This article was published in an Elsevier journal. The attached copyis furnished to the author for non-commercial research and

education use, including for instruction at the author’s institution,sharing with colleagues and providing to institution administration.

Other uses, including reproduction and distribution, or selling orlicensing copies, or posting to personal, institutional or third party

websites are prohibited.

In most cases authors are permitted to post their version of thearticle (e.g. in Word or Tex form) to their personal website orinstitutional repository. Authors requiring further information

regarding Elsevier’s archiving and manuscript policies areencouraged to visit:

http://www.elsevier.com/copyright

Author's personal copy

Biomaterials 28 (2007) 4836–4844

Fetuin-A gene expression, synthesis and release in primary humanhepatocytes cultured in a galactosylated membrane bioreactor

Bruno Memolia, Loredana De Bartolob,�, Pietro Faviac, Sabrina Morellib,Linda C. Lopezc, Alfredo Procinoa, Giuseppe Barbierib, Efrem Curciod,

Lidietta Giornob, Pasquale Espositoa, Mario Cozzolinoe, Diego Brancaccioe,Vittorio E. Andreuccia, Riccardo d’Agostinoc, Enrico Driolib,d

aDepartment of Nephrology, University Federico II of Naples, Napoli, ItalybInstitute of Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, Cubo 17/C,

Via P. Bucci, I-87030 Rende (CS), ItalycDepartment of Chemistry, University of Bari, Bari, Italy

dDepartment of Chemical Engineering and Materials, University of Calabria, Rende (CS), ItalyeDepartment of Nephrology and Dialysis, San Paolo Hospital, Milan, Italy

Received 19 February 2007; accepted 4 May 2007

Available online 13 August 2007

Abstract

This paper reports on human hepatocytes cultured in a galactosylated membrane bioreactor in order to explore the modulation of the

effects of a pro-inflammatory cytokine, Interleukin-6 (IL-6) on the liver cells at molecular level. In particular the role of IL-6 on gene

expression and production of a glycoprotein, fetuin-A produced by hepatocytes, was investigated by culturing hepatocytes in the

membrane bioreactor, both in the absence and presence of IL-6 (300 pg/ml).

IL-6 modulated the fetuin-A gene expression, synthesis and release by primary human hepatocytes cultured in the bioreactor. A 75%

IL-6-induced reduction of fetuin-A concentration in the medium was associated with a 60% increase of C-reactive protein in the same

samples. Real-time-PCR demonstrated an 8-fold IL-6-induced reduction of fetuin-A gene expression. These results demonstrate that the

hepatocyte galactosylated membrane bioreactor is a valuable tool to study IL-6 effects and gave evidence, for the first time, that IL-6

down-regulates the gene expression and synthesis of fetuin-A by primary human hepatocytes. The human hepatocyte bioreactor behaves

like the in vivo liver, reproducing the same hepatic acute-phase response that occurs during the inflammatory process.

r 2007 Elsevier Ltd. All rights reserved.

Keywords: Fetuin-A; IL-6; Inflammation; Hepatocytes; Bioreactor; Galactosylated membrane

1. Introduction

The in vitro reconstruction of human organ functionshas proved to be an important challenge for studyingdisease, drugs, infection and molecular therapeutics. Thedevelopment of dynamic systems using human liver cellsmay represent a valuable tool in the understanding of themolecular mechanism of some clinical aspects of inflam-matory diseases.

Among the inflammatory biomarkers, interleukin-6(IL-6) operates as a central regulator of inflammatory pro-cesses and plays a prominent role in the course of severalpathological conditions, including uremia [1–5]. Circulat-ing IL-6 is the most important factor controlling thehepatic acute-phase response, an innate body defence seenduring acute illnesses involving the liver to increase thesynthesis and secretion of certain blood proteins, ‘‘so-called’’ positive acute-phase proteins (C-reactive protein(CRP), serum amyloid A and fibrinogen), and to decreasethe synthesis and release of others (so that their plasmaconcentration is reduced), ‘‘so-called’’ negative acute-phaseproteins (albumin, prealbumin, transferrin and fetuin-A)

ARTICLE IN PRESS

www.elsevier.com/locate/biomaterials

0142-9612/$ - see front matter r 2007 Elsevier Ltd. All rights reserved.

doi:10.1016/j.biomaterials.2007.05.043

�Corresponding author. Tel.: +39984 492036; fax: +39 984 402103.

E-mail address: l.debartolo@itm.cnr.it (L. De Bartolo).

Author's personal copy

[6,7]. However, many aspects regarding the effects of thiscytokine, in particular the possibility of neutralizing ormodulating IL-6 effects [8,9], are still unclear and requirefurther investigation, although they are difficult to performin humans.

Engineered liver tissues may provide a good opportunityto study the actions of IL-6 and the role of its solublereceptors in an optimized microenvironment. Humanhepatocytes are the main target of IL-6. Unfortunately,human hepatocytes, when cultured in traditional systems(batch cultures) lose their viability and some liver-specificfunctions in a few days, including the ability to synthesizeproteins. For this reason, studies on hepatocytes have beencarried out almost exclusively in animal models orhepatoma cell lines.

The development of new dynamic culture models, suchas the membrane bioreactor, makes it now possible tomaintain these cells perfectly vital for many days, in amicroenvironment that simulates in vivo conditions, there-by overcoming the limitations of batch culture systems[10–13]. Various bioreactor configurations have beenexplored for hepatocyte culture including membranebioreactors (hollow fiber, flat, fiber network, spiral)[14–19] and by using several adhesive substrates [20–23].Few studies have been reported on human hepatocytesin a galactosylated membrane bioreactor and on thereproduction of the hepatic acute-phase response duringinflammation. In this study, human hepatocytes werecultured in a galactosylated polyethersulfone (PES) mem-brane bioreactor, which permits cells to be cultured in awell-defined fluid-dynamics microenvironment and meta-bolic rates to be easily estimated. Previously a strategy wasdeveloped to modify PES membranes with covalentlyimmobilized galactose oxidized to galactonic acid (GAL),because galactose derivatives elicit specific interactionswith hepatocyte asyaloglycoprotein receptors therebyimproving cell adhesion and maintenance of differentiatedfunctions [24,25]. In this study, this functionalized mem-brane was used in the bioreactor as a support for theadhesion of human hepatocytes.

