a PATTERNS & PHENOTYPES

Expression Patterns of the Wtx/Amer GeneFamily During Mouse Embryonic DevelopmentGlenda Comai, Agnes Boutet, Yasmine Neirijnck, and Andreas Schedl*

WTX/AMER1 is a novel negative regulator of the WNT/b-catenin pathway with mutations detected inWilms’ tumors and an X-linked sclerosing bone dysplasia. WTX/AMER1 (Fam123b) shares several domainsof homology with two other recently identified proteins: AMER2 (Fam123a) and AMER3 (Fam123c). Here,we describe an in-depth expression analysis of all three members of this gene family during mouse embry-onic development. All genes were strongly expressed in the central as well as the peripheral nervous sys-tem, thus suggesting important roles of this gene family during neurogenesis. Specific expression wasfound in the retina, inner ear, and nasal epithelium. Outside of the nervous system Wtx/Amer1 showed thebroadest expression domains including cephalic and limb mesenchyme, skeletal muscle, bladder, gonads,lung bud, salivary glands, and the kidneys. The widespread expression pattern of Wtx/Amer1, togetherwith its role as a modulator of the Wnt signaling pathway, suggest that Wtx/Amer1 serves pleiotropic rolesduring mammalian organogenesis. Developmental Dynamics 239:1867–1878, 2010. VC 2010 Wiley-Liss, Inc.

Key words: Wtx; Amer genes; Wilms’ tumor; Wnt signaling; central nervous system; mouse embryogenesis; geneexpression

Accepted 30 March 2010

INTRODUCTION

WTX has been recently identified as agene mutated in a high proportion ofWilms’ tumor, the most common pedi-atric solid cancer (Rivera et al., 2007).More recently, germline mutations inWTX were also observed in OSCS(osteopathia striata congenita withcranial sclerosis) patients, a conditioncharacterized by increased bone den-sity and craniofacial malformations infemales and lethality in males (Jen-kins et al., 2009). Therefore, whilebeing implicated in these different de-velopmental malignancies, WTXappears as both a tumor suppressorand a critical regulator of embryonicdevelopment.

On the molecular level, WTX

appears to be tightly linked to theWNT/b-catenin signaling pathway. Itwas identified as a protein associatedwith the b-catenin destruction com-plex (Major et al., 2007), promoting

ubiquitination and degradation of b-catenin in vitro. In a parallel study,WTX was also found to bind to APCthus directly inducing changes in thelocalization of APC from the ends of

microtubules to the plasma mem-brane. Based on these findings WTXwas given the alternative nameAMER1 for APC membrane recruit-

ment 1 (Grohmann et al., 2007). Thisstudy also identified AMER2 as a pro-tein that shares high similarity with

WTX. By using the murine WTX/

AMER1 amino acid sequence as a toolfor homology assignment in a data-base, our lab found that WTX actuallybelongs to a family of three proteins:WTX/AMER1 (NCBI nomenclature:

FAM123B), AMER2 (FAM123A), andthe third new family member we iden-tified (FAM123C) which we will callsubsequently as AMER3 accordinglyto the phylogenetic analysis (Boutet

et al., unpublished results). Despitebeing highly conserved among verte-brates, the expression patterns of theAmer gene family during embryonic

development remain largely unex-plored. In the present manuscript, wedescribed a systematic study using

Dev

elop

men

tal D

ynam

ics

Additional Supporting Information may be found in the online version of this article.

INSERM U636, Centre de Biochimie, and University of Nice/Sophia-Antipolis, Nice, FranceGrant sponsor: Association pour la Recherche sur le Cancer (ARC); Grant number: 1130; Grant sponsor: Association for InternationalCancer Research (AICR); Grant number: 09-0752.*Correspondence to: Andreas Schedl, INSERM U636, Centre de Biochimie, Parc Valrose, 06108 Nice, France.E-mail: schedl@unice.fr

DOI 10.1002/dvdy.22313Published online 12 May 2010 in Wiley InterScience (www.interscience.wiley.com).

DEVELOPMENTAL DYNAMICS 239:1867–1878, 2010

VC 2010 Wiley-Liss, Inc.

section and whole-mount in situ

hybridization to determine the spatio-temporal expression of WTX/Amer1,Amer2, and Amer3 during mouse em-bryonic development.

RESULTS

Expression of Amer Genes

From Postimplantation to

Midgestation Stages

To test whether Amer transcripts arealready present in early mouseembryos, we performed semiquantita-tive reverse transcriptase-polymerasechain reaction (RT-PCR) analysis onRNA extracted from embryonic day(E) 7.5 to E9.5 embryos. While signifi-cant expression of the WTX/Amer1gene was detected at E7.5, very lowlevels of Amer2 RNA expression wereobserved at the same stage (Supp.Fig. S1A, which is available online).Whole-mount in situ hybridization con-firmed the presence ofWTX/Amer1 andAmer2 transcripts in the embryo properat E7.5 (data not shown), suggesting apotential involvement of these genesduring gastrulation. At E8.5 WTX/Amer1 and Amer2 transcription levelswere significantly increased (Supp. Fig.S1A). Whole-mount in situ hybridiza-tion at this stage, displayed a diffuse yetclear gradient of mRNA expressionalong the anterior–posterior axis forboth genes (data not shown). This gradi-ent along the neuraxis was maintainedand became more evident for Amer2 atE9.0. (Note the strong staining forAmer2 in the prospective brain and an-terior embryonic structures in Supp.Fig. S1B). Amer3 mRNA expressionwas not detected from E7.5 to E9.0(Supp. Fig. S1A,B), but a highly region-alized expression in cranial ganglia andanterior part of the neural tube could beobserved fromE9.5 (Supp. Fig. S1C).

From E9.5 to E11.5, mRNA expres-sion of the Wtx/Amer1 and Amer2genes was detected in all prospectiveregions of the central nervous system:the neuroepithelium of developingbrain and neural tube along the bodyaxis (Figs. 1A(a,b), 1B(b), 2A(a–c),2B(a–f)). A more restricted expressionwas found for Amer3 within the telen-cephalon, mesencephalon, ventralpart of the hindbrain, and spinal cord(Figs. 1C(C3), 3(A,C), and Supp. Fig.S1C). Vibratome sections of whole-

mount stained embryos at E10.5revealed strong regionalization ofAmer3 transcripts, with labeling beingmainly restricted to groups of neuronsin the anterior–lateral part of the fore-brain and ventral midbrain (whitearrowheads in Fig. 3(d)). Other signsof regionalization were the presence ofAmer3 transcripts in the nascent mar-ginal layer of the hindbrain and spinalcord neuroepithelium (Fig. 3(a–c,c0,e,f)), with the strongest signalpresent in presumptive motor neuronpools (postmitotic neurons) of the ba-sal plate (Fig. 3(e,f), white arrow-heads). No labeling was detected inthe ventricular zone. In case of Amer2,even though moderate expression wasobserved along the neuroepithelium ofthe hindbrain, it was chiefly evident inneuronal groups in the basal plate andalar plate (Fig. 2B(d,e) black arrow-heads). Amer2 mRNA was alsoexpressed throughout the neural tubewith highest levels in the marginallayer (Fig. 2B(b)).

