidly recruit TrkB to

the plasma membrane of CNS neurons. Neuron, 21:681-693.

Michaelidis, T.; Sendtner, M.; Cooper, J.; Airaksinen, M.; Holtmann, B.; Meyer, M. and

Thoenen, H. 1996 Inactivation of bcl-2 results in progressive degeneration of

motoneurons, sympathetic and sensory neurons during early postnatal

development. Neuron, 17:75-89.

Middlemas, D.; Meisenhelder, J. and Hunter, T. 1994 Identification of TrkB

autophosphorylation sites and evidence that phospholipase C-gamma 1 is a

198

substrate of the TrkB receptor. The Journal of biological chemistry.,

269:5458-5466.

Milbrandt, J.; de Sauvage, F.; Fahrner, T.; Baloh, R.; Leitner, M.; Tansey, M.; Lampe, P.;

Heuckeroth, R.; Kotzbauer, P.; Simburger, K.; Golden, J.; Davies, J.; Vejsada, R.;

Kato, A.; Hynes, M.; Sherman, D.; Nishimura, M.; Wang, L.; Vandlen, R.; Moffat,

B.; Klein, R.; Poulsen, K.; Gray, C.; Garces, A. and Jr, J.E. 1998 Persephin, a

novel neurotrophic factor related to GDNF and neurturin. Neuron, 20:245-253.

Ming, G.; Song, H.; Berninger, B.; Inagaki, N.; Tessier-Lavigne, M. and Poo, M. 1999

Phospholipase C-gamma and phosphoinositide 3-kinase mediate cytoplasmic

signaling in nerve growth cone guidance. Neuron, 23:139-148.

Minichiello, L.; Calella, A.; Medina, D.; Bonhoeffer, T.; Klein, R. and Korte, M. 2002

Mechanism of TrkB-mediated hippocampal long-term potentiation. Neuron,

36:121-137.

Minichiello, L.; Casagranda, F.; Tatche, R.; Stucky, C.; Postigo, A.; Lewin, G.; Davies, A.

and Klein, R. 1998 Point mutation in trkB causes loss of NT4-dependent neurons

without major effects on diverse BDNF responses. Neuron, 21:335-345.

Minichiello, L. and Klein, R. 1996 TrkB and TrkC neurotrophin receptors cooperate in

promoting survival of hippocampal and cerebellar granule neurons. Genes and

Development, 10:2849-2858.

Minichiello, L.; Korte, M.; Wolfer, D.; Kuhn, R.; Unsicker, K.; Cestari, V.; Rossi-Arnaud,

C.; Lipp, H.; Bonhoeffer, T. and Klein, R. 1999 Essential role for TrkB receptors

in hippocampus-mediated learning. Neuron, 24:401-414.

199

Miranda, R.; Sohrabji, F. and Toran-Allerand, C. 1993 Neuronal colocalization of mRNAs

for neurotrophins and their receptors in the developing central nervous system

suggests a potential for autocrine interactions. Proceedings of the National

Academy of Sciences, 90:6439-6443.

Moore, D.B.; Madorsky, I.; Paiva, M. and Heaton, M.B. 2004 Ethanol exposure alters

neurotrophin receptor expression in the rat central nervous system: effects of

neonatal exposure. J. Neurobiology, 60:114-126.

Moore, M.; Klein, R.; Farinas, I.; Sauer, H.; Armanini, M.; Phillips, H.; Reichardt, L.;

Ryan, A.; Carver-Moore, K. and Rosenthal, A. 1996 Renal and neuronal

abnormalities in mice lacking GDNF. Nature (London), 382:76-79.

Murakami, M.; Hibi, M.; Nakagawa, N.; Nakagawa, T.; Yasukawa, K.; Yamanishi, K.;

Taga, T. and Kishimoto, T. 1993 IL-6-induced homodimerization of gp130 and

associated activation of a tyrosine kinase. American Association for the

Advancement of Science. Science, 260:1808-1810.

Nagavarapu, U.; Danath, S. and Boyd, R.T. 2001 Characterization of a rat neuronal

nicotinic acetylcholine receptor a7 promoter. J. Biological Chemistry,

276:16749-16757.

Nai, Q.; Mcintosh, J.M. and Margiotta, J.F. 2003 Relating neuronal nicotinic acetylcholine

receptor subtypes defined by subunit composition and channel function. Molecular

Pharmacology, 63:311-324.

200

Nawa, H.; Carnahan, J. and Gall, C. 1995 BDNF protein measured by a novel enzyme

immunoassay in normal brain and after seizure: partial disagreement with mRNA

levels. Eur. J. Neuroscience, 7:1527-1535.

Nguyen, L.; Holgado-Madruga, M.; Maroun, C.; Fixman, E.; Kamikura, D.; Fournier, T.;

Charest, A.; Tremblay, M.; Wong, A. and Park, M. 1997 Association of the

multisubstrate docking protein Gab1 with the hepatocyte growth factor receptor

requires a functional Grb2 binding site involving tyrosine 1356. The Journal of

biological chemistry., 272:20811-20819.

Nilsson, A.; Fainzilber, M.; Falck, P. and Ibanez, C. 1998 Neurotrophin-7: a novel

member of the neurotrophin family from the zebrafish. Federation of European

Biochemical Societies Letters (alternate title), 424:285-290.

Nimnual, A.; Yatsula, B. and Bar-Sagi, D. 1998 Coupling of Ras and Rac guanosine

triphosphatases through the Ras exchanger Sos. American Association for the

Advancement of Science. Science, 279:560-563.

Ninkina, N.; Adu, J.; Fischer, A.; Pinon, L.G.; Buchman, V.L. and Davies, A.M. 1996

Expression and function of TrkB variants in developing sensory neurons. EMBO

J., 15:6385-6393.

Nishi, R. and Berg, D.K. 1981 Two components from eye tissue that differentially

stimulate the growth and development of ciliary ganglion neurons in cell culture. J.

Neuroscience, 1:505-513.

Nishio, T.; Furukawa, S.; Akiguci, I. and Sunohara, N. 1998 Medial nigral dopamine

neurons have rich neurotrophin support in humans. Neuroreport, 9:1661-1665.

201

Nobes, C. and Tolkovsky, A. 1995 Neutralizing anti-p21ras Fabs suppress rat sympathetic

neuron survival induced by NGF, LIF, CNTF and cAMP. Eur. J. Neuroscience,

7:344-350.