By using this membrane bioreactor the effect of IL-6 onthe hepatocyte synthesis of acute-phase proteins wasinvestigated, which have important implications in thecardiovascular mortality of dialysis patients. In particular,the role of IL-6 on gene expression, synthesis and release offetuin-A (AHSG, alpha-2HS-glycoprotein) synthesized byhepatocytes was investigated. This protein inhibits in vivovascular calcification and in patients with inflammatoryproblems, such as patients in dialysis treatment, thereduction of plasmatic levels of this protein may contributeto cardiovascular mortality and a poor outcome [4,26]. Forthis reason, studies on molecular mechanisms that associ-ate inflammation with vascular calcification could provideeffective indications to treat patients with inflammatoryproblems more appropriately.

The aim of this study, therefore, is to evaluate the role ofIL-6 on gene expression, synthesis and release of fetuin-A

by primary human hepatocytes cultured within a galacto-sylated PES membrane bioreactor. To date this crucialissue has been studied only on hepatocytes isolated fromanimals (rat or pig) or hepatoma cell lines. Thus, allassociations and conclusions between fetuin-A levels andthe inflammatory state have been obtained purely byclinical studies [26,27].

2. Materials and methods

2.1. The bioreactor

The bioreactor (Fig. 1a) consists of a circular acrylic housing with a

chamber (volume V: 65 cm3) fitted with flow inlet and outlet. At the

bottom of the chamber a semi-permeable modified PES membrane is

located with an active area of 41.8 cm2. Human hepatocytes were adhered

on the surface of PES membranes modified by plasma techniques and

covalently immobilized with GAL. This galactose derivative was chosen

because it elicits specific interactions with primary human hepatocyte

asyaloglycoprotein receptors and improves cell adhesion and maintenance

of differentiated functions [24,25].

2.2. Modified PES membranes: plasma processes, chemical

immobilization and surface characterization

Low-temperature discharges, known as cold plasmas, offer a con-

venient way to achieve surface chemical and physical modifications of the

few topmost layers of materials, while retaining their mechanical, physical

and chemical bulk properties. Plasma techniques, in particular plasma-

enhanced chemical vapor deposition (PE-CVD), can produce surfaces

with tuneable density of functional groups (e.g. –COOH; –OH; –NH2,

etc.), which can be used as anchor groups for immobilizing molecules [28].

Flat PES membranes (7 cm diameter, 0.1 mm pore size: PALL Corp.

Michigan, US) were plasma modified in a stainless-steel parallel plate

radiofrequency (RF, 13.56MHz) plasma reactor feed with acrylic acid

vapors to achieve a stable plasma-deposited acrylic acid (pdAA) surface

[28], dense enough with –COOH functionalities to immobilize the GAL

moieties. Further details of the reactor and of the pdAA deposition

process are given in Ref. [28]. The surface composition of the modified

membranes was investigated with X-ray photoelectron spectroscopy

(XPS). Scanning electron microscopy (SEM) analysis ensured that the

morphology and porosity of the membranes were not altered.

GAL was immobilized at the PES–pdAA surface through a hydrophilic

spacer arm (SA) molecule (O,O0-bis-(2-aminopropyl)-polyethylene glycol

500), as described in [25]. PES–pdAA–SA substrates were then immersed

in a 1-ethyl-3-(3-dimethylamino-propyl) carbodiimide 0.05M solution in

morpholine ethane sulfonate buffer (pH 5.5; 1 h, 4 1C; mild stirring) and

reacted with GAL moieties in their acid oxidized form (GAL).

The presence of galactose derivatives on PES–pdAA–SA–GAL

surfaces was confirmed by fluorescence microscopy after binding

FITC-lectin to galactose moieties. Modified and unmodified PES

membranes (surface area 25mm2) were incubated in a FITC-lectin

solution (from Arachis hypogaea, 5mg/ml, Sigma, St. Louis, MO, USA,

100ml, 1 h at 37 1C). The samples were extensively rinsed with water then

observed under a Zeiss Fluorescence microscope (Eex 488nm). PES–

pdAA–SA–GAL membranes exhibited a markedly high level of FITC

fluorescence signals with respect to the unmodified PES.

2.3. The human hepatocytes

Cryopreserved primary human hepatocytes (Cambrex, Bio Science,

East Rutherford, NJ) were thawed in a 37 1C water bath with gentle

shaking. Cell suspension was slowly transferred into 20ml of cold

hepatocyte culture medium (HCMTM, Cambrex, Bio Science) and

centrifuged at 50g at 4 1C for 3min. The cell pellet was then suspended

ARTICLE IN PRESSB. Memoli et al. / Biomaterials 28 (2007) 4836–4844 4837

Author's personal copy

in HCMTM constituted from hepatocyte basal medium (HBMTM) together

with all components provided in HCMTM bulletkits (Cambrex Bio-

science): hepatocyte growth factors, insulin, ascorbic acid transferring,

BSA-FAF and GA-1000. The viability of the hepatocytes (assessed by

Trypan blue exclusion) ranged between 95% and 98%.

The human hepatocytes treated as described were then seeded on

PES–pdAA–SA–GAL membrane in the bioreactor. After the liver cells

adhered, the bioreactor was perfused with oxygenated medium with and

without IL-6.

Hepatocytes were cultured also in batch system on collagen. This latter

was used as reference substratum. Collagen from calf skin (Sigma, Milan,

Italy) was dissolved with sterile acetic acid (0.1M) to the final

concentration of 1mg/ml. Solution of collagen gel was added to obtain

a coating density of 10 mgcm2. Cells and controls were incubated at 37 1C

in a 5% CO2; 20% O2 atmosphere (v/v) with 95% relative humidity for the

duration of the experiments.

2.4. Sample preparation for SEM

Specimens of cell cultures were prepared for SEM by fixation in 2.5%

glutaraldehyde, pH 7.4 phosphate buffer, followed by post-fixation in 1%

osmium tetroxide and by progressive dehydration in ethanol. The

specimens were examined by SEM after plating with gold under vacuum.