Expression of all three Amer geneswas found in the trigeminal ganglion(V) (Fig. 1B(b), Fig. 2B(B3), Fig.3(A,C), Fig. 3(a), and data not shown)and the otic vesicle (Fig. 1A(a), Fig.2A(A1), Fig. 1C(C30)) whereas onlyWtx/Amer1 and Amer2 were detectedin the optic vesicle from E9.5 to E11.5(Fig. 1A(A1), Fig. 2B(c), and data notshown). It is important to mentionthatAmer3 transcripts in the otic vesi-cle were evident at E11.5 (Fig.1C(C30)) but not at earlier stages (Fig.3(A)). Very strong and specific expres-sion of Amer3 was also detected inadditional cranial nerves includingthe facioacoustic (VII/VIII) ganglion,glossopharyngeal or petrosal (IX) gan-glion, and inferior ganglion of vagusnerve or nodose ganglion (X) (Fig.3(A), and Suppl. Fig. S1C). Section insitu hybridization at later stages dem-onstrated also expression of Wtx/Amer1 and Amer2 in the facio-acoustic(VII/VIII) ganglion (Fig. 4D and datanot shown).

Sections through the dorsal aorta inthe rostral part of the trunk at E10.5evidenced strong Amer2 expression inthe primary sympathetic ganglioniccondensations along the midline dor-sal aorta (Fig. 2B(a,b)). Amer2 expres-sion in the sympathetic trunk wasmaintained throughout development(Fig. 9(j)). Moreover, we could detect

all Amer gene transcripts in the anla-gen of the dorsal root ganglia (Figs.2B(a,b), 3(b), and data not shown).In non-neural tissues, very strong

expression of Wtx/Amer1 was ob-served in the umbilical arteries andveins, the coelomic epithelium and thebody wall (Figs. 1A(b), 1B(b)). Wtx/Amer1 was also strongly expressed inthe limb bud mesenchyme underlyingthe surface ectoderm (Fig. 1B(a)),while Amer2 was only moderatelyexpressed in this structure (Figs.2A(c), 2B(a)). In the head region, highlevels of Wtx/Amer1 and moderate tolow levels of Amer2 expression weredetected in the facial primordium fromE9.5. Lateral views of the embryonichead region at E9.5 clearly showedpresence of Wtx/Amer1 transcripts inthe craniofacial mesenchyme (Fig.1A(A1)) and presence of Wtx/Amer1and lower levels of Amer2 mRNA inthe branchial arches (Figs. 1A(A1),2A(A1), 2B(B3)). Staining of the mes-enchyme of the brachial arches (whichis mainly neural crest derived) wasconfirmed in vibratome sections (Fig.1A(a)) and paraffin (Fig. 1B(b)) sec-tions. Conspicuous Wtx/Amer1expression was also found in thecaudal presomitic mesoderm (Fig.1A(A1)). Finally, all Amer gene tran-scripts were observed in the develop-ing somites though in a distinctive pat-tern. While Wtx/Amer1 and Amer2were detected at the internal edges ofthe somites, probably representing theboundary of dermomyotome and myo-tome (Figs. 1A(b,c), 2A(c)), Amer3mRNA was observed more internally(presumably in the sclerotome) andseemed restricted to the developingsomites of the medial part of the body(Fig. 3A(c), and Supp. Fig. S1C(b)).This complementary expression pat-tern in the somites (and in anotherstructures as the olfactory epithelium,see below) could be a reflection of thesubfunctionalization or division ofexpression betweenAmer familymem-bers that might have occurred duringevolution.

Expression in the Fetal

Nervous System and Sensory

Placode Derivatives

To further investigate the expressionpatterns of Amer genes in late

Dev

elop

men

tal D

ynam

ics

1868 COMAI ET AL.

embryonic and fetal tissues, we per-formed in situ hybridization usingparaffin sections prepared from E11.5to E18.5 mouse embryos. A summary

of the observed expression patternscan be found in Table1.

All Amer family members showed ahighly overlapping expression pattern

throughout the nervous system, butspecific domains of regionalizationcould be also distinguished.Between E12.5 and E14.5, sagittal

and transverse head paraffin sectionsshowed expression of Amer genesthroughout the telencephalon, thala-mus, midbrain, pons, medulla oblon-gata, and spinal cord (Fig. 4B,C,D).The highest level of expression wasseen for Amer2 at all stages studied.Landmarks of Wtx/Amer1 expressionwere the intense labeling of distinc-tive neuronal tracts in the medullaoblongata (asterisks in Fig. 4B,D andFig. 9(d)). In the case of Amer3,expression was restricted to the outerzone or the cortical plate (Fig. 4D;

Fig. 1.

Fig. 2.

Fig. 2. Highlights of Amer2 expression inmidgestation mouse embryos. A,B: Expres-sion of Amer2 was analyzed by whole-mountin situ hybridization (ISH) at embryonic stages9.5 (A) and 10.5 (B). Frontal (B1) and lateral(A1, B2 and B3) whole-mount views areshown. The approximate level and orientationof the gelatin sections after whole-mountstaining (a–c in A and a–f in B) are shown inthe schematic drawings. Ba, branchial arches;Bp, basal plate; Da, dorsal aorta; Dc, dience-phalon; Drg, dorsal root ganglion; Flb, forelimbbud; Fv, fourth ventricle; H, heart; Hb, hind-brain; Hlb, hindlimb bud; Inl, inner (neural)layer of the optic cup; Me, mesencephalon;Nt, neural tube; Os, optic stalk; Otv, otic vesi-cle; Ov, optic vesicle; Rb, rhombencephalon;S, somites; Sc, spinal cord; St, sympathetictrunk; Tc, telencephalon; TeV, telencephalicvesicle; Tv, third ventricle; Vg, trigeminal gan-glion. Black arrowheads are used to indicateregionalization of Amer2 expression in theneural epithelium. D, dorsal; V, ventral.

