University of Tennessee, Knoxville University of Tennessee, Knoxville

TRACE: Tennessee Research and Creative TRACE: Tennessee Research and Creative

Exchange Exchange

Doctoral Dissertations Graduate School

5-2018

Expanding the Metabolome with Applications in Neuroscience Expanding the Metabolome with Applications in Neuroscience

and Bioremediation and Bioremediation

Allen Bourdon University of Tennessee, abourdon@vols.utk.edu

Follow this and additional works at: https://trace.tennessee.edu/utk_graddiss

Recommended Citation Recommended Citation Bourdon, Allen, "Expanding the Metabolome with Applications in Neuroscience and Bioremediation. " PhD diss., University of Tennessee, 2018. https://trace.tennessee.edu/utk_graddiss/4880

This Dissertation is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact trace@utk.edu.

To the Graduate Council:

I am submitting herewith a dissertation written by Allen Bourdon entitled "Expanding the

Metabolome with Applications in Neuroscience and Bioremediation." I have examined the final

electronic copy of this dissertation for form and content and recommend that it be accepted in

partial fulfillment of the requirements for the degree of Doctor of Philosophy, with a major in

Chemistry.

Shawn R. Campagna, Major Professor

We have read this dissertation and recommend its acceptance:

Ampofo K. Darko, Brain K. Long, Ralph B. Lydic

Accepted for the Council:

Dixie L. Thompson

Vice Provost and Dean of the Graduate School

(Original signatures are on file with official student records.)

Expanding the Metabolome with Applications in

Neuroscience and Bioremediation

A Dissertation Presented for the

Doctor of Philosophy

Degree

The University of Tennessee, Knoxville

Allen Bourdon

May 2018

ii

Copyright © 2018 by Allen Kenneth Bourdon

All rights reserved.

iii

DEDICATION

Whatever it takes.

iv

ACKNOWLEDGEMENTS

I would first like to thank my advisor, Dr. Shawn R. Campagna for the educational

opportunities and resources required to advance my career. When I got to Tennessee, I

didn’t know exactly what direction my career was headed, but you were exactly the type

of advisor I needed; extremely intelligent, down-to-earth, and straight to the point. I

appreciate everything you have done for me and hope to return the favor at some point.

Thank you for having confidence in my abilities.

Next, I need to thank my out-of-department mentors, Dr. Ralph Lydic and Dr. Helen

A. Baghdoyan, whom are the biggest reason for my neuroscience-based research.

People always say that timing is everything, and I couldn’t think of a more appropriate

use of the phrase. We moved to Tennessee at different times and with slightly different

goals, but in the end, we made for a productive team. These two mentors took me under

their wings and provided me the opportunity to attend multiple conferences in various

cities, and truly allowed me to navigate my career in a positive direction.

Thank you to my committee members; Dr. Brian Long, Dr. Ampofo Darko, and Dr.

Ralph Lydic, for your continued support and effort throughout this process. Additionally,

my collaborators and associated graduate students; (UTK) Dr. Matthew Cooper, Dr.

Frank Loeffler, Dr. Fred Becker, Dr. Steve Wilhelm, Dr. Elizabeth Fozo, Dr. Rebecca

Prosser, (UGA) Dr. Diana Downs, Dr. Mary Ann Moran, (FIU) Dr. DeEtta Mills. Thank you

all for the opportunity to learn from your research!

The Campagna lab group, across my five years has provided several long-term

contacts within the field. My research open house host, Stephen Dearth was my first

contact and whom provided significant training for the use of mass spectrometry

instrumentation and metabolomics analyses. My first set of graduate colleagues; Carson

Prevatte, Abigail Tester, Brandon Kennedy, and Maggie Lookadoo. Later down the road;

Eric Tague, Caleb Gibson, Alex Fisch, Josh Powers, and Jordan Rogerson. And who

could forget, Dr. Hector Castro-Gonzalez. Thank you everyone, I appreciate your

continued support and I hope to stay connected in the future.

v

I would like to make a small shout-out to my Uncle Clyde in San Antonio. You have

always had my career goals in mind, and I truly appreciate everything you have done to

advance my scientific career.

Now I must make room for my friends from the sleep research community, whom

I primarily met through the Gordon conference on sleep regulation and function in 2015;

Dr. Allison Brager, Dr. Nicolette Ognjanovski, Dr. Jimmy Fraigne, and my best-bro, soon

to be doctor, Zoltan Torontali. You will be life-long friends and I hope that we can continue

to advance our respective fields and survive all of our future encounters.

My final acknowledgments go out to the people that mean the most to me in life:

I would like to start by thanking my fiancée, Zoe Hanken for being a huge supporter

of my career goals, and her willingness to listen to my ramblings about science. Zoe, you

make my heart smile, and I can’t wait to see where life takes us.

Have to thank my little man, Oliver the lab dog, for his unconditional love. He’s the

best cockapoo a guy could ask for.

Lastly, I want to thank my family for their continued support. My parents, Ray and

Cathy have always been there when I needed them most, and I am truly grateful for

everything they have done for me. My sister, Kendra, and her two boys, Brody and

Landyn, are the real reason I moved to Tennessee in the first place. I am so happy that I

was able to see my nephews grow up over these past 5 years and can’t wait to see them

develop into young adults. I appreciate all of the love and support you have provided

along the way. Additionally, my extended family, from both the Bourdon and the Phelix

side. You have all been extremely supportive, and I couldn’t have asked for a better

family.

vi

ABSTRACT

The study of small molecules, while not a new concept, is still at its infancy for both

detection and structure identification. My work at the University of Tennessee, Knoxville

has been focused on the advancement of both analytical detection and identification of

novel compounds as potential small molecule targets. Using in vitro and in vivo

neurometabolomics on rodents as my foundation, I have been able to identify numerous

small molecules for further study in the areas of social defeat stress and across various

states of consciousness. Through untargeted metabolomics via liquid chromatography

coupled with high-resolution mass spectrometry, this research has provided the additional

hurdle of identifying novel targets among the unidentified spectral features, or “unknown”

metabolites. In the final chapter of this dissertation, I emphasize my ability to elucidate

the structure of a novel cobamide identified as a native prosthetic group in catalytically

active tetrachloroethene reductive dehalogenases of Desulfobacterium hafniense.

Utilizing stable isotope labeling of microbial cultures, mass spectrometry confirmed the

molecular formula, followed by 1D and 2D nuclear magnetic resonance spectroscopy to

characterize structural connectivity. The research presented in this dissertation advances

the field of novel compound discovery and characterization for the identification of small

molecule targets by highlighting unique research within the fields of neurometabolomics

and microbiology.

vii

PREFACE

“I not only use all the brains that I have, but all that I can borrow.”

-- Woodrow Wilson

“The measure of who we are is what we do with what we have.”

-- Vinci Lombardi

“He who is not courageous enough to take risks will accomplish nothing in life.”

-- Muhammad Ali

“It is likely that most of what you currently learn at school will be irrelevant by the time

you are 40…My best advice is to focus on personal resilience and emotional

intelligence.”

-- Yuval Noah Harari

viii

TABLE OF CONTENTS

INTRODUCTION ............................................................................................................. 1

MODERN METABOLOMICS ....................................................................................... 3

OPENING THE DOOR FOR UNTARGETED METABOLOMICS ................................ 4

NEUROMETABOLOMICS ........................................................................................... 4

THE KNOWLEDGE GAP ............................................................................................. 5

Chapter 1: NEUROMETABOLOMICS PROFILE CLASSIFICATION OF SYRIaN HAMSTERS AND B6 MICE AS A MODEL OF STRESS RESILIENCE ......................... 8

PREFACE .................................................................................................................... 9

1.1 ABSTRACT.......................................................................................................... 12

1.2 INTRODUCTION ................................................................................................. 13

1.3 METHODS ........................................................................................................... 15

1.3.1 Animals and Housing Conditions .................................................................. 15

1.3.2 Experimental Procedures .............................................................................. 16

Social Defeat Stress ........................................................................................... 16

Social Interaction Testing ................................................................................... 17

Dominant-Subordinate Relationships ................................................................. 18

Experimental Design .......................................................................................... 18

Tissue Collection ................................................................................................ 19

1.3.3 Untargeted Metabolomics using UPLC-HRMS .............................................. 19

1.3.4 Statistical Analysis ........................................................................................ 20

ix

1.4 RESULTS ............................................................................................................ 25

1.4.1 Behavioral Data ............................................................................................. 25

1.4.2 Metabolomics Data ....................................................................................... 27

PLS-DA Reveals Distinct Metabolic Profiles ....................................................... 27

Identifying Representative Known Metabolites ................................................... 27

Identifying Representative Unknown Metabolites ............................................... 32

1.5 DISCUSSION ...................................................................................................... 39

1.5.1 The Characteristic Metabolome Associated with Social Defeat .................... 39

1.5.2 Unidentified Spectral Features Affected by Social Stress ............................. 41

1.6 CONCLUSION ..................................................................................................... 44

1.7 REFERENCES .................................................................................................... 45

1.8 APPENDIX .......................................................................................................... 55

1.8.1 Supplemental Methods and Materials ........................................................... 55

Extraction Protocol ............................................................................................. 55

UPLC-HRMS ...................................................................................................... 55

Data Processing ................................................................................................. 55

Internal Ratio Normalization (IRN) ...................................................................... 56

Heatmaps ........................................................................................................... 56

Partial least squares discriminant analysis (PLS-DA) ......................................... 57

Identification and Statistical Reduction of USFs ................................................. 57

x

Statistical Analysis .............................................................................................. 58

1.8.2 Raw data files ................................................................................................ 58

Chapter 2: NEUROMETABOLOMICS OF ACUTE SLEEP DEPRIVATION THROUGH TEMPORAL ANALYSIS OF B6 MICE ........................................................................ 134

PREFACE ................................................................................................................ 135

2.1 ABSTRACT........................................................................................................ 138

2.2 INTRODUCTION ............................................................................................... 138

2.3 MATERIALS AND METHODS ........................................................................... 139

2.3.1 Animals ....................................................................................................... 139

2.3.2 Stereotaxic Surgery ..................................................................................... 140

2.3.3 Quantifying States of Sleep and Wakefulness ............................................ 140

2.3.4 Microdialysis Experiments ........................................................................... 140

2.3.5 Experimental Groups .................................................................................. 141

Group 1: Sleep for 6h followed by wakefulness on treadmill for 3h (S6-W3; n=7

mice) ................................................................................................................. 141

Group 2: Sleep deprivation for 6h followed by sleep for 3h (SD6-S3; n = 6 mice)

......................................................................................................................... 142

Group 3: Spontaneous wakefulness for 6h followed by wakefulness on treadmill

for 3h (W6-W3; n = 6 mice) .............................................................................. 142

2.3.6 Untargeted Metabolomics using UPLC-HRMS ............................................ 142

2.3.7 Statistical Analysis ...................................................................................... 143

Pre-processing normalization ........................................................................... 143

xi

Multivariate Analysis ......................................................................................... 144

Heatmap Analysis ............................................................................................. 144

Linear Mixed Effects Model .............................................................................. 144

Classification Analysis ...................................................................................... 146

2.4 RESULTS .......................................................................................................... 147

2.4.1 Temporal Fluctuation of Identified Metabolites ............................................ 149

2.4.2 Results of LME Analysis ............................................................................. 149

2.4.3 Classification Analysis ................................................................................. 151

2.5 DISCUSSION .................................................................................................... 161

2.5.1 Comparisons with Previous Metabolomics Studies ..................................... 165

2.6 CONCLUSION ................................................................................................... 167

REFERENCES ........................................................................................................ 168

Chapter 3: CHARACTERIZATION OF NATIVE COBAMIDE FROM Desulfitobacterium hafniense ................................................................................................................... 174

PREFACE ................................................................................................................ 175

3.1 ABSTRACT........................................................................................................ 178

3.2 INTRODUCTION ............................................................................................... 179

3.3 RESULTS .......................................................................................................... 182

3.3.1 Discovery and structure of a novel cobamide.............................................. 182

3.3.2 Confirmation of the novel lower base structure ........................................... 195

3.3.3 Purinyl-Cba is the prosthetic group of Dsf PceA RDases ............................ 196

xii

3.3.4 Dsf CobT substrate specificity and phylogenetic analysis ........................... 203

3.3.5 Effects of purinyl-Cba on dechlorinating activity .......................................... 214

3.4 DISCUSSION .................................................................................................... 224

3.5 METHODS ......................................................................................................... 226

3.5.1 Chemicals ................................................................................................... 226

3.5.2 Cultures ....................................................................................................... 226

3.5.3 Corrinoid extraction ..................................................................................... 227

3.5.4 Corrinoid analysis ........................................................................................ 229

3.5.5 NMR spectroscopy ...................................................................................... 230

3.5.6 Blue native PAGE (BN–PAGE), enzyme assays and proteomic analysis ... 230

3.5.7 Primer and probe design ............................................................................. 231

3.5.8 Chemical and molecular analyses ............................................................... 232

3.5.9 Statistical analysis ....................................................................................... 233

3.5.10 Bioinformatics and phylogenetic analyses................................................. 233

3.5.11 Heterologous expression and purification of CobT .................................... 233

3.5.12 In vitro CobT activity .................................................................................. 234

REFERENCES ........................................................................................................ 238

CONCLUSION ............................................................................................................ 245

VITA ............................................................................................................................ 249

xiii

LIST OF TABLES

Table 1.1 Total number of USFs ................................................................................... 35

Table 1.2 USFs selected for discussion ........................................................................ 37

Table 1.3 Raw Data of Dominant Hamsters from BLA/CeA .......................................... 59

Table 1.4 Raw Data of Handled Control Hamsters from BLA ........................................ 63

Table 1.5 Raw Data of Subordinate Hamsters from BLA .............................................. 67

Table 1.6 Raw Data of Dominant Hamsters from HPC ................................................. 71

Table 1.7 Raw Data of Handled Control Hamsters from HPC ....................................... 75

Table 1.8 Raw Data of Subordinate Hamsters from HPC ............................................. 80

Table 1.9 Raw Data of Dominant Hamsters from NAc .................................................. 84

Table 1.10 Raw Data of Handled Control Hamsters from NAc ...................................... 87

Table 1.11 Raw Data of Subordinate Hamsters from NAc ............................................ 89

Table 1.12 Raw Data of Dominant Hamsters from vmPFC ........................................... 92

Table 1.13 Raw Data of Handled Control Hamsters from vmPFC ................................ 95

Table 1.14 Raw Data of Subordinate Hamsters from vmPFC ....................................... 98

Table 1.15 Raw Data of Resilient Mice from BLA/CeA................................................ 101

Table 1.16 Raw Data of Control Mice from BLA/CeA .................................................. 104

Table 1.17 Raw Data of Susceptible Mice from BLA/CeA ........................................... 107

Table 1.18 Raw Data of Resilient Mice from HPC ....................................................... 110

Table 1.19 Raw Data of Control Mice from HPC ......................................................... 112

xiv

Table 1.20 Raw Data of Susceptible Mice from HPC .................................................. 114

Table 1.21 Raw Data of Resilient Mice from NAc ....................................................... 116

Table 1.22 Raw Data of Control Mice from NAc .......................................................... 119

Table 1.23 Raw Data of Susceptible Mice from NAc ................................................... 122

Table 1.24 Raw Data of Resilient Mice from vmPFC .................................................. 125

Table 1.25 Raw Data of Control Mice from vmPFC .................................................... 128

Table 1.26 Raw Data of Susceptible Mice from vmPFC .............................................. 131

Table 2.1 Significant Metabolites for Regulation of Behavioral States ........................ 152

Table 3.1 Proteomic analysis of the Desulfitobacterium (Dsf) hafniense strain JH1

proteins associated with different BN-PAGE slices .............................................. 204

Table 3.2 Information about CobT and homologous proteins used for phylogenetic tree

construction (Figure 4.4B in main text) ................................................................. 211

Table 3.3 Growth of corrinoid-auxotrophic organohalide-respiring Dehalobacter restrictus

(Dhb) and Dehlaococcoides mccartyi (Dhc) pure cultures with different cobamides

............................................................................................................................. 222

Table 3.4 Nucleotide sequences of the primers designed for PCR amplification of the

cobT genes to construct overexpression plasmids............................................... 236

Table 3.5 Information about the plasmids used for the overexpression of CobT enzymes.

............................................................................................................................. 237

xv

LIST OF FIGURES

Figure 1.1 Heatmap of all identified metabolites in mice from 4 brain regions .............. 21

Figure 1.2 Heatmap of all identified metabolites in hamsters from 4 brain regions ....... 23

Figure 1.3 Results of social interaction test for mice ..................................................... 26

Figure 1.4 Metabolite patterns of mice from untargeted metabolomic approach ........... 28

Figure 1.5 Metabolite patterns of hamsters from untargeted metabolomic approach .... 29

Figure 1.6 VIP score plot from metabolomics of mice ................................................... 30

Figure 1.7 VIP score plot from metabolomics of hamsters ............................................ 31

Figure 1.8 Effects of social defeat on the relative abundance of neurochemical

metabolites in mice ................................................................................................ 33

Figure 1.9 Effects of social defeat and dominance status on the relative abundance of

neurochemical metabolites in hamsters ................................................................. 34

Figure 2.1 Experimental design ................................................................................... 148

Figure 2.2 Observation of z-score fluctuation in LME significant metabolites .............. 153

Figure 2.3 PLSDA accurately classifies states of arousal and associated VIP classification

model ascribes significant features ...................................................................... 157

Figure 3.1 Cobamide general structure and the 16 known lower bases found in naturally

occurring cobamides ............................................................................................ 181

Figure 3.2 Spectrophotometric and structural features of Desulfitobacterium native

corrinoids ............................................................................................................. 184

Figure 3.3 The native corrinoids produced by several PCE-dechlorinating

Desulfitobacterium (Dsf) strains ........................................................................... 188

xvi

Figure 3.4 UV-Vis of novel cobamides ........................................................................ 190

Figure 3.5 The mass spectra of cobamides produced by different Dsf strains and

authentic vitamin B12 ........................................................................................... 191

Figure 3.6 Guided cobamide biosynthesis by Dsf hafniense strain Y51 ...................... 194

Figure 3.7 Results from homonuclear correlation spectroscopy (COSY) experiments 197

Figure 3.8 BN-PAGE of Dsf hafniense strain JH1 ....................................................... 199

Figure 3.9 Identification of purinyl-Cba as the native prosthetic group in Dsf PCE RDase

following nondenaturing, gel-electrophoretic separation of Dsf crude protein extracts

using BN–PAGE ................................................................................................... 200

Figure 3.10 Phylogenetic analysis of CobT homologous proteins and substrate specificity

of Dsf CobT .......................................................................................................... 205

Figure 3.11 Heterologous expression of Dsf CobT and Dhc CobT in E. coli and

requirements for lower base activation ................................................................. 215

Figure 3.12 Effects of purinyl-Cba substitution for vitamin B12 on the activity of corrinoid-

auxotrophic, organohalide-respiring bacteria. ...................................................... 218

Figure 3.13 Reductive dechlorination of cDCE to ethene in Dhc strain GT cultures ... 223

Figure 3.14 Demonstration of the utility of stable isotope 15N-labeling to obtain lower base

compositional information .................................................................................... 228

1

INTRODUCTION

2

Although the term “metabolome” was not introduced until 1998, the idea of

analyzing an organism’s fluids or tissue to determine overall health is not a new concept.

This idea can be dated back as far as ancient China (2000 – 1500 B.C.), where ants were

used to evaluate glucose concentration in urine for the diagnosis of diabetes mellitus. As

odd as it sounds, these ancient doctors even relied on tasting the patient’s urine for

diagnosis; can’t say modern physicians are that committed to their patients’ health these

days. Moving down the timeline, the Greek physician, Galen of Pergamon developed the

theory of humorism. This concept, also known as the four humors – black bile, yellow bile,

blood, and phlegm, provided physicians a simple diagnostic tool that was accepted by

Western medicine for more than 1,300 years. The scientific revolution of the 17th century

provided significant strides in the field of metabolomics, which were primarily advanced

by Santorio Sanctorius. Considered a founding father of the field, Santorio is recognized

for his work on “insensible perspiration,” where he determined that the amount of excreted

fluid was less than the fluid ingested. This study is the first documented case of physical

data collection for the quantitative analysis of pathology. From this research, Thomas

Willis (1674) was able to confirm that a patient with diabetes had sweet urine and coined

the term “mellitus”. The sweet smell from the patient’s urine was later identified to be a

sugar by Matthew Dobson in 1776 but were debated until the work of George Owen Rees

in the mid-19th century. We have since identified that elevated glucose levels occur due

to a lack of insulin production in diabetes patients, but this early metabolomics research

reveals the importance of studying small molecules for disease identification, and the true

duration of time that research has been focused on the study of the human metabolome.

Following the industrial revolution and moving into the modern era, J.J. Thompson

(1905) of the University of Cambridge must be given an enormous amount of credit for

where we are today with modern metabolomics research. The development of the first

mass spectrometer marked a new era of how the molecular space would be studied.

Although this technology has been refined in the century that has passed, the study of

molecules using their molecular weight has led to the identification of thousands, if not

millions, of compounds and has become a staple for the characterization of novel

compounds. Not to be over looked, the manufacturing of the first nuclear magnetic

3

resonance spectrometer (NMR) is equally as important for the field of metabolomics. In

1946, Felix Bloch of Stanford and Edward Purcell of Harvard simultaneously published

work using the first NMR in the same issue of Physical Review. The establishment of

NMR technologies have allowed researchers to characterize structural components of

novel compounds. Both analytical tools were further supplemented by the advancement

of chromatographic separation techniques in the 1960’s and made the analysis of a

complex metabolome possible. Each of these analytical technologies have made

significant advancements that have positioned the field of metabolomics as an emerging

field for drug development.

MODERN METABOLOMICS

Technological advances allowed for the first mass-based metabolomic

experiments in 1971 by Orval Mamer (Mamer, O. A., et al., Clin. Chim. Acta 1971), and

Evan and Majorie Horning (Horning, E. C.; Horning, M. G., J. Chrom. Sci. 1971) using

gas chromatography-mass spectrometry. These experiments provided evidence that

metabolic profiles could be generated from blood and urine samples. This was the trigger

for what is referred to as “modern metabolomics,” which started with research from Arthur

B. Robinson and Linus Pauling. Later that year, Robinson and Pauling (Pauling, L.;

Robinson, A. B., et al., PNAS 1971) published the first quantitative metabolomics

experiment showing biological variability of urine vapor and breath from humans following

dietary restriction. Now their original claim of the intestinal flora disappearing due to a

“defined diet” was corrected in 1970 (Winitz et al.), but this research still marks the

climactic beginning of large-scale, small molecule analysis. The term “metabolomics” was

first used by Stephen G. Oliver (Oliver, S. G. et al., Trends Biotechnol. 1998) for their

research on the yeast genome, and so began the era of metabolomics-based research.

4

OPENING THE DOOR FOR UNTARGETED METABOLOMICS

Targeted metabolomics research was the foundation of quantitative metabolomics

through 1970’s, 80’s and most of the 90’s until the invention and proof-of-principle of the

Orbitrap™ by Alexander Makarov (2000). Although, the concept of electrostatically

trapping ions in an orbit was in first developed almost a century prior by the physicist, K.

H. Kingdon (1923), the commercialization of this technology transitioned the world of

metabolomics from a targeted point-of-view to untargeted. See, targeted metabolomics

had technical limitations due to both hardware and software capabilities. Researchers

were only able to detect less than one percent of the metabolites present in biological

samples, which prevented the establishment of a comprehensive look at the entire

metabolome from a single sample. Now by generating a mass spectrum using Fourier

transform of the frequency signal, a high-resolution mass analyzer can detect thousands

of compounds simultaneously with a large dynamic range. This capability has spring

boarded the field into the direction of finding novel biomarkers as drug targets. Parallel to

this effort, the Human Metabolome Project started in 2004 and was led by David Wishart

of the University of Alberta, Canada. In a collaborative effort, over 50 scientists have

characterized over 2500 metabolites, 1200 drugs, and 3500 food components, which

have been compiled into the Human Metabolome Database for open-access.

Today, we have met a cross-roads of metabolomics research. The amount of data

generated presents computational limitations, and the field as a whole is attempting to

provide common practices for proper publication standards. Yet, as scientist, we strive to

achieve that next level of discovery in hopes of finding the next, great drug target. To

achieve this goal, we must continue to expand our technical and analytical tools for the

discovery and characterization of the undiscovered section of the metabolome.

NEUROMETABOLOMICS

A trending research topic is the analysis of neurometabolomics. The complexity of

studying the brain starts with the inherit selectivity of the blood brain barrier. The unique

5

feature of this organ provides additional hurdles when trying to understand its intricacies.

The specialized endothelial cells that line blood capillaries can selectively filter

compounds using passive diffusion based on size, polarity, and charge. Meaning that the

study of neuronal tissue cannot be directly supplemented with metabolic changes

observed from blood or other internal organs. Not to mention that the brain is arguably

the most complex organ of the body based on the sheer number of cooperative brain

regions and intricate arborization of nerve cells within/ across these regions. A major

emphasis on brain research was initiated by president George H. W. Bush when he

designated the 1990’s as the “Decade of the Brain” and continued when president Barack

Obama began the Brain Research through Advancing Innovative Neurotechnologies

(BRAIN) Initiative in 2013. These executive branch initiatives have increased funding and

recognition for the required advancement of brain research in hopes of solving problems

such as neurodegenerative diseases, genetic mutations, and psychological disorders.

THE KNOWLEDGE GAP

In the field of discovery-based small molecule investigation, we have developed a

diverse set of methods to determine “known” metabolites with the use of standards or

confirmation through fragmentation. Yet, it is after the detection where a lack of protocols

for interpretation exists. Following the integration of ion intensities, statisticians, both

advanced and novice, are presented with the challenge of authenticating significant

changes through various statistical routes and biochemists, both advanced and novice,

with the interpretation of metabolic changes and how those relate back to the

experimental perturbation. Both scenarios offer unique challenges, and as a field, we are

still laboring over which methods offer the most conclusive results. These are the current

state of affairs in the field of understanding known metabolites, a.k.a. metabolites from

your typical biochemistry textbook. When we move past our comfort zone and begin

looking into the metabolic space of “unknown” compounds, the field is presented with a

laundry list of challenges that complicate our ability to confirm molecular structure.

6

Identification of the full de novo structure is referred to as structure elucidation,

which includes the confirmation of molecular connectivity with correct stereochemical

assignments. The development of detailed bioanalytical approaches has become an

essential component for the advancement of novel structure elucidation, and specifically

relevant within the fields of metabolomics and pharmacology, including both discovery

and synthesis processing phases. Novel structure elucidation can be easily performed

using X-ray crystallography, given that you have a pure sample in the form of a crystal

structure. Since this is generally uncommon, additional analytical techniques have been

developed to further characterize the unknown biological space. Spectroscopic methods,

such as NMR, infrared, and UV-Vis, are staples within this field. NMR technologies

include the use of one- (1D) and two-dimensional (2D) analysis to determine bond

connectivity and atomic spatial resolution, which makes this technology a critical

component for compound characterization. Yet, this technique requires a relatively large

quantity of clean sample to obtain chemical shift information from nuclei other than

protons due to the low abundance of naturally occurring isotopes and complications

related to the nuclei’s spin quantum number.

Advances across mass spectrometry platforms have propelled mass-based

analysis of novel structures to the forefront of this field. The ability to obtain elemental

composition information from the parent mass and partial structure information from mass

fragments provides a unique opportunity to use a highly sensitive instrument that can

resolve several compounds from a complex mixture in a single sample. Platforms for this

analysis include time-of-flight, triple quadrupole, ion trap, and Fourier transform

instruments. Each of these instruments have unique figures of merit associated with their

mass accuracy, resolution, dynamic range, sensitivity, and robustness, which all

accompany their specific utility. Additionally, several forms of soft and ionization

techniques can be used to enhance ion detection. To accompany resolution of molecules

in the mass domain, chromatographic techniques, primarily liquid and gas, can assist in

feature identification and detection be resolving compounds in the time domain.

Currently, the field of discovery-based small molecule identification has an

abundance of analytical tools available at their disposal. The next major hurdle is the

7

handling of mass spectral data; including the development of mass spectral databases

and data interpretation (both ion intensities and spectral features), advancement of both

hardware and software packages, and development of strict protocols for the confirmation

of novel small molecules.

8

CHAPTER 1: NEUROMETABOLOMICS PROFILE CLASSIFICATION OF

SYRIAN HAMSTERS AND B6 MICE AS A MODEL OF STRESS

RESILIENCE

9

PREFACE

With neurometabolomics in its infancy, the first chapter of this dissertation offers

several key advancements to the field. First, the use of a social defeat model for hamsters

has been established, but this technique was less commonly used on mice. These

phenotypic, behavioral studies are important for the analysis of acute/ chronic stress

leading to depression, or even post-traumatic stress disorders. While this model presents

its own challenges, the following publication is the first record of neuronal metabolomics

used to study stress resistance from sub-milligram quantities of brain tissue. This study

involved the extraction of whole brains that were strategically sliced to expose four

different brain regions; medial prefrontal cortex, hippocampus, nuclear accumbens, and

basolateral amygdala from both Syrian hamsters and B6 mice. Following an aqueous

extraction technique, small molecule analysis was performed using an untargeted

metabolomics method that facilitated the identification of hundreds of identified

metabolites, thousands of unidentified spectral features, and the elucidation of several

novel metabolic targets.

A total of 54 hamsters and 70 mice were used to produce a total of 166 and 121

samples, respectively from the above-mentioned brain regions. Initially, the left and right

brain regions were tested separately, and confirmed to have no statistical differences in

metabolite levels. This lead to the collection of both the left and right side to produce a

sample mass ~300 - 400 ng. Samples were extracted in a cold-room (5 °C) using an

acidic acetonitrile solution with a previous established protocol. Samples were injected at

10 µL aliquots and chromatographically separated prior to analyte detection. Liquid

chromatography was performed in reverse phase with step-wise increments of methanol

and formic acid in water. Mass analysis was conducted on an Exactive Plus Orbitrap and

metabolite integration was completed using the MAVEN software package.

Statistical analysis, including ANOVA and PLS-DA, VIP scores, were used to

reduce the number of unidentified features to a consolidated list that was subject to a

database search using the Human Metabolome Database (HMDB). These statistical

approaches are commonly used in metabolomics research and provided sufficient feature

10

reduction. Manual investigation of HMDB metabolite hits resulted in novel experimental

targets for future studies. Although targets were ambiguously identified, we are still left

with thousands of unidentified features that were statistically significant to our stress

model, but whose molecular formula did not equate to a known, biologically active

compound.

The discovery-based approach of this study hallmarks a first-pass analysis of

metabolic profiles related to stress resistance. The known and unknown small molecules

identified in this study will be used to design future experimental endeavors in the pursuit

of diagnostic biomarkers. In parallel studies, we can continue to identify the small

molecule targets and metabolic pathways that have a strong correlation to the reduction

of long-term effects from trauma. These future analyses could lead to the discovery of

novel drug targets used in the diagnosis, treatment and/or prevention of depression and

acute/chronic trauma-related stress, such as post-traumatic stress disorder.