Nosaka, Y.; Arai, A.; Miyasaka, N. and Miura, O. 1999 CrkL mediates Ras-dependent

activation of the Raf/ERK pathway through the guanine nucleotide exchange

factor C3G in hematopoietic cells stimulated with erythropoietin or interleukin-3.

The Journal of biological chemistry., 274:30154-30162.

Oakley, R.; Lefcort, F.; Clary, D.; Reichardt, L.; Prevette, D.; Oppenheim, R. and Frank,

E. 1997 Neurotrophin-3 promotes the differentiation of muscle spindle afferents in

the absence of peripheral targets. J. Neuroscience, 17:4262-4274.

Obata, K.; Yamanaka, H.; Dai, Y.; Mizushima, T.; Fukuoka, T.; Tokunaga, A. and

Noguchi, K. 2004 Activation of extracellular signal-regulated protein kinase in the

dorsal root ganglion following inflammation near the nerve cell body.

Neuroscience, 126:1011-1021.

Obermeier, A.; Halfter, H.; Wiesmuller, K.; Jung, G.; Schlessinger, J. and Ullrich, A. 1993

Tyrosine 785 is a major determinant of Trk--substrate interaction. The EMBO

journal., 12:933-941.

Ohmichi, M.; Decker, S. and Saltiel, A. 1992 Activation of phosphatidylinositol-3 kinase

by nerve growth factor involves indirect coupling of the trk proto-oncogene with

src homology 2 domains. Neuron, 9:769-777.

202

Okazawa, H.; Kamei, M. and Kanazawa, I. 1993 Molecular cloning and expression of a

novel truncated form of chicken trkC. FEBS (Federation of European Biochemical

Societies) Letters, 329:171-177.

Oppenheim, R.; Prevette, D.; Yin, Q.; Collins, F. and MacDonald, J. 1991 Control of

embryonic motoneuron survival in vivo by ciliary neurotrophic factor. American

Association for the Advancement of Science. Science, 251:1616-1618.

Oppenheim, R.; Yin, Q.; Prevette, D. and Yan, Q. 1992 Brain-derived neurotrophic factor

rescues developing avian motoneurons from cell death. Nature (London),

360:755-757.

Ozdinler, P.H.; Ulupinar, E. and Erzurumlu, R.S. 2005 Dose and age-dependent axonal

responses of embryonic trigeminal neurons to localized NGF via p75 receptor.

Journal of Neurobiology, 62:189-206.

Palko, M.E.; Coppola, V. and Tessarollo, L. 1999 Evidence for a role of truncated trkC

receptor isoforms in mouse development. J. Neuroscience, 19:775-782.

Palmada, M.; Kanwal, S.; Rutkoski, N.J.; Gustafson-Brown, C.; Johnson, R.S.; Wisdom,

R. and Carter, B.D. 2002 c-jun is essential for sympathetic neuronal death induced

by NGF withdrawal but not by p75 activation. J. Cell Biol., 158:453-461.

Pardi, D. and Margiotta, J.F. 1999 Pituitary adenylate cyclase-activating polypeptide

activates a phospholipase C-dependent signal pathway in chick ciliary ganglion

neurons that selectively inhibits a7-containing nicotinic receptors. J. Neurosci.,

19:6327-6337.

203

Patapoutian, A. and Reichardt, L.F. 2001 Trk receptors: mediators of neurotrophin action.

Current Opinion in Neurobiology, 11:272-280.

Patterson, S.; Abel, T.; Deuel, T.; Martin, K.; Rose, J. and Kandel, E. 1996 Recombinant

BDNF rescues deficits in basal synaptic transmission and hippocampal LTP in

BDNF knockout mice. Neuron, 16:1137-1145.

Patterson, S.L.; Grover, L.M.; Schwartzkroin, P.A. and Bothwell, M. 1992 Neurotrophin

expression in rat hippocampal slices: a stimulus paradigm inducing LTp in CA1

evokes increases in BDNF and NT-3 mRNAs. Neuron, 9:1081-1088.

Pawson, T. and Nash, P. 2000 Protein-protein interactions define specificity in signal

transduction. Genes and Development, 14:1027-1047.

Peterziel, H.; Unsicker, K. and Krieglstein, K. 2002 TGFbeta induces GDNF

responsiveness in neurons by recruitment of GFRalpha1 to the plasma membrane.

The Journal of Cell Biology, 159:157-167.

Phillips, H.S.; Hains, J.M.; Laramee, G.R.; Rosenthal, A. and Winslow, J.W. 1990

Widespread expression of BDNF but not NT3 by target areas of basal forebrain

cholinergic neurons. Science, 250:290-294.

Pirvola, U.; Hallbook, F.; Xing-Qun, L.; Virkkala, J.; Saarma, M. and Ylikoski, J. 1997

Expression of neurotrophins and Trk receptor in the developing, adult, and

regenerating avian cochlea. J. Neurobiology, 33:1019-1033.

Pizzorusso, T.; Ratto, G.M.; Putignano, E. and Maffei, L. 2000 Brain-derived

neurotrophic factor causes cAMP response element-binding protein

204

phoshporylation in absence of calcium increases in slices and cultured neurons

from rat visual cortex. J. Neuroscience, 20:2809-28016.

Poo, M. 2001 Neurotrophins as synaptic modulators. Nature Reviews Neuroscience,

2:24-32.

Poteryaev, D.; Titievsky, A.; Sun, Y.; Thomas-Crusells, J.; Lindahl, M.; Billaud, M.;

Arumae, U. and Saarma, M. 1999 GDNF triggers a novel ret-independent Src

kinase family-coupled signaling via a GPI-linked GDNF receptor alpha1.

Federation of European Biochemical Societies Letters (alternate title), 463:63-66.

Pozzo-Miller, L.D.; Gottschalk, W.; Zhang, L.; McDermott, K.; Du, J.; Gopalakrishnan,

R.; Oho, C.; Sheng, Z.-H. and Lu, B. 1999 Impairments in High-Frequency

Transmission, Synaptic Vesicle Docking, and Synaptic Protein Distribution in the

Hippocampus of BDNF Knockout Mice. J. Neurosci., 19:4972-4983.

Pugh, P. and Margiotta, J. 2000 Nicotinic acetylcholine receptor agonists promote survival

and reduce apoptosis of chick ciliary ganglion neurons. Mol Cell Neurosci,

15:113-122.