Fig. 1. Developmental expression of Wtx/Amer1 and Amer family genes in midgestationmouse embryos. A: Expression of Wtx/Amer1was analyzed by whole-mount in situ hybrid-ization (A1) followed by vibratome sections(a,b,c) at embryonic day (E) 9.5. B: Section insitu hybridization of Wtx/Amer1 at E10.5 (a,b).Drawings indicate the approximate angle ofsections at the discussed embryonic stages.C: Comparative expression analysis of theAmer gene family at E11.5. Otic vesicles aredelineated with dashed lines in C10. Lateral(A1, C1, C2 and C3) and dorsal (C10, C20, andC30) whole-mount views are shown. Ba, bran-chial arches; Bp, branchial pouch; Bw, bodywall; Cb, cerebellum; Ce, coelomic epithelium;Cfm, craniofacial mesenchyme; D, dermomyo-tome; Da, dorsal aorta; Flb, forelimb bud; Fv,fourth ventricle; H, heart; Hb, hindbrain; Hlb,hindlimb bud; Me, mesencephalon; My, myo-tome; Nt, neural tube; Otv, otic vesicle; Ov,optic vesicle; Psm, presomitic mesoderm; Rb,rhombencephalon; S, somites; Sc, spinalcord; Tc, telencephalon; Ua, umbilical artery;Uv, umbilical vein; Vg, trigeminal ganglion.

Dev

elop

men

tal D

ynam

ics

MOUSE WTX/AMER GENE FAMILY EXPRESSION PATTERNS 1869

Fig. 6A), a subpial layer where post-mitotic neurons reside (Andrieu et al.,2003). The cell layers of undifferenti-ated neural precursors such as theventricular zone of the neocortexwere not labeled. Further investiga-tions will be needed to reveal the sig-nificance of Amer3 specificity to post-mitotic neuronal populations. Finally,transcripts of Wtx/Amer1 and Amer2were also detected in the choroidplexus within the fourth ventricle(Fig. 6B).At the level of the spinal cord, trans-

verse sections at E15.5 evidencedhighly overlapping expression of Amergenes in the forming dorsal and ven-tral horns of the mantle layer (graymatter; Fig. 5A). The marginal layer(white matter) was almost devoid ofAmer gene expression. Similarly, allAmer genes transcripts were observedin ganglia of the peripheral nervous

Fig. 3.

Fig. 4.

Fig. 4. A–D: Comparative expression analy-sis of Amer family genes at E11.5 (A), E12.5(B), E13.5 (C), and E14.5 (D) (sagittal sec-tions). Ag, adrenogland primordium; Bw, bodywall; Cb, cerebellar primordium; Ce, coelomicepithelium; Cp, cortical plate; Da, dorsalaorta; Dc, diencephalon; Drg, dorsal root gan-glia; E, eye; H, heart; Hl, hindlimb; K, kidney;L, lung; Lb, lung bud; Lp, liver primordia; Lv,lateral ventricle; M, limb musculature; Mb,midbrain; Mo, medulla oblongata; Mv, mesen-cephalic vesicle; Nc, neocortex; Oe, olfactoryepithelium; Po, pons; Sc, spinal cord; Schg,sympathetic chain of ganglia; Sg, stellate gan-glion; T, tongue; Tc, telencephalon; Te, testis;Th, thalamus; Uv, umbilical vein; Vf, vibrissalfollicles; Vg, trigeminal ganglia; VII/VIIIg, vesti-bulocochlear ganglion; Vz, ventricular zone.Asterisks (*) indicate expression in nuclei ofthe medulla oblongata.

Fig. 3. Highlights of Amer3 expression inembryonic day (E) 10.5 mouse embryos.Expression of Amer3 was analyzed by whole-mount in situ hybridization (ISH). A–D: Lateral(A–C) and frontal (D) whole-mount views areshown. a–f: Gelatin sections of the stainedembryos at approximate level and orientationas shown in the schematic drawing. Ba, bran-chial arches; Da, dorsal aorta; Dc, diencepha-lon; Drg, dorsal root ganglion; Flb, forelimbbud; Fv, fourth ventricle; H, heart; Hb, hind-brain; Hlb, hindlimb bud; Me, mesencephalon;Mnp, mandibular process; Mxp, maxilar pro-cess; Nt, neural tube; Otv, otic vesicle; Rb,rhombencephalon; S, somites; Sc, spinalcord; Tc, telencephalon; Tv, third ventricle; Vg,trigeminal ganglion; VII/VIIIg, facio-acousticganglion; IXg, petrosal ganglion; Xg, nodoseganglion. White arrowheads are used to indi-cate regionalization of Amer3 expression inthe neural epithelium. D, Dorsal; V, Ventral.

Dev

elop

men

tal D

ynam

ics

1870 COMAI ET AL.

system such as the dorsal root gan-glion (Figs. 4, 5A,B), the trigeminalganglion (Figs. 4, 5D), the vestibuloco-chlear ganglion (Fig. 4D and data notshown), but not in the axon-enriched

corresponding fibers. Expression wasalso highly overlapping in the stellateganglion (Figs. 4D, 5C), a sympatheticganglion formed by the fusion of theinferior cervical ganglion and the first

thoracic ganglion. Therefore, thesedomains of expression appear to be ahallmark of the Amer gene family. Onthe other hand, strong expression ofAmer2 extended to the suprarenalganglion (Fig. 9i) and the sympathetictrunk (Fig. 2B(a,b), Fig. 9(j)). Finally,labeling for Amer2 and Amer3 wasalso significantly present in the hypo-gastric plexus (Fig. 9(k,l)).Domains of expression also covered

sensory organs such as the eye andinner ear. Wtx/Amer1 and Amer2transcripts were detected in the coch-lear epithelium of the inner ear (Fig.6C). Despite its expression in the oticvesicle at E11.5 (Fig. 1C(C3,C30)), noAmer3 labeling was observed in thecochlea at E14.5.At E13.5, the neural retina dis-

played signal for the three Amer genes(Fig. 6D). Wtx/Amer1 and Amer3transcripts were clearly enriched inthe innermost layer of the neural ret-ina, where the first postmitotic neu-rons are born (Sahly et al., 1998). Incontrast, very strong Amer2 expres-sion was detected in a ‘‘salt-and-pep-per’’ pattern throughout the entireneural retina. At E18.5, the patternof expression was maintained withWtx and Amer3 expression in theinnermost presumptive ganglion celllayer, whereas Amer2 expressionextended as well to the ventricularzone (Fig. 6E).