11

A version of this chapter was originally published by Dulka and Bourdon, et al.:

Reproduced with permission from Dulka, B. N.†; Bourdon, A. K. †; Clinard, C. T.; Muvvala,

M. B. K.; Campagna, S. R.; Cooper, M. A., Metabolomics reveals distinct neurochemical

profiles associated with stress resilience. Neurobiology of Stress 2017, 7, 103-112;

https://doi.org/10.1016/j.ynstr.2017.08.001. †Authors contributed equally.

Contributions:

This chapter contains only minor adaptations from the originally submitted manuscript.

BND, CTC, and MBM performed acute social defeat experiments and behavioral/

phenotype evaluations of subjects. AKB performed extractions and metabolomics studies

using UPLC-HRMS, and sequential statistics on results. AKB and BND equally

contributed to data analysis and interpretation, and AKB, BND, SRC, and MAC wrote the

manuscript.

12

1.1 ABSTRACT

Acute social defeat represents a naturalistic form of conditioned fear and is an

excellent model in which to investigate the biological basis of stress resilience. While

there is growing interest in identifying biomarkers of stress resilience, until recently, it has

not been feasible to associate levels of large numbers of neurochemicals and metabolites

to stress-related phenotypes. The objective of the present study was to use an untargeted

metabolomics approach to identify known and unknown neurochemicals in select brain

regions that distinguish susceptible and resistant individuals in two rodent models of acute

social defeat. In the first experiment, male mice were first phenotyped as resistant or

susceptible. Then, mice were subjected to acute social defeat, and tissues were

immediately collected from the ventral medial prefrontal cortex (vmPFC),

basolateral/central amygdala (BLA/CeA), nucleus accumbens (NAc), and dorsal

hippocampus (dHPC). Ultra-high performance liquid chromatography coupled with high

resolution mass spectrometry (UPLC-HRMS) was used for the detection of water-soluble

neurochemicals. In the second experiment, male Syrian hamsters were paired in daily

agonistic encounters for 2 weeks, during which they formed stable dominant-subordinate

relationships. Then, 24 hours after the last dominance encounter, animals were exposed

to acute social defeat stress. Immediately after social defeat, tissue was collected from

the vmPFC, BLA/CeA, NAc, and dHPC for analysis using UPLC-HRMS. Although no

single biomarker characterized stress-related phenotypes in both species, commonalities

were found. For instance, in both model systems, animals resistant to social defeat stress

also show increased concentration of molecules to protect against oxidative stress in the

NAc and vmPFC. Additionally, in both mice and hamsters, unidentified spectral features

were preliminarily annotated as potential targets for future experiments. Overall, these

findings suggest that a metabolomics approach can identify functional groups of

neurochemicals that may serve as novel targets for the diagnosis, treatment, or

prevention of stress-related mental illness.

13

1.2 INTRODUCTION

Stress is a contributing factor in the etiology of several psychiatric conditions

including depression1, panic disorder2, and post-traumatic stress disorder (PTSD)3.

Aggression is a particularly salient form of trauma, and people exposed to interpersonal

violence are at a greater risk for developing PTSD than those exposed to non-personal

trauma4. However, many individuals who experience stressful events do not develop a

stress-related psychopathology, and there is a great deal of interest in what makes certain

individuals resilient. Stress resilience refers to the ability of individuals to maintain normal

levels of psychological, biological, and social functioning following a traumatic event.

Importantly, resilience is an active process and not simply the absence of a pathological

response to stress5-7.

Animal models of social defeat stress have been put forth as high validity models

of stress-related mental illness and, interestingly, individuals exhibit pronounced

variability to the effects of social defeat8. Genetically identical, inbred mice display a great

deal of variability in social avoidance following 10 days of chronic social defeat9-10 and

two days of repeated social defeat11-12. Susceptible mice avoid novel animals in a social

interaction test following social defeat stress, whereas resilient (or resistant) mice

investigate novel animals following social defeat stress in a pattern similar to non-

defeated controls13. In the chronic social defeat model, brain-derived neurotrophic factor

(BDNF) signaling in a neural circuit involving the ventral tegmental area and nucleus

accumbens (NAc) is critical for the expression of defeat-induced social avoidance in

susceptible animals10. The ventromedial prefrontal cortex (vmPFC) also provides top-

down inhibitory control of the NAc and amygdala, which promotes a resistant phenotype

after social defeat stress 14. In a mouse model using a single day of acute social defeat,

BDNF signaling in the basolateral amygdala (BLA) is necessary for acquisition of defeat-

induced social avoidance15. The development of the susceptible and resistant

phenotypes is largely unknown, although the epigenetic changes that underlie stress

vulnerability may be linked to environmental influences during pre-natal and post-natal

development, including the establishment of early dominance hierarchies16-17.

14

Syrian hamsters are aggressive and territorial animals that exhibit a striking

change in behavior following social defeat stress. Following exposure to a single bout of

social defeat, male hamsters fail to defend their home territory and instead exhibit

submissive and defensive behavior toward novel non-aggressive intruders for up to one

month18. This stress-induced change in agonistic behavior is called the conditioned defeat

response and is similar to the defeat-induced social avoidance shown by rats and mice19-

20. The conditioned defeat response in hamsters is an ethologically relevant form of

conditioned fear and is regulated by many of the same brain regions, neural circuits, and

neurochemicals as conditioned fear. Neurotransmission in the central amygdala (CeA) is

critical for the expression of the conditioned defeat response21. In the BLA, NMDA

receptors, BDNF, and cAMP response element binding (CREB) protein are each

necessary for the acquisition of the conditioned defeat response22-24. Neurotransmission

in several other brain regions is known to modulate the conditioned defeat response, such

as the NAc, ventral hippocampus (vHPC), and vmPFC25-27. A great deal of variation exists

in the amount of submissive and defensive behavior exhibited by hamsters following

social defeat. To investigate vulnerability to the conditioned defeat response, we allowed

dyads of hamsters to establish and maintain dominance relationships and then tested

dominant and subordinate animals for their conditioned defeat response. We found that

dominant hamsters show a reduced conditioned defeat response and increased c-Fos

immunoreactivity in the vmPFC compared to subordinate and control animals28-29.

Furthermore, pharmacological blockade of neural activity in the vmPFC reinstated the

conditioned defeat response in dominant hamsters but did not alter conditioned defeat in

subordinates or controls30. While a great deal is known about the brain regions and neural

circuitry that control the conditioned defeat response, relatively little is known about the

neurochemistry within these structures.

There is growing interest in identifying neurochemical biomarkers to aid in the

diagnosis, risk assessment, and prevention of stress-related mental illnesses such as

PTSD31-33. Additionally, neurochemicals identified after a stressor can serve as

mechanistic biomarkers, and such biomarkers can be used to improve the treatment of

stress-related psychopathologies. While attempts to identify biomarkers continue to be a

15

major focus of biomedical research, at present biomarkers have not made it into clinical

application for mental illness. Part of the difficulty is that individual neurochemicals are

unlikely to correlate with diagnosis, risk, or treatment response for complex forms of

stress-related psychopathology. Taking a multifactorial approach is an essential first step

toward developing biomarkers for mental illness. Metabolomics is a quantitative analysis

of small molecules present in biological systems and has been increasingly used for the

discovery of biomarkers34-36. The use of untargeted metabolomics allows the user to take

a discovery-based approach, which initially results in a data generating experiment. After

relative quantitation of known metabolites based on pre-determined retention times and

accurate mass (< 5 ppm), the user is still left with thousands of unidentified spectral

features (USFs) that potentially relate to a novel compound.

This study focused on characterizing the neurochemical profiles in select brain

regions that distinguish animals that are susceptible and resistant to the effects of acute

social defeat stress. In both mice and hamster models, we expected that susceptible and

resistant animals would differentially express specific neurochemical metabolites in brain

regions known to modulate defeat-induced changes in behavior. Further, a comparative

approach is expected to aid in the discovery of biomarkers by identifying similar classes

of compounds associated with stress susceptibility and resilience in both animal models.

1.3 METHODS

1.3.1 Animals and Housing Conditions

Male C57BL/6 mice (7-8 weeks old, 20-27 g) were used as subjects (Envigo,

Indianapolis, IN). Mice were maintained on a 12:12 light/dark cycle with ad libitum access

to food and water in a temperature-controlled room (21 ± 2 °C). Animals were housed in

polycarbonate cages (18.4 cm x 29.2 cm x 12.7 cm) with corncob bedding, cotton nesting

materials, and wire mesh tops. All behavioral procedures were performed during the first

three hours of the dark phase of their cycle. Subjects were handled several times one

week prior to social defeat to habituate them to the stress of human handling.

16

Male Syrian hamsters (3-4 months old, 120-180 g) were obtained from our

breeding colony that is derived from animals purchased from Charles River Laboratories

(Wilmington, MA). All animals were housed in polycarbonate cages (12 cm × 27 cm × 16

cm) with corncob bedding, cotton nesting materials, and wire mesh tops. Food and water

were available ad libitum. Cages were not changed for one week prior to dominant–

subordinate encounters to allow individuals to scent mark their territory. Subjects were

handled several times one week prior to dominant–subordinate encounters to habituate

them to the stress of human handling. Animals were housed in a temperature-controlled

colony room (21 ± 2 °C) and kept on a 14:10 h light:dark cycle to facilitate reproductive

maturation. All behavioral protocols were performed during the first 3 h of the dark phase

of their cycle. Procedures in both mice and hamsters were approved by the University of

Tennessee Institutional Animal Care and Use Committee and are in accordance with the

National Institutes of Health Guide for the Care and Use of Laboratory Animals.

1.3.2 Experimental Procedures

Social Defeat Stress

Mice were subjected to acute social defeat stress using a resident-intruder model

adapted from the social defeat literature in Syrian hamsters18, 37-38. During social defeat

stress, subjects were exposed to adult male Hsd:ICR (CD1) mice that were individually

housed to maintain aggression (35-40 g, Evigo). The CD1 mice were prescreened for

high levels of aggression, and animals exhibited attack latencies of less than 30 sec.

Social defeat stress consisted of three, 2-min aggressive encounters in the home cage of

a novel CD1 resident aggressor mouse with 2-min inter-trial intervals in the subjects’

home cage, for a total duration of 10-min. These defeats were evaluated by an observer

in real time to verify that each subject received multiple attacks from each CD1 mouse.

An attack was defined as a rapid lunge followed by a bite or bite attempt. To correct for

potential variation in the amount of aggression subjects received, the first defeat episode

did not begin until the subject submitted to an attack from the resident aggressor. Non-

defeated control animals were exposed to the empty home cage of three separate CD1

mice for 2-min with 2-min inter-trial intervals in their home cage.

17

In hamsters, social defeat stress consisted of subjects being placed in the home

cages of three separate hamsters that were larger, older animals (>6 months, >190 g).

These larger animals were called resident aggressors, and they were individually housed

to maximize territorial aggression. Resident aggressors were also prescreened to ensure

that they reliably attacked and defeated intruders. Subjects were exposed to three

resident aggressors in consecutive 5-min aggressive encounters, with 5-min inter-trial

intervals in their own home cage, for a total duration of 25-min. Similarly to mice, the first

defeat episode did not begin until the subject submitted to an attack from the resident

aggressor. Subjects submitted immediately in the second and third defeat episodes. Non-

defeated control animals were placed in the empty home cages of three separate resident

aggressors for three 5-min exposures to control for the novel environment and olfactory

cues associated with social defeat stress. Social defeats were digitally recorded for

behavioral analysis. The frequency of attacks by the resident aggressor was recorded

and scored by a blind observer. Whether or not subjects fought back against the resident

aggressor during the first social defeat episode was also recorded.

In both mice and hamsters, aggressive encounters were carefully monitored for

wounding and animals that received minor scratches were treated with an antiseptic

solution. No animal received a wound that resulted in signs of pain or distress and none

of the animals were removed from the study because of wounding.

Social Interaction Testing

Social interaction testing was performed in mice to identify animals that were

susceptible and resistant to the effects of social defeat stress. Testing was performed in

an open field arena (43.2 cm x 43.2 cm x 43.2 cm) under dim light conditions. Social

interaction testing was modeled after conditioned defeat testing in Syrian hamsters18, 37,

as well as social interaction testing following chronic social defeat in mice13. Social

interaction testing consisted of two 5-min trials: CD1 mouse target absent and CD1

mouse target present. During the target absent trial, subjects were habituated to an empty

perforated plastic box that was positioned against one of the four walls. The target present

trial occurred immediately following the target absent trial, and a novel CD1 mouse was

18

placed inside the perforated plastic box. The perforated box allowed for sensory

information, but no physical contact. An observer blind to experimental conditions

quantified the duration of time the subject spent in the interaction zone. The interaction

zone was defined as a 3 cm area surrounding the plastic box. Considerable variation

exists in behavioral responses to social defeat in C57 mice, and an interaction ratio has

been used to categorize mice as either susceptible or resistant to social defeat9, 13. The

interaction ratio is calculated as (Time investigating target present) / (Time investigating

target absent). Defeated mice with interaction ratios of less than 1.0 are defined as

susceptible and defeated mice with interaction ratios equal to or greater than 1.0 are

defined as resistant to social defeat.

Dominant-Subordinate Relationships

Hamsters were not exposed to social interaction testing because it was not

necessary to phenotype animals following social defeat stress. Rather, hamsters were

given the opportunity to establish dominance relationships, and we have previously

shown that over time dominant animals become resistant to social defeat stress whereas

subordinates become susceptible29. To establish social status, subjects were weight-

matched into resident-intruder dyads and paired in daily social encounters for 14 days as

described previously29. Subjects were randomly assigned as a resident or intruder, and

all social encounters occurred in the resident’s home cage. Encounters were 10-min in

duration prior to the establishment of dominance relationships, while all subsequent

encounters were 5-min. Dominant and subordinate animals were identified by the

direction of agonistic behavior within each dyad. If a dyad did not form a dominance

relationship after 5 encounters, the animals were excluded from statistical analysis.

Experimental Design

In Experiment 1, 62 mice were exposed to social defeat stress and 12 mice were

non-defeated controls. Twenty-four hours later, mice received social interaction testing

and were identified as susceptible (N = 51) or resistant (N = 11). Mice were tested until

the resistant group reached sufficient statistical power, although brain tissue was

collected from only the first 11 mice identified as susceptible. It is noteworthy that the

19

percentage of resistant mice observed in this study (about 18%) is less than what has

been reported elsewhere in chronic social defeat models (about 30%)9. To investigate

defeat-induced changes in neurochemical activity, mice received a second bout of social

defeat stress or empty cage exposure one week following their social interaction test.

In Experiment 2, 30 hamsters were paired in daily dominant-subordinate

encounters. Three dyads were excluded from analysis because they failed to establish a

stable dominance relationship. Twenty-four hours after the final dominance encounter, 12

dominants and 12 subordinates received social defeat stress. Fourteen control animals

did not receive dominance encounters and were exposed to empty cages instead of social

defeat.

Tissue Collection

Immediately following the final social defeat encounter, animals were sacrificed

with isoflurane and rapidly decapitated. A brain matrix was used to generate 1 mm thick

brain slices that were rapidly frozen on glass slides. Tissue punches (1 mm diameter)

were collected bilaterally from regions containing the BLA/CeA, dorsal hippocampus

(dHPC), NAc, and vmPFC. Tissue punches were flash frozen in liquid nitrogen and stored

at -80 ºC until metabolite extraction. In some brain regions, tissue was not assayed

because of inaccurate punches. In mice, 3 samples were lost from the BLA/CeA, 4

samples were lost from the dHPC, 2 samples were lost from the vmPFC, and 1 sample

was lost from the NAc. In hamsters, due to inaccurate punches, 2 samples were lost from

the BLA/CeA, 8 samples were lost from the dHPC, 7 samples were lost from the vmPFC,

and 6 samples were lost from the NAc.

1.3.3 Untargeted Metabolomics using UPLC-HRMS

Analysis by UPLC-HRMS was completed in accordance with previously published

protocols39. Refer to appendix for additional details on the extraction protocol,

chromatography specifications, and mass spectrometry (MS) parameters. The

Metabolomic Analysis and Visualization Engine (MAVEN) software package, an open

source program that reduces the complexity of metabolomics analysis, was used to select

metabolites from a pre-existing list of over 270 compounds40. Henceforth, identified

20

metabolites are referred to as known metabolites, which were previously validated for

exact mass and retention time using chemical standards from Fisher Scientific or

preexisting chromatography39. MAVEN enables the user to directly extract all spectral

features from a single sample. Any spectral feature that was not confirmed as a known

metabolite will henceforth be referred to as an unidentified spectral feature (USF).

Metabolite ion counts were normalized using the ratios of intensities among metabolites

within a sample to remove errors due to sampling and instrumental variability using a

modification of known methods41-42. This internal ratio normalization (IRN; additional

information in appendix) technique provides normalized fold changes for the selected

array comparisons, as well as p-values from complimentary univariate analysis

techniques, one-way ANOVA with Tukey post-hocs and two-tailed Student’s t-tests.

These fold changes were then used to generate heatmaps of known metabolites (for mice

see Figure 1-1, for hamsters see Figure 1-2).

Additionally, unnormalized ion intensities of known and unknown metabolites were

also analyzed using partial least squares discriminant analyses (PLS-DA). PLS-DA is a

statistical method, similar to principal components regression, which finds a linear

regression model by projecting predicated variables and the observed variables into a

new space. From these PLS-DA analyses, variable importance in projection (VIP) score

plots can be extrapolated. The VIP score is a common feature selection tool that is a

probability function calculated by totaling the weighted sum of squares of the loading

vectors43, and this tool enables a matrix reduction of selected metabolites for further

investigation. A metabolite with a VIP score greater than or equal to 1.0 was considered

a variable that highly contributed to the observed separation within the PLS-DA plot.

Further description of the extraction protocol, the UPLC-HRMS procedures, and the data

processing methods can be found in the appendix.

1.3.4 Statistical Analysis

Data were analyzed using one-way ANOVAs followed by Tukey’s post-hocs,

Student’s t-tests, and chi-square tests, where appropriate. Statistical significance was set

at α = 0.05. Data are reported as mean ± SEM, except where noted. Statistical reduction

21

Figure 1.1 Heatmap of all identified metabolites in mice from 4 brain regions

Array comparisons are labeled at the top of the figure; R/C: resistant/ control, S/C:

susceptible/ control, and R/S: resistant/ susceptible.

Saturated colors are displayed on a log-2 scale. A Student’s T-test was used to produce

the p-values using a two-tail comparison of the arrays. Values were converted to symbols

and overlaid onto the figure.

22

Figure 1.1 Continued

23

Figure 1.2 Heatmap of all identified metabolites in hamsters from 4 brain regions

Array comparisons are labeled at the top of the figure; D/C: dominant/ control, S/C:

subordinate/ control, and D/S: dominant/ subordinate.

Saturated colors are displayed on a log 2 scale. A Student’s t-test was used to produce

the p-values using a two-tail comparison of the arrays. Values were converted to symbols

and overlaid onto the figure.

24

Figure 1.2 Continued

25

of USFs was accomplished using Student’s t-tests (p ≤ 0.05) and VIP score (≥ 1.0), and

individual metabolites of interest were confirmed to be significant through one-way

ANOVA analysis and Tukey’s post hoc tests.

1.4 RESULTS

1.4.1 Behavioral Data

To characterize mice as susceptible or resistant to the effects of acute social defeat

stress, mice were evaluated in a social interaction test. One-way ANOVA analysis

revealed significant differences in interaction ratios between non-defeated controls,

susceptible, and resistant mice (F(2, 30) = 31.11, p < 0.0001). Tukey’s post-hoc

comparisons demonstrated that susceptible mice had a significantly lower social

interaction ratio compared with resistant mice and controls (p < 0.001 and p < 0.001,

respectively), whereas resistant mice and controls did not significantly differ in their social

interaction ratios (p = 0.70) (Figure 1-3). A subset of the defeats were quantified, and

there were no significant differences between susceptible (8.81 ± 0.74) and resistant

(8.22 ± 0.40) mice in the number of attacks received per 2-min e (t = 0.38, df = 13, p =

0.71). No mouse, resistant or susceptible, fought back against the resident aggressor

during any of the defeat episodes, and all attacks occurred within the first 30-sec.

In hamsters, the daily dyadic encounters were videotaped and monitored in real time to

determine the direction of aggression. On average, dominance relationships were

established on day 1.07 (SD = 0.26). Dominant animals continued to direct aggression

towards the subordinate throughout the two-week period. Two pairs were excluded

because they did not form a dominance relationship after 5 days of dyadic encounters,

and one pair was excluded because of a switch in dominance status on day 6. The

number of attacks received during social defeat stress, as well as the duration of fighting

back by subjects during the first defeat were scored by an observer blind to treatment

conditions. There were no significant differences between dominant (5.94 ± 0.86) and

subordinate (5.14 ± 0.69) hamsters in the number of attacks received (t = 0.91, df = 70,

26

Figure 1.3 Results of social interaction test for mice

Mice were tested in a neutral arena for social avoidance 24 hours after their first social

defeat experience. We segregated defeated mice into two populations, resistant and

susceptible, based on their social interaction ratios. Mice with a social interaction ratio of

1 or greater were characterized as resistant, while mice with a social interaction ration of

less than 1 were characterized as susceptible. All non-defeated control mice always had

a social interaction ration greater than 1. One-way ANOVA analysis revealed significant

differences in interaction ratios between non-defeated controls, susceptible, and resistant

mice (F(2, 30) = 31.11, p < 0.0001). Tukey’s post-hoc comparisons demonstrated that

susceptible mice had a significantly lower social interaction ratio compared with resistant

mice and controls (p < 0.001 and p < 0.001, respectively), whereas resistant mice and

controls did not differ in their social interaction ratios (p = 0.70).

27

p = 0.37). Dominant hamsters (8/12) also fought back significantly more often than

subordinates (0/12) (χ2 = 12.00, df = 1, p = 0.0005).

1.4.2 Metabolomics Data

PLS-DA Reveals Distinct Metabolic Profiles

Figures 1.4 and 1.5 represent the PLS-DA plots generated from the four select

brain regions of both mice and hamsters, respectively. The shaded ellipses represent the

95% confidence intervals for each treatment condition. Significant separation of

metabolites was achieved for both mice and hamsters, which suggests that the

phenotypes exhibit a significantly different metabolic pattern of known and unknown

metabolites in each brain region. Furthermore, from the VIP scores derived from the PLS-

DA analyses, we extracted variables that differentiated susceptible and resistant mice or

subordinate and dominant hamsters. Each brain region exhibited a unique set of relevant

(VIP ≥ 1.0) metabolites (Mice; BLA/CeA: 29, dHPC: 25, vmPFC: 33, NAc: 33 and

Hamster; BLA/CeA: 48, dHPC: 39, vmPFC: 29, NAc: 29). VIP score plots are available

for both mice (Figure 1-6) and hamsters (Figure 1-7).

Identifying Representative Known Metabolites

Representative metabolites were chosen based on the following parameters: p ≤

0.05 and VIP ≥ 1.0. For mice, one-way ANOVA analyses revealed several significant

neurochemical metabolites that differentiated resistant and susceptible animals. In the

dHPC, significant differences were observed in the relative abundance of GABA (F(2, 25 =

4.360, p = 0.024); specifically, Tukey’s post hoc comparisons demonstrated that

susceptible mice had elevated levels of GABA compared to resistant mice (Figure 1.8A;

p = 0.018). In the NAc, significant differences were observed in the relative abundance of

cystine (F(2, 30) = 9.050, p = 0.001), and resistant mice had significantly higher levels

compared to subordinates (Figure 1.8B; p = 0.001). In the vmPFC, significant differences

were seen in the relative abundance of IMP (inosinic acid) (F(2, 28 = 3.487, p = 0.044) and

AMP (F(2, 28 = 3.334, p = 0.050). For both IMP and AMP, resistant mice had significantly

higher levels compared to subordinates (Figure 1.8C; p = 0.037 and Figure 1.8D; p =

28

Figure 1.4 Metabolite patterns of mice from untargeted metabolomic approach

Qualitative profiling for control (yellow), resistant (red), and susceptible (blue) mice was

conducted with PLS-DA. PLS component 1 (X-axis) and PLS component 2 (Y-axis)

represent the highest two X-scores of dimensions 1 and 2 for matrix X of metabolite ion

abundances, respectively. Ellipses express a 95% confidence interval. Plots exhibit

significant separation and clustering of samples across all four brain regions. A) BLA/CeA,

B) dHPC, C) NAc, D) vmPFC.

29

Figure 1.5 Metabolite patterns of hamsters from untargeted metabolomic approach

Qualitative profiling for control (yellow), dominant (red), and subordinate

(blue) hamsters was conducted with PLS-DA. PLS component 1 (X-axis) and PLS

component 2 (Y-axis) represent the highest two X-scores of dimensions 1 and 2 for

matrix X of metabolite ion abundances, respectively. Ellipses express a 95% confidence

interval. Plots exhibit significant separation and clustering of samples across all four brain

regions. A) BLA/CeA, B) dHPC, C) NAc, D) vmPFC.

30

Figure 1.6 VIP score plot from metabolomics of mice

VIP plots of identified metabolites in mice with a VIP score ≥ 1.0. Labels are provided to

explain the total number of metabolites within three ranges; VIP ≥ 1.0, 1.0 < VIP ≥ 0.8,

and VIP < 0.8. These plots are derived from PLS-DA multivariate analysis. A) BLA/CeA,

B) dHPC, C) NAc, D) vmPFC.

31

Figure 1.7 VIP score plot from metabolomics of hamsters

VIP plots of identified metabolites in hamsters with a VIP score ≥ 1.0. Labels are provided

to explain the total number of metabolites within three ranges; VIP ≥ 1.0, 1.0 < VIP ≥ 0.8,

and VIP < 0.8. These plots are derived from PLS-DA multivariate analysis. A) BLA/CeA,

B) dHPC, C) NAc, D) vmPFC.

32

0.042, respectively). Surprisingly, no significant differences were observed in the

BLA/CeA of mice.

In hamsters, one-way ANOVA analyses also revealed changes in neurochemical

metabolite expression. In the BLA/CeA, serine differed significantly across conditions (F(2,

33 = 3.542, p = 0.040); specifically, dominants had significantly lower levels compared to

controls (Figure 1.9A; p = 0.034). In the NAc of hamsters, a statistical trend was observed

in the relative abundance of fumarate (F(2, 30 = 2.837, p = 0.074; VIP = 0.831), and

dominant animals tended to have a higher expression compared to subordinates (Figure

1.9B; p = 0.063). In the vmPFC, tyrosine differed significantly across animals (F(2, 30 =

9.096, p = 0.001), and dominant hamsters had a higher relative abundance compared to

controls and subordinates (Figure 1.9C; p = 0.001 and p = 0.018, respectively). Also in

the vmPFC, significant differences were observed in the expression of methionine (F(2, 30

= 8.017, p = 0.002), specifically, dominants had a higher relative abundance compared

to controls and subordinates (Figure 1.9D; p = 0.001 and p = 0.023, respectively).

However, in the dHPC, no significant differences were observed across conditions.

Identifying Representative Unknown Metabolites

The discovery of thousands of USFs reveals the true complexity of mammalian

metabolism. In the BLA/CeA, dHPC, NAc, and vmPFC of hamsters, the total USFs

identified were 6981, 5622, 9565, and 7420, respectively, and 2383, 2457, 1987, and

2098 in mice (Table 1-1). Following statistical reduction of USFs, we identified a total of

27, 28, 33, and 28 features in hamsters and 27, 27, 30, and 29 features in mice from the

BLA/CeA, dHPC, NAc, and vmPFC, respectively. The compilation of USFs represents a

list of unique parent masses not found in our list of known metabolites.

Regarding unknown metabolites, only USFs that revealed significant changes

between dominant and subordinate hamsters, or resistant and susceptible mice, were

further investigated using the Human Metabolome Database (HMDB)44 to produce a list

of potential compound matches. Significance was established through the following

parameters: Student t-test: p ≤ 0.05, VIP ≥ 1.0, and the mean decrease in accuracy (MDA)

33

Figure 1.8 Effects of social defeat on the relative abundance of neurochemical

metabolites in mice

A) In the dHPC, susceptible mice had a greater relative abundance of GABA. B) In the

NAc, resistant mice had significantly higher levels of cystine. C) In the vmPFC, resistant

mice had higher levels of inosinic acid (IMP). D) Finally, also in the vmPFC, resistant mice

had a greater relative abundance of AMP. Data are shown as mean ± SEM. An asterisk

indicates a significant difference between groups as determined by a Tukey’s post hoc

test (*p ≤ 0.05).

34

Figure 1.9 Effects of social defeat and dominance status on the relative abundance

of neurochemical metabolites in hamsters

A) In the BLA/CeA, dominant hamsters had significantly lower levels of serine compared

to controls. B) In the NAc, dominant hamsters tended to have higher levels of fumarate.

C) In the vmPFC, dominant hamsters had a greater relative abundance of tyrosine

compared to controls and subordinates. D) Finally, also in the vmPFC, dominant

hamsters had significantly higher levels of methionine compared to controls and

subordinates. Data are shown as mean ± SEM. An asterisk indicates a significant

difference between groups as determined by a Tukey’s post hoc test (*p ≤ 0.05, #p =

0.074).

35

Table 1.1 Total number of USFs

Total number of unidentified spectral features (USFs) detected using UPLC-HRMS for

untargeted metabolomics.

Mic

e

Brain Region

USFs Significant*

USFs

Significant* USFs

(Res v Ctrl)

Significant* USFs

(Sus v Ctrl)

Significant* USFs

(Res v Sus)

Reduced List of USFs

BLA/CeA 2383 256 141 105 64 27

dHPC 2457 165 35 24 132 28

NAc 1987 586 301 63 471 33

vmPFC 2098 280 198 48 140 28

Ha

ms

ter

Brain Region

USFs Significant*

USFs

Significant* USFs

(Res v Ctrl)

Significant* USFs

(Sus v Ctrl)

Significant* USFs

(Dom v Sub)

Reduced List of USFs

BLA/CeA 6981 281 147 72 111 27

dHPC 5622 541 235 285 114 27

NAc 9565 421 101 195 194 30

vmPFC 7420 334 86 203 104 29

*Significant features refer to p-value ≤ 0.05 (in a Student’s t-test), variable importance in

projection (VIP) ≥ 1.0, and the mean decrease in accuracy (MDA) = top 10%.

36

(top 10%). Since each parent mass could exist as an adduct (i.e. [M+Na-H]), the number

of matches were anywhere from 0 to 50. Compound matches were screened against

existing literature to determine biologically relevant matches.

The following features were selected from both mice and hamsters (Table 1-2).