2.5. IL-6 production by peripheral blood mononuclear cells

(PBMC)

Blood samples (30ml of heparinized blood) were collected from 10

healthy subjects in order to isolate PBMC. PBMC were isolated by Ficoll-

Hypaque (Flow Laboratories, Irvine, UK) gradient density centrifugation

(400g for 30min). Mononuclear cells were washed twice with PBS (Sigma,

Milan, Italy) and re-suspended in RPMI culture medium (Sigma)

supplemented with 1% heat-inactivated fetal calf serum (Sigma) and

antibiotics (penicillin and streptomycin). Cells were then counted and their

viability determined by trypan blue dye exclusion (more than 95% PBMC

were viable). Following this step, the PBMC were incubated in culture

tubes (Falcon) at a concentration of 1� 106/ml and cultured for 24 h, at

37 1C in a 5% CO2 saturated humidity incubator in the presence of a

mitogenic stimulator, i.e. 200 ng/ml of bacterial (Escherichia coli)

lipopolysaccharide (LPS, Sigma). At the end of the incubation period

cell-free supernatants were collected by centrifugation and stored at

�80 1C. The pooled supernatants contained IL-6 at a concentration of

11,800pg/ml (ELISA assay, see below).

2.6. Experimental procedures

The bioreactor was connected to the perfusion system (Fig. 1b)

consisting of a glass medium reservoir, tubing, oxygenator and two

microperistaltic pumps (Ismatecr, Glattbrugg, Switzerland). The medium

from the reservoir first entered into the oxygenator where it was heated

and oxygenated; then it flowed into the bioreactor. The oxygenated

medium, loaded with or without IL-6, was continuously fed to the

cells adhered on the membrane in the bioreactor with a flow rate Q of

0.58ml/min, which was set on the basis of average retention time; a

fraction of the stream leaving the bioreactor Qr of 4.5ml/min was recycled

to mix with the stream of fresh medium, Q, before entering the bioreactor.

Residence time distribution analysis was performed with the classical

tracer response technique to the step change of the tracer concentration in

the inlet stream, to identify fluid-dynamic conditions that would grant a

uniform concentration of metabolite in the bioreactor [29]. Under these

conditions, the bioreactor could be considered an ideal Continuous Stirred

Tank Reactor and the subsequent kinetics study was simplified.

The metabolic rate of a given metabolite was estimated directly from

the metabolite concentration in the inlet (Cin) and outlet (Cout) streams

according to the steady state mass balance about the bioreactor, by using

the following equation:

�r ¼QðCin � CoutÞ

V. (1)

Experiments were performed in a basal condition (without IL-6 in the

medium) and in the presence of human IL-6. Experiments with IL-6 were

carried out by changing the medium without IL-6 with the same medium

containing an IL-6 concentration of 300 pg/ml. In other studies, in order

to evaluate the effects of increasing concentrations of IL-6 on hepatocytes

functions, cytokine concentration was increased stepwise in the feed

stream from 0 to 300 pg/ml. In both types of experiments, after a relatively

short transient, the IL-6 concentration in the stream leaving the bioreactor

attained a steady state that remained constant throughout the duration of

the experiment. When the bioreactor reached the steady state, the system

ARTICLE IN PRESS

Peristalticpump

sample

collector

Peristalticpump

Oxygenator

O2(95%) / CO2(5%)

Membrane

Bioreactor

medium

reservoir

Fig. 1. Membrane bioreactor: (a) photograph and (b) scheme of the bioreactor connected to the perfusion system. The medium from the reservoir is

pushed by a peristaltic pump through the oxygenator into the membrane bioreactor. Mixing is improved by recirculating a part of the outlet stream back

to the reactor to prevent the formation of stagnant regions and channeling.

B. Memoli et al. / Biomaterials 28 (2007) 4836–48444838

Author's personal copy

was continuously recycled in order to increase the concentration of

detectable metabolites in the reservoir. Hepatocytes in the bioreactor were

cultured up to 20 days without any significant decline in their

differentiated functions. Samples of supernatant were collected from both

inlet and outlet of the bioreactor and from the reservoir of culture

medium; all samples were immediately frozen at �80 1C until assays. The

experimental concentration versus time data were fitted by appropriate

analytical functions (R240.95), and first derivatives used for calculating

reaction rates by the tangent method. The metabolic values reported in the

graphs are the mean of three measurements repeated for six experi-

ments7standard deviation (SD).

2.7. Biochemical and ELISA assays

Samples of the culture medium were collected from the bioreactor in

pre-chilled tubes and stored at �80 1C until assayed. Albumin production

in the samples was measured by the immunometric method (ELISA) using

antibodies against human albumin (Sigma, St. Louis, MO, USA). ELISA

assays were done from cells of six different isolations. Chromatographi-

cally purified human albumin and the monoclonal antibody for human

albumin were from Bethyl (Bethyl Laboratories Inc., USA). Ninety-six

well plates were coated with 50mg/ml of albumin and left overnight at

4 1C. After washing the plate 4 times, 100ml of cell culture supernatant wasadded to the wells and incubated with 100ml of anti-human albumin

antibody conjugated with horseradish peroxidase (Bethyl Laboratories,

Inc.). After 24 h at 4 1C, the substrate buffer containing Tetramethylben-

zidine and H2O2 (Sigma, St. Louis, MO, USA) was added for 7min. The

reaction was stopped with 50ml of 8 NH2SO4. Absorbance was measured

at 450 nm using a Multiskan Ex (Thermo Lab Systems).

The concentration of IL-6 in hepatocyte supernatant was evaluated

using ELISA (Quantikine, R&D Systems, Minneapolis, MN) as described

elsewhere [3,5]. The lower detection limit was o0.70 pg/ml. CRP and

fetuin-A concentrations were also assayed using ELISA (Bender

MedSystems GmbH, Vienna, Austria, for CRP, and Li Star FISH,

Milan, Italy, for fetuin-A, respectively). For all kits variation coefficients

of both inter- and intra-assay was o5%. All samples were analyzed in

triplicate.

2.8. Cell detachment

For genomic analysis the cells were detached from the membrane, after

experiments, by the addition of 0.05% collagenase in PBS (Sigma, Milan,

Italy) followed by incubation at 37 1C for 30min. The cells were then

centrifuged for 5min at 800 rpm. The cell pellet was washed with 10ml

PBS and then stored at �80 1C until assay.