Pugh, P.; Zhou, X.; Nai, Q. and Margiotta, J. 2005 PACAP- and neurotrophin-generated

signals converge on MAPK to support parasympathetic neuronal survival.

Submitted.

Pugh, P.C. and Berg, D.K. 1994 Neuronal acetylcholine receptors that bind

a-bungarotoxin mediate neurite retraction in a calcium-dependent manner. J.

Neurosci., 14:889-896.

205

Radziejewski, C. and Robinson, R.C. 1993 Heterodimers of the neurotrophic factors:

formation, isolation, and differential stability. Biochemistry, 32:13350-13356.

Reiness, C.G.; Seppa, M.J.; Dion, D.M.; Sweeney, S.; Foster, D.N. and Nishi, R. 2001

Chick ciliary neurotrophic factor is secreted via a nonclassical pathway. Mol. Cell

Neurosci., 17:931-944.

Riccio, A.; Ahn, S.; Davenport, C.; Blendy, J. and Ginty, D. 1999 Mediation by a CREB

family transcription factor of NGF-dependent survival of sympathetic neurons.

American Association for the Advancement of Science. Science, 286:2358-2361.

Rifkin, J.T.; Todd, V.J.; Anderson, L.W. and Lefcort, F. 2000 Dynamic expression of

neurotrophin receptors during sensory neuron genesis and differentiation.

Developmental Biology, 227.

Robinson, M. and Cobb, M. 1997 Mitogen-activated protein kinase pathways. Current

Opinion in Cell Biology, 9:180-186.

Rocamora, N.; Welker, E.; Pascual, M. and Soriano, E. 1996 Upregulation of BDNF

mRNA Expression in the Barrel Cortex of Adult Mice after Sensory Stimulation. J.

Neurosci., 16:4411-4419.

Rodriguez-Tebar, A. and Barde, Y. 1988 Binding characteristics of brain-derived

neurotrophic factor to its receptors on neurons from the chick embryo. J.

Neuroscience, 8:3337-3342.

Rodriguez-Tebar, A.; Dechant, G.; Gotz, R. and Barde, Y. 1992 Binding of

neurotrophin-3 to its neuronal receptors and interactions with nerve growth factor

and brain-derived neurotrophic factor. The EMBO journal., 11:917-922.

206

Rodriguez-Viciana, P.; Warne, P.; Dhand, R.; Vanhaesebroeck, B.; Gout, I.; Fry, M.;

Waterfield, M. and Downward, J. 1994 Phosphatidylinositol-3-OH kinase as a

direct target of Ras. Nature (London), 370:527-532.

Rohrer, H. and Sommer, I. 1982 Simultaneous expression of neuronal and glial properties

by chick ciliary ganglion cells during development. J. Neuroscience, 3:1683-1693.

Rohrer, H. and Sommer, I. 1983 Simultaneous expression of neuronal and glial properties

by chick ciliary ganglion cells during development. J. Neuroscience, 3:1683-1693.

Role, L.W. and Berg, D.K. 1996 Nicotinic receptors in the development and modulation

of CNS synapses. Neuron, 16:1077-1085.

Rosen, L.B.; Ginty, D.D.; Weber, M.J. and Greenberg, M.E. 1994 Membrane depolarizing

and calcium influx stimulate MEK and MAP kinase via activation of ras. Neuron,

12:1207-1221.

Rosenthal, A.; Goeddel, D.; Nguyen, T.; Lewis, M.; Shih, A.; Laramee, G.; Nikolics, K.

and Winslow, J. 1990 Primary structure and biological activity of a novel human

neurotrophic factor. Neuron, 4:767-773.

Rossi, J.; Luukko, K.; Poteryaev, D.; Laurikainen, A.; Sun, Y.; Laakso, T.; Eerikainen, S.;

Tuominen, R.; Lakso, M.; Rauvala, H.; Arumae, U.; Pasternack, M.; Saarma, M.

and Airaksinen, M. 1999 Retarded growth and deficits in the enteric and

parasympathetic nervous system in mice lacking GFR alpha2, a functional

neurturin receptor. Neuron, 22:243-252.

207

Rudy, B.; Kirschenbaum, B.; Rukenstein, A. and Greene, L.A. 1987 Nerve growth factor

increases the number of functional Na channels and induced TTX-resistant Na

channels in PC12 pheochromocytoma cells. J. Neuroscience, 7:1613-1625.

Ruit, K.; Elliott, J.; Osborne, P.; Yan, Q. and Snider, W. 1992 Selective dependence of

mammalian dorsal root ganglion neurons on nerve growth factor during embryonic

development. Neuron, 8:573-587.

Rutherford, L.; Nelson, S. and Turrigiano, G. 1998 BDNF has opposite effects on the

quantal amplitude of pyramidal neuron and interneuron excitatory synapses.

Neuron, 21:521-530.

Saadat, S.; Sendtner, M. and Rohrer, H. 1989 Ciliary neurotrophic factor induces

cholinergic differentiation of rat sympathetic neurons in culture. The Journal of

cell biology., 108:1807-1816.

Scharfman, H. 1997 Hyperexcitability in combined entorhinal/hippocampal slices of adult

rat after exposure to brain-derived neurotrophic factor. Journal of

Neurophysiology, 78:1082-1095.

Schecterson, L.C. and Bothwell, M. 1992 Novel roles for neurotrophins are suggested by

BDNF and NT-3 mRNA expression in developing neurons. Neuron, 9:449-463.

Schlessinger, J. and Ullrich, A. 1992 Growth factor signaling by receptor tyrosine kinase.

Neuron, 9:383-391.

Schmidt, M. and Kater, S. 1995 Depolarization and laminin independently enable bFGF to

promote neuronal survival through different second messenger pathways.

Developmental Biology, 168:235-246.

208

Schnider, A.S. and Poo, M. 2000 The neurotrophin hypothesis for synaptic plasticity.

Trends in Neurosci., 23:639-645.

Schoepfer, R.; Conroy, W.G.; Whiting, P.; Gore, M. and Lindstrom, J. 1990 Brain

a-bungarotoxin binding protein cDNAs and MAbs reveal subtypes of this brain of

the ligand-gated ion channel gene superfamily. Neuron, 5:35-48.