Two features from the BLA/CeA, m/z 279.0458 (F(2, 26 = 4.919, p = 0.015) and m/z

297.0563 (F(2, 26 = 5.2, p = 0.013), were significantly reduced in resistant mice compared

to controls (p = 0.036 and p = 0.043, respectively) and susceptible mice (p = 0.027 and p

= 0.017, respectively). These features are believed to be the same compound but

detected as separate adducts. In the NAc, the m/z 274.1045 feature (F(2, 30 = 242.613, p

< 0.001) revealed a significant decrease in susceptible mice compared to controls (p <

0.001) and resistant mice (p < 0.001), while resistant mice were also significantly

increased compared to controls (p < 0.001).

In the BLA/CeA of hamsters, the m/z 316.1012 feature (F(2, 33 = 11.073, p < 0.001)

was significantly increased in subordinates compared to controls (p = 0.001) and

dominants (p < 0.001). Also, in the BLA/CeA, the m/z 289.0903 feature (F(2, 33 = 3.434, p

= 0.044) was significantly decreased in subordinates compared to dominants (p = 0.044).

Two features; m/z 320.0619 (F(2, 29 = 3.163, p = 0.057) and m/z 342.0441 (F(2, 29 = 5.402,

p = 0.010) in the NAc were selected as potential adduct masses, which means that they

are derived from the same compound. These features showed a decreased concentration

in subordinate hamsters compared to dominant hamsters (p = 0.050 and p = 0.010,

respectively).

37

Table 1.2 USFs selected for discussion

Statistical reduction using Student’s t-tests identified several USFs with Human Metabolome Database (HMDB) matches

44, which were then confirmed to be significant through one-way ANOVA analysis and Tukey’s post-hoc tests.

Mic

e

Brain Region USF parent mass (Da) Retention time (min) Adduct HMDB match

BLA/CeA 279.0458

11.5 [M-H]

N-acetylserotonin sulfate 297.0563 [M-H2O-H]

dHPC No statistically and biologically active matches

vmPFC No statistically and biologically active matches

NAc 274.1045 4.7 [M-H] Norophthalmic acid

Ha

ms

ter

Brain Region USF parent mass (Da) Retention time (min) Adduct HMDB match

BLA/CeA 316.1012 11.6 [M+TFA-H] L-acetylcarnitine

289.0903 11.6 [M+Na-2H] N-acetylcarnosine

dHPC No statistically and biologically active matches

vmPFC No statistically and biologically active matches

NAc 320.0619

15.0 [M-H]

beta-citryl-L-glutamic acid 342.0441 [M+Na-2H]

38

Table 1.2 Continued

ANOVA Tukey Post-hoc Student T-test

Mic

e

Brain Region

df1 df2 F-test p-value Res/Ctrl Sus/Ctrl Res/Sus Res/Ctrl Sus/Ctrl Res/Sus

BLA/CeA 2 26 4.919 0.015 0.036 0.998 0.027 0.012 0.957 0.011

2 26 5.200 0.013 0.043 0.945 0.017 0.127 0.385 0.013

dHPC No statistically and biologically active matches

vmPFC No statistically and biologically active matches

NAc 2 30 242.613 0.000 0.000 0.000 0.000 0.049 0.172 0.006

Ha

ms

ter

Brain Region

df1 df2 F-test p-value Dom/Ctrl Sub/Ctrl Dom/Sub Dom/Ctrl Sub/Ctrl Dom/Sub

BLA/CeA 2 33 11.073 0.000 0.928 0.001 0.000 0.984 0.009 0.005

2 33 3.434 0.044 0.814 0.155 0.044 0.353 0.170 0.079

dHPC No statistically and biologically active matches

vmPFC No statistically and biologically active matches

NAc 2 29 3.163 0.057 0.586 0.288 0.050 0.845 0.041 0.017

2 29 5.402 0.010 0.606 0.074 0.010 0.830 0.029 0.025

39

1.5 DISCUSSION

1.5.1 The Characteristic Metabolome Associated with Social Defeat

For the first time, UPLC-HRMS based metabolomics analyses were used to

investigate the metabolic fluctuations associated with stress resistance. Metabolomics as

a field is currently at its infancy. Complications arising from biological diversity and poor

understanding of how to interpret results defines the current state of the field. There are

thousands of metabolites within a biological system, not to mention that each metabolite

can be involved within multiple metabolic pathways. These current issues present an

opportunity to discover novel aspects of biological systems. An untargeted method was

used for the current analysis, with the goal of identifying features that could lead to the

discovery of a novel biomarker. Specifically, we used a comparative approach to identify

similar metabolites that are associated with stress resistance in both models. The varying

levels of global metabolites for both mice and hamsters were analyzed using PLS-DA,

which resulted in significant clustering of subjects and separation of phenotypes. The

separation of the phenotypes in the PLS-DA plots suggests that stress-induced metabolic

fluctuations can reliably predict phenotypic responses to social defeat stress. Based on

VIP scores and Tukey’s post hoc comparisons, significant fluctuations were found in

amino acid and neurotransmitter metabolism that are associated with stress susceptibility

and resistance in both mice and hamsters.

Interestingly, both mice and hamsters that are susceptible and resistant to social

defeat stress show changes in small molecules in the NAc that modulate oxidative stress.

The relative abundance of the amino acid cystine was higher in resistant mice compared

to susceptible mice. Cystine is a critical component of the cystine-glutamate exchange,

also known as the system xc–. The uptake of cystine that results from a cystine-glutamate

exchange is important for maintaining the levels of glutathione, a critical antioxidant45-46.

Furthermore, system xc-dependent glutathione production modulates protection from

oxidative stress47. Taken together, the upregulation of cystine in resistant mice may help

protect them against defeat-induced social avoidance. In hamsters, the levels of fumarate

tended to be higher in the NAc of dominants compared to subordinates. Fumarate is an

40

intermediate in the Krebs cycle used by cells to produce energy in the form of adenosine

triphosphate (ATP). Not surprisingly, oxidative stress suppresses the Krebs cycle48.

Esterification of the unsaturated dicarbonic acid, fumarate can be enzymatically catalyzed

to form fumaric acid esters (FAEs), such as dimethyl fumarate that has been shown to

exert neuroprotective effects against neuroinflammation via activation of the Nrf2

antioxidant pathway49. Additionally, research has also shown that dimethyl fumarate

protects cells from oxidative stress50. In addition to these molecules within the NAc that

modulate oxidative stress, evidence of protection from oxidative stress was further

observed in the vmPFC of dominant hamsters. To illustrate, methionine was elevated in

dominants compared to both controls and subordinates. Methionine is an antioxidant that

has been shown to reverse the effects of oxidative stress51-53. Overall, subjects resistant

to acute social defeat had elevated levels of small molecules in the NAc and vmPFC

following social defeat that protect against oxidative stress, such as cystine, fumarate,

and methionine.

This study also revealed significant defeat-induced changes in neurotransmitters

and their precursors. In the dHPC, susceptible mice had significantly higher levels of

GABA compared to both resistant and control mice. Stress exposure has been shown to

increase GABA levels in the hippocampus. For instance, mild stressors such as novel

cage exposure and more intense stressors such as forced swimming both increase

hippocampal GABA levels54. Furthermore, microdialysis reveals increased extracellular

levels of GABA in response to novelty stress in the vHPC55. In hamsters, we found that

dominant animals had increased tyrosine concentrations in the vmPFC compared to

subordinates. Tyrosine serves as a critical precursor to catecholamines and has

antioxidant properties56-57. Rats given tyrosine before acute tail-shock displayed neither

shock induced norepinephrine depletion nor the deficits in exploratory behaviors

observed in saline-treated animals58. Similarly, pre-treatment with tyrosine not only

prevented behavioral depression and norepinephrine depletion after acute restraint stress

and intermittent tail-shock but also suppressed the rise in plasma corticosterone59.

Additionally, we found that dominant hamsters had lower serine concentrations in

the BLA/CeA compared to control hamsters. D-serine is an endogenous modulator of the

41

glycine site of NMDA receptors and functions to facilitate memory processes60-61.

Systemic administration of D-serine has been shown to enhance both object recognition

and T-maze performance62. While partial agonists at the glycine site on NMDA receptors

have been proposed as cognitive enhancers to facilitate cognitive behavioral therapy63,

systemic administration of D-serine induces oxidative stress in the rat brain64. One

possibility is that dominant animals may have less endogenous serine to bind to the

glycine site of the NMDA receptor in the BLA, which may also reduce the potential for

oxidative stress.

Finally, in the vmPFC of mice, changes were observed in molecules relate to

cellular energy consumption. More specifically, resistant mice had significantly higher

levels of IMP (inosinic acid) and AMP (adenosine monophosphate) in the vmPFC

immediately following social defeat compared to susceptible mice. AMP is produced

during adenosine triphosphate (ATP) synthesis, while IMP is generated via ATP

degradation in two metabolic pathways in which AMP is generated and then degraded to

either IMP or adenosine65. Taken together, these two molecules are indicative of

increased cellular activity in the vmPFC of resistant mice.

1.5.2 Unidentified Spectral Features Affected by Social Stress

The current state of metabolomics research is focused on the structural elucidation

of USFs from an untargeted experiment. Through this technology, the breadth of the

metabolome can be revealed but there are many steps involved with confirmation of

structure. This hypothesis driven experiment has produced thousands of USFs, which are

potential metabolites that could better explain the entire metabolome of a subject. Here,

we provided a high-throughput method for the characterization of USFs. In this

experiment, the aim was to find a reduced list of metabolites that exhibited significant

metabolic changes associated with social stress defeat and provide possible compound

matches to be evaluated in future experiments.

Preliminary annotation of USFs revealed a common trend in which several of the

compounds were related to oxidative stress. In the NAc of mice, the 274.1945 m/z at 4.7

min feature was matched to norophthalmic acid. This neurochemical was significantly

42

decreased in susceptible mice and increased in resistant mice. As a tripeptide analogue

of glutathione, norophthalmic acid has been shown to be an intracellular antioxidant. It is

known that disturbance of glutathione homeostasis either leads to or results from

oxidative stress66-67. This was particularly interesting because cystine levels in NAc of

mice were also elevated in resistant mice after social defeat. As a dimer of cysteine,

fluctuations in concentrations of this compound have a direct effect on levels of

glutathione. Because resistant mice show increased concentrations of both compounds,

it suggests that susceptible mice respond to social defeat stress with fewer essential

antioxidants which may reduce their coping ability. Also, in the BLA/CeA of hamsters, the

289.0903 m/z at 11.6 mins feature corresponded to N-acetylcarnosine (NAC). This free-

radical scavenger is a natural N-acetylated dipeptide consisting of alanine and histidine.

Carnosine derivatives have been shown to act as natural antioxidants with hydroxy

radical, singlet oxygen scavenging and lipid peroxidase properties68. Although this

compound hasn’t been associated with stress-related behavior, NAC treatment has been

shown to reduce the effects of cataracts, which are caused by oxidative stress on the

lens69. In the present study, NAC was increased in dominant hamsters, again suggesting

a potential mechanism that protects against oxidative stress.

In a separate correlation, two USF features from hamsters exhibited effects on the

efficiency of mitochondrial activity. In mammalian cells, mitochondria have been shown

to produce reactive oxygen species (ROSs) to reduce oxidative damage and contribute

to redox signaling to the nucleus70. Acetyl-L-carnitine (ALC) has a known biological

function of improving the efficiency of mitochondrial function by facilitating the movement

of acetyl CoA into the matrices71. In our study, the amount of ALC (316.1012 m/z at 11.6

min) was significantly increased in the BLA/CeA of subordinate hamsters. This

observation reveals that the cellular mitochondrial activity is being up-regulated in

subordinate hamsters after social defeat. Additionally, the NAc samples revealed a

significant decrease of relative concentration in subordinate hamsters for a set of parent

masses at 15 mins; 320.0619 m/z ([M-H]-) and 342.0441 m/z ([M+Na-2H]-). These

features both correlated to beta-citryl-L-glutamic acid (BCG), which is a derivative of

glutamate found in the developing brain of rats72. This metabolite has been shown to be

43

an iron carrier that is used to activate the enzyme aconitase73, which is used to enhance

cell viability by accelerating mitochondrial activity. Alterations to normal mitochondrial

function during stress can contribute to cell death through two mechanisms; change in

production of ROSs and release of death regulatory and signaling molecules from the

intermembrane space74-75.

Finally, preliminary annotation of unknown metabolites indicates changes in small

molecules associated with memory function. For example, in the BLA/CeA of mice, two

features (m/z, 279.0458 ([M-H]-) and 297.0563 ([M-H2O-H]-)) at 11.5 minutes revealed

the existence of the same compound, N-acetylserotonin sulfate (NAS). NAS is an

intermediate in the endogenous production of melatonin from serotonin76, and has been

shown to act as a classic antioxidant through hydrogen donation77. NAS has also been

shown to improve cognition78 and increases BDNF levels79. Interestingly, NAS has been

shown to directly activate the TrkB receptor80. TrkB, as the primary receptor for BDNF, is

critical for learning and memory related plasticity81. One possibility is that increased NAS

in susceptible mice is associated with a stronger memory of the defeat experience. This

possibility is consistent with our previous finding that inhibition of the BDNF synthesis

pathway in the BLA reduced defeat-induced social avoidance15.

Some limitations of the present study should be acknowledged. While untargeted

metabolomics provides opportunity for the discovery of novel biomarkers, large quantities

of data are produced and an agreed upon high-throughput method for structure

elucidation has not been validated. We have used statistical significance to reduce the

number of USF considered for discussion, although additional tandem MS/MS analyses

should be performed to definitively characterize novel metabolites. Additionally, this study

is limited in that it only used male subjects, which is particularly concerning given that

women are more likely to develop a stress-related mental illness82-83. Indeed, a sex bias

exists in neuroscience research84, especially within the realm of social defeat models.

One noteworthy exception can be seen in work with the California mouse (Peromyscus

californicus), a monogamous species in which both males and females aggressively

defend their home territories85. In this species, females are particularly susceptible to

social defeat compared to males, and analyses of brain activity immediately following

44

social interaction testing suggested that cellular activity in the NAc may be related to

social avoidance86. While these data suggest that the NAc may be ideally situated to study

biomarkers in females, sex-differences in stress-induced social withdrawal in the

California mouse are also associated with BDNF in the bed nucleus of the stria

terminalus87. Overall, further research is needed to characterize the stress-induced

neurochemical profiles of females.

1.6 CONCLUSION

We found that 18% of C57 mice show resistance to social avoidance following an

acute social defeat. Similarly, hamsters that have maintained dominant social status

exhibit less defeat-induced social avoidance compared to subordinates. While an analysis

of defeat-induced changes in metabolites within select brain regions indicates that the

concentrations of many small molecules differ between susceptible and resistant animals,

no single biomarker was observed in both species. However, both dominant hamsters

and resistant mice show changes in neurochemicals within similar functional classes.

Importantly, animals resistant to social defeat stress show an increased concentration of

molecules to protect against oxidative stress in the NAc and vmPFC. Overall, a

metabolomics approach to the study of stress resilience can identify functional groups of

neurochemicals that may serve as novel targets for the treatment of stress-related mental

illness.

45

1.7 REFERENCES

1. Heim, C.; Newport, D. J.; Mletzko, T.; Miller, A. H.; Nemeroff, C. B., The link between

childhood trauma and depression: insights from HPA axis studies in humans.

Psychoneuroendocrinology 2008, 33 (6), 693-710.

2. Abelson, J. L.; Khan, S.; Liberzon, I.; Young, E. A., HPA axis activity in patients with

panic disorder: review and synthesis of four studies. Depress. Anxiety 2007, 24

(1), 66-76.

3. Meewisse, M. L.; Reitsma, J. B.; de Vries, G. J.; Gersons, B. P.; Olff, M., Cortisol and

post-traumatic stress disorder in adults: systematic review and meta-analysis. Br.

J. Psychiatry 2007, 191, 387-92.

4. Charuvastra, A.; Cloitre, M., Social bonds and posttraumatic stress disorder. Annual

review of psychology 2008, 59, 301.

5. Charney, D. S., Psychobiological Mechanisms of Resilience and vulnerability:

Implications for Successful Adaptation to Extreme Stress. American Journal of

Psychiatry 2004, 161 (2), 195-216.

6. Russo, S. J.; Murrough, J. W.; Han, M. H.; Charney, D. S.; Nestler, E. J., Neurobiology

of resilience. Nature neuroscience 2012, 15 (11), 1475-84.

7. Feder, A.; Nestler, E. J.; Charney, D. S., Psychobiology and molecular genetics of

resilience. Nature reviews. Neuroscience 2009, 10 (6), 446-57.

8. Nestler, E. J.; Hyman, S. E., Animal models of neuropsychiatric disorders. Nature

neuroscience 2010, 13 (10), 1161-1169.

9. Krishnan, V.; Han, M. H.; Graham, D. L.; Berton, O.; Renthal, W.; Russo, S. J.; Laplant,

Q.; Graham, A.; Lutter, M.; Lagace, D. C.; Ghose, S.; Reister, R.; Tannous, P.;

Green, T. A.; Neve, R. L.; Chakravarty, S.; Kumar, A.; Eisch, A. J.; Self, D. W.;

Lee, F. S.; Tamminga, C. A.; Cooper, D. C.; Gershenfeld, H. K.; Nestler, E. J.,

Molecular adaptations underlying susceptibility and resistance to social defeat in

brain reward regions. Cell 2007, 131 (2), 391-404.

10. Berton, O.; McClung, C. A.; Dileone, R. J.; Krishnan, V.; Renthal, W.; Russo, S. J.;

Graham, D.; Tsankova, N. M.; Bolanos, C. A.; Rios, M.; Monteggia, L. M.; Self, D.

W.; Nestler, E. J., Essential role of BDNF in the mesolimbic dopamine pathway in

social defeat stress. Science 2006, 311 (5762), 864-8.

46

11. Meduri, J. D.; Farnbauch, L. A.; Jasnow, A. M., Paradoxical enhancement of fear

expression and extinction deficits in mice resilient to social defeat. Behavioural

brain research 2013, 256, 580-90.

12. Dulka, B. N.; Lynch Iii, J. F.; Latsko, M. S.; Mulvany, J. L.; Jasnow, A. M., Phenotypic

responses to social defeat are associated with differences in cued and contextual

fear discrimination. Behavioural Processes 2015, 118, 115-122.

13. Golden, S. A.; Covington III, H. E.; Berton, O.; Russo, S. J., A standardized protocol

for repeated social defeat stress in mice. Nature protocols 2011, 6 (8), 1183-1191.

14. Vialou, V.; Bagot, R. C.; Cahill, M. E.; Ferguson, D.; Robison, A. J.; Dietz, D. M.;

Fallon, B.; Mazei-Robison, M.; Ku, S. M.; Harrigan, E., Prefrontal cortical circuit for

depression-and anxiety-related behaviors mediated by cholecystokinin: Role of

ΔFosB. The Journal of Neuroscience 2014, 34 (11), 3878-3887.

15. Dulka, B. N.; Ford, E. C.; Lee, M. A.; Donnell, N. J.; Goode, T. D.; Prosser, R.; Cooper,

M. A., Proteolytic cleavage of proBDNF into mature BDNF in the basolateral

amygdala is necessary for defeat-induced social avoidance. Learning & memory

2016, 23 (4), 156-160.

16. Peaston, A. E.; Whitelaw, E., Epigenetics and phenotypic variation in mammals.

Mammalian Genome 2006, 17 (5), 365-374.

17. Wong, A. H.; Gottesman, I. I.; Petronis, A., Phenotypic differences in genetically

identical organisms: the epigenetic perspective. Human molecular genetics 2005,

14 (suppl 1), R11-R18.

18. Huhman, K. L.; Solomon, M. B.; Janicki, M.; Harmon, A. C.; Lin, S. M.; Israel, J. E.;

Jasnow, A. M., Conditioned defeat in male and female Syrian hamsters. Hormones

and behavior 2003, 44 (3), 293-299.

19. Kudryavtseva, N., Experience of defeat decreases the behavioural reactivity to

conspecifics in the partition test. Behavioural processes 1994, 32 (3), 297-304.

20. Meerlo, P.; Overkamp, G.; Daan, S.; Van Den Hoofdakker, R.; Koolhaas, J., Changes

in behaviour and body weight following a single or double social defeat in rats.

Stress 1996, 1 (1), 21-32.

47

21. Jasnow, A. M.; Huhman, K. L., Activation of GABA A receptors in the amygdala blocks

the acquisition and expression of conditioned defeat in Syrian hamsters. Brain

research 2001, 920 (1), 142-150.

22. Day, D. E.; Cooper, M. A.; Markham, C. M.; Huhman, K. L., NR2B subunit of the

NMDA receptor in the basolateral amygdala is necessary for the acquisition of

conditioned defeat in Syrian hamsters. Behavioural brain research 2011, 217 (1),

55-9.

23. Jasnow, A. M.; Shi, C.; Israel, J. E.; Davis, M.; Huhman, K. L., Memory of social defeat

is facilitated by cAMP response element-binding protein overexpression in the

amygdala. Behavioral neuroscience 2005, 119 (4), 1125-30.

24. Taylor, S.; Fedoroff, I. C.; Koch, W. J.; Thordarson, D. S.; Fecteau, G.; Nicki, R. M.,

Posttraumatic stress disorder arising after road traffic collisions: Patterns of

response to cognitive–behavior therapy. Journal of consulting and clinical

psychology 2001, 69 (3), 541.

25. Gray, C.; Norvelle, A.; Larkin, T.; Huhman, K., Dopamine in the nucleus accumbens

modulates the memory of social defeat in Syrian hamsters (Mesocricetus auratus).

Behavioural brain research 2015, 286, 22-28.

26. Markham, C. M.; Taylor, S. L.; Huhman, K. L., Role of amygdala and hippocampus in

the neural circuit subserving conditioned defeat in Syrian hamsters. Learning &

memory 2010, 17 (2), 109-16.

27. Markham, C. M.; Luckett, C. A.; Huhman, K. L., The medial prefrontal cortex is both

necessary and sufficient for the acquisition of conditioned defeat.

Neuropharmacology 2012, 62 (2), 933-939.

28. Morrison, K. E.; Swallows, C. L.; Cooper, M. A., Effects of dominance status on

conditioned defeat and expression of 5-HT1A and 5-HT2A receptors. Physiology

& behavior 2011, 104 (2), 283-90.

29. Morrison, K. E.; Bader, L. R.; Clinard, C. T.; Gerhard, D. M.; Gross, S. E.; Cooper, M.

A., Maintenance of dominance status is necessary for resistance to social defeat

stress in Syrian hamsters. Behavioural brain research 2014, 270, 277-86.

48

30. Morrison, K. E.; Bader, L. R.; McLaughlin, C. N.; Cooper, M. A., Defeat-induced

activation of the ventral medial prefrontal cortex is necessary for resistance to

conditioned defeat. Behavioural brain research 2013, 243, 158-64.

31. Yehuda, R.; Neylan, T. C.; Flory, J. D.; McFarlane, A. C., The use of biomarkers in

the military: From theory to practice. Psychoneuroendocrinology 2013, 38 (9),

1912-1922.

32. Zoladz, P. R.; Diamond, D. M., Current status on behavioral and biological markers

of PTSD: a search for clarity in a conflicting literature. Neuroscience &

Biobehavioral Reviews 2013, 37 (5), 860-895.

33. Baker, D. G.; Nievergelt, C. M.; O'Connor, D. T., Biomarkers of PTSD: neuropeptides

and immune signaling. Neuropharmacology 2012, 62 (2), 663-673.

34. Griffiths, W.; Karu, K.; Hornshaw, M.; Woffendin, G.; Wang, Y., Metabolomics and

metabolite profiling: past heroes and future developments. European Journal of

Mass Spectrometry 2007, 13 (1), 45-50.

35. Oldiges, M.; Lütz, S.; Pflug, S.; Schroer, K.; Stein, N.; Wiendahl, C., Metabolomics:

current state and evolving methodologies and tools. Appl Microbiol Biotechnol

2007, 76 (3), 495-511.

36. Kaddurah-Daouk, R.; Kristal, B. S.; Weinshilboum, R. M., Metabolomics: a global

biochemical approach to drug response and disease. Annu Rev Pharmacol Toxicol

2008, 48, 653-83.

37. McCann, K. E.; Bicknese, C. N.; Norvelle, A.; Huhman, K. L., Effects of inescapable

versus escapable social stress in Syrian hamsters: the importance of stressor

duration versus escapability. Physiology & behavior 2014, 129, 25-9.

38. Clinard, C. T.; Bader, L. R.; Sullivan, M. A.; Cooper, M. A., Activation of 5-HT2a

receptors in the basolateral amygdala promotes defeat-induced anxiety and the

acquisition of conditioned defeat in Syrian hamsters. Neuropharmacology 2015,

90, 102-12.

39. Lu, W.; Clasquin, M. F.; Melamud, E.; Amador-Noguez, D.; Caudy, A. A.; Rabinowitz,

J. D., Metabolomic Analysis via Reversed-Phase Ion-Pairing Liquid

Chromatography Coupled to a Stand Alone Orbitrap Mass Spectrometer.

Analytical Chemistry 2010, 82 (8), 3212-3221.

49

40. Melamud, E.; Vastag, L.; Rabinowitz, J. D., Metabolomic analysis and visualization

engine for LC− MS data. Analytical chemistry 2010, 82 (23), 9818-9826.

41. Altmaier, E.; Ramsay, S. L.; Graber, A.; Mewes, H.-W.; Weinberger, K. M.; Suhre, K.,

Bioinformatics Analysis of Targeted Metabolomics—Uncovering Old and New

Tales of Diabetic Mice under Medication. Endocrinology 2008, 149 (7), 3478-3489.

42. Suhre, K.; Shin, S.-Y.; Petersen, A.-K.; Mohney, R. P.; Meredith, D.; Wagele, B.;

Altmaier, E.; CardioGram; Deloukas, P.; Erdmann, J.; Grundberg, E.; Hammond,

C. J.; de Angelis, M. H.; Kastenmuller, G.; Kottgen, A.; Kronenberg, F.; Mangino,

M.; Meisinger, C.; Meitinger, T.; Mewes, H.-W.; Milburn, M. V.; Prehn, C.; Raffler,

J.; Ried, J. S.; Romisch-Margl, W.; Samani, N. J.; Small, K. S.; Erich Wichmann,

H.; Zhai, G.; Illig, T.; Spector, T. D.; Adamski, J.; Soranzo, N.; Gieger, C., Human

metabolic individuality in biomedical and pharmaceutical research. Nature 2011,

477 (7362), 54-60.

43. Xia, J.; Psychogios, N.; Young, N.; Wishart, D. S., MetaboAnalyst: a web server for

metabolomic data analysis and interpretation. Nucleic Acids Research 2009, 37

(Web Server issue), W652-W660.

44. Wishart, D. S.; Jewison, T.; Guo, A. C.; Wilson, M.; Knox, C.; Liu, Y.; Djoumbou, Y.;

Mandal, R.; Aziat, F.; Dong, E.; Bouatra, S.; Sinelnikov, I.; Arndt, D.; Xia, J.; Liu,

P.; Yallou, F.; Bjorndahl, T.; Perez-Pineiro, R.; Eisner, R.; Allen, F.; Neveu, V.;

Greiner, R.; Scalbert, A., HMDB 3.0—The Human Metabolome Database in 2013.

Nucleic Acids Research 2013, 41 (D1), D801-D807.

45. Bridges, R.; Lutgen, V.; Lobner, D.; Baker, D. A., Thinking outside the cleft to

understand synaptic activity: contribution of the cystine-glutamate antiporter

(system xc−) to normal and pathological glutamatergic signaling. Pharmacological

reviews 2012, 64 (3), 780-802.

46. Reissner, K. J., The cystine/glutamate antiporter: when too much of a good thing goes

bad. The Journal of clinical investigation 2014, 124 (8), 3279.

47. Shih, A. Y.; Erb, H.; Sun, X.; Toda, S.; Kalivas, P. W.; Murphy, T. H.,

Cystine/glutamate exchange modulates glutathione supply for neuroprotection

from oxidative stress and cell proliferation. The Journal of neuroscience 2006, 26

(41), 10514-10523.

50

48. Tretter, L.; Adam-Vizi, V., Inhibition of Krebs cycle enzymes by hydrogen peroxide: a

key role of α-ketoglutarate dehydrogenase in limiting NADH production under

oxidative stress. The Journal of Neuroscience 2000, 20 (24), 8972-8979.

49. Linker, R. A.; Lee, D.-H.; Ryan, S.; van Dam, A. M.; Conrad, R.; Bista, P.; Zeng, W.;

Hronowsky, X.; Buko, A.; Chollate, S., Fumaric acid esters exert neuroprotective

effects in neuroinflammation via activation of the Nrf2 antioxidant pathway. Brain

2011, 134 (3), 678-692.

50. Albrecht, P.; Bouchachia, I.; Goebels, N.; Henke, N.; Hofstetter, H. H.; Issberner, A.;

Kovacs, Z.; Lewerenz, J.; Lisak, D.; Maher, P., Effects of dimethyl fumarate on

neuroprotection and immunomodulation. J Neuroinflammation 2012, 9 (163),

2094-9.

51. Patra, R.; Swarup, D.; Dwivedi, S., Antioxidant effects of α tocopherol, ascorbic acid

and L-methionine on lead induced oxidative stress to the liver, kidney and brain in

rats. Toxicology 2001, 162 (2), 81-88.

52. Nandi, D.; Patra, R.; Swarup, D., Effect of cysteine, methionine, ascorbic acid and

thiamine on arsenic-induced oxidative stress and biochemical alterations in rats.

Toxicology 2005, 211 (1), 26-35.

53. Luo, S.; Levine, R. L., Methionine in proteins defends against oxidative stress. The

FASEB Journal 2009, 23 (2), 464-472.

54. De Groote, L.; Linthorst, A., Exposure to novelty and forced swimming evoke stressor-

dependent changes in extracellular GABA in the rat hippocampus. Neuroscience

2007, 148 (3), 794-805.

55. Bianchi, L.; Ballini, C.; Colivicchi, M.; Della Corte, L.; Giovannini, M.; Pepeu, G.,

Investigation on acetylcholine, aspartate, glutamate and GABA extracellular levels

from ventral hippocampus during repeated exploratory activity in the rat.

Neurochem Res 2003, 28 (3-4), 565-573.

56. Yen, G.-C.; Hsieh, C.-L., Antioxidant effects of dopamine and related compounds.

Bioscience, biotechnology, and biochemistry 1997, 61 (10), 1646-1649.

57. Gülçin, I., Comparison of in vitro antioxidant and antiradical activities of L-tyrosine and

L-Dopa. Amino acids 2007, 32 (3), 431-438.

51

58. Reinstein, D. K.; Lehnert, H.; Scott, N. A.; Wurtman, R. J., Tyrosine prevents

behavioral and neurochemical correlates of an acute stress in rats. Life sciences

1984, 34 (23), 2225-2231.

59. Reinstein, D. K.; Lehnert, H.; Wurtman, R. J., Dietary tyrosine suppresses the rise in

plasma corticosterone following acute stress in rats. Life sciences 1985, 37 (23),

2157-2163.