2.9. Hepatocyte gene expression of fetuin-A, CRP and albumin

The genome sequence corresponding to fetuin-A, CRP and albumin,

respectively, was obtained from the GeneBank (www.ncbi.nlm.nih.gov)

in order to identify the specific primers. The exon sequences were analyzed

in order to establish a pair of primers (sense and anti-sense) for each gene,

able to generate amplified fragments measuring between 150 and 500 bp in

length and with annealing temperature between 55 and 62 1C. The sense

and anti-sense primers were selected to include at least one intron to

prevent genomic DNA contamination during amplification. The selected

primers are shown in Table 1.

Frozen hepatocytes were pulverized with a blender and lysed in

guanidinium isothiocyanate. Total RNA was extracted by the single-step

method, using phenol and chloroform/isoamylalcohol. Four microgram of

total RNA were subjected to cDNA synthesis for 1 h at 37 1C using the

‘‘Ready to go You-Primer First-Stand Beads’’ kit (Amersham Pharmacia

Biotech Little Chalfont Buckinghamshire, UK) in a reaction mixture

containing 0.5mg oligo-dT (Amersham Pharmacia Biotech Little Chalfont

Buckinghamshire, UK).

PCR amplification of cDNA was performed in a reaction mixture

containing 5ml of cDNA sample and different primer sets (20 picomol

each). The amplification of the different genes (fetuin-A, CRP, albumin

and human b-actin, as house-keeping) was achieved using one pair of

primers for each specific gene in a single reaction. PCR products were

separated by ethidium 1.2% agarose gel electrophoresis.

2.10. Real-time PCR

Real-time quantitative PCR analyses for fetuin-A, CRP and albumin

genes were performed using ABI prism 7500 (Applied Biosystem, Foster

City, CA) and the 50exonuclease assay (Taq-Man technology). This assay

uses a specific oligonucleotide probe, annealing between the two primer

sites, which is labelled with a reporter fluorophore and a quencher.

Cleavage of the probe by exonuclease activity of Taq polymerase during

strand elongation releases the reporter from the probe resulting in an

increase in reporter emission intensity owing to its separation from the

quencher. This increment in net fluorescence is monitored in real-time

during each PCR amplification.

The cDNA, synthesized as previously described, was used for real-time

PCR performed in 96-well optical reaction plates with cDNA equivalent

to 100 ng RNA in a volume of 25ml reaction containing 1�Taqman

Universal Master Mix, optimized concentrations of FAM-labelled probe

and specific forward and reverse primer for the genes selected from Assay

on Demand (Applied Biosystems Foster City, CA). Controls included

RNA subjected to RT–PCR without reverse transcriptase and PCR with

water replacing cDNA. The results were analyzed using a comparative

method, and the values were normalized to the b-actin expression and

converted into fold change based on a doubling of PCR product in each

PCR cycle, according to the manufacturer’s guidelines.

2.11. Statistical analysis

Statistical analysis was performed using the ANOVA followed by

Bonferroni, as post hoc test. Results are express as mean7SD; statistical

significance was defined as po0.05 and po0.01.

3. Results

PES membranes were coated with a thin (�30 nm) pdAAlayer, very stable in water media and further modified byGAL moieties. After each modification step surfaces wereanalyzed with XPS. The atomic composition of thePES–pdAA surface (C 78.9%, O 21.1%) did not reveal

ARTICLE IN PRESS

Table 1

Selected sense and anti-sense primer used in the identification of albumin, CRP and fetuin-A gene expressions

Primers Sense Anti-sense

CRP TTTCTTCGTCTTGACCAGCC TTCTTCAGACTCTTCCTCACCC

Albumin CTTGAATGTGCTGATGACAGG GCAAGTCAGCAGGCATCTCAT

AHSGA CTTTGTCTTGCTCAGCTCTG GGTGTCTATTTCAATCTCAAA

b-actin CACCATGGATGATGATATCG TGGATAGCAACGTACATGG

B. Memoli et al. / Biomaterials 28 (2007) 4836–4844 4839

Author's personal copy

any signal of the PES substrate underneath (e.g. fromSulfur). The pdAA layer resulted dense with a 4% (relativeto all surface C atoms) of COOH groups to be utilized forthe covalent immobilization of a diamine SA moleculethrough the synthesis of an amide bond. The resultingPES–pdAA–SA surface was further modified by thecovalent immobilization of GAL moieties through anotheramide bond. The PES–pdAA–SA–GAL surface exhibited aC 75.7%; O 22.9%; N 1.3% XPS atomic composition.

The complete adherence of hepatocytes to the surface ofPES–pdAA–SA–GAL membranes was evaluated withSEM (Fig. 2). When loaded into the bioreactor, the cellsrapidly attached and formed small clusters, spreadingwithin 24 h. After 1 day, the hepatocytes established cell-to-cell contacts with nearby cells and exhibited a polygonalshape, maintaining their differentiated functions for almostone month (Fig. 2).

Since IL-6 is the most potent inductor of acute-phaseresponse by the liver, first the effect of IL-6 on theproduction of the most important acute-phase proteins wasinvestigated, such as albumin and CRP, negative andpositive protein of the acute-phase, respectively.

Fig. 3a shows a significant decrease in albumin synthesisand release following the addition of IL-6 (300 pg/ml) tothe medium. After 3 days of culture the albuminconcentration decreased from 21.471 to 8.871.1 ng/mlin the presence of IL-6. These results were confirmed by thereal-time PCR analysis for albumin obtained in humanhepatocytes cultured in basal condition and after IL-6stimulation (Fig. 3b). It is evident a 3.33 fold increase ofalbumin gene expression in hepatocytes in basal conditionswith respect to those treated with this proinflammatorycytokine. IL-6 also affected the production of CRP, sinceits synthesis by hepatocytes increased significantly duringIL-6 stimulation; also in this case the production of CRPover time under the effect of IL-6 (300 pg/ml) followed thesame trend observed without IL-6 (Fig. 4a). In agreement

with the metabolic data, the real-time PCR analysis showsan increase of CRP gene expression in hepatocytes treatedwith IL-6 with respect to those untreated (Fig. 4b).In the human hepatocyte bioreactor the response of cells

to increasing concentrations of IL-6 was also evaluated.Fig. 5 shows the synthesis rate of albumin that wascalculated according to Eq. (1), as a function of increasingIL-6 concentrations. It is evident that the rate of albuminsynthesis by human hepatocytes cultured in adhesion onPES–pdAA–SA–GAL membrane bioreactor decreasedproportionally and significantly with the progressiveincrease of IL-6 concentration in the culture medium.In Fig. 6 the results of the experiments regarding fetuin-A

(in comparison with CRP) are reported. The addition ofIL-6 (300 pg/ml) to the medium led to a statisticallysignificant reduction of fetuin-A concentration in the

ARTICLE IN PRESS

Fig. 2. SEM’s images of human hepatocytes cultured on PES–pdAA–

SA–GAL membrane in the bioreactor. Bar 20mm.