Schropel, A.; von Schack, D.; Dechant, G. and Barde, Y.A. 1995 Early expression of the

nerve growth factor receptor ctrkA in chick sympathetic and sensory ganglia. Mol.

Cell Neurosci., 6:544-566.

Schuman, E.M. 1999 Neurotrophin regulation of synaptic transmission. Current Opin. in

Neurobiol., 9:105-109.

Scott, B.S. and Fisher, K.C. 1970 Potassium concentration and number of neurons in

cultures of dissociated ganglia. Experimental Neurology, 27:16-22.

Scott, J.; Selby, M.; Urdea, M.; Quiroga, M.; Bell, G. and Rutter, W. 1983 Isolation and

nucleotide sequence of a cDNA encoding the precursor of mouse nerve growth

factor. Nature (London), 302:538-540.

Scott, R. and Ibanez, C. 2001 Determinants of ligand binding specificity in the glial cell

line-derived neurotrophic factor family receptor alpha S. The Journal of biological

chemistry., 276:1450-1458.

Segal, R. 2003 Selectivity in neurotrophin signaling: theme and variations. Annual

Review of Neuroscience, 26:299-330.

Segal, R. and Greenberg, M. 1996a Intracellular signaling pathways activated by

neurotrophic factors. Annual Review of Neuroscience, 19:463-489.

209

Segal, R.A. and Greenberg, M.E. 1996b Intracellular signaling pathways activated by

neurotrophic factors. Annu Rev Neurosci., 19:463-489.

Segouffin-Cariou, C. and Billaud, M. 2000 Transforming ability of MEN2A-RET requires

activation of the phosphatidylinositol 3-kinase/AKT signaling pathway. The

Journal of biological chemistry., 275:3568-3576.

Seidah, N.G.; Benjannet, S.; Parrek, S.; Chretien, M. and Murphy, R.A. 1996 Cellular

processing of the neurotrophin precursors of NT-3 and BDNF by the mammalian

pro-protein convertases. FEBS Lett., 379:247-250.

Seil, F. and Drake-Baumann, R. 2000 TrkB receptor ligands promote activity-dependent

inhibitory synaptogenesis. J. Neuroscience, 20:5367-5373.

Sendtner, M.; Carroll, P.; Holtmann, B.; Hughes, R. and Thoenen, H. 1994 Ciliary

neurotrophic factor. Journal of Neurobiology, 25:1436-1453.

Sendtner, M.; Holtmann, B.; Kolbeck, R.; Thoenen, H. and Barde, Y. 1992a Brain-derived

neurotrophic factor prevents the death of motoneurons in newborn rats after nerve

section. Nature (London), 360:757-759.

Sendtner, M.; Kreutzberg, G. and Thoenen, H. 1990 Ciliary neurotrophic factor prevents

the degeneration of motor neurons after axotomy. Nature (London), 345:440-441.

Sendtner, M.; Stockli, K. and Thoenen, H. 1992b Synthesis and localization of ciliary

neurotrophic factor in the sciatic nerve of the adult rat after lesion and during

regeneration. The Journal of cell biology., 118:139-148.

210

Shalizi, A.; Lehtinen, M.; Gaudilliere, B.; Donovan, N.; Han, J.; Konishi, Y. and Bonni,

A. 2003 Characterization of a neurotrophin signaling mechanism that mediates

neuron survival in a temporally specific pattern. J. Neuroscience, 23:7326-7336.

Sharma, G. and Vijayaraghavan, S. 2003 Modulation of presynaptic store calcium induces

release of glutamate and postsynaptic firing. Neuron, 38:929-939.

Shelton, D.L.; Sutherland, J.; Gripp, J.; Camerato, T.; Armanini, M.P.; Phillips, H.S.;

Carroll, K.; Spencer, S.D. and Levinson, A.D. 1995 Human trks: molecular

cloning, tissue distribution, and expression of extracellular domain

immunoadhesins. J. Neurosci., 15:477-491.

Sherwood, N.T. and Lo, D.C. 1999 Long-term enhancement of central synaptic

transmission by chronic brain-derived neurotrophic factor treatment. J.

Neuroscience, 19:7025-7036.

Shieh, P.; Hu, S.; Bobb, K.; Timmusk, T. and Ghosh, A. 1998 Identification of a signaling

pathway involved in calcium regulation of BDNF expression. Neuron,

20:727-740.

Silva, A.; Kogan, J.; Frankland, P. and Kida, S. 1998 CREB and memory. Annual Review

of Neuroscience, 21:127-148.

Smeyne, R.; Klein, R.; Schnapp, A.; Long, L.; Bryant, S.; Lewin, A.; Lira, S. and

Barbacid, M. 1994 Severe sensory and sympathetic neuropathies in mice carrying

a disrupted Trk/NGF receptor gene. Nature (London), 368:246-249.

Smith, C.; Farrah, T. and Goodwin, R. 1994 The TNF receptor superfamily of cellular and

viral proteins: activation, costimulation, and death. Cell (Cambridge), 76:959-962.

211

Smith, M.A.; Zhang, L.X.; Lyons, W.E. and Mamounas, L.A. 1997 Anterograde transport

of endogenous brain-derived neurotrophic factor in hippocampal mossy fibers.

Neuroreport, 8:1829-1834.

Snider, W. and Lichtman, J. 1996 Are neurotrophins synaptotrophins? Molecular and

Cellular Neuroscience, 7:433-442.

Soler, R.; Dolcet, X.; Encinas, M.; Egea, J.; Bayascas, J. and Comella, J. 1999 Receptors

of the glial cell line-derived neurotrophic factor family of neurotrophic factors

signal cell survival through the phosphatidylinositol 3-kinase pathway in spinal

cord motoneurons. J. Neuroscience, 19:9160-9169.

Soontornniyomkij, V.; Wang, G.; Pittman, C.; Hamilton, R.; Wiley, C. and Achim, C.

1999 Absence of brain-derived neurotrophic factor and trkB receptor

immunoreactivity in glia of Alzheimer's disease. Acta Neuropathologica,

98:345-348.

Squinto, S.P.; Stitt, T.N.; Aldrich, T.H.; Davis, S.; Bianco, S.M.; Radziejewski, C.; Glass,

D.J.; Masiakowski, P.; Furth, M.E. and Valenzuela, D.M., et al. 1991 TrkB

encodes a functional receptor for brain-derived neurotrophic factor and

neurotrophin-3 but not nerve growth factor. Cell, 65:885-893.