60. Mothet, J.-P.; Parent, A. T.; Wolosker, H.; Brady, R. O.; Linden, D. J.; Ferris, C. D.;

Rogawski, M. A.; Snyder, S. H., D-serine is an endogenous ligand for the glycine

site of the N-methyl-D-aspartate receptor. Proceedings of the National Academy

of Sciences 2000, 97 (9), 4926-4931.

61. Collingridge, G. L.; Volianskis, A.; Bannister, N.; France, G.; Hanna, L.; Mercier, M.;

Tidball, P.; Fang, G.; Irvine, M. W.; Costa, B. M., The NMDA receptor as a target

for cognitive enhancement. Neuropharmacology 2013, 64, 13-26.

62. Bado, P.; Madeira, C.; Vargas-Lopes, C.; Moulin, T. C.; Wasilewska-Sampaio, A. P.;

Maretti, L.; de Oliveira, R. V.; Amaral, O. B.; Panizzutti, R., Effects of low-dose D-

serine on recognition and working memory in mice. Psychopharmacology 2011,

218 (3), 461-470.

63. Davis, M.; Ressler, K.; Rothbaum, B. O.; Richardson, R., Effects of D-cycloserine on

extinction: translation from preclinical to clinical work. Biological psychiatry 2006,

60 (4), 369-375.

64. Armagan, G.; Kanıt, L.; Yalcin, A., D-serine treatment induces oxidative stress in rat

brain. Drug and chemical toxicology 2011, 34 (2), 129-138.

65. Seki, H.; Nakazato, K.; Hamada-Sato, N., Adenosine monophosphate degradation

and inosinic acid accumulation in the shrimp Penaeus japonicus. International

Aquatic Research 2017, 9 (1), 37.

66. Gonçalves, L.; Dafre, A. L.; Carobrez, S. G.; Gasparotto, O. C., A temporal analysis

of the relationships between social stress, humoral immune response and

glutathione-related antioxidant defenses. Behavioural brain research 2008, 192

(2), 226-231.

52

67. Schulz, J. B.; Lindenau, J.; Seyfried, J.; Dichgans, J., Glutathione, oxidative stress

and neurodegeneration. European Journal of Biochemistry 2000, 267 (16), 4904-

4911.

68. Babizhayev, M. A.; Seguin, M. C.; Gueyne, J.; Evstigneeva, R. P.; Ageyeva, E. A.;

Zheltukhina, G. A., L-carnosine (β-alanyl-L-histidine) and carcinine (β-

alanylhistamine) act as natural antioxidants with hydroxyl-radical-scavenging and

lipid-peroxidase activities. Biochemical Journal 1994, 304 (2), 509-516.

69. Babizhayev, M. A.; Deyev, A. I.; Yermakova, V. N.; Semiletov, Y. A.; Davydova, N.

G.; Kurysheva, N. I.; Zhukotskii, A. V.; Goldman, I. M., N-Acetylcarnosine, a natural

histidine-containing dipeptide, as a potent ophthalmic drug in treatment of human

cataracts. Peptides 2001, 22 (6), 979-994.

70. Murphy, Michael P., How mitochondria produce reactive oxygen species. Biochemical

Journal 2009, 417 (Pt 1), 1-13.

71. Wutzke, K. D.; Lorenz, H., The effect of l-carnitine on fat oxidation, protein turnover,

and body composition in slightly overweight subjects. Metabolism 2004, 53 (8),

1002-1006.

72. Miyake, M.; Kakimoto, Y.; Sorimachi, M., Isolation and identification of β-citryl-L-

glutamic acid from newborn rat brain. Biochimica et Biophysica Acta (BBA)-

General Subjects 1978, 544 (3), 656-666.

73. Hamada-Kanazawa, M.; Narahara, M.; Takano, M.; Min, K. S.; Tanaka, K.; Miyake,

M., &beta;-Citryl-<small>L</small>-glutamate Acts as an Iron Carrier to Activate

Aconitase Activity. Biological and Pharmaceutical Bulletin 2011, 34 (9), 1455-

1464.

74. García-Ruiz, C.; Colell, A.; Morales, A.; Kaplowitz, N.; Fernández-Checa, J. C., Role

of oxidative stress generated from the mitochondrial electron transport chain and

mitochondrial glutathione status in loss of mitochondrial function and activation of

transcription factor nuclear factor-kappa B: studies with isolated mitochondria and

rat hepatocytes. Molecular Pharmacology 1995, 48 (5), 825-834.

75. Ouyang, Y.-B.; Giffard, R. G., Changes in astrocyte mitochondrial function with stress:

effects of Bcl-2 family proteins. Neurochemistry International 2004, 45 (2–3), 371-

379.

53

76. Weissbach, H.; Redfield, B. G.; Axelrod, J., Biosynthesis of melatonin: enzymic

conversion of serotonin to N-acetylserotonin. Biochimica et biophysica acta 1960,

43, 352-353.

77. Barsacchi, R.; Kusmic, C.; Damiani, E.; Carloni, P.; Greci, L.; Donato, L., Vitamin E

Consumption Induced by Oxidative Stress in Red Blood Cells Is Enhanced by

Melatonin and Reduced by N-Acetylserotonin. Free Radical Biology and Medicine

1998, 24 (7–8), 1187-1192.

78. Alvarez-Diduk, R. n.; Galano, A.; Tan, D. X.; Reiter, R. J., N-Acetylserotonin and 6-

hydroxymelatonin against oxidative stress: Implications for the overall protection

exerted by melatonin. The Journal of Physical Chemistry B 2015, 119 (27), 8535-

8543.

79. Yoo, D. Y.; Nam, S. M.; Kim, W.; Lee, C. H.; Won, M.-H.; Hwang, I. K.; Yoon, Y. S.,

N-acetylserotonin increases cell proliferation and differentiating neuroblasts with

tertiary dendrites through upregulation of brain-derived neurotrophic factor in the

mouse dentate gyrus. Journal of Veterinary Medical Science 2011, 73 (11), 1411-

1416.

80. Jang, S.-W.; Liu, X.; Pradoldej, S.; Tosini, G.; Chang, Q.; Iuvone, P. M.; Ye, K., N-

acetylserotonin activates TrkB receptor in a circadian rhythm. Proceedings of the

National Academy of Sciences 2010, 107 (8), 3876-3881.

81. Minichiello, L., TrkB signalling pathways in LTP and learning. Nature Reviews

Neuroscience 2009, 10 (12), 850-860.

82. Kessler, R. C., Epidemiology of women and depression. Journal of affective disorders

2003, 74 (1), 5-13.

83. Bekker, M. H.; van Mens-Verhulst, J., Anxiety disorders: sex differences in

prevalence, degree, and background, but gender-neutral treatment. Gender

medicine 2007, 4, S178-S193.

84. Beery, A. K.; Zucker, I., Sex bias in neuroscience and biomedical research.

Neuroscience & Biobehavioral Reviews 2011, 35 (3), 565-572.

85. Ribble, D. O.; Salvioni, M., Social organization and nest co-occupancy in Peromyscus

californicus, a monogamous rodent. Behavioral Ecology and Sociobiology 1990,

26 (1), 9-15.

54

86. Trainor, B. C., Stress responses and the mesolimbic dopamine system: social

contexts and sex differences. Hormones and behavior 2011, 60 (5), 457-469.

87. Greenberg, G. D.; Laman-Maharg, A.; Campi, K. L.; Voigt, H.; Orr, V. N.; Schaal, L.;

Trainor, B. C., Sex differences in stress-induced social withdrawal: role of brain

derived neurotrophic factor in the bed nucleus of the stria terminalis. Frontiers in

behavioral neuroscience 2013, 7.

88. Rabinowitz, J. D.; Kimball, E., Acidic Acetonitrile for Cellular Metabolome Extraction

from Escherichia coli. Analytical Chemistry 2007, 79 (16), 6167-6173.

89. Martens, L.; Chambers, M.; Sturm, M.; Kessner, D.; Levander, F.; Shofstahl, J.; Tang,

W. H.; Römpp, A.; Neumann, S.; Pizarro, A. D., mzML—a community standard for

mass spectrometry data. Molecular & Cellular Proteomics 2011, 10 (1), R110.

000133.

90. Chambers, M. C.; Maclean, B.; Burke, R.; Amodei, D.; Ruderman, D. L.; Neumann,

S.; Gatto, L.; Fischer, B.; Pratt, B.; Egertson, J., A cross-platform toolkit for mass

spectrometry and proteomics. Nature biotechnology 2012, 30 (10), 918-920.

91. Saldanha, A. J., Java Treeview—extensible visualization of microarray data.

Bioinformatics 2004, 20 (17), 3246-3248.

92. Wold, S.; Sjöström, M.; Eriksson, L., PLS-regression: a basic tool of chemometrics.

Chemometrics and intelligent laboratory systems 2001, 58 (2), 109-130.

93. Racine, J. S., RStudio: A Platform-Independent IDE for R and Sweave. Journal of

Applied Econometrics 2012, 27 (1), 167-172.

55

1.8 APPENDIX

1.8.1 Supplemental Methods and Materials

Extraction Protocol

Samples were transferred from a -80 °C freezer to a 5 °C cold room, where they were left

to thaw for 20 minutes. The samples were then extracted using a modified acidic

acetonitrile protocol88. To the tissue punches, 500 μL of extraction solvent (40:40:20

acetonitrile/methanol/water containing 0.1 M formic acid) was added and the mixture was

transferred to -20 °C for 20 minutes. The samples were then centrifuged for 5 minutes at

13,000 rpm and the resulting supernatant was collected. Pellets were washed twice with

100 μL aliquots of extraction solvent. The combined supernatants were then dried under

nitrogen, followed by resuspension with 150 μL of Millipore water.

UPLC-HRMS

Analysis by UPLC-HRMS was completed using an ultimate 3000 LC pump coupled with

an Exactive Plus Orbitrap MS (Thermo Fisher Scientific, Waltham, MA). All solvents were

HPLC grade and purchased from Fisher Scientific (Atlanta, GA). The mobile phases,

solvent A (97:3 water:methanol containing 10 mM tributylamine, and 15 mM acetic acid)

and solvent B (methanol), were set to use a multi-step gradient as follows; 0 to 5 min, 0%

B; 5 to 13 min, 20% B; 13 to 15.5 min, 55% B; 15.5 to 19 min, 95% B; and 19 to 25 min,

0% B. With a flow rate of 200 μL/min, a 10 μL aliquot of sample was injected through a

Synergi 2.5 μm Hydro-RP 100, 100 x 2.0 mm LC column (Phenomenex) maintained at

25 °C. While running full scan in negative mode, the eluent was introduced to the MS by

an electrospray ionization source39. Samples were analyzed with a resolving power of

140,000 and a scan window of 72 to 800 m/z from 0 to 9 min, and 100 to 1,000 m/z from

9 to 25 min. Samples were injected in a randomized order to reduce instrumental error.

Data Processing

Raw files generated by the Xcaliber software (Thermo Fisher Scientific) were converted

to an open source format, mxML89, via the open source MSConvert software, which is

part of the ProteoWizard package90. The converted files were then uploaded into the

56

Metabolomic Analysis and Visualization Engine (MAVEN) software, which automatically

adjusts the total ion chromatograms based on retention times for each sample40. Using

MAVEN40, metabolites were selected from a pre-existing list of 270 known compounds

with annotated biological activity. All retention times were previously validated for exact

mass and retention time using chemical standards from Fisher Scientific or preexisting

chromatography39. Integration of the area under the curve provided each metabolite with

a total ion count that can be considered the relative concentration of the metabolite within

a single sample.

Internal Ratio Normalization (IRN)

By assuming that intensity ratios within a sample are consistent across all metabolites,

an internal ratio can be used to normalize the data in an attempt to reduce instrumental

and technical variability. This technique constructs a correlation type matrix for each

sample, which is composed of the individual ratios across every metabolite within the

sample. These generated matrices are then averaged among replicates, followed by

comparison between treatments. Using the IRN R script (https://irn-

access:bu609campagna@gitlab.com/irn/irn.git), the data were normalized to produce

fold change and p-values across experimental comparisons. These normalized values

were used to produce the heatmap figures for known metabolites. The discussed IRN

script is currently in submission for publication.

Heatmaps

The fold-change data, after IRN, were log 2 transformed and clustered by average linkage

using Cluster software, version 3.0 (Eisen Lab, Berkeley, CA). This data was then

displayed in a heatmap generated by Java Treeview software91. Using a saturated color

scale ranging from +3 (red) to -3 (blue), visual comparison of concentration changes can

be observed. The two array comparisons are listed above each column on the heatmap.

Each cell has been overlaid with a symbol representing a specific p-value range (≤ 0.01

– “***”; ≤ 0.05 – “**”; ≤ 0.1 – “*”).

57

Partial least squares discriminant analysis (PLS-DA)

Within the field of metabolomics, a widely accepted statistical tool used to confirm

variation among variables is PLS-DA. As a two-dimensional, multivariate linear regression

model, PLS-DA finds the direction of maximum covariance between a data set (X) and

the class (Y)92. The original variables are compressed into fewer variables by using their

weighted averages, referred to as scores.

Following compilation of all spectral features detected (includes both identified and

unidentified spectral features), the grouped data was loaded into RStudio93. To generate

the PLS-DA data, the DiscriMiner package was utilized and specifically the PLS-DA

function. All data were normalized by using an auto-scaling method that attempts to scale

and center the data by dividing each value by the metabolites standard deviation. By

extracting the PLS-DA scores values, the visualization aid was generated using the ggplot

package with a 95% confidence interval. Variable importance projection (VIP) score plots

were also generated from the plsDA function of DiscriMiner. These VIP plots only

represent the identified spectral features to facilitate interpretation.

Identification and Statistical Reduction of USFs

The MAVEN software includes a peak picking algorithm that generates a list of all spectral

features detected by the HRMS in a single sample. A user generated training model

establishes a quality score for each peak, which enables the software to identify

thousands of USFs from each sample. All peaks were confirmed manually to have a

proper Gaussian curve, 3:1 signal-to-blank, and an ion count greater than 103.

Next, the lists were reduced using Student’s t-tests for three separate array comparisons;

resistant vs. control, susceptible vs. control, and resistant vs. susceptible for mice or

dominant vs. control, subordinate vs. control, and dominant vs. subordinate for hamsters.

Using this statistical tool dramatically reduces the overall number of identified metabolites,

which are then manually investigated to remove any “known metabolites” that were

previously identified, as well as any carbon-13 isomers.

58

Finally, the web-based statistical analysis tools of Metaboanalyst43 were used to focus on

a small number of these USFs. Through cross comparison of the variable importance

projection (VIP) score plots generated from the PLS-DA and the mean decrease in

accuracy (MDA) plots from the random forest classification, a reduced list of ~30

important USFs were extrapolated and used for additional investigation. By viewing Table

1-1, the specific quantities of USFs after each step can be observed for each brain region.

Statistical Analysis

Data were analyzed using one-way ANOVAs followed by Tukey post-hocs and Student’s

t-tests, where appropriate. Statistical significance was set at α = 0.05. Data are reported

as mean ± SEM, except where noted. Statistical reduction of USFs was accomplished

using Student’s t-tests (p ≤ 0.05) and VIP score (≥ 1.0) and metabolites selected for

further discussion were confirmed to be significant through one-way ANOVA analysis and

Tukey’s post hoc tests.

1.8.2 Raw data files

The following tables are raw ion intensities from both hamsters and mice.

59

Table 1.3 Raw Data of Dominant Hamsters from BLA/CeA

Sample Name H2 H3 H4 H5 H12 H19 H21 H25 H28 H33 H38 H47

2-Aminoadipate 2.83E+04 3.80E+04 7.77E+04 4.72E+04 7.24E+04 7.44E+03 6.26E+03 6.53E+04 4.32E+04 6.97E+04 9.07E+04 6.60E+04 2-Hydroxy-2-methylsuccinate 2.15E+05 4.01E+05 8.34E+05 4.07E+05 7.14E+05 4.01E+05 3.59E+05 5.86E+05 2.58E+05 7.12E+05 8.64E+05 6.60E+05

3-Methoxytyramine 9.51E+04 1.29E+05 1.15E+05 1.01E+05 1.12E+05 1.41E+05 1.45E+05 1.18E+05 1.32E+05 1.15E+05 1.26E+05 1.11E+05 3_4-Dihydroxyphenylacetate 8.78E+04 5.68E+04 6.02E+04 5.89E+04 9.65E+04 7.66E+04 8.87E+04 7.09E+04 1.23E+05 7.88E+04 1.99E+05 3.45E+04

4-Aminobutyrate 6.48E+05 9.99E+05 8.53E+05 8.59E+05 1.56E+06 1.61E+06 1.64E+06 1.43E+06 1.75E+06 2.00E+06 1.82E+06 1.38E+06 5-Hydroxyindoleacetic acid 4.49E+04 3.20E+04 3.98E+04 1.42E+04 7.29E+04 4.19E+04 4.33E+04 4.34E+04 6.85E+04 9.16E+04 4.21E+04 4.13E+04

6-Phospho-D-gluconate 1.60E+05 1.74E+05 1.80E+05 1.72E+05 4.67E+03 7.70E+03 7.85E+03 1.17E+05 9.13E+03 3.49E+03 8.78E+04 1.08E+05

Acadesine 2.99E+03 5.57E+03 9.27E+03 1.09E+04 9.53E+03 1.77E+04 1.64E+04 2.33E+04 1.49E+04 1.01E+04 2.29E+04 1.82E+04

Aconitate 1.68E+04 1.80E+04 1.35E+04 4.62E+04 1.24E+03 1.27E+03 1.44E+03 1.52E+05 1.62E+03 3.51E+03 8.95E+03 1.10E+04

Adenine 1.26E+05 3.52E+05 3.66E+04 1.10E+05 1.08E+05 2.15E+04 3.86E+04 1.47E+05 1.05E+05 6.58E+05 2.56E+05 2.49E+05

Adenosine 2.38E+05 5.83E+05 5.12E+04 2.23E+05 1.76E+05 3.20E+04 6.65E+04 2.76E+05 1.78E+05 8.67E+05 4.63E+05 3.72E+05

AICAR 1.87E+04 2.23E+04 3.46E+04 2.96E+04 6.86E+04 5.42E+04 4.87E+04 3.77E+04 5.14E+04 1.10E+05 9.13E+04 7.20E+04

Alanine 1.09E+06 1.67E+06 2.77E+06 2.02E+06 2.69E+06 2.62E+06 2.44E+06 2.92E+06 2.33E+06 2.76E+06 2.95E+06 2.48E+06

Allantoin 3.45E+03 5.95E+03 9.66E+03 1.57E+04 1.17E+04 6.78E+03 2.13E+04 3.83E+03 7.75E+03 1.12E+04 8.99E+03 7.26E+03

alpha-Ketoglutarate 7.92E+03 2.88E+04 1.56E+04 2.56E+04 1.32E+04 8.81E+03 8.75E+03 1.76E+04 7.93E+03 1.44E+04 2.42E+04 2.87E+04

AMP 2.03E+06 2.52E+06 3.70E+06 3.44E+06 3.67E+06 2.77E+06 2.14E+06 3.25E+06 2.68E+06 2.21E+06 3.33E+06 4.27E+06

Arginine 2.75E+03 2.66E+03 4.35E+03 6.53E+03 1.80E+04 8.12E+03 1.64E+04 1.44E+04 1.63E+04 2.23E+04 1.62E+04 6.36E+03

Ascorbate 7.39E+06 1.53E+07 2.28E+07 1.94E+07 2.18E+07 8.61E+05 5.63E+06 2.43E+07 1.50E+07 2.38E+07 4.31E+07 3.96E+07

Asparagine 1.21E+05 9.83E+04 1.00E+05 1.22E+05 1.60E+05 1.43E+05 1.11E+05 1.63E+05 1.54E+05 1.85E+05 1.63E+05 1.70E+05

Aspartate 4.67E+06 6.22E+06 8.70E+06 9.01E+06 1.04E+07 7.67E+06 6.18E+06 1.07E+07 9.18E+06 1.02E+07 1.07E+07 8.97E+06

Atrolactic acid 5.94E+04 4.51E+04 8.15E+04 5.25E+04 2.04E+05 1.06E+05 1.97E+05 4.42E+04 1.48E+05 2.82E+04 5.56E+04 4.55E+04

cAMP 3.46E+04 3.63E+04 3.39E+04 2.77E+04 2.26E+04 2.60E+04 3.06E+04 3.54E+04 1.85E+04 1.95E+04 3.14E+04 3.99E+04

CDP-ethanolamine 1.00E+05 1.16E+05 1.17E+05 1.14E+05 1.87E+05 8.83E+04 1.11E+05 1.28E+05 1.53E+05 1.71E+05 1.60E+05 1.45E+05

Citrate/isocitrate 2.26E+04 2.23E+04 3.04E+04 4.47E+04 3.28E+03 7.64E+03 1.06E+04 8.58E+04 7.34E+03 1.58E+04 5.12E+04 9.33E+04

Citrulline 4.10E+04 4.11E+04 6.30E+04 3.45E+04 1.21E+05 1.34E+05 9.25E+04 8.61E+04 9.72E+04 1.41E+05 1.20E+05 1.21E+05

CMP 1.94E+04 3.06E+04 6.65E+04 3.43E+04 7.05E+04 3.18E+04 4.58E+04 3.91E+04 4.33E+04 3.37E+04 5.00E+04 4.59E+04

Creatine 1.30E+06 1.61E+06 3.90E+06 2.44E+06 3.41E+06 3.52E+06 3.20E+06 4.28E+06 2.96E+06 3.74E+06 3.50E+06 3.48E+06

Creatinine 1.67E+04 1.64E+04 3.58E+04 1.59E+04 2.72E+04 3.20E+04 2.01E+04 4.42E+04 2.59E+04 3.59E+04 3.67E+04 3.03E+04

Cystathionine 6.98E+04 5.65E+04 1.55E+05 8.88E+04 2.03E+05 1.96E+05 1.75E+05 1.18E+05 1.63E+05 2.47E+05 1.89E+05 2.00E+05

Cysteine 1.59E+04 4.14E+04 6.78E+04 4.00E+04 1.77E+05 3.77E+04 4.37E+04 8.28E+04 2.27E+05 1.47E+05 1.23E+05 9.88E+04

Cystine 1.45E+03 4.92E+03 8.69E+03 4.61E+03 2.23E+04 3.35E+05 3.67E+05 4.82E+03 2.94E+04 4.81E+04 3.92E+03 7.50E+03

60

Table 1.3 Continued

Sample Name H2 H3 H4 H5 H12 H19 H21 H25 H28 H33 H38 H47

Cytidine 4.26E+04 5.68E+04 6.44E+04 9.74E+04 1.32E+05 1.21E+05 8.80E+04 1.47E+05 7.31E+04 1.34E+05 1.21E+05 1.02E+05

D-Gluconate 2.13E+05 8.35E+04 1.28E+05 1.51E+05 1.17E+05 1.44E+05 1.18E+05 1.86E+05 8.31E+04 1.42E+05 1.00E+05 1.07E+05 D-Glyceraldehdye 3-phosphate 1.74E+05 3.79E+05 2.96E+05 3.17E+05 3.16E+05 3.69E+05 1.46E+05 4.59E+05 2.21E+05 1.09E+05 2.14E+05 4.39E+05

Diiodothyronine 1.48E+05 1.48E+05 2.89E+05 3.08E+05 7.92E+05 6.14E+05 8.05E+05 2.97E+05 5.80E+05 1.02E+06 8.33E+05 9.21E+05

Dimethylglycine 6.48E+05 9.99E+05 8.53E+05 8.59E+05 1.56E+06 1.61E+06 1.64E+06 1.43E+06 1.75E+06 2.00E+06 1.82E+06 1.38E+06

Fumarate 1.07E+05 2.98E+05 4.14E+05 2.92E+05 8.11E+05 3.91E+05 3.46E+05 4.30E+05 5.77E+05 7.55E+05 3.95E+05 4.11E+05

Glucose 1-phosphate 1.60E+05 1.92E+05 8.57E+04 1.39E+05 2.35E+05 2.14E+05 2.92E+05 2.57E+05 2.71E+05 3.61E+05 2.70E+05 2.41E+05

Glucose 6-phosphate 2.78E+05 1.46E+05 1.09E+05 1.31E+05 1.63E+05 1.90E+05 1.68E+05 1.40E+05 1.55E+05 1.19E+05 1.85E+05 4.55E+05

Glutamate 7.71E+07 9.21E+07 1.07E+08 1.19E+08 1.06E+08 3.13E+07 3.37E+07 1.21E+08 8.42E+07 1.10E+08 1.31E+08 1.16E+08

Glutamine 1.96E+07 2.33E+07 2.32E+07 2.25E+07 3.89E+07 3.54E+07 3.56E+07 2.80E+07 3.20E+07 4.22E+07 3.46E+07 3.88E+07

Glutathione 8.93E+06 1.35E+07 1.59E+07 1.36E+07 1.39E+07 6.43E+06 7.60E+06 1.53E+07 1.17E+07 1.10E+07 1.94E+07 1.82E+07

Glutathione disulfide 1.13E+05 8.14E+04 4.27E+04 6.84E+04 2.72E+05 1.97E+05 2.41E+05 9.70E+04 2.30E+05 8.73E+05 8.58E+04 9.24E+04

Glycerate 3.57E+05 1.08E+05 1.23E+05 1.75E+05 6.78E+04 2.12E+05 1.56E+05 8.01E+05 9.18E+04 8.66E+04 9.98E+04 1.28E+05

Glycerone phosphate 1.74E+05 3.79E+05 2.96E+05 3.17E+05 3.16E+05 3.69E+05 1.46E+05 4.59E+05 2.21E+05 1.09E+05 2.14E+05 4.39E+05

GMP 1.31E+05 1.99E+05 2.30E+05 2.33E+05 4.58E+05 3.61E+05 4.16E+05 3.14E+05 3.37E+05 3.73E+05 3.09E+05 3.34E+05

Guanine 5.83E+03 5.55E+03 1.06E+04 8.05E+03 9.53E+03 1.29E+04 1.06E+04 8.40E+03 1.10E+04 1.62E+04 1.13E+04 1.72E+04

Guanosine 2.70E+05 4.93E+05 1.26E+05 1.28E+05 4.66E+05 2.31E+05 3.33E+05 3.83E+05 6.79E+05 1.14E+06 5.33E+05 3.30E+05

Histidine 7.29E+03 5.73E+03 1.29E+04 8.74E+03 3.03E+04 2.61E+04 3.55E+04 8.19E+03 2.93E+04 5.52E+04 2.23E+04 2.35E+04

Homocysteic acid 1.64E+04 2.56E+04 2.39E+04 1.33E+04 2.29E+04 6.36E+02 6.23E+03 2.35E+04 2.06E+04 2.10E+04 2.39E+04 1.51E+04

Homoserine 4.27E+05 6.29E+05 6.85E+05 7.64E+05 7.45E+05 1.04E+06 8.91E+05 1.03E+06 1.02E+06 1.13E+06 8.88E+05 1.16E+06

Homovanillic acid 8.18E+04 7.50E+04 7.80E+04 9.84E+04 8.92E+04 3.76E+04 3.27E+04 8.47E+04 7.56E+04 1.04E+05 1.04E+05 8.62E+04

Hydroxybenzoate 5.70E+04 2.71E+04 7.98E+04 2.45E+04 2.28E+04 2.35E+04 2.34E+04 2.09E+04 2.69E+04 1.17E+04 1.60E+04 9.24E+03

Hydroxyisocaproic acid 2.82E+05 2.53E+05 2.85E+05 2.86E+05 2.07E+05 1.50E+05 1.81E+05 4.63E+05 1.69E+05 9.94E+04 4.34E+05 4.62E+05

Hydroxyphenylpyruvate 4.82E+04 4.84E+04 4.07E+04 4.86E+04 4.46E+04 3.89E+04 9.67E+04 4.65E+04 4.28E+04 5.11E+04 4.57E+04 5.19E+04

Hypoxanthine 5.52E+05 5.46E+05 6.52E+05 2.44E+05 1.71E+06 1.40E+06 1.18E+06 1.08E+06 1.62E+06 1.70E+06 9.73E+05 9.23E+05

IMP 1.34E+05 1.13E+05 1.68E+05 1.43E+05 5.77E+05 3.18E+05 4.49E+05 3.20E+05 4.37E+05 4.44E+05 3.10E+05 1.78E+05

Indole-3-carboxylate 4.25E+03 2.32E+03 4.11E+03 2.34E+03 2.61E+03 3.20E+03 2.05E+03 2.67E+04 1.73E+03 4.16E+03 5.31E+03 1.83E+03

Inosine 2.67E+06 2.18E+06 2.31E+06 1.39E+06 4.81E+06 4.59E+06 5.53E+06 3.36E+06 5.56E+06 6.45E+06 4.06E+06 2.93E+06

Lactate 5.79E+07 6.38E+07 8.31E+07 6.99E+07 9.54E+07 2.45E+07 2.17E+07 8.24E+07 7.15E+07 9.03E+07 9.28E+07 1.00E+08

Leucine/Isoleucine 1.95E+05 3.10E+05 5.08E+05 3.51E+05 5.42E+05 5.69E+05 8.20E+05 5.80E+05 5.25E+05 6.17E+05 5.25E+05 6.38E+05

Malate 8.27E+05 1.21E+06 1.47E+06 1.19E+06 4.50E+04 3.97E+04 3.71E+04 1.04E+06 2.68E+04 3.19E+04 1.00E+06 1.07E+06

Mandelate 7.08E+05 6.53E+05 7.45E+05 5.79E+05 3.31E+05 2.34E+05 2.13E+05 7.26E+05 3.60E+05 1.46E+05 3.35E+05 4.81E+05

61

Table 1.3 Continued

Sample Name H2 H3 H4 H5 H12 H19 H21 H25 H28 H33 H38 H47

Methionine 4.61E+05 3.85E+05 5.97E+05 6.15E+05 7.32E+05 7.02E+05 6.28E+05 7.37E+05 6.70E+05 9.01E+05 9.24E+05 8.00E+05

Methionine sulfoxide 2.48E+05 1.66E+05 2.69E+05 2.59E+05 9.19E+04 7.29E+04 8.04E+04 3.53E+05 8.88E+04 7.34E+04 9.20E+04 1.45E+05

Methylmalonate 6.69E+06 1.30E+07 1.31E+07 1.51E+07 2.44E+06 1.60E+06 1.59E+06 1.27E+07 2.16E+06 2.60E+06 1.61E+07 1.61E+07

myo-Inositol 6.51E+05 6.12E+05 7.91E+05 6.51E+05 8.53E+05 6.76E+04 5.66E+04 8.19E+05 7.51E+05 8.52E+05 1.02E+06 7.93E+05

N-Acetyl-beta-alanine 1.93E+04 2.24E+04 2.72E+04 2.13E+04 2.73E+04 1.95E+04 1.63E+04 3.59E+04 2.69E+04 3.33E+04 3.10E+04 3.65E+04