0

5

10

15

20

25

30

2 4

Time [days]

Alb

um

in [pg/m

l]

*

**

0

1

2

3

4

medium without IL-6 medium with IL-6

Alb

um

in m

RN

A e

xpre

ssio

n

(fold

diffe

rence)

β-Actin 433bp

Albumin 157bp

3

Fig. 3. (a) Cumulative concentration of albumin synthesized by human

hepatocytes cultured on PES–pdAA–SA–GAL membrane in the bior-

eactor, without (shade bar) and with (full bar) IL-6 (300 pg/ml). Albumin

synthesis was greatly decreased by IL-6 addition to the inlet stream. The

values are the mean of six experiments7standard deviation. *po0.05

versus IL-6 unstimulated cells. (b) Upper panel: b-actin (as housekeeping,

top left) and albumin (bottom right) gene expression in human

hepatocytes cultured in the bioreactor in absence of IL-6. Image is

representative of six experiments. Lower panel: albumin gene expression in

human hepatocytes. Bar graph shows the relative expression of albumin

mRNA, as determined by real-time PCR, in hepatocytes fed with a

medium with or without IL-6 (300 pg/ml). Values on the Y-axis represent

an arbitrary unit derived from the mean expression value for gene of

hepatocytes unstimulated with IL-6 compared with values for hepatocytes

stimulated with IL-6 set at 1.

B. Memoli et al. / Biomaterials 28 (2007) 4836–48444840

Author's personal copy

medium (from 8079.8 to 6078.7 pg/ml, after 1 day, and to20710.1 pg/ml, after 2 days, po0.01) associated with acontemporary increase of CRP concentration (from177712.1 to 280711.7 pg/ml, after 1 day, and to 287711.5 pg/ml, after 2 days, po0.01). It is evident that IL-6strongly affected the rate of fetuin-A synthesis by humanhepatocytes.

This phenomenon is also shown in Fig. 7, where thecalculated reaction rates are reported as a function of time:the addition of IL-6 to the inlet fluid at a concentration of300pg/ml was followed by a decrease in the rate of fetuin-Asynthesis by human hepatocytes from 1 to 0.46 pg/ml/h.These results give the clear first evidence that human fetuin-A, like albumin, may be considered as a negative acute-phase protein.

These observations are confirmed by the differentexpression of fetuin-A gene found in unstimulated andstimulated human hepatocytes. In Fig. 8 (upper panel) wereport the mRNA for fetuin-A expressed in humanhepatocytes (in absence of IL-6 stimulation). In Fig. 8(lower panel) we also report the results of real-time PCRanalysis for fetuin-A obtained in human hepatocytes inbasal condition and after IL-6 stimulation. It is evident thatfetuin-A gene expression is eight-fold higher in humanhepatocytes not treated with IL-6 than those treated withthis proinflammatory cytokine. Similar results wereobtained in hepatocytes cultured in batch system. A change

ARTICLE IN PRESS

0

50

100

150

200

250

Time [days]

CR

P [pg

/ml]

*

*

*

0

1

2

3

4

medium without IL-6 medium with IL-6

CR

P m

RN

A e

xpre

ssio

n

(fold

diffe

rence)

433bp β-Actin

405bp CRP

2 3 4

Fig. 4. (a) Cumulative concentration of C-reactive protein (CRP)

synthesized by human hepatocytes cultured on PES–pdAA–SA–GAL

membrane in the bioreactor without (shade bar) and with (full bar) IL-6

(300 pg/ml). CRP synthesis was greatly increased by IL-6 addition to the

inlet stream. The production of CRP with time under IL-6 treatment

followed the same trend observed without IL-6. The values are the mean

of six experiments7standard deviation. *po0.05 versus unstimulated

cells. (b) Upper panel: b-actin (as housekeeping, top left) and CRP

(bottom right) gene expression in human hepatocytes cultured in the

bioreactor in absence of IL-6. Image is representative of six experiments.

Lower panel: CRP gene expression in human hepatocytes. Bar graph

shows the relative expression of CRP mRNA, as determined by real-time

PCR, in hepatocytes fed with a medium with or without IL-6 (300 pg/ml).

Values on the Y-axis represent an arbitrary unit derived from the mean

expression value for gene of hepatocytes unstimulated with IL-6 compared

with values for hepatocytes stimulated with IL-6 set at 1.

0

50

100

150

200

250

0 60 120 240

IL-6 [pg/ml]

Alb

um

in s

yn

thesis

[ng/h

*m

ilioncell]

*

*

*

*

Fig. 5. Rate of albumin synthesis by human hepatocytes cultured on

PES–pdAA–SA–GAL membrane in the bioreactor at different concentra-

tions of IL-6. The progressive increase of IL-6 concentration into the

culture medium was followed by a progressive decrease of albumin

synthesis. The values are the mean of six experiments7standard deviation.

*po0.05 versus all the others.

0

50

100

150

200

250

300

Concentr

ation

[pg/m

l]

1 3

Time [days]

IL-6

CRP

Fetuin-A

+ IL-6

*

**

2 4 5

Fig. 6. Effect of the presence of IL-6 (300 pg/ml) in the medium of

hepatocytes. The addition of IL-6 induced an increase of CRP

concentration in the medium associated with a decrease of fetuin-A

concentration. The values are the mean of six experiments7standard

deviation. *po0.01 versus fetuin-A days 4 and 5; **po0.01 versus CRP

days 4 and 5.

B. Memoli et al. / Biomaterials 28 (2007) 4836–4844 4841

Author's personal copy

of fetuin-A gene expression following the treatment withIL-6 was also measured (Fig. 9).