Stahl, N.; Boulton, T.G.; Farruggella, T.; Ip, N.Y.; Davis, S.; Witthuhn, B.A.; Quelle,

F.W.; Silvennoinen, O.; Barbieri, G.; Pellegrini, S.; Ihle, N. and Yancopoulos,

G.D. 1994 Association and activation of Jak-Tyk kinases by

CNTF-LIF-OSM-IL-6 b receptor components. Science, 263:92-95.

212

Steljes, T.P.V.; Kinoshita, Y.; Wheeler, E.F.; Oppenheim, R.W. and von Bartheld, C.S.

1999 Neurotrophic factor regulation of developing avian occulomotor neurons:

differential effects of BDNF and GDNF. J. Neurobiology, 41:295-315.

Stephens, R.; Loeb, D.; Copeland, T.; Pawson, T.; Greene, L. and Kaplan, D. 1994 Trk

receptors use redundant signal transduction pathways involving SHC and

PLC-gamma 1 to mediate NGF responses. Neuron, 12:691-705.

Stockli, K.; Lottspeich, F.; Sendtner, M.; Masiakowski, P.; Carroll, P.; Gotz, R.;

Lindholm, D. and Thoenen, H. 1989 Molecular cloning, expression and regional

distribution of rat ciliary neurotrophic factor. Nature (London), 342:920-923.

Stockel, K.; Paravicini, U. and Thoenen, H. 1974 Specificity of the retrograde axonal

transport of nerve growth factor. Brain Research, 76:413-421.

Stone, E.M.; Rothblum, K.N.; Alevy, M.C.; Kuo, T.M. and Schwartz, R.J. 1985 Complete

coding sequence of the chicken glyceraldehyde-3-phosphate dehydrogenase gene.

Proceedings National Academy of Sciences USA, 82:1628-1632.

Stoop, R. and Poo, M. 1995 Potentiation of transmitter release by ciliary neurotrophic

factor requires somatic signaling. Science, 267:695-699.

Stoop, R. and Poo, M. 1996 Synaptic modulation by neurotrophic factors: differential

and synergistic effects of brain-derived neurotrophic factor and ciliary

neurtotrophic factor. J. Neuroscience, 16:3256-3264.

Stucky, C.; DeChiara, T.; Lindsay, R.; Yancopoulos, G. and Koltzenburg, M. 1998

Neurotrophin 4 is required for the survival of a subclass of hair follicle receptors. J.

Neuroscience, 18:7040-7046.

213

Suen, P.; Wu, K.; Levine, E.; Mount, H.; Xu, J.; Lin, S. and Black, I. 1997 Brain-derived

neurotrophic factor rapidly enhances phosphorylation of the postsynaptic

N-methyl-D-aspartate receptor subunit 1. Proceedings of the National Academy of

Sciences, 94:8191-8195.

Sun, P.D. and Davies, D.R. 1995 The cystine-knot growth-factor superfamily. Annu Rev.

Biophys. Biomol. Struct., 24:269-291.

Sutter, A.; Riopelle, R.; Harris-Warrick, R. and Shooter, E. 1979 Nerve growth factor

receptors. Characterization of two distinct classes of binding sites on chick embryo

sensory ganglia cells. The Journal of biological chemistry., 254:5972-5982.

Takahashi, T.; Yamashita, H.; Nakamura, S.; Ishiguro, H.; Nagatsu, T. and Kawakami, H.

1999 Effects of nerve growth factor and nicotine on the expression of nicotinic

acetylcholine receptor subunits in PC12 cells. Neuroscience Research,

35:175-181.

Tanaka, T.; Saito, H. and Matsuki, N. 1997 Inhibition of GABAA synaptic responses by

brain-derived neurotrophic factor (BDNF) in rat hippocampus. J. Neuroscience,

17:2959-2966.

Tao, X.; Finkbeiner, S.; Arnold, D.; Shaywitz, A. and Greenberg, M. 1998 Ca2+ influx

regulates BDNF transcription by a CREB family transcription factor-dependent

mechanism. Neuron, 20:709-726.

Tao, X.; West, A.; Chen, W.; Corfas, G. and Greenberg, M. 2002 A calcium-responsive

transcription factor, CaRF, that regulates neuronal activity-dependent expression

of BDNF. Neuron, 33:383-395.

214

Tartaglia, N.; Du, J.; Tyler, W.J.; Neale, E.; Pozzo-Miller, L. and Lu, B. 2001 Protein

synthesis-dependent and -independent regulation of hippocampal synapses by

brain-derived neurotrophic factor. J. Biol. Chem., 276:37585-37593.

Tessarollo, L.; Tsoulfas, P.; Donovan, M.; Palko, M.; Blair-Flynn, J.; Hempstead, B. and

Parada, L. 1997 Targeted deletion of all isoforms of the trkC gene suggests the use

of alternate receptors by its ligand neurotrophin-3 in neuronal development and

implicates trkC in normal cardiogenesis. Proceedings of the National Academy of

Sciences, 94:14776-14781.

Tessarollo, L.; Vogel, K.; Palko, M.; Reid, S. and Parada, L. 1994 Targeted mutation in

the neurotrophin-3 gene results in loss of muscle sensory neurons. Proceedings of

the National Academy of Sciences, 91:11844-11848.

Tetzlaff, W.; Graeber, M.; Bisby, M. and Kreutzberg, G. 1988 Increased glial fibrillary

acidic protein synthesis in astrocytes during retrograde reaction of the rat facial

nucleus. Glia., 1:90-95.

Thompson, J.; Doxakis, E.; Pinon, L.; Strachan, P.; Buj-Bello, A.; Wyatt, S.; Buchman, V.

and Davies, A. 1998 GFRalpha-4, a new GDNF family receptor. Molecular and

Cellular Neuroscience, 11:117-126.

Timmusk, T.; Belluardo, N.; Metsis, M. and Persson, H. 1993b Widespread and

developmentally regulated expression of neurotrophin-4 mRNA in rat brain and

peripheral tissues. Eur. J. Neuroscience, 5:605-613.

Timmusk, T.; Lendahl, U.; Funakoshi, H.; Arenas, E.; Persson, H. and Metsis, M. 1995

Identification of brain-derived neurotrophic factor promoter regions mediating

215

tissue-specific, axotomy, and neuronal activity-induced expression in transgenic

mice. J. Cell Biol., 128:185-199.