Expression in Organs

Containing an Epithelial

Component

Throughout development, Wtx/Amer1 transcripts were clearly notice-able at sites where interactionsbetween mesenchymal and epithelialtissues take place: e.g., salivaryglands, lungs, kidneys, developingvibrissae, and palate. Expression wasalso robust in the olfactory and oralepithelium. It is noteworthy to men-tion that Amer2 transcripts werepresent either at low levels or in acomplementary manner in respect toWtx/Amer1 when analyzing those tis-sues. No expression of Amer3 could bedetected in epithelial structures.In the olfactory epithelium, strong

hybridization signal for Wtx/Amer1was detected from E11.5 onward. Thesignal for Amer2 was much lower at

TABLE 1. Summary of the Expression of Amer Family from E12.5 to E14.5

Wtx/Amer1 Amer2 Amer3

Central nervous system1. Forebrain* Telencephalon þþ þþþ þþ* DiencephalonThalamus þþ þþþ þþ

2. Hinbrain* MetencephalonCerebellum þþ þþþ þþPons þþ þþþ þþ

* MetencephalonMedulla Oblongata þþ þþþ þþ

3. Midbrain þþ þþþ þþ4. Spinal cord þþþ þþþ þþþPeripheral and sensory nerves1. Peripheral nervous system* Dorsal root ganglion þþþ þþþ þþþ* Autonomic gangliaStellate ganglion þþ þþþ þþSympathetic trunk � þþþ �

* Trigeminal ganglion þþ þþþ þþ* Vestibulocochlear ganglion þþ þþþ þ2. Sensory organs* Eye (neural retina) þ þþþ þ* Ear (cochlea) þþ þþþ �* Nose (olfactory epithelium) þþ þþ �Other tissues1. Digestive system* Tongue þþ � � (1)* Esophagus þþþ � �* Salivary gland epithelium þþ þ �2. Respiratory system* Lung þþ þ �* Main bronchus þþþ � �3. Urogenital system* Kidney þþþ þ �* Bladder þþþ þ (2) �* Male gonad þþþ þ �4. Integumental system* Vibrissa þþ þ �5. Skeleton* Muscle þþþ þ �* Cartilage/boneLong bone þ þ �Vertebrae � � �Craniofacial þþ þ �

6. Thymus gland � (3) � �

Abbreviations: (�), virtually absent transcripts; (þ), expression at slightly abovebackground levels; (þþ), moderate expression levels; (þþþ), robust expression lev-els. The level of expression was assessed for each probe separately.(1) No transcripts in the intrinsic muscle of the tongue; expression restricted toclusters of cells.(2) Expression at the level of the bladder neck.(2) Expression restricted to thymic capsule.

Dev

elop

men

tal D

ynam

ics

MOUSE WTX/AMER GENE FAMILY EXPRESSION PATTERNS 1871

this stage (Fig. 4A). Later on, bothWtx/Amer1 and Amer2 wereexpressed at high levels in the olfac-tory epithelium of the nasal cavity,although in a complementary/strati-fied manner (Fig. 7A,B). Wtx/Amer1was present in the presumptive sup-porting cell layer, whereas Amer2 waspresent in the basal layer (Fig. 7A,B,bottom insets). Expression for the twogenes was higher in the ventral part ofthe nasal cavity epithelium. Finally,Amer2 expression was also detected inthe tubules of the nasal serous glandsat higher levels than that of Wtx/Amer1 (Fig. 7B, top inset).

In the developing vibrissae, Wtx/Amer1 transcripts were observed inthe epithelial compartment, predomi-nantly in the connective tissue sheath(Fig. 7C). Additionally, Wtx/Amer1expression was found in the interfollic-ular epidermis. In contrast, the devel-oping follicles were almost devoid ofAmer2 transcripts, but expression

seemed confined to the interfollicularepidermis in their immediate sur-roundings (Fig. 7C).

At E14.5, Wtx/Amer1 mRNA waspatent in the branching epithelium ofthe developing submandibulary sali-vary glands (Fig. 7D). Amer2 expres-sionwas slightly above background lev-els. Interestingly, Amer2 and Amer3expression was prominent in the pre-sumptive submandibular ganglia alongthe ducts of the submandibular gland(Fig. 7D, black arrowheads).

Wtx/Amer1 was ubiquitously andstrongly expressed in the mesenchy-mal component of the lung buds atE12.5 (Fig. 7E). Moreover,Wtx/Amer1labeling in the luminal side of some ofthe branches of the epithelial bron-chial tree was also detected (Fig. 7Einset). In contrast, very low levels ofAmer2 expression were foundthroughout the developing lungswhereas no expression of Amer3 couldbe detected. At E14.5, the level of

expression of Wtx/Amer1 in the lungswas significantly reduced in the mes-enchymal tissue and expression in theepithelial component was mainly re-stricted to the epithelium of the termi-nal bronchi (Fig. 9(e) inset). Promi-nent Wtx/Amer1 expression was alsoseen in the luminal side of the mainbronchus (Fig. 9(f)).Another feature of note was the

presence of Wtx/Amer1 transcripts inthe intrinsic muscle of the tongue(genioglossus) (Figs. 7F, 9(c), and datanot shown) as well as the oral and softpalate epithelium (Figs. 7F, 9(c)). Inaddition, clusters of cells at the ven-trolateral portion of the tongue, whichcould correspond to neuronal col-umns, exhibited strong Amer3 hybrid-ization signal (Fig. 7F, white arrow-heads). Finally, the esophagealepithelium was also labeled for Wtx/Amer1 (Fig. 9(f)).

Expression in the Urogenital

System

Wilms’ tumor is a developmental tu-mor of the kidney and given theinvolvement of Wtx/Amer1 in thistype of cancer, we were very interest-ed to study a potential expressionof Amer genes during urogenitaldevelopment.In the developing kidney, only tran-

scripts ofWtx/Amer1 and Amer2 weredetected being the expression highlydevelopmentally regulated. At E10.5,expression of Wtx/Amer1 was firstdetected in the urogenital ridge and atE11.5, both Wtx/Amer1 and Amer2were observed in the metanephricmesenchyme surrounding the branch-ing epithelium (data not shown). FromE12.5 onward, Wtx/Amer1 showedovert expression in the condensingmesenchyme and derived early epithe-lial structures, such as comma and S-shaped bodies (Fig. 8A,B).Wtx/Amer1expression in the branching epithe-lia—with the exception of the uretericbud tips could not be detected. Amer2transcripts overlapped highly withthose of Wtx/Amer1, although levelsof expression were much lower (Fig.8A,B). At later stages, expression ofWtx/Amer1 and Amer2 decreased andbecame confined to the cortical (neph-rogenic) region of the kidney (data notshown). This spatiotemporal expres-sion suggests that Wtx/Amer1 is

Fig. 5. A–D: Expression of Amer genes in the spinal cord and ganglia at embryonic day (E)14.5 (B–D) and E15.5 (A). (A, transverse and B–D, sagittal sections). Expression of Amer genesin the spinal cord at the T1 vertebrae level (A), the dorsal root ganglia at the thoracic level (B),the stellate ganglion (C), the trigeminal ganglion (D). Dh, dorsal horn; Drg, dorsal root ganglion;R, cartilage primordium of rib; R-Vg, rootlets of trigeminal ganglion; Sa, subclavian artery; Sg,stellate ganglion; T1, cartilage primordium of the thoracic T1 vertebrae; V, cartilage primordiumof vertebrae; Vg, trigeminal ganglion; Vh, ventral horn; Wm, white matter.