N-Acetylglucosamine 4.35E+03 3.11E+03 4.38E+03 2.82E+03 3.93E+03 1.18E+03 5.04E+03 7.07E+03 1.91E+03 7.44E+03 5.90E+03 7.98E+03 N-Acetylglucosamine 1/6-phosphate 5.63E+03 5.94E+03 8.90E+03 5.83E+03 1.26E+04 1.05E+04 4.85E+03 8.83E+03 8.28E+03 1.27E+04 9.04E+03 1.52E+04

N-Acetylglutamate 4.15E+05 5.01E+05 6.78E+05 5.39E+05 5.65E+05 5.04E+05 3.72E+05 6.98E+05 5.68E+05 7.77E+05 8.40E+05 8.02E+05

N-Acetylglutamine 1.52E+05 2.23E+05 2.91E+05 3.43E+05 4.52E+05 2.36E+05 2.17E+05 3.82E+05 2.60E+05 4.95E+05 4.52E+05 5.43E+05

N-Acetylornithine 5.70E+03 8.67E+03 9.76E+03 6.62E+03 1.01E+04 7.98E+03 1.22E+04 1.34E+04 8.69E+03 1.98E+04 1.81E+04 1.25E+04 N-Carbamoyl-L-aspartate 2.31E+05 2.92E+05 3.46E+05 2.10E+05 4.04E+05 2.63E+05 2.53E+05 3.26E+05 2.02E+05 1.31E+05 3.71E+05 3.16E+05

NAD+ 5.46E+04 1.41E+05 7.50E+04 1.87E+05 8.56E+03 3.21E+04 4.36E+04 1.30E+05 5.61E+03 1.04E+04 1.58E+05 1.83E+05

Nicotinate 4.35E+04 7.27E+03 6.10E+03 7.80E+03 2.67E+03 7.33E+03 5.78E+03 3.11E+03 1.11E+04 3.81E+03 5.31E+03 4.67E+03

Orotate 4.51E+04 5.91E+04 4.70E+04 4.33E+04 5.62E+04 4.19E+04 3.46E+04 6.02E+04 4.60E+04 8.82E+04 1.13E+05 9.59E+04

Pantothenate 1.66E+06 2.07E+06 2.06E+06 1.92E+06 2.53E+06 2.52E+06 3.04E+06 2.94E+06 2.03E+06 2.52E+06 2.84E+06 2.63E+06

Phenylalanine 2.22E+05 1.89E+05 2.23E+05 2.54E+05 2.54E+05 4.69E+05 5.26E+05 2.62E+05 2.79E+05 3.61E+05 2.37E+05 2.89E+05

Phenylpyruvate 6.22E+03 2.79E+04 1.11E+04 4.60E+04 2.67E+03 1.00E+02 1.00E+02 2.29E+04 2.56E+03 2.74E+03 1.02E+05 8.24E+04

Phosphorylcholine 4.55E+04 5.26E+04 4.65E+04 4.74E+04 4.66E+05 1.18E+05 5.33E+04 2.49E+05 8.77E+04 5.74E+04 4.60E+05 1.75E+05

Prephenate 9.51E+04 1.08E+05 1.14E+05 9.21E+04 9.36E+05 5.57E+05 5.37E+05 1.01E+05 8.45E+05 9.06E+05 1.59E+05 1.64E+05

Proline 1.12E+05 1.21E+05 1.79E+05 1.30E+05 1.92E+05 1.74E+05 2.14E+05 2.03E+05 1.56E+05 2.57E+05 1.65E+05 2.13E+05

Pyroglutamic acid 2.04E+06 1.82E+06 1.59E+06 1.87E+06 2.88E+06 1.15E+06 1.46E+06 2.46E+06 3.00E+06 3.74E+06 1.75E+06 2.52E+06

Pyruvate 1.15E+06 1.34E+06 1.56E+06 1.47E+06 1.13E+06 1.22E+06 1.06E+06 8.30E+05 1.25E+06 1.45E+06 7.50E+05 1.05E+06

Ribose phosphate 1.29E+05 1.22E+05 1.08E+05 6.16E+04 4.84E+05 1.80E+05 2.23E+05 2.15E+05 4.05E+05 5.21E+05 2.65E+05 1.80E+05 S-Adenosyl-L-homocysteine 2.07E+03 1.14E+03 4.30E+03 7.23E+02 3.04E+03 4.76E+03 4.70E+03 3.46E+03 8.85E+03 6.51E+03 4.19E+03 3.13E+03

Sarcosine 1.09E+06 1.67E+06 2.77E+06 2.02E+06 2.69E+06 2.62E+06 2.44E+06 2.92E+06 2.33E+06 2.76E+06 2.95E+06 2.48E+06 Sedoheptulose 1/7-phosphate 1.95E+04 1.55E+04 1.60E+04 1.09E+04 1.17E+04 4.97E+03 4.68E+03 2.46E+04 2.62E+04 6.13E+03 2.29E+04 2.69E+04

Serine 1.48E+06 1.96E+06 2.59E+06 2.46E+06 3.42E+06 3.27E+06 3.28E+06 3.43E+06 2.72E+06 4.07E+06 3.36E+06 3.45E+06 sn-Glycerol 3-phosphate 1.12E+05 1.42E+05 4.89E+04 1.49E+05 3.14E+04 7.33E+04 3.57E+04 1.17E+05 2.00E+04 3.29E+04 7.63E+04 7.40E+04

Succinate 6.69E+06 1.30E+07 1.31E+07 1.51E+07 2.44E+06 1.60E+06 1.59E+06 1.27E+07 2.16E+06 2.60E+06 1.61E+07 1.61E+07

Sulfolactate 1.46E+04 1.93E+04 1.28E+04 3.71E+04 2.46E+03 1.96E+03 2.39E+03 1.18E+05 2.23E+03 2.29E+03 2.65E+03 1.38E+04

62

Table 1.3 Continued

Sample Name H2 H3 H4 H5 H12 H19 H21 H25 H28 H33 H38 H47

Taurine 1.78E+07 2.00E+07 2.20E+07 2.25E+07 2.92E+07 2.13E+07 3.04E+07 2.52E+07 2.72E+07 2.94E+07 3.35E+07 3.33E+07

Threonine 4.27E+05 6.29E+05 6.85E+05 7.64E+05 7.45E+05 1.04E+06 8.91E+05 1.03E+06 1.02E+06 1.13E+06 8.88E+05 1.16E+06

Thymidine 3.42E+03 2.48E+03 4.64E+03 4.57E+03 5.46E+03 1.00E+02 1.00E+02 3.68E+03 2.57E+03 9.90E+03 6.88E+03 8.69E+03

Trehalose/sucrose 9.91E+04 7.43E+04 7.47E+04 2.12E+05 4.53E+04 7.22E+04 6.26E+04 3.80E+04 3.43E+04 4.77E+04 2.27E+04 5.56E+04

Tryptophan 2.19E+05 2.94E+05 3.71E+05 3.46E+05 4.40E+05 2.20E+05 2.41E+05 4.11E+05 2.63E+05 3.96E+05 4.06E+05 5.33E+05

Tyrosine 1.02E+06 1.43E+06 1.75E+06 2.00E+06 1.76E+06 1.27E+06 1.42E+06 1.82E+06 1.50E+06 2.20E+06 1.88E+06 2.24E+06

UDP-glucose 2.15E+05 2.23E+05 3.71E+05 3.36E+05 5.98E+05 3.59E+05 7.08E+05 3.98E+05 5.34E+05 5.17E+05 4.71E+05 3.58E+05 UDP-N-acetylglucosamine 2.22E+05 2.18E+05 3.22E+05 3.37E+05 5.29E+05 3.71E+05 4.88E+05 4.02E+05 5.07E+05 5.36E+05 4.10E+05 3.57E+05

UMP 2.37E+05 3.40E+05 4.73E+05 4.19E+05 5.44E+05 3.09E+05 3.06E+05 5.07E+05 3.47E+05 4.20E+05 6.48E+05 5.91E+05

Uracil 8.50E+04 9.47E+04 1.11E+05 5.48E+04 4.70E+05 5.44E+05 4.78E+05 5.12E+05 4.67E+05 6.22E+05 3.22E+05 2.51E+05

Uric acid 1.26E+05 8.92E+04 1.32E+05 1.32E+05 8.04E+04 4.55E+04 9.07E+04 5.56E+04 3.87E+04 7.18E+04 6.85E+04 8.35E+04

Uridine 3.88E+04 3.51E+04 4.67E+04 4.43E+04 6.31E+04 4.88E+04 5.54E+04 5.61E+04 6.29E+04 7.63E+04 6.22E+04 6.04E+04

Valine 4.08E+05 5.10E+05 6.20E+05 6.00E+05 7.29E+05 5.57E+05 7.61E+05 8.38E+05 6.93E+05 8.01E+05 7.75E+05 8.91E+05

Xanthine 1.48E+03 4.10E+03 4.38E+03 2.97E+03 1.01E+04 2.56E+03 1.07E+04 4.23E+03 1.59E+03 1.43E+03 6.69E+03 2.94E+03

Xanthosine 7.53E+03 5.95E+03 3.80E+03 4.20E+03 9.68E+03 5.40E+03 4.23E+03 1.24E+04 1.15E+04 1.26E+04 6.43E+03 3.54E+03

63

Table 1.4 Raw Data of Handled Control Hamsters from BLA

Sample Name H1 H10 H11 H18 H26 H31 H32 H34 H43 H44 H49 H53

2-Aminoadipate 2.75E+04 4.90E+04 2.87E+04 4.42E+04 3.83E+04 1.37E+04 2.34E+04 6.01E+04 1.69E+03 4.39E+04 5.63E+04 5.31E+04

2-Hydroxy-2-methylsuccinate 1.42E+05 2.87E+05 1.71E+05 2.60E+05 6.65E+05 2.91E+05 3.12E+05 4.40E+05 1.08E+05 3.51E+05 6.62E+05 4.51E+05

3-Methoxytyramine 8.94E+04 8.65E+04 9.49E+04 1.36E+05 1.14E+05 1.18E+05 1.24E+05 1.32E+05 1.34E+05 1.18E+05 1.27E+05 1.18E+05

3_4-Dihydroxyphenylacetate 6.24E+04 4.35E+04 3.83E+04 5.44E+04 1.10E+05 1.17E+05 1.32E+05 1.20E+05 1.05E+05 5.28E+04 6.14E+04 4.98E+04

4-Aminobutyrate 1.09E+06 9.78E+05 1.18E+06 8.43E+05 1.27E+06 1.81E+06 2.15E+06 1.81E+06 1.48E+06 1.18E+06 1.23E+06 1.26E+06

5-Hydroxyindoleacetic acid 2.49E+04 1.68E+04 2.21E+04 2.05E+04 4.98E+04 6.40E+04 6.91E+04 1.01E+05 3.56E+04 1.39E+04 1.52E+04 2.84E+04

6-Phospho-D-gluconate 7.09E+04 1.20E+05 1.30E+05 1.93E+05 1.89E+05 5.39E+03 1.41E+04 1.06E+04 7.64E+03 1.18E+05 1.46E+05 7.94E+04

Acadesine 9.61E+03 1.72E+04 2.41E+04 7.74E+03 1.57E+04 1.28E+04 1.99E+04 1.13E+04 1.74E+04 1.54E+04 2.04E+04 2.88E+04

Aconitate 5.74E+03 8.70E+03 1.54E+04 4.33E+04 3.57E+04 1.31E+03 1.41E+03 2.62E+03 1.43E+03 1.17E+04 1.65E+04 6.48E+03

Adenine 2.37E+05 1.70E+05 1.47E+05 1.51E+05 2.09E+05 1.18E+05 4.96E+05 4.78E+05 6.99E+04 1.01E+05 1.36E+05 9.15E+04

Adenosine 4.52E+05 3.31E+05 2.85E+05 2.73E+05 4.25E+05 2.01E+05 7.10E+05 7.83E+05 1.04E+05 1.95E+05 2.92E+05 1.61E+05

AICAR 6.14E+04 5.24E+04 5.24E+04 1.82E+04 4.65E+04 6.61E+04 6.33E+04 8.45E+04 3.71E+04 7.67E+04 7.98E+04 6.90E+04

Alanine 2.10E+06 2.40E+06 2.23E+06 1.90E+06 2.31E+06 2.47E+06 2.50E+06 3.25E+06 2.07E+06 2.70E+06 2.73E+06 3.27E+06

Allantoin 7.79E+03 1.98E+03 4.00E+03 3.93E+03 1.18E+04 1.36E+04 8.43E+03 7.02E+03 8.05E+03 6.22E+03 5.34E+03 5.88E+03

alpha-Ketoglutarate 1.90E+04 2.22E+04 2.26E+04 1.97E+04 2.71E+04 8.76E+03 1.51E+04 6.72E+03 7.46E+03 2.08E+04 1.52E+04 1.87E+04

AMP 3.86E+06 3.01E+06 2.79E+06 2.45E+06 2.66E+06 2.24E+06 1.97E+06 1.81E+06 6.79E+05 4.55E+06 5.52E+06 3.90E+06

Arginine 4.20E+03 5.16E+03 1.17E+04 8.68E+03 2.19E+04 1.99E+04 1.72E+04 1.62E+04 9.32E+03 5.44E+03 1.39E+04 8.69E+03

Ascorbate 1.69E+07 2.51E+07 2.62E+07 1.81E+07 2.56E+07 1.32E+07 6.96E+06 2.95E+07 2.61E+06 2.84E+07 3.05E+07 2.88E+07

Asparagine 1.86E+05 1.56E+05 1.07E+05 8.48E+04 1.38E+05 1.92E+05 2.02E+05 2.08E+05 9.46E+04 1.80E+05 1.37E+05 1.36E+05

Aspartate 6.69E+06 9.06E+06 9.41E+06 6.81E+06 1.25E+07 1.03E+07 1.06E+07 1.07E+07 5.04E+06 1.02E+07 1.01E+07 8.48E+06

Atrolactic acid 4.88E+04 5.89E+04 5.17E+04 6.40E+04 5.37E+04 8.08E+04 4.92E+04 1.07E+05 4.21E+04 5.44E+04 8.23E+04 8.02E+04

cAMP 4.06E+04 3.77E+04 3.59E+04 2.46E+04 2.90E+04 2.56E+04 2.23E+04 2.07E+04 1.28E+04 5.38E+04 6.29E+04 3.35E+04

CDP-ethanolamine 1.19E+05 1.29E+05 9.61E+04 1.07E+05 1.23E+05 1.63E+05 1.80E+05 1.82E+05 6.36E+04 1.21E+05 1.38E+05 1.25E+05

Citrate/isocitrate 5.92E+03 5.27E+04 5.36E+04 7.85E+04 6.88E+04 1.36E+04 1.31E+04 2.93E+04 1.14E+04 8.04E+04 7.68E+04 7.07E+04

Citrulline 7.27E+04 6.56E+04 8.38E+04 8.01E+04 7.52E+04 1.33E+05 1.68E+05 1.24E+05 9.35E+04 6.04E+04 1.00E+05 6.36E+04

CMP 3.54E+04 3.75E+04 3.62E+04 2.96E+04 3.31E+04 4.39E+04 3.53E+04 5.47E+04 2.15E+04 5.45E+04 5.21E+04 3.68E+04

Creatine 2.63E+06 3.44E+06 2.92E+06 2.66E+06 3.03E+06 3.06E+06 3.18E+06 4.42E+06 2.96E+06 3.73E+06 3.45E+06 4.24E+06

Creatinine 2.51E+04 2.57E+04 2.91E+04 2.32E+04 3.19E+04 3.21E+04 3.79E+04 4.40E+04 2.57E+04 3.33E+04 3.87E+04 2.96E+04

Cystathionine 1.21E+05 1.46E+05 1.30E+05 7.27E+04 1.07E+05 1.87E+05 1.88E+05 2.84E+05 1.28E+05 1.83E+05 2.06E+05 3.11E+05

Cysteine 2.52E+04 4.61E+04 8.55E+04 4.13E+04 8.65E+04 1.10E+05 3.62E+04 3.01E+05 9.75E+03 2.71E+04 3.94E+04 6.08E+04

Cystine 3.02E+03 2.53E+03 2.06E+03 7.98E+03 5.54E+04 7.44E+04 6.29E+04 6.21E+04 2.08E+05 5.66E+03 2.85E+03 3.65E+03

Cytidine 7.43E+04 1.33E+05 8.82E+04 7.25E+04 1.29E+05 7.51E+04 9.57E+04 1.24E+05 7.09E+04 1.15E+05 1.11E+05 1.46E+05

D-Gluconate 1.12E+05 7.14E+04 7.47E+04 1.28E+05 2.17E+05 2.70E+05 1.95E+05 1.40E+05 1.08E+05 8.37E+04 1.12E+05 1.53E+05

D-Glyceraldehdye 3-phosphate 4.41E+05 2.18E+05 1.98E+05 1.97E+05 2.14E+05 1.08E+05 1.65E+05 1.53E+05 9.56E+04 4.23E+05 5.82E+05 3.85E+05

64

Table 1.4 Continued

Sample Name H1 H10 H11 H18 H26 H31 H32 H34 H43 H44 H49 H53

Diiodothyronine 5.87E+05 6.96E+05 7.23E+05 2.19E+05 5.94E+05 1.04E+06 9.99E+05 1.10E+06 4.61E+05 6.72E+05 7.10E+05 5.60E+05

Dimethylglycine 1.09E+06 9.78E+05 1.18E+06 8.43E+05 1.27E+06 1.81E+06 2.15E+06 1.81E+06 1.48E+06 1.18E+06 1.23E+06 1.26E+06

Fumarate 1.75E+05 2.00E+05 1.78E+05 1.98E+05 3.03E+05 6.93E+05 8.73E+05 9.35E+05 1.33E+05 2.84E+05 3.10E+05 2.71E+05

Glucose 1-phosphate 1.62E+05 1.73E+05 1.78E+05 1.55E+05 2.03E+05 3.93E+05 4.53E+05 4.92E+05 1.75E+05 1.43E+05 2.42E+05 1.62E+05

Glucose 6-phosphate 2.11E+05 9.35E+04 8.23E+04 7.83E+04 1.14E+05 1.15E+05 9.59E+04 1.53E+05 6.89E+04 1.97E+05 3.12E+05 1.43E+05

Glutamate 9.90E+07 1.13E+08 9.78E+07 9.41E+07 1.25E+08 9.64E+07 1.06E+08 1.15E+08 2.04E+07 1.10E+08 1.17E+08 1.17E+08

Glutamine 3.87E+07 3.06E+07 2.98E+07 2.39E+07 3.54E+07 4.17E+07 5.01E+07 5.09E+07 2.65E+07 3.37E+07 3.27E+07 3.46E+07

Glutathione 1.20E+07 1.64E+07 1.48E+07 1.40E+07 1.65E+07 1.21E+07 8.36E+06 1.45E+07 4.77E+06 1.74E+07 1.74E+07 1.59E+07

Glutathione disulfide 1.53E+05 1.76E+05 8.41E+04 9.12E+04 1.27E+05 9.90E+05 1.68E+06 6.63E+05 4.69E+05 9.88E+04 1.60E+05 7.25E+04

Glycerate 9.79E+04 9.55E+04 1.38E+05 2.83E+05 3.88E+05 9.16E+04 7.68E+04 9.70E+04 1.60E+05 9.68E+04 1.08E+06 1.58E+05

Glycerone phosphate 4.41E+05 2.18E+05 1.98E+05 1.97E+05 2.14E+05 1.08E+05 1.65E+05 1.53E+05 9.56E+04 4.23E+05 5.82E+05 3.85E+05

GMP 2.45E+05 2.18E+05 1.85E+05 2.40E+05 2.79E+05 4.43E+05 4.23E+05 4.33E+05 1.65E+05 2.44E+05 2.89E+05 2.46E+05

Guanine 7.67E+03 1.10E+04 6.74E+03 6.55E+03 1.04E+04 1.20E+04 7.15E+03 1.38E+04 4.86E+03 1.22E+04 1.35E+04 1.45E+04

Guanosine 2.86E+05 2.47E+05 2.30E+05 1.95E+05 4.20E+05 4.82E+05 1.08E+06 1.27E+06 3.29E+05 8.65E+04 1.77E+05 1.32E+05

Histidine 1.80E+04 1.05E+04 2.04E+04 8.84E+03 2.37E+04 2.67E+04 1.83E+04 3.17E+04 1.13E+04 1.12E+04 2.34E+04 1.76E+04

Homocysteic acid 2.62E+04 2.39E+04 1.97E+04 1.60E+04 1.93E+04 1.90E+04 7.46E+03 2.20E+04 2.60E+03 2.55E+04 2.43E+04 2.63E+04

Homoserine 8.89E+05 7.29E+05 8.88E+05 6.19E+05 9.87E+05 1.12E+06 1.44E+06 1.26E+06 8.10E+05 9.63E+05 1.08E+06 1.11E+06

Homovanillic acid 1.06E+05 8.05E+04 7.94E+04 9.13E+04 9.83E+04 7.23E+04 7.81E+04 9.01E+04 4.11E+04 1.07E+05 9.41E+04 9.73E+04

Hydroxybenzoate 2.27E+04 1.89E+04 1.84E+04 3.55E+04 2.93E+04 1.82E+04 2.34E+04 2.27E+04 1.55E+04 1.86E+04 2.50E+04 2.23E+04

Hydroxyisocaproic acid 2.81E+05 2.90E+05 3.89E+05 3.64E+05 4.66E+05 1.73E+05 1.58E+05 1.57E+05 9.75E+04 4.16E+05 1.96E+05 2.87E+05

Hydroxyphenylpyruvate 3.75E+04 4.88E+04 5.04E+04 4.19E+04 5.14E+04 4.35E+04 4.62E+04 4.57E+04 4.27E+04 4.94E+04 3.78E+04 4.90E+04

Hypoxanthine 2.81E+05 6.03E+05 4.96E+05 5.00E+05 2.03E+06 1.96E+06 2.18E+06 2.26E+06 9.27E+05 2.31E+05 9.72E+05 5.33E+05

IMP 1.90E+05 2.99E+05 3.37E+05 3.03E+05 5.79E+05 6.14E+05 4.26E+05 5.67E+05 1.47E+05 1.76E+05 2.01E+05 2.81E+05

Indole-3-carboxylate 2.59E+03 2.70E+03 2.72E+03 6.25E+03 5.36E+03 3.37E+03 4.54E+03 2.05E+03 2.15E+03 4.36E+03 5.03E+03 2.61E+03

Inosine 1.76E+06 2.31E+06 1.94E+06 2.13E+06 3.15E+06 5.64E+06 6.36E+06 8.06E+06 4.26E+06 8.81E+05 1.16E+06 1.72E+06

Lactate 7.10E+07 7.15E+07 6.64E+07 7.03E+07 8.44E+07 6.18E+07 9.12E+07 8.27E+07 1.86E+07 6.22E+07 7.38E+07 6.86E+07

Leucine/Isoleucine 5.03E+05 5.04E+05 5.74E+05 4.36E+05 7.91E+05 7.09E+05 9.29E+05 6.77E+05 3.86E+05 5.00E+05 8.70E+05 6.39E+05

Malate 5.95E+05 7.69E+05 6.30E+05 8.95E+05 1.18E+06 3.39E+04 4.10E+04 2.94E+04 2.64E+04 7.28E+05 7.86E+05 5.02E+05

Malate 3.38E+06 5.22E+06 4.76E+06 4.70E+06 7.25E+06 6.43E+06 7.82E+06 7.52E+06 3.26E+06 5.38E+06 6.24E+06 5.21E+06

Mandelate 6.53E+05 2.92E+05 3.56E+05 6.69E+05 3.95E+05 2.43E+05 2.74E+05 2.61E+05 2.30E+05 4.00E+05 4.33E+05 6.64E+05

Methionine 5.01E+05 6.83E+05 6.25E+05 5.52E+05 7.66E+05 5.89E+05 6.51E+05 1.00E+06 4.21E+05 6.73E+05 7.19E+05 6.82E+05

Methionine sulfoxide 9.99E+04 1.66E+05 1.57E+05 2.24E+05 1.50E+05 6.47E+04 5.19E+04 1.03E+05 1.17E+05 1.46E+05 1.06E+05 1.07E+05

Methylmalonate 1.44E+07 1.25E+07 1.11E+07 1.06E+07 1.23E+07 3.33E+06 3.47E+06 3.44E+06 2.37E+06 1.77E+07 2.44E+07 1.94E+07

myo-Inositol 7.23E+05 7.48E+05 7.34E+05 6.75E+05 8.69E+05 1.34E+05 8.74E+05 7.23E+05 4.11E+04 8.66E+05 7.84E+05 7.83E+05

N-Acetyl-beta-alanine 2.16E+04 2.12E+04 2.63E+04 1.58E+04 3.45E+04 2.23E+04 2.63E+04 3.36E+04 1.22E+04 1.89E+04 4.96E+04 3.50E+04

N-Acetylglucosamine 2.58E+03 6.07E+03 5.61E+03 2.67E+03 3.57E+03 7.52E+03 2.06E+03 7.73E+03 9.08E+02 5.76E+03 9.64E+03 5.48E+03

65

Table 1.4 Continued

Sample Name H1 H10 H11 H18 H26 H31 H32 H34 H43 H44 H49 H53 N-Acetylglucosamine 1/6-phosphate 6.62E+03 6.79E+03 3.77E+03 5.01E+03 3.93E+03 1.33E+04 1.79E+04 1.71E+04 3.31E+03 5.73E+03 7.57E+03 3.93E+03

N-Acetylglutamate 3.93E+05 5.60E+05 6.13E+05 4.73E+05 6.47E+05 6.58E+05 7.38E+05 7.65E+05 2.80E+05 5.56E+05 8.53E+05 5.53E+05

N-Acetylglutamine 3.06E+05 2.83E+05 2.30E+05 3.42E+05 4.07E+05 4.67E+05 5.80E+05 5.89E+05 1.69E+05 3.55E+05 4.98E+05 4.90E+05

N-Acetylornithine 1.38E+04 8.35E+03 1.42E+04 5.61E+03 1.36E+04 1.21E+04 1.43E+04 1.51E+04 1.06E+04 1.47E+04 1.28E+04 1.45E+04

N-Carbamoyl-L-aspartate 2.79E+05 3.22E+05 3.96E+05 2.04E+05 3.66E+05 4.08E+05 3.60E+05 4.20E+05 2.72E+05 3.36E+05 3.67E+05 2.91E+05

NAD+ 1.69E+05 1.60E+05 2.42E+05 1.40E+05 1.35E+05 2.22E+04 8.13E+03 1.04E+04 1.27E+04 2.85E+05 3.31E+05 1.68E+05

Nicotinate 6.27E+03 7.20E+03 5.46E+03 4.89E+03 1.04E+04 3.74E+03 7.50E+03 5.16E+03 6.97E+03 4.68E+03 1.06E+04 9.70E+03

Orotate 4.81E+04 7.87E+04 6.76E+04 5.31E+04 1.31E+05 1.11E+05 8.51E+04 1.23E+05 4.33E+04 6.36E+04 7.79E+04 5.47E+04

Pantothenate 2.34E+06 2.63E+06 2.24E+06 2.29E+06 2.90E+06 2.99E+06 2.90E+06 3.05E+06 2.42E+06 2.37E+06 3.01E+06 2.34E+06

Phenylalanine 2.15E+05 2.42E+05 2.60E+05 2.24E+05 3.96E+05 5.45E+05 3.26E+05 3.22E+05 4.26E+05 2.21E+05 4.35E+05 2.65E+05

Phenylpyruvate 2.34E+04 3.74E+04 7.33E+04 5.76E+04 1.00E+02 1.78E+03 2.57E+03 2.75E+03 1.91E+03 5.47E+04 1.53E+04 2.02E+04

Phosphorylcholine 5.05E+04 8.71E+04 1.11E+05 9.87E+04 1.08E+05 5.66E+04 8.87E+04 6.33E+04 7.63E+04 5.08E+04 6.15E+04 5.23E+04

Prephenate 1.61E+05 1.20E+05 1.16E+05 1.03E+05 1.31E+05 7.96E+05 8.33E+05 8.66E+05 5.45E+05 1.42E+05 1.32E+05 2.11E+05

Proline 1.17E+05 1.36E+05 1.36E+05 1.17E+05 1.91E+05 2.05E+05 2.11E+05 2.73E+05 1.26E+05 1.65E+05 1.97E+05 1.97E+05

Pyroglutamic acid 2.77E+06 2.39E+06 2.67E+06 1.80E+06 5.56E+06 3.33E+06 5.11E+06 4.28E+06 1.05E+06 1.81E+06 4.23E+06 3.39E+06

Pyruvate 1.47E+06 9.11E+05 8.57E+05 8.66E+05 1.73E+06 2.24E+06 2.13E+06 2.11E+06 7.88E+05 7.94E+05 9.91E+05 1.31E+06

Ribose phosphate 8.68E+04 1.11E+05 8.94E+04 1.18E+05 1.95E+05 3.38E+05 6.12E+05 6.50E+05 1.57E+05 4.82E+04 6.57E+04 1.07E+05

S-Adenosyl-L-homocysteine 1.00E+02 4.19E+03 7.18E+03 7.84E+03 6.16E+03 1.01E+04 3.69E+03 8.67E+03 4.13E+03 2.76E+03 1.17E+03 4.12E+03

Sarcosine 2.10E+06 2.40E+06 2.23E+06 1.90E+06 2.31E+06 2.47E+06 2.50E+06 3.25E+06 2.07E+06 2.70E+06 2.73E+06 3.27E+06

Sedoheptulose 1/7-phosphate 1.69E+04 1.35E+04 6.80E+03 1.42E+04 1.33E+04 1.99E+03 3.61E+03 7.00E+03 2.67E+03 5.97E+03 1.27E+04 1.44E+04

Serine 2.72E+06 3.60E+06 3.03E+06 2.38E+06 3.84E+06 3.88E+06 4.04E+06 4.04E+06 2.97E+06 3.36E+06 3.72E+06 4.10E+06

sn-Glycerol 3-phosphate 1.82E+05 8.94E+04 1.15E+05 1.19E+05 1.12E+05 2.43E+04 2.97E+04 3.02E+04 1.61E+04 2.50E+05 9.75E+05 8.94E+04

Succinate 1.44E+07 1.25E+07 1.11E+07 1.06E+07 1.23E+07 3.33E+06 3.47E+06 3.44E+06 2.37E+06 1.77E+07 2.44E+07 1.94E+07

Sulfolactate 2.26E+03 7.23E+03 2.37E+04 4.98E+04 3.30E+04 1.84E+03 2.88E+03 2.81E+03 2.33E+03 2.48E+03 4.76E+03 2.22E+03

Taurine 2.41E+07 3.16E+07 3.34E+07 2.32E+07 3.16E+07 3.82E+07 3.43E+07 3.77E+07 2.44E+07 2.99E+07 3.40E+07 2.57E+07

Threonine 8.89E+05 7.29E+05 8.88E+05 6.19E+05 9.87E+05 1.12E+06 1.44E+06 1.26E+06 8.10E+05 9.63E+05 1.08E+06 1.11E+06