Timmusk, T.; Palm, K.; Metsis, M.; Reintam, T.; Paalme, V.; Saarma, M. and Persson, H.

1993a Multiple promoters direct tissue-specific expression of the rat BDNF gene.

Neuron, 10:475-489.

Tirassa, P.; Manni, L.; Stenfors, C.; Lundeberg, T. and Aloe, L. 2000 RT-PCR Elisa

method for the analysis of neurotrophin mRNA expression in brain and peripheral

tissues. J. Biotech., 84:259-272.

Treanor, J.; Goodman, L.; de Sauvage, F.; Stone, D.; Poulsen, K.; Beck, C.; Gray, C.;

Armanini, M.; Pollock, R.; Hefti, F.; Phillips, H.; Goddard, A.; Moore, M.;

Buj-Bello, A.; Davies, A.; Asai, N.; Takahashi, M.; Vandlen, R.; Henderson, C.

and Rosenthal, A. 1996 Characterization of a multicomponent receptor for GDNF.

Nature (London), 382:80-83.

Trupp, M.; Arenas, E.; Fainzilber, M.; Nilsson, A.; Sieber, B.; Grigoriou, M.; Kilkenny,

C.; Salazar-Grueso, E.; Pachnis, V. and Arumae, U. 1996 Functional receptor for

GDNF encoded by the c-ret proto-oncogene. Nature (London), 381:785-789.

Trupp, M.; Ryden, M.; Jornvall, H.; Funakoshi, H.; Timmusk, T.; Arenas, E. and Ibanez,

C. 1995 Peripheral expression and biological activities of GDNF, a new

neurotrophic factor for avian and mammalian peripheral neurons. The Journal of

cell biology., 130:137-148.

216

Trupp, M.; Scott, R.; Whittemore, S. and Ibanez, C. 1999 Ret-dependent and -independent

mechanisms of glial cell line-derived neurotrophic factor signaling in neuronal

cells. The Journal of biological chemistry., 274:20885-20894.

Tsoulfas, P.; Soppet, D.; Escandon, E.; Tessarollo, L.; Mendoza-Ramirez, J.; Rosenthal,

A.; Nikolics, K. and Parada, L. 1993 The rat trkC locus encodes multiple

neurogenic receptors that exhibit differential response to neurotrophin-3 in PC12

cells. Neuron, 10:975-990.

Tyler, W. and Pozzo-Miller, L. 2001 BDNF enhances quantal neurotransmitter release and

increases the number of docked vesicles at the active zones of hippocampal

excitatory synapses. J. Neuroscience, 21:4249-4258.

Tyler, W.J.; Perrett, S.P. and Pozzo-Miller, L.D. 2002 The role of neurotrophins in

neurotransmitter release. Neuroscientist, 8:524-531.

Ullian, E.M.; McIntosh, J.M. and Sargent, P.B. 1997 Rapid synaptic transmission in the

avian ciliary ganglion is mediated by two distinct classes of nicotinic receptors. J.

Neurosci., 17:7210-7219.

Ullrich, A.; Gray, A.; Berman, C. and Dull, T. 1983 Human beta-nerve growth factor gene

sequence highly homologous to that of mouse. Nature (London), 303:821-825.

Ultsch, M.; Wiesmann, C.; Simmons, L.; Henrich, J.; Yang, M.; Reilly, D.; Bass, S. and de

Vos, A. 1999 Crystal structures of the neurotrophin-binding domain of TrkA,

TrkB and TrkC. Journal of Molecular Biology, 290:149-159.

217

Urfer, R.; Tsoulfas, P.; O'Connell, L.; Shelton, D.; Parada, L. and Presta, L. 1995 An

immunoglobulin-like domain determines the specificity of neurotrophin receptors.

EMBO J., 14:2795-2805.

Vaillant, A.; Mazzoni, I.; Tudan, C.; Boudreau, M.; Kaplan, D. and Miller, F. 1999

Depolarization and neurotrophins converge on the phosphatidylinositol

3-kinase-Akt pathway to synergistically regulate neuronal survival. The Journal of

cell biology., 146:955-966.

Valenzuela, D.; Maisonpierre, P.; Glass, D.; Rojas, E.; Nunez, L.; Kong, Y.; Gies, D.;

Stitt, T.; Ip, N. and Yancopoulos, G. 1993 Alternative forms of rat TrkC with

different functional capabilities. Neuron, 10:963-974.

Vega, Q.; Worby, C.; Lechner, M.; Dixon, J. and Dressler, G. 1996 Glial cell line-derived

neurotrophic factor activates the receptor tyrosine kinase RET and promotes

kidney morphogenesis. Proceedings of the National Academy of Sciences,

93:10657-10661.

Verdi, J.; Birren, S.; Ibanez, C.; Persson, H.; Kaplan, D.; Benedetti, M.; Chao, M. and

Anderson, D. 1994 p75LNGFR regulates Trk signal transduction and

NGF-induced neuronal differentiation in MAH cells. Neuron, 12:733-745.

Vernallis, A.B.; Conroy, W.G. and Berg, D.K. 1993 Neurons assemble AChRs with as

many as 3 kinds of subunits while maintaining subunit segregation among

subtypes. Neuron, 10:451-464.

218

Vesa, J.; Kruttgen, A. and Shooter, E.M. 2000 p75 reduces TrkB tyrosine

autophosphorylatin in response to brain-derived neurotrophic factor and

neurotrophin 4/5. J. Biological Chemistry, 275:24414-24420.

Vetter, M.; Martin-Zanca, D.; Parada, L.; Bishop, J. and Kaplan, D. 1991 Nerve growth

factor rapidly stimulates tyrosine phosphorylation of phospholipase C-gamma 1 by

a kinase activity associated with the product of the trk protooncogene. Proceedings

of the National Academy of Sciences, 88:5650-5654.

Viant, M.R.; Millam, J.R.; Delany, M.E. and Fry, D.M. 2000 Regulation of brain-derived

neurotrophic factor messenger RNA levels in avian hypothalamic slice cultures.

Neuroscience, 99:373-380.

Vicario-Abejon, C.; Collin, C.; McKay, R.D.G. and Segal, M. 1998 Neurotrophins Induce

Formation of Functional Excitatory and Inhibitory Synapses between Cultured

Hippocampal Neurons. J. Neurosci., 18:7256-7271.