4. Discussion

Tissue engineering today represents a great challenge tomaintain, restore, or create tissues and organs [30,31]. Asan expression of tissue engineering, our hepatocytebioreactor represents the most appropriate culture systemfor human hepatocytes, since cell cultures in batch are notsufficiently reliable. Static culture methods, in fact, arecharacterized by an unstirred medium layer overlying cellsattached to a gas impermeable substrate and are exposed tochanges in nutrient concentration and to catabolite

accumulation with time. In such conditions, quantitativereliable information on cell metabolism is difficult toobtain because the concentration of a given metabolitechanges over time, so that it cannot be completely relatedto cell metabolism; other factors (e.g. the development ofconcentration gradients in the culture medium owing todiffusive resistances to mass transport or poor mixing andreduction of cell viability over time) may affect reactionpaths and rates. Furthermore, in the case of the liver(an organ highly perfused in vivo) static cell culturemethods are susceptible to oxygen and nutrient limitationswith consequent reduction of cell viability and functionality[27]. Several bioreactors have been developed for hepato-cyte culture [14–19] and the use of galactose-modifiedsurfaces has been shown to improve cell adhesion andfunctional maintenance [22,25]. However, few studies havebeen reported about the application of these functionalmembranes in a human hepatocyte bioreactor. A distin-guishing feature of our bioreactor is that its fluid dynamicsensures a uniform concentration of metabolites at the cellsite because of well-mixing. Cells inside the bioreactor werecultured under closely monitored and tightly controlledenvironmental and operating conditions ensuring a con-tinuous and high perfusion of cells similarly to the naturalliver. Additionally, a galactose derivative modified mem-brane mediates specific interactions between asyaloglyco-protein receptors of cellular membranes and the membranesurface maintaining hepatocyte functions and phenotype,probably owing to the enhanced cell–cell interactions. Inthe case of acute-phase response investigation the reductionor increase of metabolic rates were estimated and related tothe effective IL-6 concentration differently from theconventional methods. Furthermore, long-term study canbe performed owing to the best preservation of cell viabilityand function integrity inside the bioreactor.In order to validate our bioreactor, as a potential tool

for testing the effects of IL-6 stimulation on liver cells, wehave firstly studied the effects of IL-6 on the production of

ARTICLE IN PRESS

0

0.2

0.4

0.6

0.8

1

1.2

3 5 6

Time [days]

Fetu

in-A

synth

esis

[pg/m

l*h]

*

7

Fig. 7. Effects of IL-6 on the rate of fetuin-A synthesis. The addition of

IL-6 to the inlet fluid at concentration of 300 pg/ml was followed by a

significant (po0.01) decrease in the rate of fetuin-A synthesis by

hepatocytes. The reaction rates were calculated by tangent method on

average concentration values. The values are the mean of six experi-

ments7standard deviation.

-Actin 433bp

Fetuin-A 236bp

0

2

4

6

8

10

medium without IL-6 medium with IL-6

Fe

tuin

-A r

ela

tive

mR

NA

exp

ressio

n

β

Fig. 8. Upper panel: b-actin (as housekeeping, top left) and fetuin-A

(bottom right) gene expression in human hepatocytes cultured in the

bioreactor in absence of IL-6. Image is representative of five experiments.

Lower panel: fetuin-A gene expression in human hepatocytes. Bar graph

shows the relative expression of fetuin-A mRNA, as determined by real-

time PCR, in hepatocytes fed with a medium with or without IL-6 (300 pg/

ml). Values on the Y-axis represent an arbitrary unit derived from the

mean expression value for gene of hepatocytes unstimulated with IL-6

compared with values for hepatocytes stimulated with IL-6 set at 1.

0

2

4

6

8

10

medium without IL-6 medium with IL-6

Fe

tuin

-A r

ela

tive

mR

NA

exp

ressio

n (

fold

diffe

ren

ce

)

Fig. 9. Fetuin-A gene expression in human hepatocytes cultured in batch

system. Bar graph shows the relative expression of fetuin-A mRNA, as

determined by real-time PCR, in hepatocytes fed with a medium with or

without IL-6 (300 pg/ml). Values on the Y-axis represent an arbitrary unit

derived from the mean expression value for gene of hepatocytes

unstimulated with IL-6 compared with values for hepatocytes stimulated

with IL-6 set at 1.

B. Memoli et al. / Biomaterials 28 (2007) 4836–48444842

Author's personal copy

albumin and CRP by adding IL-6 to the medium.Considering the influence of flow rate on the meanresidence time (t ¼ V/Q), experimental investigations werecarried out at different flow rates. The results demonstratedthat for a mean residence time t ¼ 64min the IL-6 down-regulation of albumin synthesis was of 17% with respect tothe basal conditions. As expected, increasing the meanresidence time to 108min the reduction of albuminsynthesis in the presence of IL-6 was of 50%. In this worka t ¼ 108min was chosen in order to measure anappreciable metabolic conversion.

Our results clearly demonstrated that our humanhepatocyte bioreactor works perfectly as an in vitro modelsystem to study many highly differentiated functions. Ourexperiments, in fact, perfectly simulated an IL-6-inducedacute-phase response with an increased production of CRPand a reduced synthesis and release of albumin. We thenstudied the effects of IL-6 on human fetuin-A synthesis andrelease.

Human fetuin-A (or AHSG, a2-Heremans Schmidglycoprotein, a2HS-glycoprotein, a2-HSG) is an extracel-lular calcium-regulatory protein acting as a potentinhibitor of calcium� phosphate precipitation [26,32]. Itis ubiquitous and accounts for more than 50% of theprecipitation inhibitory effect of serum.

To date, mechanisms underlying synthesis and release offetuin-A in humans are still to be demonstrated and nodata are present in the worldwide literature regardingfetuin-A production by primary human hepatocytes.Triffitt et al. [33], in fact, demonstrated, by the liver ofrabbit perfused in situ, the production of a a-glycoprotein(analogous of human fetuin) that the same authors hadpreviously isolated from bovine and rabbit bone matrix.