Thymidine 4.53E+03 7.57E+03 1.24E+03 3.39E+03 7.70E+03 3.48E+03 7.04E+03 1.10E+04 1.00E+02 3.15E+03 6.98E+03 4.22E+03

Trehalose/sucrose 9.91E+04 4.80E+04 6.19E+04 4.02E+04 1.08E+05 5.77E+04 8.48E+04 3.91E+04 6.89E+04 3.02E+04 3.82E+04 6.79E+04

Tryptophan 2.94E+05 3.73E+05 2.98E+05 3.23E+05 5.15E+05 3.59E+05 3.83E+05 4.43E+05 1.47E+05 3.10E+05 5.64E+05 3.00E+05

Tyrosine 1.52E+06 1.84E+06 1.55E+06 1.38E+06 2.02E+06 1.76E+06 1.90E+06 1.99E+06 1.28E+06 1.72E+06 2.27E+06 2.00E+06

UDP-glucose 3.05E+05 3.33E+05 3.12E+05 3.65E+05 4.23E+05 7.69E+05 6.96E+05 1.00E+06 4.79E+05 3.33E+05 3.90E+05 3.74E+05

UDP-N-acetylglucosamine 2.80E+05 2.71E+05 2.74E+05 3.19E+05 4.09E+05 8.13E+05 8.07E+05 1.00E+06 4.60E+05 3.08E+05 3.80E+05 3.45E+05

UMP 3.66E+05 4.76E+05 3.86E+05 4.67E+05 5.36E+05 4.13E+05 3.45E+05 4.49E+05 1.49E+05 6.10E+05 6.85E+05 5.13E+05

Uracil 7.46E+04 2.37E+05 2.35E+05 2.35E+05 4.55E+05 5.22E+05 8.23E+05 7.05E+05 3.51E+05 3.66E+04 4.06E+05 2.07E+05

Uric acid 1.56E+05 7.75E+04 8.28E+04 5.32E+04 2.51E+05 1.37E+05 9.80E+04 8.66E+04 3.40E+04 3.18E+04 9.07E+04 5.43E+04

Uridine 3.67E+04 5.52E+04 5.40E+04 4.56E+04 6.26E+04 7.54E+04 6.39E+04 7.63E+04 4.07E+04 6.17E+04 6.43E+04 5.98E+04

66

Table 1.4 Continued

Sample Name H1 H10 H11 H18 H26 H31 H32 H34 H43 H44 H49 H53

Uridine 6.41E+05 6.01E+05 5.02E+05 5.80E+05 7.26E+05 1.21E+06 1.10E+06 1.19E+06 4.09E+05 4.32E+05 6.47E+05 5.49E+05

Valine 6.68E+05 6.58E+05 7.37E+05 5.58E+05 1.10E+06 8.57E+05 8.30E+05 9.35E+05 4.05E+05 8.30E+05 1.06E+06 8.43E+05

Xanthine 2.25E+03 1.73E+03 3.21E+03 3.61E+03 3.87E+03 7.21E+03 1.47E+03 2.46E+03 2.11E+03 2.29E+03 1.16E+03 6.48E+03

Xanthine 2.65E+05 4.19E+05 4.06E+05 2.22E+05 1.08E+06 7.13E+05 8.79E+05 1.05E+06 4.61E+05 2.77E+05 8.37E+05 2.05E+05

Xanthosine 3.40E+03 3.18E+03 2.13E+03 4.12E+03 8.69E+03 9.05E+03 1.45E+04 1.17E+04 1.66E+03 3.29E+03 7.34E+03 2.02E+03

67

Table 1.5 Raw Data of Subordinate Hamsters from BLA

Sample Name H6 H7 H8 H9 H14 H15 H17 H23 H24 H35 H36 H41

2-Aminoadipate 6.46E+04 6.86E+04 5.45E+04 3.98E+04 3.62E+04 4.26E+03 5.75E+03 4.81E+04 3.56E+04 6.69E+03 3.81E+04 4.93E+04 2-Hydroxy-2-methylsuccinate 1.05E+06 4.90E+05 3.08E+05 2.75E+05 5.88E+05 1.87E+05 3.58E+05 4.46E+05 5.05E+05 1.82E+05 3.77E+05 5.91E+05

3-Methoxytyramine 1.19E+05 1.03E+05 1.04E+05 1.10E+05 1.40E+05 1.12E+05 1.17E+05 1.31E+05 1.30E+05 1.37E+05 1.26E+05 1.43E+05 3_4-Dihydroxyphenylacetate 2.42E+05 5.65E+04 5.45E+04 5.77E+04 1.18E+05 8.05E+04 7.17E+04 4.20E+04 4.75E+04 1.12E+05 6.46E+04 1.14E+05

4-Aminobutyrate 1.16E+06 1.05E+06 1.12E+06 1.61E+06 1.65E+06 1.72E+06 2.23E+06 1.33E+06 1.40E+06 1.80E+06 5.64E+05 1.75E+06 5-Hydroxyindoleacetic acid 4.28E+04 4.42E+04 5.59E+04 5.32E+04 6.32E+04 4.65E+04 9.08E+04 4.23E+04 3.59E+04 5.02E+04 2.93E+04 7.96E+04

6-Phospho-D-gluconate 1.25E+05 1.71E+05 1.74E+05 1.30E+05 7.51E+03 5.73E+03 2.67E+03 1.71E+05 8.63E+04 2.93E+03 1.65E+05 2.76E+03

Acadesine 2.74E+04 2.25E+04 1.11E+04 2.57E+04 1.12E+04 1.69E+04 1.57E+04 1.72E+04 2.30E+04 2.44E+04 1.88E+04 1.09E+04

Aconitate 1.09E+06 2.78E+04 1.56E+04 9.17E+03 1.69E+03 1.00E+02 1.38E+03 1.38E+04 6.91E+03 1.73E+03 2.08E+04 1.41E+03

Adenine 1.34E+05 8.50E+04 3.28E+05 9.07E+04 3.54E+05 3.01E+04 4.48E+04 3.17E+05 2.53E+05 5.06E+04 2.85E+05 1.53E+05

Adenosine 2.87E+05 1.90E+05 5.87E+05 1.87E+05 5.90E+05 4.37E+04 7.09E+04 5.35E+05 4.44E+05 8.74E+04 4.22E+05 2.60E+05

AICAR 4.53E+04 4.48E+04 5.58E+04 5.89E+04 5.13E+04 5.44E+04 6.94E+04 6.34E+04 6.93E+04 4.13E+04 2.30E+04 6.66E+04

Alanine 2.89E+06 2.88E+06 2.39E+06 2.85E+06 2.81E+06 2.29E+06 2.49E+06 2.46E+06 2.44E+06 1.93E+06 2.08E+06 2.62E+06

Allantoin 6.35E+03 3.99E+03 5.25E+03 5.61E+03 5.83E+03 8.07E+03 9.64E+03 5.02E+03 8.78E+03 7.68E+03 5.04E+03 7.09E+03

alpha-Ketoglutarate 2.33E+04 2.43E+04 1.62E+04 1.62E+04 1.49E+04 9.87E+03 1.27E+04 1.45E+04 1.55E+04 8.43E+03 2.19E+04 1.01E+04

AMP 3.95E+06 3.27E+06 2.91E+06 3.31E+06 2.11E+06 1.34E+06 3.41E+06 2.54E+06 3.09E+06 1.49E+06 2.17E+06 2.93E+06

Arginine 7.51E+03 3.46E+03 4.07E+03 1.69E+04 1.51E+04 1.04E+04 3.07E+04 1.25E+04 1.06E+04 1.10E+04 8.78E+03 6.97E+03

Ascorbate 3.14E+07 2.53E+07 2.69E+07 2.74E+07 2.91E+07 4.61E+06 6.68E+06 3.08E+07 2.63E+07 2.46E+06 1.74E+07 5.72E+06

Asparagine 1.89E+05 8.95E+04 1.75E+05 2.07E+05 1.73E+05 1.07E+05 2.48E+05 1.46E+05 1.75E+05 1.37E+05 1.09E+05 1.61E+05

Aspartate 9.97E+06 8.94E+06 1.03E+07 1.07E+07 8.76E+06 5.95E+06 6.86E+06 9.07E+06 8.30E+06 5.88E+06 7.06E+06 8.70E+06

Atrolactic acid 7.90E+03 3.86E+04 6.66E+04 4.78E+04 8.90E+04 7.89E+04 5.92E+04 4.24E+04 6.89E+04 5.45E+04 3.19E+04 3.53E+04

cAMP 3.14E+04 2.97E+04 4.07E+04 3.83E+04 2.55E+04 1.15E+04 2.23E+04 1.78E+04 3.08E+04 1.44E+04 3.25E+04 1.77E+04

CDP-ethanolamine 1.33E+05 1.20E+05 1.71E+05 1.39E+05 1.95E+05 7.22E+04 7.97E+04 1.48E+05 1.43E+05 7.26E+04 1.23E+05 1.56E+05

Citrate/isocitrate 6.96E+04 3.93E+04 5.09E+04 3.55E+04 5.32E+03 6.26E+03 3.92E+03 6.67E+04 6.06E+04 1.22E+04 8.61E+04 1.04E+04

Citrulline 9.37E+04 6.86E+04 7.17E+04 8.33E+04 1.16E+05 1.25E+05 1.40E+05 1.03E+05 8.81E+04 1.01E+05 7.68E+04 1.50E+05

CMP 4.34E+04 4.28E+04 3.90E+04 4.18E+04 5.41E+04 2.50E+04 3.74E+04 3.89E+04 4.20E+04 2.95E+04 3.39E+04 5.02E+04

Creatine 3.43E+06 3.87E+06 3.03E+06 4.00E+06 3.56E+06 3.00E+06 3.26E+06 3.24E+06 3.14E+06 2.40E+06 2.74E+06 3.18E+06

Creatinine 3.34E+04 4.25E+04 2.76E+04 3.51E+04 3.80E+04 2.69E+04 3.47E+04 2.51E+04 2.74E+04 2.48E+04 2.45E+04 3.26E+04

Cystathionine 1.26E+05 1.13E+05 1.39E+05 1.47E+05 2.47E+05 1.68E+05 2.56E+05 1.23E+05 1.75E+05 1.46E+05 7.48E+04 1.69E+05

Cysteine 8.34E+04 6.04E+04 9.62E+04 8.05E+04 3.26E+05 1.72E+04 2.10E+04 6.36E+04 7.05E+04 1.78E+04 5.39E+04 3.24E+03

Cystine 3.30E+03 2.94E+03 5.78E+03 5.15E+03 3.84E+03 3.28E+05 5.15E+05 2.53E+03 3.14E+03 1.84E+05 1.46E+04 4.89E+04

Cytidine 2.94E+05 6.34E+04 1.05E+05 9.31E+04 1.07E+05 1.18E+05 1.34E+05 1.01E+05 1.12E+05 1.51E+05 7.83E+04 1.49E+05

D-Gluconate 3.97E+05 1.28E+05 7.82E+04 2.58E+05 9.78E+04 2.42E+05 1.48E+05 1.25E+05 8.92E+04 1.40E+05 1.26E+05 1.31E+05 D-Glyceraldehdye 3-phosphate 2.84E+05 3.95E+05 2.98E+05 3.24E+05 1.53E+05 2.32E+05 1.41E+05 2.36E+05 3.22E+05 2.64E+05 2.08E+05 4.87E+05

68

Table 1.5 Continued

Sample Name H6 H7 H8 H9 H14 H15 H17 H23 H24 H35 H36 H41

Diiodothyronine 6.82E+05 1.92E+05 4.56E+05 5.26E+05 9.25E+05 6.86E+05 1.12E+06 5.53E+05 6.27E+05 6.30E+05 2.11E+05 9.28E+05

Dimethylglycine 1.16E+06 1.05E+06 1.12E+06 1.61E+06 1.65E+06 1.72E+06 2.23E+06 1.33E+06 1.40E+06 1.80E+06 5.64E+05 1.75E+06

Fumarate 6.66E+05 3.96E+05 4.16E+05 3.96E+05 6.48E+05 4.57E+05 7.73E+05 3.41E+05 3.34E+05 3.23E+05 1.87E+05 9.25E+05

Glucose 1-phosphate 1.67E+05 1.76E+05 1.78E+05 1.62E+05 4.32E+05 1.78E+05 2.31E+05 1.85E+05 2.37E+05 2.48E+05 1.59E+05 4.09E+05

Glucose 6-phosphate 1.17E+05 1.69E+05 8.88E+04 1.38E+05 1.28E+05 9.71E+04 1.34E+05 1.43E+05 1.41E+05 1.00E+05 8.74E+04 1.06E+05

Glutamate 1.30E+08 1.25E+08 1.14E+08 1.20E+08 1.03E+08 3.08E+07 3.75E+07 1.01E+08 1.03E+08 3.86E+07 9.18E+07 9.68E+07

Glutamine 3.60E+07 2.17E+07 3.27E+07 3.46E+07 3.18E+07 3.66E+07 5.06E+07 3.32E+07 3.31E+07 2.95E+07 1.83E+07 3.90E+07

Glutathione 1.78E+07 1.54E+07 1.55E+07 1.62E+07 1.50E+07 5.82E+06 8.34E+06 1.62E+07 1.54E+07 4.62E+06 1.31E+07 5.97E+06

Glutathione disulfide 6.47E+04 1.42E+05 9.99E+04 9.83E+04 1.47E+05 3.74E+05 3.18E+05 9.99E+04 7.16E+04 6.71E+05 8.82E+04 2.06E+06

Glycerate 2.62E+06 1.25E+05 9.01E+04 1.09E+05 1.16E+05 1.79E+05 1.30E+05 2.84E+05 2.08E+05 1.39E+05 1.14E+05 7.64E+04

Glycerone phosphate 2.84E+05 3.95E+05 2.98E+05 3.24E+05 1.53E+05 2.32E+05 1.41E+05 2.36E+05 3.22E+05 2.64E+05 2.08E+05 4.87E+05

GMP 2.63E+05 2.73E+05 2.22E+05 2.73E+05 4.41E+05 2.22E+05 4.40E+05 1.98E+05 2.62E+05 2.78E+05 1.97E+05 5.28E+05

Guanine 8.24E+03 8.73E+03 1.37E+04 1.21E+04 1.67E+04 1.27E+04 1.19E+04 7.98E+03 1.56E+04 9.32E+03 6.62E+03 1.52E+04

Guanosine 2.70E+05 1.96E+05 5.61E+05 2.16E+05 8.91E+05 2.98E+05 2.66E+05 4.08E+05 4.60E+05 2.46E+05 4.28E+05 6.89E+05

Histidine 8.36E+03 8.18E+03 1.30E+04 4.38E+04 2.06E+04 2.14E+04 3.85E+04 1.74E+04 1.92E+04 2.25E+04 6.00E+03 3.55E+04

Homocysteic acid 1.97E+04 2.46E+04 2.23E+04 2.42E+04 1.99E+04 1.04E+04 7.02E+03 2.38E+04 2.22E+04 3.07E+03 1.59E+04 8.09E+03

Homoserine 9.52E+05 7.57E+05 9.34E+05 1.49E+06 6.44E+05 1.03E+06 1.21E+06 1.15E+06 1.01E+06 1.06E+06 8.20E+05 1.01E+06

Homovanillic acid 8.89E+04 7.51E+04 7.92E+04 9.16E+04 7.02E+04 4.13E+04 2.72E+04 8.65E+04 9.56E+04 5.73E+04 8.04E+04 9.28E+04

Hydroxybenzoate 5.26E+04 2.09E+04 7.28E+04 2.44E+04 1.84E+04 1.53E+04 1.68E+04 1.38E+04 1.50E+05 1.79E+04 2.63E+04 1.10E+04

Hydroxyisocaproic acid 2.44E+05 2.56E+05 4.06E+05 3.30E+05 1.66E+05 1.10E+05 1.18E+05 3.68E+05 2.25E+05 9.61E+04 4.99E+05 1.21E+05

Hydroxyphenylpyruvate 5.06E+04 4.20E+04 4.85E+04 4.58E+04 5.12E+04 3.99E+04 3.61E+04 5.41E+04 4.79E+04 3.11E+04 4.73E+04 4.96E+04

Hypoxanthine 7.35E+05 5.76E+05 7.19E+05 7.90E+05 2.01E+06 1.68E+06 1.35E+06 8.73E+05 7.92E+05 1.08E+06 5.95E+05 1.80E+06

IMP 2.93E+05 2.94E+05 2.48E+05 2.96E+05 4.64E+05 2.32E+05 4.07E+05 1.97E+05 2.63E+05 2.56E+05 2.04E+05 3.44E+05

Indole-3-carboxylate 1.73E+05 2.16E+03 2.50E+03 1.96E+03 1.78E+03 3.27E+03 2.05E+03 2.24E+03 5.14E+03 2.07E+03 2.93E+03 2.21E+03

Inosine 2.71E+06 2.23E+06 3.10E+06 2.57E+06 5.42E+06 6.22E+06 5.67E+06 2.76E+06 3.21E+06 3.66E+06 2.81E+06 5.12E+06

Lactate 8.37E+07 7.90E+07 7.40E+07 9.29E+07 7.22E+07 2.05E+07 2.52E+07 7.49E+07 8.48E+07 2.44E+07 7.65E+07 8.28E+07

Leucine/Isoleucine 5.81E+05 5.29E+05 5.22E+05 1.52E+06 6.04E+05 5.88E+05 5.05E+05 5.99E+05 5.63E+05 4.67E+05 5.38E+05 6.08E+05

Malate 9.85E+05 1.17E+06 1.04E+06 1.09E+06 3.72E+04 2.70E+04 4.36E+04 1.03E+06 7.87E+05 2.53E+04 7.26E+05 3.38E+04

Malate 1.06E+07 7.24E+06 6.52E+06 6.08E+06 7.30E+06 4.52E+06 7.07E+06 6.33E+06 6.10E+06 3.35E+06 4.82E+06 7.25E+06

Mandelate 3.11E+05 7.25E+05 4.36E+05 4.07E+05 3.98E+05 2.48E+05 2.75E+05 3.15E+05 5.71E+05 1.51E+05 5.68E+05 1.49E+05

Methionine 5.56E+05 6.79E+05 6.54E+05 1.18E+06 9.31E+05 5.89E+05 7.39E+05 6.47E+05 7.31E+05 5.06E+05 4.90E+05 7.17E+05

Methionine sulfoxide 9.81E+04 2.46E+05 1.64E+05 1.42E+05 8.06E+04 7.24E+04 5.18E+04 1.55E+05 1.27E+05 7.90E+04 2.71E+05 6.28E+04

Methylmalonate 3.42E+07 2.10E+07 7.26E+06 1.60E+07 2.94E+06 1.06E+06 1.86E+06 1.25E+07 1.30E+07 2.07E+06 6.79E+06 3.13E+06

myo-Inositol 8.35E+05 7.91E+05 6.92E+05 8.62E+05 5.98E+05 6.29E+04 5.73E+04 9.05E+05 9.74E+05 7.32E+04 7.91E+05 6.89E+05

N-Acetyl-beta-alanine 3.63E+04 2.19E+04 2.28E+04 4.96E+04 3.20E+04 1.71E+04 1.55E+04 3.26E+04 4.20E+04 1.45E+04 2.14E+04 3.29E+04

N-Acetylglucosamine 6.48E+03 3.21E+03 3.55E+03 1.85E+04 4.03E+03 2.41E+03 4.95E+03 7.84E+03 7.97E+03 3.26E+03 4.64E+03 2.12E+03

69

Table 1.5 Continued

Sample Name H6 H7 H8 H9 H14 H15 H17 H23 H24 H35 H36 H41 N-Acetylglucosamine 1/6-phosphate 5.09E+03 1.03E+04 6.87E+03 1.11E+04 7.76E+03 7.12E+03 9.26E+03 7.64E+03 8.14E+03 4.95E+03 1.18E+04 1.60E+04

N-Acetylglutamate 1.05E+06 9.25E+05 7.03E+05 7.72E+05 7.11E+05 3.38E+05 5.46E+05 6.59E+05 6.00E+05 3.64E+05 5.12E+05 7.43E+05

N-Acetylglutamine 5.01E+05 2.74E+05 3.04E+05 2.97E+05 3.47E+05 2.45E+05 4.18E+05 2.66E+05 3.09E+05 2.14E+05 2.32E+05 4.44E+05

N-Acetylornithine 7.04E+03 1.02E+04 9.20E+03 1.14E+04 1.23E+04 9.46E+03 1.56E+04 1.09E+04 1.24E+04 6.72E+03 8.41E+03 1.08E+04 N-Carbamoyl-L-aspartate 1.33E+05 3.14E+05 3.02E+05 2.87E+05 4.08E+05 2.52E+05 3.91E+05 3.35E+05 3.87E+05 2.26E+05 2.72E+05 3.96E+05

NAD+ 1.75E+05 1.50E+05 1.08E+05 1.42E+05 1.54E+04 8.76E+03 6.84E+03 1.58E+05 1.72E+05 2.47E+03 1.24E+05 4.06E+03

Nicotinate 8.20E+03 9.49E+03 5.18E+03 5.76E+03 4.41E+03 5.00E+03 2.65E+03 6.31E+03 6.79E+03 3.91E+03 8.56E+03 9.61E+03

Orotate 1.29E+05 5.76E+04 5.88E+04 5.85E+04 6.93E+04 4.51E+04 4.10E+04 7.76E+04 7.36E+04 5.17E+04 4.17E+04 6.77E+04

Pantothenate 2.67E+06 2.87E+06 2.62E+06 2.52E+06 2.83E+06 2.61E+06 2.84E+06 2.68E+06 2.49E+06 2.04E+06 1.94E+06 2.56E+06

Phenylalanine 2.27E+05 2.24E+05 2.26E+05 8.63E+05 3.51E+05 5.25E+05 4.74E+05 2.52E+05 2.93E+05 4.64E+05 2.41E+05 2.70E+05

Phenylpyruvate 3.70E+04 5.72E+04 9.68E+04 6.55E+04 3.56E+03 1.00E+02 1.00E+02 2.17E+04 6.02E+03 4.89E+03 5.34E+04 3.64E+03

Phosphorylcholine 5.01E+04 4.75E+04 5.27E+04 5.21E+04 8.11E+05 4.17E+05 7.75E+04 4.39E+05 1.11E+05 1.07E+05 5.88E+05 1.20E+05

Prephenate 1.24E+05 1.15E+05 1.29E+05 1.13E+05 7.95E+05 6.51E+05 5.58E+05 1.05E+05 1.65E+05 7.11E+05 1.17E+05 1.03E+06

Proline 2.10E+05 1.19E+05 1.09E+05 2.63E+05 1.54E+05 1.94E+05 1.99E+05 1.97E+05 2.26E+05 1.67E+05 1.32E+05 1.71E+05

Pyroglutamic acid 6.32E+06 1.68E+06 1.86E+06 1.35E+07 3.42E+06 1.60E+06 1.06E+06 2.70E+06 3.18E+06 1.73E+06 4.50E+06 3.53E+06

Pyruvate 1.07E+06 1.69E+06 1.06E+06 2.82E+06 1.30E+06 1.09E+06 9.21E+05 7.74E+05 9.61E+05 1.51E+06 1.14E+06 1.78E+06

Ribose phosphate 1.23E+05 9.35E+04 1.41E+05 1.10E+05 4.16E+05 2.48E+05 2.33E+05 1.55E+05 1.72E+05 1.91E+05 1.56E+05 5.04E+05 S-Adenosyl-L-homocysteine 5.91E+03 4.69E+03 2.21E+03 7.61E+03 5.98E+03 3.66E+03 4.89E+03 6.25E+03 5.51E+03 3.55E+03 1.92E+03 6.56E+03

Sarcosine 2.89E+06 2.88E+06 2.39E+06 2.85E+06 2.81E+06 2.29E+06 2.49E+06 2.46E+06 2.44E+06 1.93E+06 2.08E+06 2.62E+06 Sedoheptulose 1/7-phosphate 2.06E+04 1.81E+04 2.14E+04 2.01E+04 8.81E+03 7.90E+03 1.39E+04 2.43E+04 1.77E+04 2.30E+03 1.15E+04 1.09E+04

Serine 3.27E+06 2.88E+06 3.41E+06 5.27E+06 3.57E+06 2.92E+06 3.55E+06 2.78E+06 3.09E+06 2.98E+06 3.00E+06 3.49E+06 sn-Glycerol 3-phosphate 7.83E+04 5.53E+04 8.58E+04 6.80E+04 2.64E+04 2.14E+04 1.31E+04 1.02E+05 8.81E+04 2.82E+04 7.72E+04 1.74E+04

Succinate 3.42E+07 2.10E+07 7.26E+06 1.60E+07 2.94E+06 1.06E+06 1.86E+06 1.25E+07 1.30E+07 2.07E+06 6.79E+06 3.13E+06

Sulfolactate 2.68E+05 2.03E+04 3.32E+04 7.85E+03 2.34E+03 2.44E+03 3.48E+03 1.99E+04 4.70E+03 2.46E+03 2.94E+04 2.39E+03

Taurine 3.16E+07 2.26E+07 2.39E+07 3.01E+07 3.65E+07 2.50E+07 3.08E+07 2.92E+07 2.82E+07 2.25E+07 2.45E+07 2.85E+07

Threonine 9.52E+05 7.57E+05 9.34E+05 1.49E+06 6.44E+05 1.03E+06 1.21E+06 1.15E+06 1.01E+06 1.06E+06 8.20E+05 1.01E+06

Thymidine 1.07E+04 4.01E+03 6.82E+03 7.23E+03 8.41E+03 1.00E+02 1.00E+02 3.68E+03 2.95E+03 1.00E+02 2.55E+03 5.57E+03

Trehalose/sucrose 3.48E+04 1.11E+05 2.02E+05 1.10E+05 5.05E+04 5.12E+04 3.88E+04 7.68E+04 5.08E+04 7.11E+04 1.06E+05 4.74E+04

Tryptophan 3.12E+05 3.13E+05 3.63E+05 8.52E+05 3.58E+05 2.43E+05 3.08E+05 2.91E+05 3.39E+05 1.93E+05 2.69E+05 2.91E+05

Tyrosine 1.70E+06 1.76E+06 1.70E+06 3.44E+06 2.00E+06 1.54E+06 1.65E+06 1.42E+06 1.57E+06 1.08E+06 1.40E+06 1.53E+06

UDP-glucose 3.91E+05 4.19E+05 3.35E+05 4.13E+05 4.73E+05 2.88E+05 6.94E+05 3.11E+05 3.65E+05 2.11E+05 3.22E+05 4.90E+05 UDP-N-acetylglucosamine 3.82E+05 3.62E+05 3.02E+05 3.93E+05 3.89E+05 3.06E+05 6.25E+05 3.20E+05 3.45E+05 2.54E+05 3.07E+05 3.80E+05

UMP 5.23E+05 4.42E+05 4.07E+05 5.15E+05 3.50E+05 1.80E+05 3.85E+05 4.67E+05 3.99E+05 1.93E+05 4.30E+05 4.92E+05

70

Table 1.5 Continued

Sample Name H6 H7 H8 H9 H14 H15 H17 H23 H24 H35 H36 H41

Uracil 2.59E+05 1.38E+05 1.76E+05 1.57E+05 5.94E+05 5.95E+05 5.03E+05 3.88E+05 4.24E+05 5.02E+05 2.57E+05 5.03E+05

Uric acid 1.02E+05 7.57E+04 7.21E+04 2.57E+05 1.04E+05 1.00E+05 9.48E+04 8.21E+04 8.32E+04 4.94E+04 9.00E+04 6.06E+04

Uridine 6.38E+04 5.49E+04 5.51E+04 7.10E+04 6.51E+04 4.96E+04 5.57E+04 6.63E+04 6.89E+04 4.55E+04 4.77E+04 6.48E+04

Valine 9.88E+05 8.26E+05 7.24E+05 1.93E+06 7.36E+05 7.23E+05 7.84E+05 7.83E+05 8.87E+05 5.99E+05 7.67E+05 7.56E+05

Xanthine 1.49E+03 4.35E+03 2.29E+03 4.09E+03 7.37E+02 1.04E+04 1.12E+04 2.97E+03 3.52E+03 3.52E+03 1.26E+04 9.97E+03

Xanthine 4.02E+05 3.51E+05 6.90E+05 8.54E+05 8.91E+05 7.12E+05 5.75E+05 6.73E+05 7.43E+05 6.26E+05 3.61E+05 1.19E+06

Xanthosine 2.18E+03 1.10E+04 3.05E+03 7.21E+03 3.70E+03 8.97E+03 5.68E+03 6.63E+03 8.44E+03 5.57E+03 5.61E+03 1.50E+04

71

Table 1.6 Raw Data of Dominant Hamsters from HPC

Sample Name H2 H3 H4 H12 H19 H21 H25 H28 H33 H40

1-Methyladenosine 9.91E+03 6.52E+03 5.54E+03 4.12E+03 3.68E+03 2.06E+03 5.78E+03 2.93E+03 6.05E+03 3.15E+03

2-Aminoadipate 1.27E+04 1.34E+04 1.54E+04 3.38E+04 4.67E+04 1.65E+04 2.21E+04 4.07E+04 9.84E+03 3.76E+04

2-Dehydro-D-gluconate 3.79E+03 4.17E+03 3.72E+03 1.17E+04 3.01E+03 3.82E+03 4.83E+03 3.78E+03 3.37E+03 4.85E+03

2-Hydroxy-2-methylsuccinate 2.10E+05 2.43E+05 2.12E+05 9.52E+05 1.56E+05 1.07E+05 1.75E+05 6.85E+04 1.17E+05 2.25E+05

3-Methoxytyramine 4.44E+04 5.14E+04 4.68E+04 1.69E+05 5.69E+04 5.73E+04 4.67E+04 4.46E+04 4.74E+04 4.20E+04

3_4-Dihydroxyphenylacetate 2.37E+04 2.13E+04 2.08E+04 1.02E+05 2.52E+04 3.56E+04 2.63E+04 4.35E+04 3.32E+04 3.71E+04

4-Aminobutyrate 1.01E+06 1.14E+06 1.09E+06 2.74E+06 5.30E+05 4.45E+05 8.73E+05 4.52E+05 8.10E+05 3.56E+05

5-Hydroxyindoleacetic acid 5.45E+04 7.39E+04 6.71E+04 3.21E+04 3.03E+04 8.18E+03 1.58E+04 1.05E+04 1.34E+04 9.48E+03

Acadesine 5.06E+03 5.94E+03 5.94E+03 1.22E+04 8.31E+03 6.36E+03 6.17E+03 7.94E+03 6.93E+03 8.38E+03

Acetyllysine 3.35E+03 2.56E+03 3.84E+03 6.70E+03 3.17E+03 3.09E+03 4.24E+03 2.99E+03 3.69E+03 3.34E+03