Vogel, K.; Brannan, C.; Jenkins, N.; Copeland, N. and Parada, L. 1995 Loss of

neurofibromin results in neurotrophin-independent survival of embryonic sensory

and sympathetic neurons. Cell (Cambridge), 82:733-742.

von Bartheld, C.S.; Williams, R.; Lefcort, F.; Clary, D.O.; Reichardt, L.F. and Bothwell,

M. 1996 Retrograde transport of neurotrophins from the eye to the brain in chick

embryos: roles of the p75NTR and trkB receptors. J. Neuroscience, 16:2995-3008.

Wang, T.; Xie, K. and Lu, B. 1995 Neurotrophins promote maturation of developing

neuromuscular synapses. J. Neuroscience, 15:4796-4805.

219

Watson, F.L.; Heerssen, H.M.; Bhattacharyya, A.; Klesse, L.; Lin, M.Z. and Sega, R.A.

2001 Neurotrophins use the Erk5 pathway to mediate a retrograde survival

response. Nature Neuroscience, 4:981-988.

Wescamp, G. and Reichardt, L.F. 1991 Evidence that biological activity of NGF is

mediated through a novel subclass of high-affinity receptors. Neuron, 6:649-663.

West, A.E.; Chen, W.G.; Dalva, M.B.; Dolmetsch, R.E.; Kornhauser, J.M.; Shaywitz,

A.J.; Takasu, M.A.; Tao, X. and Greenberg, M.E. 2001 Calcium regulation of

neuronal gene expression. PNAS, 98:11024-11031.

Wetmore, C. and Olson, L. 1995 Neuronal and nonneuronal expression of neurotrophins

and their receptors in sensory and sympathetic ganglia suggest new intercellular

trophic interactions. The Journal of comparative neurology., 353:143-159.

Widenfalk, J.; Nosrat, C.; Tomac, A.; Westphal, H.; Hoffer, B. and Olson, L. 1997

Neurturin and glial cell line-derived neurotrophic factor receptor-beta

(GDNFR-beta), novel proteins related to GDNF and GDNFR-alpha with specific

cellular patterns of expression suggesting roles in the developing and adult nervous

system and in peripheral organs. J. Neuroscience, 17:8506-8519.

Widmer, H.; Kaplan, D.; Rabin, S.; Beck, K.; Hefti, F. and Knusel, B. 1993 Rapid

phosphorylation of phospholipase C gamma 1 by brain-derived neurotrophic factor

and neurotrophin-3 in cultures of embryonic rat cortical neurons. Journal of

Neurochemistry, 60:2111-2123.

220

Windisch, J.M.; Marksterner, R. and Schneider, R. 1995 Nerve growth factor binding site

on TrkA mapped to a single 24-Amino acid leucine-rich motif. J. Biological

Chemistry, 270:28133-28138.

Wonnacott, S. 1997 Presynaptic nicotinic ACh receptors. Trends Neurosci, 20:92-98.

Wooten, M.; Seibenhener, M.; Mamidipudi, V.; Diaz-Meco, M.; Barker, P. and Moscat, J.

2001 The atypical protein kinase C-interacting protein p62 is a scaffold for

NF-kappaB activation by nerve growth factor. The Journal of biological

chemistry., 276:7709-7712.

Worby, C.; Vega, Q.; Zhao, Y.; Chao, H.; Seasholtz, A. and Dixon, J. 1996 Glial cell

line-derived neurotrophic factor signals through the RET receptor and activates

mitogen-activated protein kinase. The Journal of biological chemistry.,

271:23619-23622.

Wright, E.; Vogel, K. and Davies, A. 1992 Neurotrophic factors promote the maturation of

developing sensory neurons before they become dependent on these factors for

survival. Neuron, 9:139-150.

Wright, J.; Drueckes, P.; Bartoe, J.; Zhao, Z.; Shen, S. and Krebs, E. 1997 A role for the

SHP-2 tyrosine phosphatase in nerve growth-induced PC12 cell differentiation.

Molecular Biology of the Cell, 8:1575-1585.

Wright, L. 1981 Cell survival in chick embryo ciliary ganglion is reduced by chronic

ganglionic blockade. Dev. Brain Res., 1:283-286.

221

Wyatt, S.; Middleton, G.; Doxakis, E. and Davies, A.M. 1999 Selective Regulation of

trkC Expression by NT3 in the Developing Peripheral Nervous System. J.

Neurosci., 19:6559-6570.

Xia, Z.; Dickens, M.; Raingeaud, J.; Davis, R. and Greenberg, M. 1995 Opposing effects

of ERK and JNK-p38 MAP kinases on apoptosis. Science, 270:1326-1331.

Xie, K.; Wang, T.; Olafsson, P.; Mizuno, K. and Lu, B. 1997 Activity-dependent

expression of NT-3 in muscle cells in culture: implications in the development of

neuromuscular junctions. J. Neuroscience, 17:2947-2958.

Xing, J.; Ginty, D. and Greenberg, M. 1996 Coupling of the RAS-MAPK pathway to gene

activation by RSK2, a growth factor-regulated CREB kinase. American

Association for the Advancement of Science. Science, 273:959-963.

Xu, B.; Gottschalk, W.; Chow, A.; Wilson, R.; Schnell, E.; Zang, K.; Wang, D.; Nicoll,

R.; Lu, B. and Reichardt, L. 2000 The role of brain-derived neurotrophic factor

receptors in the mature hippocampus: modulation of long-term potentiation

through a presynaptic mechanism involving TrkB. J. Neuroscience, 20:6888-6897.

Yacoubian, T.A. and Lo, D.C. 2000 Truncated and full-length TrkB receptors regulate

distinct modes of dendritic growth. Nature Neuroscience, 3:342-349.

Yamada, M.; Ohnishi, H.; Sano, S.; Nakatani, A.; Ikeuchi, T. and Hatanaka, H. 1997

Insulin receptor substrate (IRS)-1 and IRS-2 are tyrosine-phosphorylated and

associated with phosphatidylinositol 3-kinase in response to brain-derived

neurotrophic factor in cultured cerebral cortical neurons. The Journal of biological

chemistry., 272:30334-30339.