It has also been speculated that fetuin-A is down-regulated in vivo as a negative acute-phase protein: itsserum concentration, in fact, falls during inflammation ortrauma [34]. Consistent with this observation is thedemonstration of a significant inverse relationship indialysis patients between fetuin-A and CRP serumconcentrations [26]. No data are however available in theworld literature concerning the role of proinflammatorycytokines on fetuin-A production by human hepatocytes.Ohnishi et al. [35], in fact, demonstrated only in rats aninhibitory role exerted by inflammatory cytokines (includ-ing IL-6) on phosphofetuin (the rat counterpart of bovinefetuin-A and human a2-HSG) synthesis and mRNAexpression by rat hepatocytes. Daveau et al. [36] demon-strated that HepG2 hepatoma cells (incubated for only24–48 h) synthesized a2HS-glycoprotein and this synthesiswas down-regulated by various recombinant cytokines(rIL-1b, rIL-6 etc). The authors also demonstrated thatproinflammatory cytokines induced a down-regulation ofAHSG mRNA levels, as measured by northern blotanalysis. Gangneux et al. [37] recently showed themolecular mechanism of the down-regulation of plasmafetuin-A induced by inflammation in rat and mice, which iscontrolled by a series of binding sites for transcription

factors in the gene promoter. However, all these resultswere obtained in cells different from human primaryhepatocytes. It is well-known, in fact, that hepatoma cells,although easier to culture, have important functionaldifferences, as compared to primary hepatocytes [38].Hepatoma cell lines may express only a set of hepaticfunctions and at levels different from those exhibited bynormal hepatocytes [39]. Thus, results obtained fromhepatoma cell lines cannot be directly transferred tohumans.Our results represent the first clear demonstration that

human IL-6 down-regulates fetuin-A synthesis and release(by 75% after 2 days) as well as its gene expression (eight-fold) in human hepatocytes cultured in the bioreactor.These results are in good agreement with the clinicalstudies that have demonstrated low levels of fetuin-A indialysis patients with signs of inflammation associated withprogressive coronary artery and aortic calcification [26]although gene variations of fetuin-A may also influencefetuin levels and outcome [40].The developed human hepatocyte bioreactor behaves as

the in vivo liver reproducing the same hepatic acute-phaseresponse that occurs during the inflammation process.Therefore, this system may allow studies of modulation ofthe effects of cytokines (such as IL-6) on the liver cells evenat molecular level and may help to solve the pathogenesisof important human diseases.

5. Conclusion

This study demonstrated that the hepatocyte galactosy-lated membrane bioreactor is a valuable tool to study IL-6effects and gave evidence, for the first time, that IL-6down-regulated the gene expression and synthesis of fetuin-A by primary human hepatocytes. The effect of IL-6 indecreasing fetuin-A production by hepatocytes strengthensthe negative role of this proinflammatory cytokine andsuggests new associations between IL-6 and cardiovascularmortality in dialysis patients. According to these conclu-sions, fetuin-A may be definitely considered a ‘‘negative’’acute-phase protein, such as albumin.

Acknowledgments

The Italian Ministry of Instruction, University andResearch (MIUR) is gratefully acknowledged for fundingthis research through the FIRB RBNE012B2K researchproject.

References

[1] Memoli B, Libetta C, Rampino T, Dal Canton A, Conte G, Scala G,

et al. Hemodialysis related induction of interleukin-6 production by

peripheral blood mononuclear cells. Kidney Int 1992;42:320–6.

[2] Libetta C, De Nicola L, Rampino T, De Simone W, Memoli B.

Inflammatory effects of peritoneal dialysis: evidence of systemic

monocyte activation. Kidney Int 1996;49:506–11.

ARTICLE IN PRESSB. Memoli et al. / Biomaterials 28 (2007) 4836–4844 4843

Author's personal copy

[3] Memoli B, Postiglione L, Cianciaruso B, Bisesti V, Cimmaruta C,

Marzano L, et al. Role of different dialysis membranes in the release

of interleukin 6 soluble receptor in uremic patients. Kidney Int

2000;58:417–24.

[4] Memoli B, Minutolo R, Bisesti V, Postiglione L, Conti A, Marzano

L, et al. Changes of serum albumin and C-reactive protein are related

to changes of interleukin 6 release by peripheral blood mononuclear

cells in hemodialysis patients treated with different membranes. Am J

Kidney Dis 2002;39:266–73.

[5] Memoli B, Grandaliano G, Soccio M, Postiglione L, Guida B, Bisesti

V, et al. In vivo modulation of soluble ‘‘antagonist’’ IL-6 receptor

synthesis and release in end stage renal disease. J Am Soc Nephrol

2005;16:1099–107.

[6] Stenvinkel P, Barany P, Heimburger O, Pecoits-Filho R, Lindholm B.

Mortality, malnutrition, and atherosclerosis in ESRD: what is the

role of interleukin 6? Kidney Int 2002;61(Suppl 80):S103–8.

[7] Stenvinkel P, Ketteler M, Johnson RJ, Lindholm B, Pecoits-Filho R,

Riella M, et al. IL-10, IL-6, and TNF-a: central factors in the altered

cytokine network of uremia—the good, the bad, and the ugly. Kidney

Int 2005;67:1216–33.

[8] Nishimoto N, Kishimoto T. Inhibition of IL-6 for the treatment of

inflammatory diseases. Curr Opin Pharmacol 2004;4:386–91.

[9] Ito H, Takazoe M, Fukuda Y, Hibi T, Kusugami K, Andoh A, et al.

A pilot randomized trial of a human anti-interleukin 6 receptor

monoclonal antibody in active Crohn’s disease. Gastroenterology

2004;126:989–96.

[10] De Bartolo L, Bader A. Review of a flat membrane as a bioartificial

liver. Ann Transpl 2001;6:40–6.

[11] Strain AJ, Neuberger JM. A bioartificial liver—state of the art.

Science 2002;295:1005–9.

[12] De Bartolo L, Salerno S, Morelli S, Giorno L, Rende M, Memoli B,

et al. Long-term maintenance of human hepatocytes in oxygen-

permeable membrane bioreactor. Biomaterials 2006;27:4794–803.

[13] Curcio E, De Bartolo L, Barbieri G, Rende M, Giorno L, Morelli S,

et al. Diffusive and convective transport through hollow fiber

membranes for liver cell culture. J Biotechnol 2005;117:309–21.

[14] Flendrig LM, La Soe JW, Joerning GGA, Steenbeck A, Karlsen OT,

Bovee WMM, et al. In vitro evaluation of a novel bioreactor based on

an integral oxygenator and a spirally wound nonwoven polyester

matrix for hepatocyte culture as small aggregates. J Hepatol 1997;

26:1379–92.

[15] Gerlach J, Schnoy N, Smith MD, Neuhaus P. Hepatocyte culture

between woven capillary networks—a microscopy study. Artif

Organs 1994;18:226–30.