Adenine 1.76E+04 1.77E+04 1.77E+04 2.94E+04 8.74E+03 5.84E+03 1.27E+04 6.75E+03 1.12E+04 6.02E+03

Adenosine 3.41E+04 3.33E+04 1.45E+04 7.68E+05 2.98E+04 2.85E+05 6.90E+05 3.29E+05 5.29E+05 9.53E+04

AICAR 8.61E+03 8.21E+03 1.01E+04 4.41E+04 1.12E+04 9.03E+03 1.06E+04 8.99E+03 6.08E+03 1.30E+04

Alanine 1.45E+06 1.40E+06 1.20E+06 2.66E+06 1.19E+06 1.12E+06 1.29E+06 1.16E+06 1.23E+06 1.08E+06

Allantoate 3.06E+03 1.68E+03 3.83E+03 1.11E+04 2.08E+03 6.72E+02 3.22E+03 1.63E+03 2.28E+03 7.37E+02

alpha-Ketoglutarate 1.80E+03 4.48E+03 2.54E+03 1.45E+04 1.44E+03 2.97E+03 3.17E+03 1.55E+03 1.54E+03 3.30E+03

AMP 3.35E+04 3.62E+04 1.15E+04 3.44E+06 2.88E+05 7.10E+05 8.03E+05 5.53E+05 6.39E+05 1.18E+06

Allantoin 2.81E+03 6.22E+03 6.24E+03 1.10E+04 6.29E+03 2.90E+03 3.32E+03 4.05E+03 3.24E+03 8.48E+03

Arginine 1.70E+04 2.18E+04 1.84E+04 1.13E+04 2.62E+04 1.30E+04 1.83E+04 1.85E+04 1.26E+04 2.13E+04

Ascorbate 1.11E+07 1.04E+07 1.46E+07 4.85E+07 6.30E+06 7.47E+06 1.54E+07 6.46E+06 1.09E+07 5.20E+06

Asparagine 4.81E+04 5.58E+04 6.24E+04 1.28E+05 3.91E+04 2.94E+04 5.70E+04 4.44E+04 3.97E+04 3.25E+04

Aspartate 2.30E+06 2.66E+06 2.53E+06 8.02E+06 2.65E+06 1.18E+06 2.25E+06 1.57E+06 1.75E+06 1.27E+06

beta-Alanine 1.45E+06 1.40E+06 1.20E+06 2.66E+06 1.19E+06 1.12E+06 1.29E+06 1.16E+06 1.23E+06 1.08E+06

Betaine 2.56E+05 2.61E+05 2.81E+05 7.73E+05 2.46E+05 1.86E+05 2.54E+05 3.00E+05 1.98E+05 2.33E+05

CDP-ethanolamine 3.25E+04 2.98E+04 2.47E+04 1.30E+05 3.22E+04 2.66E+04 3.42E+04 2.90E+04 3.42E+04 3.36E+04

Citrate/isocitrate 3.00E+03 4.75E+03 1.74E+03 7.36E+04 1.05E+04 1.63E+03 1.54E+04 2.44E+03 1.46E+03 3.82E+03

Citrulline 6.83E+04 7.90E+04 7.05E+04 8.47E+04 4.72E+04 5.04E+04 6.92E+04 6.22E+04 5.67E+04 4.54E+04

CMP 6.58E+03 7.20E+03 2.93E+03 5.34E+04 1.97E+04 1.68E+04 2.04E+04 1.63E+04 1.41E+04 2.94E+04

Creatine 1.50E+06 1.50E+06 1.32E+06 3.25E+06 1.37E+06 1.26E+06 1.38E+06 1.26E+06 1.33E+06 1.19E+06

72

Table 1.6 Continued

Sample Name H2 H3 H4 H12 H19 H21 H25 H28 H33 H40

Creatinine 1.36E+04 1.14E+04 1.69E+04 3.65E+04 1.39E+04 1.07E+04 1.10E+04 1.01E+04 1.00E+04 1.29E+04

Cystathionine 1.82E+05 1.75E+05 1.85E+05 3.72E+05 1.96E+05 2.16E+05 2.53E+05 2.38E+05 1.65E+05 2.94E+05

Cysteine 3.43E+05 3.42E+05 4.74E+05 1.91E+05 5.22E+05 9.10E+04 9.24E+04 1.01E+05 8.83E+04 1.06E+05

Cystine 1.83E+04 6.26E+04 2.80E+04 3.24E+03 2.83E+04 3.57E+03 2.16E+03 3.32E+03 2.36E+03 4.21E+03

Cytidine 6.54E+04 6.23E+04 9.61E+04 9.52E+04 3.55E+04 2.11E+04 4.67E+04 2.92E+04 3.75E+04 1.68E+04

Cytidine 3.30E+04 3.78E+04 3.81E+04 7.58E+04 4.85E+04 4.12E+04 3.56E+04 4.28E+04 2.96E+04 6.52E+04

D-Gluconate 5.16E+04 6.29E+04 5.81E+04 1.09E+05 4.27E+04 3.04E+04 4.76E+04 4.20E+04 3.69E+04 4.32E+04

D-Glucosamine 1-phosphate 7.72E+03 5.52E+03 6.52E+03 8.82E+02 4.77E+02 1.82E+02 2.56E+02 2.85E+02 2.06E+02 1.75E+02

D-Glyceraldehdye 3-phosphate 5.45E+05 5.49E+05 4.36E+05 8.39E+05 3.56E+05 1.53E+05 3.94E+05 1.79E+05 2.79E+05 3.01E+05

Diiodothyronine 1.73E+04 1.79E+04 1.27E+04 6.09E+04 2.30E+04 1.68E+04 1.57E+04 7.52E+03 1.03E+04 2.09E+04

Dimethylglycine 9.85E+04 1.07E+05 9.33E+04 3.69E+05 7.78E+04 7.22E+04 1.02E+05 6.87E+04 9.19E+04 7.01E+04

Dimethylglycine 1.01E+06 1.14E+06 1.09E+06 2.74E+06 5.30E+05 4.45E+05 8.73E+05 4.52E+05 8.10E+05 3.56E+05

Fumarate 1.37E+05 1.59E+05 1.65E+05 4.09E+05 4.43E+04 7.19E+04 1.69E+05 3.97E+04 9.54E+04 7.02E+04

Glucosamine 1.00E+02 3.86E+03 4.28E+02 1.00E+02 1.00E+02 4.08E+02 1.00E+02 1.42E+04 2.74E+02 4.16E+02

Glucose 1-phosphate 1.62E+05 1.74E+05 1.92E+05 4.56E+05 1.03E+05 8.30E+04 2.58E+05 9.85E+04 2.25E+05 9.33E+04

Glucose 6-phosphate 8.84E+05 3.79E+05 8.04E+05 1.61E+05 1.02E+05 3.44E+04 1.39E+05 1.12E+05 8.71E+04 8.92E+04

Glutamate 3.17E+07 3.14E+07 3.18E+07 1.04E+08 2.54E+07 2.26E+07 3.43E+07 2.32E+07 2.82E+07 2.38E+07

Glutamine 1.42E+07 1.37E+07 1.49E+07 3.09E+07 1.22E+07 9.81E+06 1.40E+07 1.09E+07 1.28E+07 1.11E+07

Glutathione 5.74E+06 5.98E+06 5.63E+06 1.88E+07 4.32E+06 5.21E+06 9.15E+06 5.68E+06 6.96E+06 6.62E+06

Glutathione disulfide 8.46E+04 1.05E+05 6.43E+04 9.93E+04 2.62E+04 1.28E+04 3.58E+04 1.86E+04 2.09E+04 2.78E+04

GMP 4.48E+03 6.72E+03 6.66E+02 2.99E+05 3.14E+04 5.23E+04 7.53E+04 5.70E+04 6.96E+04 7.51E+04

Guanine 6.57E+03 5.07E+03 6.24E+03 7.08E+03 5.40E+03 2.12E+03 1.50E+03 2.33E+03 4.69E+03 3.12E+03

Guanosine 1.05E+06 1.04E+06 1.10E+06 5.19E+05 4.96E+05 1.37E+05 3.19E+05 2.18E+05 2.49E+05 1.10E+05

Histidine 2.61E+04 2.12E+04 3.02E+04 3.66E+04 1.92E+04 1.47E+04 1.84E+04 2.35E+04 1.53E+04 1.78E+04

Homocysteic acid 1.45E+04 8.34E+03 1.33E+04 2.75E+04 1.37E+04 8.69E+03 1.03E+04 1.24E+04 9.68E+03 7.77E+03

Homoserine 3.15E+05 3.59E+05 3.74E+05 6.41E+05 3.97E+05 3.02E+05 3.70E+05 4.12E+05 2.52E+05 3.65E+05

Hydroxyphenylacetate 1.56E+05 1.88E+05 1.49E+05 2.49E+05 7.73E+04 9.30E+04 5.38E+04 3.34E+05 1.34E+05 8.12E+04

Hypoxanthine 8.87E+05 8.69E+05 9.16E+05 6.59E+05 9.62E+05 1.32E+05 2.60E+05 2.89E+05 1.58E+05 2.76E+05

Hypoxanthine 4.50E+03 6.64E+03 3.12E+03 5.35E+03 2.29E+03 3.67E+02 2.03E+03 1.82E+03 1.69E+03 2.22E+03

73

Table 1.6 Continued

Sample Name H2 H3 H4 H12 H19 H21 H25 H28 H33 H40

IMP 2.21E+04 1.81E+04 1.87E+04 2.64E+05 3.41E+04 5.54E+04 9.76E+04 5.82E+04 1.08E+05 3.72E+04

Inosine 5.34E+06 5.13E+06 5.35E+06 3.24E+06 3.59E+06 8.63E+05 1.87E+06 1.69E+06 1.47E+06 1.40E+06

Lactate 3.57E+07 4.40E+07 4.61E+07 9.17E+07 4.26E+07 3.47E+07 4.14E+07 4.15E+07 3.61E+07 4.42E+07

Leucine/Isoleucine 1.70E+05 2.17E+05 2.54E+05 3.71E+05 1.85E+05 8.52E+04 1.31E+05 1.50E+05 7.81E+04 1.30E+05

Lysine 7.98E+03 7.99E+03 7.17E+03 5.89E+03 9.04E+03 7.81E+03 8.51E+03 6.45E+03 4.28E+03 6.98E+03

Malate 3.63E+06 4.59E+06 4.36E+06 1.04E+07 1.68E+06 1.52E+06 2.84E+06 1.27E+06 1.84E+06 2.02E+06

Mandelate 6.42E+04 5.50E+04 5.13E+04 1.67E+05 9.25E+04 7.39E+04 1.02E+05 6.53E+04 7.65E+04 9.03E+04

Methionine 3.69E+05 3.36E+05 4.09E+05 8.30E+05 3.61E+05 1.68E+05 2.64E+05 2.42E+05 2.64E+05 2.20E+05

Methionine sulfoxide 2.59E+04 3.53E+04 3.06E+04 3.92E+04 3.26E+04 3.23E+04 3.43E+04 2.56E+04 2.93E+04 2.91E+04

Methylmalonate 5.03E+05 6.34E+05 3.88E+05 5.63E+06 5.39E+05 1.52E+06 1.88E+06 1.41E+06 1.17E+06 2.10E+06

myo-Inositol 2.89E+05 3.30E+05 3.51E+05 6.69E+05 3.24E+05 3.54E+05 3.39E+05 3.93E+05 3.31E+05 3.52E+05

N-Acetyl-beta-alanine 1.41E+04 1.42E+04 1.92E+04 3.12E+04 2.02E+04 9.01E+03 1.12E+04 1.05E+04 9.77E+03 1.41E+04

N-Acetylglutamate 3.63E+05 3.46E+05 3.30E+05 1.07E+06 2.04E+05 2.34E+05 3.60E+05 1.49E+05 2.47E+05 1.89E+05

N-Acetylglutamine 2.98E+05 2.73E+05 3.46E+05 4.11E+05 4.01E+05 1.75E+05 2.49E+05 1.84E+05 2.23E+05 4.25E+05

N-Acetylornithine 5.09E+03 4.90E+03 4.63E+03 1.52E+04 3.97E+03 3.96E+03 6.02E+03 3.29E+03 5.69E+03 4.44E+03

N-Acetyltaurine 1.23E+05 1.01E+05 8.26E+04 1.46E+05 4.59E+04 6.55E+04 1.24E+05 6.32E+04 7.98E+04 5.01E+04

N-Acetyltaurine 3.15E+03 3.12E+03 3.91E+03 2.46E+03 1.17E+04 2.47E+03 2.16E+03 4.58E+03 1.47E+03 2.87E+03

N-Carbamoyl-L-aspartate 5.09E+04 1.00E+05 1.01E+05 3.58E+05 8.49E+04 7.47E+04 1.00E+05 6.50E+04 8.67E+04 6.92E+04

NAD+ 7.16E+02 1.57E+03 6.07E+02 4.69E+04 2.72E+03 9.22E+03 3.65E+03 3.25E+03 2.93E+03 7.88E+03

Orotate 1.45E+04 1.68E+04 1.22E+04 3.69E+04 1.03E+04 7.44E+03 1.42E+04 8.21E+03 1.26E+04 8.36E+03

Pantothenate 4.63E+05 4.80E+05 4.55E+05 1.59E+06 6.92E+05 3.83E+05 5.08E+05 4.50E+05 3.91E+05 6.46E+05

Phenylalanine 1.67E+05 1.68E+05 1.91E+05 2.26E+05 2.30E+05 1.05E+05 1.12E+05 1.79E+05 1.16E+05 1.70E+05

Phenyllactic acid 9.86E+04 1.14E+05 1.05E+05 2.61E+05 7.34E+04 7.68E+04 5.67E+04 2.01E+05 8.55E+04 7.42E+04

Proline 9.99E+04 9.59E+04 8.50E+04 1.85E+05 7.05E+04 4.21E+04 7.96E+04 9.72E+04 6.45E+04 7.31E+04

Pyroglutamic acid 2.41E+06 2.39E+06 3.64E+06 2.92E+06 2.31E+06 1.18E+06 7.54E+05 1.83E+06 9.69E+05 1.39E+06

Pyruvate 4.55E+05 4.85E+05 6.53E+05 1.02E+06 3.04E+05 4.25E+05 3.19E+05 5.54E+05 3.42E+05 6.27E+05

Ribose phosphate 5.00E+05 4.39E+05 4.33E+05 3.08E+05 3.46E+05 7.38E+04 1.71E+05 1.19E+05 1.53E+05 8.81E+04

74

Table 1.6 Continued

Sample Name H2 H3 H4 H12 H19 H21 H25 H28 H33 H40

Sedoheptulose 1/7-phosphate 8.05E+04 5.86E+04 1.07E+05 2.03E+04 3.34E+04 3.65E+03 1.20E+04 9.69E+03 1.08E+04 5.80E+03

Serine 1.06E+06 1.10E+06 1.22E+06 2.30E+06 1.05E+06 9.04E+05 1.14E+06 1.21E+06 9.11E+05 1.12E+06

sn-Glycerol 3-phosphate 2.27E+04 2.43E+04 1.19E+04 6.57E+04 2.36E+04 5.81E+04 2.30E+04 2.07E+04 1.99E+04 3.30E+04

Succinate 5.03E+05 6.34E+05 3.88E+05 5.63E+06 5.39E+05 1.52E+06 1.88E+06 1.41E+06 1.17E+06 2.10E+06

Taurine 1.29E+07 1.17E+07 1.15E+07 3.93E+07 9.15E+06 8.71E+06 1.24E+07 9.90E+06 1.07E+07 1.06E+07

Thymidine 7.69E+03 5.80E+03 7.67E+03 4.78E+03 5.32E+03 2.23E+03 5.58E+03 3.73E+03 6.16E+03 3.60E+03

Thymine 5.91E+03 5.98E+03 5.32E+03 3.99E+03 5.81E+03 2.50E+03 6.14E+03 4.43E+03 2.67E+03 4.07E+03

Trehalose/sucrose 3.99E+04 4.52E+04 4.82E+04 3.24E+04 3.39E+04 5.79E+04 2.39E+04 1.55E+05 7.08E+04 6.95E+04

Tryptophan 2.29E+05 2.05E+05 2.09E+05 3.63E+05 2.09E+05 1.44E+05 1.96E+05 1.86E+05 1.88E+05 1.74E+05

Tyrosine 6.21E+05 5.92E+05 6.28E+05 1.46E+06 5.72E+05 4.96E+05 5.82E+05 5.87E+05 6.39E+05 5.51E+05

UDP-glucose 3.92E+04 6.06E+04 7.39E+04 4.23E+05 1.02E+05 1.02E+05 1.39E+05 1.31E+05 1.07E+05 1.20E+05

UDP-N-acetylglucosamine 7.74E+04 8.34E+04 9.07E+04 3.84E+05 7.89E+04 8.17E+04 1.44E+05 1.13E+05 1.15E+05 9.79E+04

UMP 8.12E+03 8.30E+03 2.61E+03 5.53E+05 4.89E+04 1.12E+05 1.33E+05 9.03E+04 9.24E+04 1.77E+05

Uracil 4.02E+05 4.09E+05 4.42E+05 4.70E+05 2.86E+05 4.18E+04 1.75E+05 9.26E+04 1.25E+05 6.94E+04

Uric acid 3.73E+04 4.24E+04 3.77E+04 1.18E+05 5.85E+04 3.73E+04 3.18E+04 5.36E+04 3.67E+04 7.97E+04

Uridine 2.88E+04 2.59E+04 2.71E+04 7.66E+04 1.73E+04 1.39E+04 2.46E+04 1.63E+04 2.27E+04 1.56E+04

Xanthine 6.69E+05 6.36E+05 6.62E+05 6.57E+05 5.41E+05 9.27E+04 2.39E+05 2.40E+05 1.66E+05 2.15E+05

Xanthosine 1.20E+04 1.13E+04 1.01E+04 2.39E+03 7.11E+03 1.66E+03 4.14E+03 2.92E+03 2.21E+03 2.62E+03

75

Table 1.7 Raw Data of Handled Control Hamsters from HPC

Sample Name H1 H10 H18 H26 H19 H32 H34 H43 H44 H49 H52 H53

1-Methyladenosine 4.89E+03 5.04E+03 6.05E+03 4.96E+03 6.29E+03 4.28E+03 4.88E+03 6.28E+03 9.10E+03 1.11E+04 9.67E+03 7.23E+03

2-Aminoadipate 2.97E+04 2.64E+04 8.87E+03 1.26E+04 1.14E+04 8.96E+03 1.40E+04 1.20E+04 1.07E+04 1.10E+04 1.33E+04 1.45E+04

2-Dehydro-D-gluconate 1.35E+03 9.26E+03 4.12E+03 4.27E+03 5.05E+03 5.75E+03 4.85E+03 5.41E+03 6.09E+03 4.32E+03 4.10E+03 3.89E+03

2-Hydroxy-2-methylsuccinate 5.49E+04 4.56E+05 1.63E+05 1.06E+05 9.35E+04 1.61E+05 1.37E+05 1.73E+05 2.09E+05 1.88E+05 1.64E+05 1.23E+05

3-Methoxytyramine 4.76E+04 1.33E+05 4.44E+04 4.73E+04 5.35E+04 5.04E+04 5.67E+04 4.16E+04 5.30E+04 1.73E+05 5.54E+04 3.65E+04

3_4-Dihydroxyphenylacetate 2.07E+04 1.25E+05 3.04E+04 2.73E+04 2.14E+04 3.64E+04 3.23E+04 2.47E+04 2.09E+04 2.92E+04 2.21E+04 2.05E+04

4-Aminobutyrate 4.83E+05 2.30E+06 7.61E+05 8.07E+05 1.01E+06 8.61E+05 1.01E+06 1.20E+06 1.08E+06 1.06E+06 7.56E+05 8.27E+05

5-Hydroxyindoleacetic acid 4.04E+04 1.73E+04 7.31E+03 1.12E+04 5.16E+04 1.24E+04 3.54E+04 6.66E+04 4.89E+04 6.37E+04 2.89E+04 4.89E+04

Acadesine 7.60E+03 9.00E+03 4.30E+03 5.82E+03 5.65E+03 6.01E+03 5.93E+03 5.87E+03 7.18E+03 7.53E+03 7.12E+03 5.75E+03

Acetyllysine 2.89E+03 7.57E+03 2.88E+03 3.20E+03 3.58E+03 4.01E+03 2.72E+03 2.40E+03 1.27E+03 2.62E+03 1.73E+03 2.19E+03

Adenine 6.16E+03 3.18E+04 8.44E+03 1.20E+04 1.54E+04 1.44E+04 1.29E+04 1.80E+04 1.54E+04 1.77E+04 1.74E+04 1.25E+04

Adenosine 1.51E+04 7.16E+05 4.78E+05 5.54E+05 7.60E+04 4.67E+05 5.28E+04 6.95E+04 2.16E+04 3.87E+04 4.08E+04 4.54E+04

AICAR 1.22E+04 4.01E+04 1.07E+04 1.15E+04 1.18E+04 8.83E+03 8.92E+03 1.21E+04 7.26E+03 1.18E+04 8.58E+03 8.51E+03

Alanine 9.87E+05 2.62E+06 1.11E+06 1.41E+06 1.32E+06 1.39E+06 1.29E+06 1.38E+06 1.16E+06 1.25E+06 1.32E+06 1.31E+06

Allantoate 3.60E+02 5.51E+03 2.36E+03 2.84E+03 5.61E+03 4.17E+03 3.96E+03 4.68E+03 3.59E+02 1.38E+03 1.00E+02 1.88E+03

alpha-Ketoglutarate 1.16E+03 9.32E+03 3.13E+03 2.94E+03 3.27E+03 4.13E+03 2.73E+03 1.81E+03 2.62E+03 1.63E+03 2.32E+03 1.16E+03

AMP 5.81E+05 3.19E+06 8.33E+05 9.90E+05 3.91E+04 9.01E+05 3.16E+04 2.20E+04 1.64E+04 1.28E+04 2.01E+04 4.15E+04

Allantoin 4.16E+03 1.26E+04 2.39E+03 4.11E+03 3.91E+03 3.26E+03 3.67E+03 4.66E+03 1.18E+04 2.43E+03 3.92E+03 4.66E+03

Arginine 2.44E+04 1.94E+04 1.30E+04 1.63E+04 2.69E+04 1.57E+04 2.12E+04 2.19E+04 1.60E+04 2.35E+04 1.75E+04 1.80E+04

Ascorbate 3.98E+06 2.96E+07 1.32E+07 1.53E+07 1.45E+07 1.59E+07 1.27E+07 1.55E+07 3.65E+06 5.24E+06 1.06E+03 7.44E+06

Asparagine 3.98E+04 1.08E+05 3.93E+04 5.17E+04 6.01E+04 5.02E+04 5.79E+04 5.66E+04 5.88E+04 5.60E+04 4.58E+04 4.70E+04

Aspartate 2.55E+06 7.68E+06 1.82E+06 2.29E+06 2.57E+06 2.26E+06 2.62E+06 3.15E+06 2.67E+06 2.62E+06 2.36E+06 2.28E+06

beta-Alanine 9.87E+05 2.62E+06 1.11E+06 1.41E+06 1.32E+06 1.39E+06 1.29E+06 1.38E+06 1.16E+06 1.25E+06 1.32E+06 1.31E+06

Betaine 2.05E+05 7.15E+05 1.66E+05 2.20E+05 2.75E+05 2.47E+05 2.60E+05 2.88E+05 2.52E+05 2.76E+05 2.40E+05 2.37E+05

CDP-ethanolamine 2.72E+04 1.33E+05 3.08E+04 3.11E+04 3.54E+04 4.12E+04 3.20E+04 4.23E+04 2.72E+04 2.56E+04 2.48E+04 2.44E+04

Citrate/isocitrate 2.71E+03 2.59E+03 2.69E+03 2.73E+03 3.43E+03 3.35E+03 5.74E+04 4.50E+03 1.59E+04 5.05E+03 3.51E+03 2.40E+03

76

Table 1.7 Continued

Sample Name H1 H10 H18 H26 H19 H32 H34 H43 H44 H49 H52 H53

Citrulline 3.86E+04 8.31E+04 5.85E+04 8.60E+04 9.17E+04 5.94E+04 8.19E+04 6.61E+04 6.46E+04 5.33E+04 6.14E+04 4.61E+04

CMP 1.64E+04 3.94E+04 1.45E+04 2.10E+04 1.07E+04 1.62E+04 8.87E+03 7.04E+03 5.43E+03 3.42E+03 3.45E+03 7.09E+03

Creatine 1.09E+06 3.05E+06 1.25E+06 1.52E+06 1.37E+06 1.47E+06 1.40E+06 1.52E+06 1.28E+06 1.44E+06 1.38E+06 1.42E+06

Creatinine 9.96E+03 2.96E+04 9.85E+03 1.24E+04 1.44E+04 1.54E+04 1.35E+04 1.26E+04 1.49E+04 1.48E+04 1.72E+04 1.18E+04

Cystathionine 1.06E+05 4.21E+05 1.64E+05 2.50E+05 2.37E+05 2.64E+05 2.12E+05 1.91E+05 1.24E+05 1.82E+05 1.11E+05 1.64E+05

Cysteine 3.51E+05 1.90E+05 1.01E+05 1.18E+05 4.47E+05 1.10E+05 4.31E+05 5.38E+05 6.19E+04 1.20E+05 1.56E+04 4.15E+05

Cystine 2.40E+04 5.92E+03 2.31E+03 3.72E+03 1.63E+04 8.29E+03 2.54E+04 2.41E+04 1.34E+05 1.67E+05 1.05E+05 2.00E+04

Cytidine 2.31E+04 1.10E+05 3.49E+04 4.28E+04 7.39E+04 5.12E+04 5.85E+04 8.87E+04 8.23E+04 7.73E+04 3.83E+04 4.90E+04

Cytidine 6.25E+04 8.11E+04 3.62E+04 3.49E+04 2.97E+04 3.85E+04 3.13E+04 2.90E+04 3.97E+04 3.42E+04 2.89E+04 3.25E+04

D-Gluconate 3.60E+04 1.16E+05 3.00E+04 3.72E+04 8.16E+04 5.99E+04 5.10E+04 5.56E+04 7.77E+04 5.44E+04 6.21E+04 4.23E+04

D-Glucosamine 1-phosphate 1.00E+02 5.00E+02 2.30E+02 1.78E+02 5.10E+03 4.14E+02 6.31E+03 6.79E+03 5.98E+03 6.55E+03 5.38E+03 3.85E+03

D-Glyceraldehdye 3-

phosphate

1.75E+05 7.99E+05 2.12E+05 3.72E+05 4.81E+05 3.32E+05 4.98E+05 5.71E+05 4.52E+05 4.49E+05 4.02E+05 3.45E+05

Diiodothyronine 1.92E+04 4.55E+04 1.58E+04 1.55E+04 1.36E+04 1.78E+04 1.49E+04 1.29E+04 1.46E+04 1.65E+04 9.96E+03 1.28E+04

Dimethylglycine 5.09E+04 3.25E+05 8.55E+04 1.06E+05 1.06E+05 1.10E+05 9.06E+04 1.16E+05 9.02E+04 1.14E+05 9.86E+04 8.00E+04

Dimethylglycine 4.83E+05 2.30E+06 7.61E+05 8.07E+05 1.01E+06 8.61E+05 1.01E+06 1.20E+06 1.08E+06 1.06E+06 7.56E+05 8.27E+05

Fumarate 3.34E+04 2.75E+05 1.37E+05 1.11E+05 1.07E+05 1.88E+05 1.15E+05 1.11E+05 1.32E+05 1.25E+05 8.92E+04 1.02E+05

Glucosamine 5.74E+02 1.00E+02 3.31E+03 4.09E+02 1.00E+02 1.37E+03 4.12E+02 5.91E+02 1.00E+02 2.48E+03 3.60E+02 4.99E+02

Glucose 1-phosphate 4.74E+04 3.22E+05 1.97E+05 1.51E+05 1.34E+05 2.58E+05 1.43E+05 2.52E+05 1.96E+05 2.22E+05 1.04E+05 1.25E+05

Glucose 6-phosphate 6.50E+04 1.87E+05 5.22E+04 1.04E+05 6.52E+05 8.02E+04 7.49E+05 7.79E+05 6.51E+05 8.02E+05 5.61E+05 3.29E+05

Glutamate 2.30E+07 9.87E+07 2.79E+07 3.10E+07 3.10E+07 3.61E+07 3.09E+07 3.38E+07 2.91E+07 3.13E+07 2.96E+07 2.93E+07

Glutamine 1.26E+07 2.63E+07 1.37E+07 1.33E+07 1.43E+07 1.42E+07 1.42E+07 1.36E+07 1.23E+07 1.24E+07 1.19E+07 1.29E+07

Glutathione 3.61E+06 1.56E+07 7.14E+06 8.02E+06 6.48E+06 9.71E+06 5.64E+06 6.95E+06 2.92E+06 4.16E+06 2.91E+06 4.92E+06

Glutathione disulfide 2.49E+04 7.16E+04 1.55E+04 2.25E+04 5.45E+04 6.72E+04 6.26E+04 1.04E+05 3.72E+05 2.86E+05 1.70E+05 4.08E+04

GMP 4.43E+04 2.86E+05 6.97E+04 7.56E+04 7.05E+03 8.36E+04 9.19E+03 2.04E+03 1.61E+03 8.00E+02 5.46E+03 1.27E+04

Guanine 6.67E+03 6.77E+03 3.21E+03 1.02E+03 5.17E+03 4.16E+03 3.74E+03 8.87E+03 5.82E+03 8.21E+03 5.65E+03 4.76E+03

77

Table 1.7 Continued

Sample Name H1 H10 H18 H26 H19 H32 H34 H43 H44 H49 H52 H53

Guanosine 2.06E+05 5.23E+05 1.78E+05 2.45E+05 1.09E+06 3.05E+05 1.04E+06 1.24E+06 9.79E+05 1.01E+06 8.72E+05 8.77E+05

Histidine 2.09E+04 3.42E+04 1.69E+04 1.67E+04 1.82E+04 1.67E+04 2.54E+04 2.75E+04 1.84E+04 2.43E+04 1.94E+04 2.21E+04

Homocysteic acid 6.90E+03 1.31E+04 1.27E+04 1.18E+04 1.51E+04 1.26E+04 1.15E+04 1.28E+04 9.76E+03 1.10E+04 4.68E+02 1.21E+04

Homoserine 3.19E+05 6.96E+05 2.33E+05 3.65E+05 3.98E+05 3.60E+05 3.71E+05 3.01E+05 3.42E+05 3.17E+05 2.87E+05 3.04E+05

Hydroxyphenylacetate 7.08E+04 1.79E+05 1.75E+05 1.13E+05 1.02E+05 4.70E+04 1.32E+05 3.02E+05 2.30E+05 3.51E+05 1.16E+05 1.66E+05

Hypoxanthine 7.40E+05 7.26E+05 1.41E+05 2.21E+05 8.67E+05 2.54E+05 7.02E+05 9.41E+05 8.30E+05 9.26E+05 7.99E+05 7.39E+05