Dev

elop

men

tal D

ynam

ics

1872 COMAI ET AL.

active in the progenitor cell populationthat is supposed to give rise to Wilms’tumors. Indeed Wtx/Amer1 wasexpressed in a similar, but not com-pletely overlapping pattern to theWilms’ tumor suppressor geneWT1 aspreviously reported for embryonichuman tissues (Rivera et al., 2007).We could not detect expression inmore mature tubular or glomerularstructures.

In the developing adrenal glands,Wtx/Amer1 was expressed at low lev-els in the cortical region. A major mo-lecular landmark is the unambiguousdetection of Amer2 hybridization sig-nals in groups of cells of the medul-lary region (Fig. 8A, arrows, Fig. 9(i)).These cells very likely correspond toneural crest derived adrenal medul-lary chromaffin cells, which could beconfirmed by a co-staining using tyro-

sine hydroxylase as a marker (Lohret al., 2006).In respect to the developing gonads,

Wtx/Amer1 was very stronglyexpressed in the coelomic epithelium ofthe urogenital ridge from E10.5 (Figs.1B(b), 4A). At E12.5, conspicuoushybridization signal for Wtx/Amer1was detected in the gonadal epitheliumof both the female andmale gonad (datanot shown). However, expression forWtx/Amer1 was excluded from themesonephric tubules, the mesonephric(Wolffian), and the paramesonephric(Mullerian) ducts (data not shown). AtE14.5, the interstitial tissue betweenthe seminiferous tubules of the malegonad was highly positive for Wtx/Amer1 transcripts (Fig. 8C). In thefemale gonad, the highest expressionwas detected in the germinal epithelium(Fig. 8D). The ‘‘spotty’’ pattern observedthroughout the ovarian tissuewas prob-ably due to the main expression ofWtx/Amer1 around the ovigerous cords.Amer2 expression, while present, wassubstantially lower than that of Wtx/Amer1 in gonadal tissues, whereas noexpression of Amer3 could be detectedat any of the stages studied. Amer2seemed to be expressed at very low lev-els in the coelomic epithelium of themale gonad at E12.5 (data not shown),being restricted to a subset of cells of theinterstitial population at E14.5 (Fig.8C). In the female gonad, it wasexpressed at low levels in the corticalregion at E14.5 (Fig. 8D).In the future bladder at E14.5,Wtx/

Amer1 was prominently expressed inthe muscularis mucosa and externaladventicia layer, whereas much lowerexpression was seen in the smoothmuscle layers (detrusor muscle; Fig.8E). In the case of Amer2, only faintexpression was observed in the futurebladder wall. However, strong expres-sions of Amer2, and to a lesser extentin case of Amer3, were detected in thebladder neck (Fig. 8E, bracket, anddata not shown). These hybridizationsignals are likely to correspond to sym-pathetic neurons from the sympa-thetic chain and hypogastric plexus(see also Figs. 9(k) and 9(l)).

Other Sites of Amer Gene

Expression

In the developing limbs, both Wtx/Amer1 and Amer2 transcripts were

Fig. 6. A–E: Expression of Amer genes in the nervous system and sensory organs at embry-onic day (E) 13.5 (A,B,D), E14.5 (C), and E18.5 (E) (sagittal sections). A: Magnification of thefrontal part of the head region of the E14.5 embryos shown in Figure 4D showing the distinctexpression of Amer genes in the forebrain/midbrain structures. B: Magnification of the rostralpart of the head region of the E14.5 embryos shown in Figure 4D showing the distinct expres-sion of Amer genes in the hindbrain. C: Expression of Amer genes in the cochlea. D,E: Expres-sion of Amer genes in the retina. C, cochlea; Cop, choroid plexus within central part of lumen offourth ventricle; Cp, cortical plate; Ct, cartilage primordium of the petrous part of the temporalbone; El, eyelid; Fv, fourth ventricle; Gcl, ganglion cell layer; Ivf, interventricular foramen; L, lens;Lv, lateral ventricle; Mo, medulla oblongata; Nc, neocortex; Po, pons; Rn, retinal neuroepithe-lium; Th, thalamus; Vz, ventricular zone.

Dev

elop

men

tal D

ynam

ics

MOUSE WTX/AMER GENE FAMILY EXPRESSION PATTERNS 1873

detected. At E10.5, strong expressionof Wtx/Amer1 was observed in thelimb buds (Fig. 1B(a)). In contrast,Amer2 hybridization signal was sig-nificantly less intense and mostly con-fined to the distal part of the buds(Fig. 2B(a)). Sections revealed that

the labeling in both cases was mainlyof mesodermal origin. The thin layerof ectodermal cells that ensheaththose limb bud mesenchymal cellsappeared negative. At later stages,intense labeling for Wtx/Amer1 wasobserved in the interdigital mesen-

chyme (Fig. 9(a)) right below the sur-face ectoderm. Labeling for Amer2was also present, although at lowerlevel (data not shown). Strong expres-sion of Wtx/Amer1 was also observedin differentiating muscles of the limbmuscles (Fig. 9(b)) and body wall(Figs. 1A(b), 4B, and data not shown).Lower labeling was observed forAmer2 (data not shown). Theseresults are consistent with the earlyexpression of Wtx/Amer1 and Amer2in the somites (Figs. 1A(b,c), 2A(c)).In addition, in the skeletal system,moderate expression of Wtx/Amer1was detected in the epiphyseal regionof the long bones at E14.5, whereasthe ossifying diaphyseal region wasvirtually devoid of staining (Fig. 9(b–b2). Amer2 expression followed that ofWtx/Amer1, but at seemingly lowerintensity (data not shown). The Wtx/Amer1 expression in the formingbones overlaps with a previous study(Jenkins et al., 2009), although in ourcase we could not detect strong label-ing as reported. On the other hand,we could detect specific and intenseexpression in extraskeletal structuressuch as the kidneys, the gonads, thelungs, and the central nervous sys-tem. These differences in sensitivitywithin different structures might bedue to probe differences or differenthybridization conditions. Finally, sec-tions through the ribs and vertebraedid not show labeling for any of theAmer genes.In the cardiovascular system, clear

Amer2 labeling was found in the tho-racic dorsal aorta from E11.5 (Fig.4A,B; Fig. 9(j)). Wtx/Amer1 wasdetected in both the umbilical arteryand vein of the umbilical cord consti-tuting one of the strongest areas ofWtx/Amer1 expression (Fig. 1A(b),1B(b), Fig. 9(g)). We could not detectspecific expression of any of the Amergenes in the heart chambers at any ofthe studied stages (Fig. 4A–D, anddata not shown).Finally, and in contrast to a previous

report (Jenkins et al., 2009), Wtx/Amer1 did not appear to be expressedin the thymic rudiment at the stagesanalyzed (E13.5–E14.5; Fig. 9(h) anddata not shown). Nevertheless, anenrichment of Wtx/Amer1 signalabove background levels was observedat the level of the cortical region of thethymus (Fig. 9(h), bracket).