[16] Jauregui HO, Mullon CJP, Trenkler D, Naik S, Santangini H, Press

P, et al. In vivo evaluation of a hollow fiber liver assist device.

Hepatology 1995;21:460–9.

[17] Nyberg SL, Shirabe K, Peshwa MW, Sielaff TD, Crotty PL, Mann

HJ, et al. Extracorporeal application of a gel-entrapment, bioartificial

liver: demonstration of drug metabolism and other biochemical

functions. Cell Transplant 1993;2(6):441–52.

[18] Patzer JF. Advances in bioartificial liver assist devices. Ann N Y

Acad Sci 2001;944:320–33.

[19] De Bartolo L, Jarosch-Von Schweder G, Haverich A, Bader A. A

novel full-scale flat membrane bioreactor utilizing porcine hepato-

cytes: cell viability and tissue-specific functions. Biotechnol Prog

2000;16:102–8.

[20] Dunn JC, Tompkins RG, Yarmush ML. Long-term in vitro function

of adult hepatocytes in a collagen sandwich configuration. Biotechnol

Prog 1991;7(3):237–45.

[21] Sanchez A, Alvarez Pagan R, Roncero C, Vilaro S, Benito M,

Fabregat I. Fibronectin regulates morphology, cell organization and

gene expression of rat fetal hepatocytes in primary culture. J Hepatol

2000;32(2):242–50.

[22] Lu HF, Lim WS, Wang J, Tang ZQ, Zhang PC, Leong KW,

et al. Galactosylated PVDF membrane promotes hepatocyte attach-

ment and functional maintenance. Biomaterials 2003;24(27):

4893–903.

[23] De Bartolo L, Morelli S, Lopez L, Giorno L, Campana C, Salerno S,

et al. Biotransformation and liver specific functions of human

hepatocytes in culture on RGD-immobilised plasma-processed

membranes. Biomaterials 2005;26(21):4432–41.

[24] Park TG. Perfusion culture of hepatocytes within galactose-deriva-

tized biodegradable poly(lactide-co-glycolide) scaffolds prepared by

gas foaming of effervescent salts. J Biomed Mater Res 2002;59:

127–35.

[25] De Bartolo L, Morelli S, Rende M, Salerno S, Giorno L, Lopez LC,

et al. Galactose derivative immobilized glow discharge processed PES

membranes maintain the metabolic activity of human and pig liver

cells. J Nanosci Nanotech 2006;6:2344–53.

[26] Ketteler M, Bongartz P, Westenfeld R, Wildberger JE, Mahnken

AH, Bohm R, et al. Association of low fetuin-A (AHSG) concentra-

tions in serum with cardiovascular mortality in patients on dialysis: a

cross-sectional study. Lancet 2003;361:827–33.

[27] Honda H, Qureshi AR, Heimburger O, Barany P, Wang K, Pecoits-

Filho R, et al. Serum albumin, C-reactive protein, interleukin 6, and

fetuin-A as predictors of malnutrition, cardiovascular disease, and

mortality in patients with ESRD. Am J Kidney Dis 2006;47:139–48.

[28] Detomaso L, Gristina R, Senesi GS, d’Agostino R, Favia P. Stable

plasma-deposited acrylic acid surfaces for cell culture applications.

Biomaterials 2005;26:3831–41.

[29] De Bartolo L, Salerno S, Giorno L, Morelli S, Barbieri G, Curcio E,

et al. Membrane bioreactor using pig hepatocytes for in vitro

evaluation of antinflammatory drug. Catal Today 2006;118:172–80.

[30] Griffith LG, Naughton G. Tissue engineering—current challenges

and expanding opportunities. Science 2002;295:1009–14.

[31] Bader A, Fruhauf N, Tiedge M, Drinkgern M, De Bartolo L, Borlak

JT, et al. Enhanced oxygen delivery reverses anaerobic metabolic

states in prolonged sandwich rat hepatocyte culture. Exp Cell Res

1999;246:221–32.

[32] Reynolds JL, Skepper JN, McNair R, Kasama T, Gupta K,

Weissberg PL, et al. Multifunctional roles for serum protein fetuin-

A in inhibition of human vascular smooth muscle cell calcification. J

Am Soc Nephrol 2005;16:2920–30.

[33] Triffitt JT, Gebauer U, Ashton BA, Owen ME. Origin of plasma

a2HS-glycoprotein and its accumulation in bone. Nature 1976;262:

226–7.

[34] Lebreton JP, Joisel F. Serum concentration of human alpha2 HS

glycoprotein during the inflammatory process. J Clin Invest

1979;64:1118–29.

[35] Ohnishi T, Nakamura O, Arakaki N, Miyazaki H, Daikuhara Y.

Effects of cytokines and growth factors on phosphorylated fetuin

biosynthesis by adult rat hepatocytes in primary culture. Biochem

Biophys Res Commun 1994;200:598–605.

[36] Daveau M, Davrinche C, Julen N, Hiron M, Arnaud P, Lebreton JP.

The synthesis of human a2-HS glycoprotein is down-regulated by

cytokines in hepatoma HepG2 cells. FEBS Lett 1988;241:191–4.

[37] Gangneux C, Daveau M, Hiron M, Derambure C, Papaconstantinou

J, Salier J-P. the inflammation-induced down-regulation of plasma

fetuin-A (a2HS-glycoprotein) in liver results from the loss of

interaction between long C/EBP isoforms at two neighbouring

binding sites. Nucleic Acid Res 2003;31(20):5957–70.

[38] Wilkening S, Stahl F, Bader A. Comparison of primary human

hepatocytes and hepatoma cell line HEPG2 with regard to their

biotransformation properties. Drug Metab Dispos 2003;31:1035–42.

[39] Guillozo A, Morel F, Langouet S, Maheo K, Rissel M. Use of

hepatocyte cultures for study of hepatotoxic compounds. J Hepatol

1997;26(Suppl 2):23–80.

[40] Stenvinkel P, Wang K, Qureshi AR, Axelsson J, Pecoits-Filho R,

Gao P, et al. Low fetuin-A are associated with cardiovascular death:

impact of variations in the gene encoding fetuin. Kidney Int 2005;67:

2383–92.

ARTICLE IN PRESSB. Memoli et al. / Biomaterials 28 (2007) 4836–48444844