222

Yamashita, H.; Avraham, S.; Jiang, S.; Dikic, I. and Avraham, H. 1999a The Csk

homologous kinase associates with TrkA receptors and is involved in neurite

outgrowth of PC12 cells. The Journal of biological chemistry., 274:15059-15065.

Yamashita, T.; Tucker, K. and Barde, Y. 1999b Neurotrophin binding to the p75 receptor

modulates Rho activity and axonal growth. Neuron, 24:585-593.

Yamashita, T.; Tucker, K.L. and Barde, Y.A. 1999c Neurotrophin binding to the p75

receptor modulates Rho activity and axonal outgrowth. Neuron, 24:585-593.

Yan, Q.; Elliott, J.; Matheson, C.; Sun, J.; Zhang, L.; Mu, X.; Rex, K. and Snider, W. 1993

Influences of neurotrophins on mammalian motoneurons in vivo. Journal of

Neurobiology, 24:1555-1577.

Yan, Q.; Radeke, M.J.; Matheson, C.R.; Talvenheimo, J.; Welcher, A.A. and Feinstein,

S.C. 1997 Immunocytochemical localization of TrkB in the central nervous system

of the adult rat. J. Comp. Neurol., 378:135-157.

Yang, F.; He, X.; Feng, L.; Mizuno, K.; Liu, X.; Russell, J.; Xiong, W. and Lu, B. 2001

PI-3 kinase and IP3 are both necessary and sufficient to mediate NT3-induced

synaptic potentiation. Nature Neuroscience, 4:19-28.

Yao, R. and Cooper, G. 1995 Requirement for phosphatidylinositol-3 kinase in the

prevention of apoptosis by nerve growth factor. American Association for the

Advancement of Science. Science, 267:2003-2006.

Yeh, J.J.; Ferreira, M.; Ebert, S.; Yasuda, R.P.; Kellar, K.J. and Wolfe, B.B. 2001

Axotomy and nerve growth factor regulate levels of neuronal nicotinic

223

acetylcholine receptor a3 subunit protein in the rat superior cervical ganglion. J.

Neurochemistry, 79:258-265.

Yin, Q.W.; Johnson, J.; Prevette, D. and Oppenheim, R.W. 1994 Cell death of spinal

motoneurons in the chick embryo following deafferentation: rescue effects of

tissue extracts, soluble proteins, and neurotrophic agents. J. Neurosci.,

14:7629-7640.

Ying, S.W.; Futter, M.; Rosenblum, K.; Webber, M.J.; Hunt, S.P.; Bliss, T.V. and

Bramham, C.R. 2002 Brain-derived neurotrophic factor induces long-term

potentiation in intact adult hippocampus: requirement for ERK activation

coupled to CREB upregulation and Arc synthesis. J. Neuroscience, 22:1532-1540.

York, R.; Yao, H.; Dillon, T.; Ellig, C.; Eckert, S.; McCleskey, E. and Stork, P. 1998 Rap1

mediates sustained MAP kinase activation induced by nerve growth factor. Nature

(London), 392:622-626.

Zafra, F.; Castren, E.; Thoenen, H. and Lindholm, D. 1991 Interplay between glutamate

and g-aminobutyric acid transmitter systems in the physiological regulation of

brain-derived neurotrophic factor and nerve growth factor synthesis in

hippocampal neurons. Proceedings National Academy of Sciences USA,

88:10037-10041.

Zafra, F.; Hengerer, B.; Leibrock, J.; Thoenen, H. and Lindholm, D. 1990 Activity

dependent regulation of BDNF and NGF mRNAs in the rat hippocampus is

mediated by non-NMDA glutamate receptor. EMBO J., 9:3545-3550.

224

Zafra, F.; Lindholm, D.; Castren, E.; Hartikka, J. and Thoenen, H. 1992 Regulation of

brain-derived neurotrophic factor and nerve growth factor mRNA in primary

cultures of hippocampal neurons and astrocytes. J. Neuroscience, 12:4793-4799.

Zhong, Z.; Wen, Z. and Darnell, J.E.J. 1994 Stat3: a STAT family member activated by

tyrosine phosphorylation in response to epidermal growth factor and interleukin-6.

Science, 264:95-98.

Zhou, X.; Nai, Q.; Chen, M.; Dittus, J.; Howard, M. and Margiotta, J. 2004 Brain-derived

neurotrophic factor and trkB signaling in parasympathetic neurons: relevance to

regulating alpha7-containing nicotinic receptors and synaptic function. J.

Neuroscience, 24:4340-4350.

Zhou, X. and Rush, R. 1994 Localization of neurotrophin-3-like immunoreactivity in the

rat central nervous system. Brain Research, 643:162-172.

Zhou, X. and Rush, R. 1995 Sympathetic neurons in neonatal rats require endogenous

neurotrophin-3 for survival. Journal of Neuroscience, 15:6521-6530.

225

ABSTRACT

Neurotrophin family is composed of several neurotrophin molecules. BDNF, as one of the

widely studied family members, is a potent molecule in promoting the neuronal survival

and regulating synaptic functions demonstrated in a variety of systems. However, in the

chicken CG neurons, general wisdom considers the irrelevance of BDNF to this classic

model of the parasympathetic system. In this study, both the expression and the potential

function of BDNF/TrkB in the chicken CG were carefully investigated. BDNF, as well as

its functional receptor TrkB, were both detected in the CG neurons during the embryonic

stage (E8-E14). Application of BDNF in the culture specifically upregulated the surface

binding sites and the transcript level of α7 nAChRs, but not those of α3∗-nAChRs. The

full length TrkB receptor was shown essential for the BDNF induced regulation. In

addition, whole-cell currents mediated by α7 nAChRs and synaptic activities dramatically

increased following the same treatment. Interestingly, BDNF was shown as a

survival-promoting neurotrophic factor in vitro as well. The BDNF expression and release

in culture was upregulated by the depolarization. Moreover, depolarization-induced

survival of CG neurons was attenuated with the application of BDNF antibody which

blocks the endogenous BDNF function. Combined with the fact that an increase was

detected in the level of released BDNF in the culture media, such results above imply the

potential BDNF autocrine pathway in promoting activity-dependent CG neuronal survival.

Based on the expression pattern of BDNF during the embryogenesis, it is quite reasonable

to speculate that BDNF may support CG neuronal survival and regulate receptor

expression, function and synaptic activity in vivo.

226