Fig. 7. A–F: Expression of Amer genes in epithelial structures at embryonic day (E) 12.5 (E),E15.5 (A,C,D,F), and E18.5 (B). (E, sagittal section; A–D, F transverse sections) A,B: Expressionof Wtx/Amer1 and Amer2 in the olfactory epithelium. Higher power views of the epithelia (bot-tom insets) and the tubules of nasal serous glands (top insets) are shown. C: Expression ofAmer genes in the primordium of follicle of vibrissa. The dotted circles are used to delimitate theconnective tissue sheath from the interfollicular epidermis. D: Expression of Amer genes in thesubmandibular gland. Black arrowheads are used to indicate expression in presumptive sub-mandibular autonomic ganglia. E: Expression of Amer genes in the lung. F: Expression of Amergenes in the tongue. White arrowheads are used to indicate expression in presumptive neuronalcolumns. V (ventral) and D (dorsal) indicate the orientation of the tissue. Be, branching epithe-lium; Cts, connective tissue sheath; E, eye; H, heart; Ie, interfollicular epidermis; Im, intrinsicmuscle of the tongue; Lm, lung mesenchyme; Ns, nasal septum; Oe, olfactory epithelium; Ore,oral epithelium; Sg, serous glands; St, sympathetic trunk.

Dev

elop

men

tal D

ynam

ics

1874 COMAI ET AL.

DISCUSSION

Here, we have characterized theexpression of Wtx/Amer1 and the Wtxrelated genes Amer2 and Amer3 dur-ing mouse embryonic development.Genes belonging to the same gene fam-ily often share common sites of expres-sion pattern and we expected that thismay also be the case for the Amergenes. Indeed, we observed that thethree members are expressed in ahighly overlapping manner, in partic-ular concerning neuroectoderm deriv-atives, yet they also have distinct tem-poral and tissue-specific signatures.Overall, our results indicate that

Amer genes share to a certain extentexpression in neurons of both centraland peripheral nervous systems, andin many neural crest derivativesincluding sensory cranial ganglia, dor-sal root ganglia, autonomic ganglia,and branchial arches. This spatial andtemporal overlap of gene expressionpatterns may suggest that one of theoriginal functions of an AMER ances-tor protein may have been related tothe development of the nervous sys-tem.WhetherAmer genes play amajorrole in the development of those struc-tures and whether they act in a func-tionally redundant manner remains tobe investigated. However, it is note-worthy that patients with germlinemutations inWTX/AMER1 display, inaddition to the sclerosing skeletal dys-plasia, central nervous system malfor-mations, and learning disabilities(Jenkins et al., 2009) pointing towardan important role of WTX/AMER1during neurogenesis.Wtx/Amer1 appears to be the most

widely expressed member of the Amergene family and staining could bedetected in ectoderm, endoderm, andmesoderm derived tissues. This broadexpression may reflect a novel func-tion(s) adopted by this protein.Indeed, Wtx/Amer1 has adopted along C-terminal domain which seemsto be able to interact with b-catenin, afunction that—based on their proteinstructure—is unlikely to be found inAmer2 and Amer3. The broad andspecific expression of Wtx/Amer1 innon-neural tissues, such as thesomites, the developing limb buds,the axial muscles, the kidneys, themale gonad, and the lungs suggestmultiple independent roles of this

Fig. 8. Expression of Wtx/Amer1 and Amer2 genes in the urogenital system at embryonicday (E) 14.5 (sagittal sections). A: Expression in the kidney and adrenoglands. The arrows indi-cate chromaffin cells. B: Higher power views of the kidney cortical region. The dotted anddashed lines are used to delineate ureteric tips and S-shaped bodies, respectively. C: Expres-sion in the testis. D: Expression in the ovary. E: Expression the urogenital sinus (future blad-der). A, adventitia of the bladder; Ag, adrenogland; Be, branching epithelia; Cm, condensingmesenchyme; CMd, caudal part of the mesonephric duct; D, detrusor muscle of the bladder;E, epithelium of the bladder (Urothelium); Ge, germinal epithelium; Hp, hypogastric plexus atthe level of the bladder neck; K, kidney; Mm, muscularis mucosa of the bladder; PMd, proxi-mal part of the mesonephric duct; S, S-shaped body; St, seminiferous tubules; U, urethra; Ut,ureteric tip.

Dev

elop

men

tal D

ynam

ics

MOUSE WTX/AMER GENE FAMILY EXPRESSION PATTERNS 1875

gene during embryogenesis. This pat-tern of expression suggests potentialroles of WTX/AMER1 in muscle, bone,and kidney development in correla-

tion with the clinical phenotypes ofpatients with either germline (Jen-kins et al., 2009) or de novo (Riveraet al., 2007) WTX/AMER1 mutations.

Finally, the robust expression of Wtx/Amer1 in the facial mesenchyme,branchial arches, and somites mightalso suggest involvement of this genein the differentiation of neural crestcells and mesoderm derived mesen-chyme (Hunter et al., 2006; Fisheret al., 2006).Wtx/Amer1 was also significantly

present in places where mesenchy-mal–epithelial interactions takeplace. Canonical Wnt signaling isknown to be essential in many aspectsof tissue branching in organs such asthe kidney, lung, and salivary gland(for review, see Grigoryan et al.,2008). Therefore, the specific expres-sion of Wtx/Amer1 in these organsmight be related to its role as a modu-lator of Wnt/b-catenin signaling andbe required for proper morphogenesis.Finally and remarkably, our data

indicate that Wtx/Amer1 expressionoverlaps with regions where both Wntgenes and Wnt pathway modulatorshave been reported to be expressedand play a developmental role (Parret al., 1993; Bhat et al., 1994; Takadaet al., 1994; Ikeya et al., 1997; Zenget al., 1997; Yamaguchi et al., 1999;Hasegawa et al., 2002; Lan et al.,2006; Yu et al., 2007; Summerhurstet al., 2008; Vendrell et al., 2009;Witte et al., 2009). Moreover, a com-prehensive view of the domains ofexpression of Amer genes throughoutembryonic development, suggestsinvolvement of these genes in proc-esses such as cellular differentiation,organ morphogenesis, and tissue pat-terning. It will now be important toperform functional studies to eluci-date the physiological role of Amergenes and their relationship with theWnt signaling pathway.

EXPERIMENTAL

PROCEDURES

Embryo Collection

Embryos were collected from time-mated C57B6 females considering thedate when the vaginal plug wasobserved as embryonic day 0.5 (E0.5).Embryos from E11.5 to E18.5 werefixed with 4% paraformaldehyde(PFA) in phosphate buffer saline (PBS)at 4�C overnight. Embryos were thenwashed in PBS, dehydrated through a

Fig. 9. Other sites of expression of Amer genes. a: Expression of Wtx/Amer1 in embryonic day(E) 14.5 mouse forelimb. Gelatin sections at three different levels after staining and re-fixation ofthe whole-mount limb are shown. b: Expression of Wtx/Amer1 in the femur at E14.5. Higherpower views of distal (b1) and medial (b2) regions are shown. c: Expression of Wtx/Amer1 in thepalate at E14.5. d: Expression of Wtx/Amer1 in a nucleus of the medulla oblongata at E14.5. e:Expression of Wtx/Amer1 in the lung at E15.5. The inset shows expression in the luminal side ofthe epithelia of a segmental bronchus. f: Expression of WTX/Amer1 in the esophageal and mainbronchus epithelial lumen at E14.5. g: Expression of Wtx/Amer1 in the umbilical artery and veinof the umbilical cord at E12.5. h: Expression of Wtx/Amer1 in the thymus at E14.5. i: Expressionof Amer2 in the adrenogland at E14.5. The arrowheads indicate neurons of the suprarenal gan-glion. j: Expression of Amer2 in the sympathetic trunk at E12.5. k: Expression of Amer2 in thehypogastric plexus E14.5. l: Expression of Amer3 in the hypogastric plexus E14.5. Ag, adrenog-land; Br, bronchus; D, diaphysis; Da, dorsal aorta; E, esophagus; Ep, epiphysis; H, heart; Hp,hypogastric plexus; Htc, hypertrophic chondrocytes; K, kidney; Lm, limb muscle; MBr, mainbronchus; Mo, medulla oblongata; P, cartilage primordium of the palatal shelf of maxilla; Pe, pal-atal epithelium; Pt, periosteum, Rp, residual lumen of Rathke’s pouch; St, sympathetic trunk; T,tongue; Th, thymus; Uc, umbilical cord.

Dev

elop

men

tal D

ynam

ics

1876 COMAI ET AL.

graded series of ethanol, placed inxylene, and paraffin embedded.

Embryos from E8.5 to E11.5 werefixed for 1 hr in PFA 4%, washed inPBS, dehydrated through a gradedmethanol series and kept in 100%methanol at �20�C till use for whole-mount in situ hybridization.

In Situ Hybridization

In situ hybridizations on 10-mm-thickparaffin embedded sections or onwhole-mount sections were carried outessentially as described previously(Chaboissier et al., 2004). A minimumof two independent experiments withat range of two to four embryos per de-velopmental stage were performed.

Hybridizations were performedwithdigoxigenin-UTP labeled antisenseprobes transcribed with T7 or Sp6polymerases. Expression was revealedby colorimetric staining using an anti-digoxigenin antibody coupled to alka-line phosphatase in the presence ofBM purple (Roche Diagnostics) sup-plemented with 2 mM levamisole(Sigma). Control experiments wereperformed using corresponding senseriboprobes on adjacent sections, givingeither no signal or a uniformly lowbackground as expected. In case ofWtx/Amer1, while two different anti-sense RNA probes were used for thedetection of gene transcripts, datawere reproducible and consistentlyoverlapping with those two differentprobes.

Whole-mount stained embryos werethen refixed in PFA 4% in PBS, em-bedded in a gelatin/albumin mixturesupplemented with 2.5% glutaralde-hyde and sectioned in 50- to 80-mm-thick vibratome sections.

Probes

Wtx/Amer-1, 2, and 3 riboprobes usedto generate the data were obtained byRT-PCR using total RNA isolated fromE12.5 mouse embryos. Purified PCRproducts were cloned into PCRII vector(Invitrogen). Details concerning designof the probes are shown in Table 2.

RT-PCR

A total of four E7.5, four E8.5, threeE9.5, and two E10.5 embryos were col-lected and snap-frozen. RNA wasextracted using Trizol (Invitrogen),cDNAs generated from 3 mg of RNA(M-MLV Reverse Transcriptase Sys-tem and random hexamers; Invitro-gen) and 1 ml of the produced cDNAused for semiquantitative PCR. A totalof 0.5 ml of the original RNA sample(RT-PCR without reverse transcrip-tion) was used as a DNA contamina-tion control. All experiments were per-formed in duplicate. The sequences ofthe primers used are as follows:mWTX_fw: gctgtagtcccggtgaagg; mWTX_rs: gtcaggaagcatcacagtgg; mAmer2_fw: gctccacagaattcccattg; mAmer2_rs: tgctccttctccggatgtt; mAmer3_fw:aaggcacggctttcctct; mAmer3_rs: aggtcctggcataggctgt; mHPRT_fw: tcctcctcagaccgctttt; mHPRT_rs: cctggttcat-catcgctaatc. 25 cycles of PCR were per-formed using annealing temperaturesof 58�C for wtx/Amer1 andHprt, 56�CforAmer2 and 54�C forAmer3.

ACKNOWLEDGMENTSWe thank Thomas Lamonerie andMichele Studer for their comments onthe manuscript. We also thank FaribaRanc for providing mice. G.C. was sup-ported by a Marie-Curie fellowship aspart of the InterDeC PhD programand G.C. and A.B. by personal fellow-ships from the Association pour la Re-

cherche sur le Cancer (ARC). Thiswork was supported by grants fromARC (grant 1130) and the Associationfor International Cancer Research(AICR grant 09-0752).

REFERENCES

AndrieuD,Watrin F,NiinobeM,YoshikawaK, Muscatelli F, Fernandez PA. 2003.Expression of the Prader-Willi gene Nec-din during mouse nervous system devel-opment correlates with neuronaldifferentiation and p75NTR expression.GeneExprPatterns 3:761–765.

Bhat RV, Baraban JM, Johnson RC, EipperBA,Mains RE. 1994. High levels of expres-sion of the tumor suppressor gene APCduring development of the rat central nerv-ous system. JNeurosci 14:3059–3071.

Chaboissier MC, Kobayashi A, Vidal VI,Lutzkendorf S, van de Kant HJ, WegnerM, de Rooij DG, Behringer RR, Schedl A.2004. Functional analysis of Sox8 andSox9 during sex determination in themouse. Development 131:1891–1901.

Fisher DA, Kivimae S, Hoshino J, SuribenR, Martin PM, Baxter N, Cheyette BN.2006. Three Dact gene family membersare expressed during embryonic develop-ment and in the adult brains of mice. DevDyn 235:2620–2630.

Grigoryan T, Wend P, Klaus A, Birchme-ier W. 2008. Deciphering the function ofcanonical Wnt signals in developmentand disease: conditional loss- and gain-of-function mutations of beta-catenin inmice. Genes Dev 22:2308–2341.

Grohmann A, Tanneberger K, Alzner A,Schneikert J, Behrens J. 2007. AMER1regulates the distribution of the tumorsuppressor APC between microtubulesand the plasma membrane. J Cell Sci120:3738–3747.

Hasegawa S, Sato T, Akazawa H, OkadaH, Maeno A, Ito M, Sugitani Y, ShibataH, Miyazaki Ji J, Katsuki M, YamauchiY, Yamamura Ki K, Katamine S, NodaT. 2002. Apoptosis in neural crest cellsby functional loss of APC tumor sup-pressor gene. Proc Natl Acad Sci U S A99:297–302.

Hunter NL, Hikasa H, Dymecki SM,Sokol SY. 2006. Vertebrate homologuesof Frodo are dynamically expressed dur-ing embryonic development in tissuesundergoing extensive morphogeneticmovements. Dev Dyn 235:279–284.

Ikeya M, Lee SM, Johnson JE, McMahonAP, Takada S. 1997. Wnt signallingrequired for expansion of neural crest andCNS progenitors. Nature 389:966–970.

Jenkins ZA, van Kogelenberg M, MorganT, Jeffs A, Fukuzawa R, Pearl E, Thal-ler C, Hing AV, Porteous ME, Garcia-Minaur S, Bohring A, Lacombe D,Stewart F, Fiskerstrand T, Bindoff L,Berland S, Ades LC, Tchan M, David A,Wilson LC, Hennekam RC, Donnai D,Mansour S, Cormier-Daire V, RobertsonSP. 2009. Germline mutations in WTXcause a sclerosing skeletal dysplasia

TABLE 2. Details of Expression Probes Used to Reveal Specific Expression

Gene Extent of probe in GenBank sequence

Probe length

in nucleotides

Wtx/Amer1 Nucleotide 1604-2526 on NM_175179.41 923 bpWtx/Amer1 Nucleotide 630-1248 on NM_175179.42 619 bpAmer2 Nucleotide 914-1897 on NM_028113.3 984 bpAmer3 Nucleotide 217-1168 on NM_213727.2 952 bp

1Referred as probe in N-terminal.2Referred as probe in C-terminal.

Dev

elop

men

tal D

ynam

ics

MOUSE WTX/AMER GENE FAMILY EXPRESSION PATTERNS 1877

but do not predispose to tumorigenesis.Nat Genet 41:95–100.

Lan Y, Ryan RC, Zhang Z, Bullard SA,Bush JO, Maltby KM, Lidral AC, JiangR. 2006. Expression of Wnt9b and acti-vation of canonical Wnt signaling dur-ing midfacial morphogenesis in mice.Dev Dyn 235:1448–1454.

Lohr J, Gut P, Karch N, Unsicker K,Huber K. 2006. Development of adrenalchromaffin cells in Sf1 heterozygousmice. Cell Tissue Res 325:437–444.

Major MB, Camp ND, Berndt JD, Yi X,Goldenberg SJ, Hubbert C, BiecheleTL, Gingras AC, Zheng N, Maccoss MJ,Angers S, Moon RT. 2007. Wilms tumorsuppressor WTX negatively regulatesWNT/beta-catenin signaling. Science316:1043–1046.

Parr BA, Shea MJ, Vassileva G, McMa-hon AP. 1993. Mouse Wnt genes exhibitdiscrete domains of expression in theearly embryonic CNS and limb buds.Development 119:247–261.

Rivera MN, Kim WJ, Wells J, DriscollDR, Brannigan BW, Han M, Kim JC,

Feinberg AP, Gerald WL, Vargas SO,Chin L, Iafrate AJ, Bell DW, Haber DA.2007. An X chromosome gene, WTX, iscommonly inactivated in Wilms tumor.Science 315:642–645.

Sahly I, Gogat K, Kobetz A, Marchant D,Menasche M, Castel M, Revah F, Dufier J,Guerre-MilloM, AbitbolMM. 1998. Promi-nent neuronal-specific tub gene expressionin cellular targets of tubby mice mutation.HumMolGenet 7:1437–1447.

Summerhurst K, StarkM, Sharpe J, DavidsonD, Murphy P. 2008. 3D representation ofWnt and Frizzled gene expression patternsin the mouse embryo at embryonic day 11.5(Ts19). Gene Expr Patterns 8:331–348.

Takada S, Stark KL, Shea MJ, VassilevaG, McMahon JA, McMahon AP. 1994.Wnt-3a regulates somite and tailbudformation in the mouse embryo. GenesDev 8:174–189.

Vendrell V, Summerhurst K, Sharpe J,Davidson D, Murphy P. 2009. Geneexpression analysis of canonical Wntpathway transcriptional regulators dur-ing early morphogenesis of the facial

region in the mouse embryo. Gene ExprPatterns 9:296–305.

Witte F, Dokas J, Neuendorf F, MundlosS, Stricker S. 2009. Comprehensiveexpression analysis of all Wnt genesand their major secreted antagonistsduring mouse limb development andcartilage differentiation. Gene ExprPatterns 9:215–223.

Yamaguchi TP, Bradley A, McMahon AP,Jones S. 1999. A Wnt5a pathway under-lies outgrowth of multiple structures inthe vertebrate embryo. Development126:1211–1223.

Yu HM, Liu B, Costantini F, Hsu W.2007. Impaired neural developmentcaused by inducible expression of Axinin transgenic mice. Mech Dev 124:146–156.

Zeng L, Fagotto F, Zhang T, Hsu W, Vasi-cek TJ, Perry WL, 3rd, Lee JJ, Tilgh-man SM, Gumbiner BM, Costantini F.1997. The mouse Fused locus encodesAxin, an inhibitor of the Wnt signalingpathway that regulates embryonic axisformation. Cell 90:181–192.

Dev

elop

men

tal D

ynam

ics

1878 COMAI ET AL.