Hypoxanthine 2.77E+03 2.07E+03 1.22E+03 1.92E+03 3.52E+03 4.88E+03 4.04E+03 3.28E+03 1.18E+04 1.25E+04 1.42E+04 8.93E+03

IMP 5.67E+04 2.28E+05 1.17E+05 1.19E+05 1.56E+04 1.12E+05 1.56E+04 1.74E+04 1.70E+04 1.68E+04 1.68E+04 2.10E+04

Inosine 2.29E+06 3.41E+06 1.02E+06 1.44E+06 5.50E+06 1.98E+06 5.12E+06 5.53E+06 4.94E+06 5.18E+06 4.78E+06 4.48E+06

Lactate 3.78E+07 8.85E+07 3.61E+07 4.35E+07 4.53E+07 4.41E+07 3.87E+07 4.45E+07 4.01E+07 3.98E+07 3.83E+07 3.78E+07

Leucine/Isoleucine 1.66E+05 4.55E+05 8.26E+04 1.03E+05 2.41E+05 1.89E+05 1.62E+05 2.02E+05 2.26E+05 2.50E+05 2.04E+05 1.72E+05

Lysine 1.02E+04 7.72E+03 4.36E+03 5.81E+03 8.64E+03 6.35E+03 7.18E+03 1.05E+04 7.72E+03 6.93E+03 6.30E+03 7.97E+03

Malate 1.09E+06 7.12E+06 2.41E+06 2.22E+06 3.17E+06 3.73E+06 2.80E+06 3.65E+06 3.86E+06 3.75E+06 2.39E+06 2.22E+06

Mandelate 6.10E+04 1.87E+05 5.35E+04 9.38E+04 8.83E+04 7.10E+04 8.24E+04 1.13E+05 7.16E+04 6.43E+04 7.20E+04 5.87E+04

Methionine 2.95E+05 7.33E+05 2.33E+05 2.55E+05 3.50E+05 2.70E+05 3.38E+05 4.47E+05 3.59E+05 4.08E+05 3.25E+05 3.34E+05

Methionine sulfoxide 1.88E+04 6.89E+04 2.32E+04 2.78E+04 2.73E+04 2.38E+04 3.29E+04 3.09E+04 4.51E+04 2.38E+04 3.03E+04 2.54E+04

Methylmalonate 6.13E+05 4.93E+06 2.08E+06 1.55E+06 4.57E+05 2.34E+06 7.24E+05 5.94E+05 4.71E+05 7.03E+05 3.73E+05 4.06E+05

myo-Inositol 3.14E+05 1.14E+06 3.08E+05 3.64E+05 3.44E+05 3.67E+05 3.47E+05 3.79E+05 3.26E+05 3.40E+05 3.25E+05 2.95E+05

N-Acetyl-beta-alanine 1.40E+04 2.87E+04 1.30E+04 1.07E+04 2.18E+04 1.63E+04 1.45E+04 2.39E+04 1.98E+04 2.27E+04 1.88E+04 1.44E+04

N-Acetylglutamate 1.56E+05 5.95E+05 2.64E+05 3.82E+05 4.68E+05 3.98E+05 3.97E+05 3.67E+05 2.57E+05 2.51E+05 3.60E+05 3.12E+05

N-Acetylglutamine 2.80E+05 3.78E+05 2.46E+05 2.94E+05 4.23E+05 4.32E+05 3.71E+05 4.07E+05 2.89E+05 2.47E+05 3.20E+05 3.20E+05

N-Acetylornithine 3.35E+03 1.22E+04 3.73E+03 8.23E+03 4.81E+03 5.67E+03 6.77E+03 7.80E+03 4.57E+03 4.38E+03 6.32E+03 4.45E+03

N-Acetyltaurine 2.91E+04 1.05E+05 8.89E+04 1.56E+05 1.59E+05 1.64E+05 8.32E+04 1.22E+05 7.81E+04 8.69E+04 7.09E+04 7.61E+04

N-Acetyltaurine 2.65E+03 2.39E+03 9.53E+02 7.92E+02 4.86E+03 1.48E+03 1.14E+04 5.05E+03 1.98E+04 9.98E+03 7.36E+03 3.00E+04

N-Carbamoyl-L-aspartate 8.92E+04 3.12E+05 5.87E+04 9.19E+04 9.98E+04 8.30E+04 8.39E+04 1.15E+05 9.32E+04 9.59E+04 6.89E+04 9.83E+04

78

Table 1.7 Continued

Sample Name H1 H10 H18 H26 H19 H32 H34 H43 H44 H49 H52 H53

NAD+ 3.67E+03 2.02E+04 1.42E+04 3.94E+03 1.52E+03 9.39E+03 9.94E+02 1.53E+03 6.90E+02 1.00E+02 6.66E+02 1.13E+03

Orotate 9.40E+03 2.44E+04 1.55E+04 1.54E+04 1.64E+04 1.85E+04 1.49E+04 2.22E+04 5.51E+04 2.39E+04 1.38E+04 1.25E+04

Pantothenate 6.66E+05 1.45E+06 4.50E+05 4.97E+05 5.48E+05 5.41E+05 4.74E+05 5.69E+05 4.72E+05 4.84E+05 4.84E+05 4.83E+05

Phenylalanine 1.90E+05 1.75E+05 8.83E+04 9.85E+04 1.73E+05 9.84E+04 1.82E+05 2.11E+05 1.88E+05 2.08E+05 1.75E+05 1.67E+05

Phenyllactic acid 6.65E+04 2.02E+05 1.04E+05 7.15E+04 7.70E+04 6.55E+04 7.77E+04 1.52E+05 1.30E+05 6.02E+05 9.16E+04 1.03E+05

Proline 5.46E+04 1.57E+05 5.49E+04 7.17E+04 8.86E+04 7.24E+04 8.26E+04 1.04E+05 9.66E+04 1.02E+05 1.02E+05 8.79E+04

Pyroglutamic acid 1.48E+06 2.48E+06 7.56E+05 6.43E+05 2.91E+06 8.87E+05 2.94E+06 3.89E+06 3.04E+06 3.34E+06 2.62E+06 2.20E+06

Pyruvate 2.70E+05 9.48E+05 4.63E+05 3.18E+05 4.40E+05 4.34E+05 4.16E+05 4.80E+05 4.74E+05 4.48E+05 4.98E+05 3.97E+05

Ribose phosphate 1.96E+05 3.01E+05 1.15E+05 1.57E+05 4.54E+05 1.73E+05 4.83E+05 4.73E+05 4.09E+05 4.49E+05 3.99E+05 3.13E+05

Ribose phosphate 1.21E+05 1.57E+05 6.47E+04 7.62E+04 4.58E+05 1.11E+05 4.44E+05 4.97E+05 4.08E+05 4.27E+05 3.94E+05 2.91E+05

Ribose phosphate 3.33E+05 3.24E+05 1.39E+05 1.37E+05 2.42E+05 2.10E+05 2.67E+05 2.21E+05 2.27E+05 2.58E+05 2.85E+05 2.10E+05

Ribose phosphate 3.33E+05 3.24E+05 1.39E+05 1.57E+05 4.58E+05 2.10E+05 4.83E+05 4.97E+05 4.08E+05 4.27E+05 3.94E+05 3.13E+05

Sedoheptulose 1/7-phosphate 2.07E+04 2.83E+04 6.21E+03 8.34E+03 6.92E+04 8.91E+03 8.26E+04 1.12E+05 6.48E+04 9.10E+04 8.41E+04 5.65E+04

Serine 1.01E+06 2.24E+06 8.54E+05 1.16E+06 1.33E+06 1.08E+06 1.32E+06 1.38E+06 1.29E+06 1.19E+06 1.05E+06 9.74E+05

sn-Glycerol 3-phosphate 2.88E+04 7.32E+04 2.68E+04 1.85E+04 1.67E+04 3.50E+04 1.26E+04 1.98E+04 1.01E+04 1.32E+04 1.32E+04 1.27E+04

Succinate 6.13E+05 4.93E+06 2.08E+06 1.55E+06 4.57E+05 2.34E+06 7.24E+05 5.94E+05 4.71E+05 7.03E+05 3.73E+05 4.06E+05

Taurine 7.94E+06 3.32E+07 1.03E+07 1.26E+07 1.29E+07 1.27E+07 1.20E+07 1.28E+07 1.13E+07 1.26E+07 1.08E+07 9.79E+06

Thymidine 1.71E+03 7.90E+03 3.25E+03 3.75E+03 7.79E+03 5.15E+03 6.18E+03 6.28E+03 5.75E+03 8.16E+03 7.16E+03 4.60E+03

Thymine 4.17E+03 4.08E+03 2.57E+03 4.06E+03 4.71E+03 2.81E+03 6.04E+03 5.34E+03 7.34E+03 4.15E+03 3.88E+03 4.05E+03

Trehalose/sucrose 7.42E+05 8.95E+04 1.63E+04 1.46E+04 4.17E+05 7.44E+04 4.03E+04 1.02E+05 6.21E+04 6.33E+04 2.88E+04 2.93E+04

Tryptophan 1.72E+05 3.31E+05 1.59E+05 2.01E+05 1.99E+05 2.29E+05 2.64E+05 2.72E+05 1.86E+05 2.33E+05 1.91E+05 1.89E+05

Tyrosine 4.76E+05 1.57E+06 5.42E+05 5.88E+05 5.74E+05 6.29E+05 6.41E+05 8.30E+05 5.62E+05 6.97E+05 5.86E+05 5.62E+05

UDP-glucose 5.81E+04 2.87E+05 1.20E+05 9.80E+04 5.27E+04 1.03E+05 7.94E+04 7.33E+04 7.40E+04 8.03E+04 5.12E+04 8.06E+04

UDP-N-acetylglucosamine 4.07E+04 3.26E+05 1.11E+05 1.05E+05 8.55E+04 1.46E+05 1.00E+05 9.20E+04 8.21E+04 1.02E+05 5.68E+04 7.94E+04

UMP 7.82E+04 3.76E+05 1.25E+05 1.45E+05 9.57E+03 1.38E+05 1.12E+04 3.28E+03 4.51E+03 1.73E+03 4.95E+03 1.40E+04

79

Table 1.7 Continued

Sample Name H1 H10 H18 H26 H19 H32 H34 H43 H44 H49 H52 H53

Uracil 2.41E+05 4.33E+05 9.68E+04 1.54E+05 3.04E+05 1.90E+05 4.17E+05 4.80E+05 3.46E+05 4.54E+05 3.44E+05 3.37E+05

Uric acid 2.06E+04 5.97E+04 1.53E+04 2.55E+04 2.62E+04 2.28E+04 1.36E+04 3.51E+04 2.89E+04 4.13E+04 1.79E+04 2.28E+04

Uridine 1.29E+04 7.34E+04 1.99E+04 2.56E+04 2.69E+04 2.72E+04 2.49E+04 3.16E+04 3.12E+04 2.79E+04 2.12E+04 2.09E+04

Xanthine 3.69E+05 5.08E+05 1.22E+05 1.30E+05 5.08E+05 2.27E+05 4.24E+05 6.18E+05 5.38E+05 6.28E+05 5.81E+05 4.84E+05

Xanthosine 7.98E+03 2.02E+03 6.39E+02 3.67E+03 7.31E+03 2.71E+03 8.22E+03 7.76E+03 7.56E+03 1.05E+04 9.86E+03 8.13E+03

80

Table 1.8 Raw Data of Subordinate Hamsters from HPC

Sample Name H6 H8 H9 H14 H15 H17 H23 H24 H36 H41

1-Methyladenosine 5.92E+03 6.67E+03 3.61E+03 3.03E+03 2.86E+03 1.59E+03 4.68E+03 5.40E+03 3.82E+03 3.14E+03

2-Aminoadipate 1.51E+04 1.25E+04 2.44E+04 4.02E+04 2.05E+04 7.03E+03 1.28E+04 1.39E+04 1.29E+04 2.93E+04

2-Dehydro-D-gluconate 4.78E+03 2.97E+03 3.26E+03 9.61E+03 3.14E+03 3.54E+02 3.99E+03 4.27E+03 3.31E+03 2.76E+03

2-Hydroxy-2-methylsuccinate 2.52E+05 1.79E+05 1.16E+05 1.17E+05 1.92E+05 2.85E+04 2.61E+05 1.79E+05 1.46E+05 1.21E+05

3-Methoxytyramine 4.52E+04 4.79E+04 4.82E+04 4.13E+04 4.15E+04 4.38E+04 4.20E+04 4.71E+04 4.64E+04 4.98E+04

3_4-Dihydroxyphenylacetate 2.49E+04 2.22E+04 1.86E+04 3.30E+04 2.76E+04 2.44E+04 3.00E+04 3.02E+04 3.46E+04 2.28E+04

4-Aminobutyrate 1.33E+06 7.87E+05 4.77E+05 1.46E+06 3.81E+05 1.73E+05 7.99E+05 8.01E+05 8.06E+05 4.86E+05

5-Hydroxyindoleacetic acid 8.84E+04 5.86E+04 3.94E+04 8.33E+03 1.16E+04 2.25E+03 1.29E+04 1.57E+04 1.24E+04 2.62E+04

Acadesine 5.17E+03 5.95E+03 9.13E+03 1.18E+04 6.05E+03 9.14E+03 5.73E+03 7.43E+03 6.99E+03 8.28E+03

Acetyllysine 3.46E+03 2.75E+03 1.76E+03 7.10E+03 1.97E+03 1.00E+03 3.92E+03 4.74E+03 2.02E+03 2.42E+03

Adenine 2.16E+04 2.30E+04 8.92E+03 3.18E+04 8.12E+03 3.57E+03 8.22E+03 8.34E+03 8.31E+03 5.45E+03

Adenosine 9.51E+04 8.07E+04 2.94E+04 4.80E+05 8.23E+04 7.76E+04 4.98E+05 5.36E+05 4.93E+05 2.93E+04

AICAR 1.10E+04 7.04E+03 1.30E+04 5.65E+04 1.07E+04 3.22E+03 7.57E+03 1.01E+04 1.17E+04 1.19E+04

Alanine 1.48E+06 1.28E+06 1.25E+06 2.83E+06 1.22E+06 5.83E+05 1.28E+06 1.32E+06 1.21E+06 1.21E+06

Allantoate 3.04E+03 3.42E+02 4.04E+02 4.50E+03 9.19E+02 4.44E+02 5.13E+03 1.55E+03 2.68E+03 1.10E+03

alpha-Ketoglutarate 3.15E+03 4.36E+03 1.82E+03 2.96E+03 6.35E+03 1.80E+03 3.47E+03 3.65E+03 3.24E+03 1.16E+03

AMP 2.27E+04 1.87E+04 2.84E+05 9.05E+05 1.16E+06 4.28E+05 9.46E+05 8.57E+05 7.12E+05 3.94E+05

Allantoin 3.69E+03 2.44E+03 1.64E+03 7.83E+03 2.92E+03 1.68E+03 3.06E+03 3.80E+03 3.31E+03 5.09E+03

Arginine 2.24E+04 2.29E+04 2.31E+04 1.34E+04 1.41E+04 6.15E+03 1.54E+04 1.79E+04 1.36E+04 2.66E+04

Ascorbate 1.47E+07 2.38E+06 3.94E+06 2.79E+07 5.27E+06 1.38E+06 1.32E+07 1.32E+07 1.29E+07 5.69E+06

Asparagine 7.79E+04 5.06E+04 4.81E+04 1.28E+05 3.55E+04 1.38E+04 4.48E+04 5.84E+04 3.98E+04 4.41E+04

Aspartate 3.09E+06 2.93E+06 2.55E+06 6.08E+06 1.61E+06 4.93E+05 1.96E+06 1.94E+06 2.00E+06 1.82E+06

beta-Alanine 1.48E+06 1.28E+06 1.25E+06 2.83E+06 1.22E+06 5.83E+05 1.28E+06 1.32E+06 1.21E+06 1.21E+06

Betaine 3.27E+05 2.76E+05 2.61E+05 6.01E+05 1.99E+05 5.98E+04 2.46E+05 2.30E+05 2.30E+05 2.35E+05

CDP-ethanolamine 3.09E+04 3.31E+04 3.08E+04 1.10E+05 3.17E+04 1.28E+04 3.33E+04 3.18E+04 2.99E+04 3.19E+04

Citrate/isocitrate 3.42E+03 3.42E+03 4.49E+03 1.82E+03 2.03E+03 1.96E+03 2.31E+03 2.64E+03 3.81E+03 4.75E+03

Citrulline 6.10E+04 5.99E+04 4.67E+04 5.41E+04 4.83E+04 1.84E+04 7.75E+04 6.33E+04 6.13E+04 4.33E+04

CMP 4.44E+03 1.30E+03 1.92E+04 5.12E+04 1.78E+04 9.24E+03 1.80E+04 2.04E+04 1.48E+04 2.22E+04

Creatine 1.62E+06 1.41E+06 1.41E+06 3.80E+06 1.29E+06 6.34E+05 1.41E+06 1.51E+06 1.33E+06 1.34E+06

81

Table 1.8 Continued

Sample Name H6 H8 H9 H14 H15 H17 H23 H24 H36 H41

Creatinine 1.55E+04 1.30E+04 1.27E+04 2.72E+04 8.16E+03 4.96E+03 1.44E+04 1.12E+04 1.16E+04 1.09E+04

Cystathionine 1.72E+05 1.06E+05 1.19E+05 4.76E+05 1.56E+05 7.66E+04 1.82E+05 2.34E+05 2.14E+05 1.88E+05

Cysteine 5.46E+05 3.65E+05 5.52E+05 2.01E+05 1.18E+05 1.12E+04 7.12E+04 9.20E+04 9.17E+04 3.09E+05

Cystine 2.62E+04 5.74E+04 3.80E+04 9.62E+03 3.49E+03 1.02E+04 2.19E+03 1.97E+03 3.57E+03 1.32E+04

Cytidine 8.30E+04 4.23E+04 3.24E+04 7.48E+04 2.14E+04 8.34E+03 4.10E+04 3.26E+04 3.44E+04 2.06E+04

Cytidine 3.58E+04 2.94E+04 4.62E+04 7.69E+04 5.98E+04 4.29E+04 3.71E+04 3.81E+04 2.93E+04 6.51E+04

D-Gluconate 6.02E+04 6.20E+04 4.74E+04 9.98E+04 4.11E+04 1.23E+04 4.69E+04 4.41E+04 4.97E+04 3.16E+04

D-Glucosamine 1-phosphate 6.67E+03 5.62E+03 5.42E+02 1.00E+02 1.00E+02 1.00E+02 2.38E+02 3.91E+02 2.01E+02 1.82E+03

D-Glyceraldehdye 3-phosphate 4.96E+05 5.16E+05 2.02E+05 3.41E+05 4.64E+04 3.03E+04 3.03E+05 2.48E+05 3.30E+05 4.13E+05

Diiodothyronine 1.35E+04 1.14E+04 1.82E+04 6.79E+04 1.63E+04 1.35E+04 1.80E+04 9.87E+03 2.03E+04 1.72E+04

Dimethylglycine 1.21E+05 9.50E+04 9.17E+04 2.68E+05 7.40E+04 3.37E+04 1.03E+05 1.01E+05 1.01E+05 7.11E+04

Dimethylglycine 1.33E+06 7.87E+05 4.77E+05 1.46E+06 3.81E+05 1.73E+05 7.99E+05 8.01E+05 8.06E+05 4.86E+05

Fumarate 1.84E+05 1.23E+05 3.61E+04 5.45E+04 8.61E+04 1.45E+04 1.41E+05 1.58E+05 1.12E+05 4.83E+04

Glucosamine 1.00E+02 5.64E+02 3.86E+02 2.02E+03 1.00E+02 3.33E+02 1.00E+02 5.27E+02 1.00E+02 2.22E+02

Glucose 1-phosphate 1.88E+05 1.10E+05 7.11E+04 2.03E+05 9.39E+04 2.86E+04 1.75E+05 1.55E+05 1.87E+05 8.83E+04

Glucose 6-phosphate 6.00E+05 6.00E+05 9.71E+04 1.30E+05 2.98E+04 1.13E+04 8.23E+04 1.07E+05 5.96E+04 2.91E+05

Glutamate 3.35E+07 3.02E+07 2.53E+07 8.48E+07 2.36E+07 1.22E+07 3.25E+07 3.10E+07 2.93E+07 2.24E+07

Glutamine 1.44E+07 1.29E+07 1.11E+07 2.04E+07 1.18E+07 5.70E+06 1.36E+07 1.32E+07 1.21E+07 1.09E+07

Glutathione 6.97E+06 4.54E+06 3.33E+06 1.32E+07 5.58E+06 9.77E+05 7.38E+06 7.77E+06 7.25E+06 4.90E+06

Glutathione disulfide 9.44E+04 7.90E+04 2.60E+04 1.15E+04 1.64E+04 6.23E+04 3.01E+04 2.07E+04 2.76E+04 2.89E+04

GMP 2.99E+03 1.95E+03 3.48E+04 5.62E+04 7.44E+04 2.76E+04 7.91E+04 6.65E+04 6.23E+04 4.58E+04

Guanine 6.03E+03 5.52E+03 6.60E+03 8.98E+03 3.12E+03 2.91E+02 1.05E+03 3.03E+03 2.88E+03 4.09E+03

Guanosine 1.23E+06 1.03E+06 4.37E+05 3.12E+05 1.00E+05 3.48E+04 2.20E+05 2.17E+05 2.24E+05 3.42E+05

Histidine 1.93E+04 2.34E+04 1.90E+04 2.18E+04 1.73E+04 6.89E+03 1.63E+04 2.08E+04 1.52E+04 1.69E+04

Homocysteic acid 1.05E+04 5.76E+03 1.05E+04 3.48E+04 1.15E+04 3.21E+03 1.06E+04 9.35E+03 1.29E+04 1.03E+04

Homoserine 3.89E+05 3.57E+05 3.75E+05 7.12E+05 2.82E+05 2.02E+05 3.04E+05 3.75E+05 2.94E+05 3.94E+05

Hydroxyphenylacetate 1.35E+05 1.37E+05 2.65E+05 1.41E+05 1.24E+05 5.46E+04 5.12E+04 2.14E+05 1.83E+05 9.61E+04

Hypoxanthine 9.60E+05 8.42E+05 8.96E+05 7.52E+05 2.10E+05 5.95E+04 2.15E+05 1.86E+05 1.63E+05 6.19E+05

82

Table 1.8 Continued

Sample Name H6 H8 H9 H14 H15 H17 H23 H24 H36 H41

IMP 1.84E+04 1.82E+04 4.20E+04 5.15E+04 6.37E+04 1.87E+04 8.24E+04 6.31E+04 5.91E+04 2.55E+04

Inosine 5.65E+06 5.22E+06 3.58E+06 2.57E+06 1.01E+06 4.28E+05 1.29E+06 1.42E+06 1.57E+06 3.04E+06

Lactate 4.47E+07 3.52E+07 3.86E+07 9.07E+07 3.34E+07 2.19E+07 3.93E+07 4.70E+07 4.04E+07 3.72E+07

Leucine/Isoleucine 2.43E+05 2.23E+05 2.45E+05 4.22E+05 9.11E+04 2.36E+04 1.10E+05 1.12E+05 1.02E+05 1.45E+05

Lysine 8.72E+03 7.00E+03 9.27E+03 3.94E+03 5.69E+03 1.89E+03 5.96E+03 7.32E+03 5.63E+03 5.88E+03

Malate 5.08E+06 2.84E+06 1.21E+06 1.14E+06 1.61E+06 3.22E+05 2.94E+06 2.88E+06 2.13E+06 1.76E+06

Mandelate 5.35E+04 7.31E+04 4.84E+04 6.66E+04 6.39E+04 7.27E+04 8.72E+04 1.18E+05 9.87E+04 8.54E+04

Methionine 4.00E+05 3.60E+05 3.58E+05 6.94E+05 1.98E+05 5.63E+04 2.18E+05 2.37E+05 1.93E+05 2.90E+05

Methionine sulfoxide 2.33E+04 3.34E+04 4.01E+04 7.46E+04 2.20E+04 2.18E+04 1.88E+04 2.51E+04 2.97E+04 3.34E+04

Methylmalonate 6.35E+05 5.89E+05 4.15E+05 1.55E+06 1.80E+06 7.57E+05 1.86E+06 2.28E+06 1.41E+06 4.22E+05

myo-Inositol 3.54E+05 2.87E+05 3.24E+05 6.65E+05 2.64E+05 2.10E+05 3.33E+05 3.97E+05 3.42E+05 2.80E+05

N-Acetyl-beta-alanine 1.58E+04 1.80E+04 2.12E+04 3.07E+04 8.26E+03 6.47E+03 1.26E+04 1.12E+04 1.28E+04 1.59E+04

N-Acetylglutamate 4.54E+05 3.60E+05 2.22E+05 2.09E+05 2.22E+05 5.82E+04 3.55E+05 3.32E+05 3.16E+05 1.60E+05

N-Acetylglutamine 3.19E+05 2.85E+05 3.14E+05 4.98E+05 2.36E+05 5.57E+04 2.11E+05 2.12E+05 2.16E+05 3.07E+05

N-Acetylornithine 4.24E+03 5.36E+03 4.72E+03 7.14E+03 3.37E+03 1.30E+03 3.70E+03 6.60E+03 6.19E+03 3.53E+03

N-Acetyltaurine 1.11E+05 7.76E+04 3.29E+04 1.42E+05 5.01E+04 1.78E+04 1.46E+05 1.20E+05 8.29E+04 4.09E+04

N-Acetyltaurine 2.09E+03 4.40E+03 2.94E+03 1.24E+03 2.04E+03 1.56E+03 7.72E+02 2.03E+03 3.25E+03 5.63E+03

N-Carbamoyl-L-aspartate 6.94E+04 9.50E+04 7.85E+04 9.44E+04 8.51E+04 5.14E+04 8.42E+04 8.16E+04 9.58E+04 7.66E+04

NAD+ 1.15E+03 2.97E+03 2.95E+03 2.60E+04 1.84E+04 7.16E+03 6.32E+03 5.11E+03 6.07E+03 1.54E+03

Orotate 2.51E+04 1.09E+04 9.06E+03 2.67E+04 1.02E+04 3.35E+03 1.13E+04 1.46E+04 1.20E+04 1.02E+04

Pantothenate 5.77E+05 3.38E+05 6.21E+05 4.05E+05 4.51E+05 2.52E+05 6.46E+05 5.85E+05 4.07E+05 4.76E+05

Phenylalanine 1.90E+05 1.80E+05 2.47E+05 2.19E+05 1.09E+05 4.10E+04 9.11E+04 1.19E+05 8.71E+04 1.96E+05

Phenyllactic acid 1.10E+05 9.18E+04 1.42E+05 9.57E+04 7.77E+04 5.31E+04 5.38E+04 1.44E+05 9.34E+04 7.60E+04

Proline 1.15E+05 7.94E+04 6.17E+04 9.61E+04 4.37E+04 1.98E+04 8.84E+04 8.28E+04 7.33E+04 6.65E+04

Pyroglutamic acid 3.24E+06 2.90E+06 2.93E+06 2.88E+06 8.29E+05 6.17E+05 9.51E+05 1.18E+06 9.61E+05 1.59E+06

Pyruvate 5.80E+05 5.53E+05 4.12E+05 9.03E+05 3.44E+05 2.72E+05 3.81E+05 4.30E+05 4.25E+05 2.78E+05

Ribose phosphate 4.05E+05 4.05E+05 1.88E+05 2.20E+05 7.49E+04 2.81E+04 1.32E+05 1.15E+05 1.24E+05 2.68E+05

Sedoheptulose 1/7-phosphate 9.70E+04 9.03E+04 2.53E+04 1.37E+04 4.23E+03 2.08E+03 8.92E+03 8.75E+03 6.79E+03 2.62E+04

83

Table 1.8 Continued

Sample Name H6 H8 H9 H14 H15 H17 H23 H24 H36 H41

Serine 1.42E+06 1.19E+06 1.16E+06 2.92E+06 8.39E+05 5.19E+05 1.11E+06 1.07E+06 9.01E+05 1.11E+06

sn-Glycerol 3-phosphate 1.82E+04 1.85E+04 3.35E+04 7.14E+04 3.73E+04 4.52E+04 3.44E+04 1.93E+04 2.09E+04 1.74E+04

Succinate 6.35E+05 5.89E+05 4.15E+05 1.55E+06 1.80E+06 7.57E+05 1.86E+06 2.28E+06 1.41E+06 4.22E+05

Taurine 1.26E+07 1.25E+07 8.96E+06 3.36E+07 7.94E+06 4.41E+06 1.18E+07 1.02E+07 1.20E+07 9.77E+06

Thymidine 7.78E+03 9.78E+03 5.45E+03 1.06E+04 2.72E+03 5.85E+02 4.38E+03 4.76E+03 5.01E+03 2.40E+03

Thymine 5.30E+03 4.05E+03 4.26E+03 5.45E+03 2.25E+03 9.30E+02 3.01E+03 3.73E+03 3.23E+03 4.50E+03

Trehalose/sucrose 2.87E+04 4.15E+04 8.57E+04 6.53E+04 2.77E+04 2.99E+04 5.91E+04 3.37E+04 3.07E+04 3.07E+04

Tryptophan 2.14E+05 2.11E+05 1.99E+05 3.41E+05 1.76E+05 4.51E+04 1.69E+05 1.92E+05 1.57E+05 1.48E+05

Tyrosine 6.72E+05 6.10E+05 5.68E+05 1.72E+06 5.69E+05 1.89E+05 5.43E+05 6.10E+05 4.99E+05 4.86E+05

UDP-glucose 7.44E+04 2.84E+04 5.84E+04 7.73E+04 8.40E+04 4.56E+04 1.01E+05 9.77E+04 9.92E+04 1.08E+05

UDP-N-acetylglucosamine 9.87E+04 5.18E+04 4.56E+04 6.79E+04 7.97E+04 3.19E+04 1.04E+05 9.25E+04 9.97E+04 8.00E+04

UMP 5.78E+03 2.38E+03 5.79E+04 1.42E+05 1.33E+05 4.81E+04 1.29E+05 1.28E+05 1.08E+05 7.55E+04

Uracil 4.60E+05 3.27E+05 2.09E+05 3.17E+05 4.04E+04 2.02E+04 1.21E+05 1.21E+05 1.34E+05 1.93E+05

Uric acid 2.62E+04 1.81E+04 1.09E+05 1.28E+05 3.73E+04 8.66E+03 2.28E+04 2.95E+04 3.79E+04 4.12E+04

Uridine 3.07E+04 2.59E+04 1.51E+04 4.37E+04 1.68E+04 4.03E+03 2.28E+04 2.09E+04 2.05E+04 1.49E+04

Xanthine 6.85E+05 7.59E+05 4.84E+05 3.05E+05 1.14E+05 3.39E+04 2.17E+05 2.00E+05 1.68E+05 3.74E+05

Xanthosine 1.01E+04 8.76E+03 6.04E+03 4.50E+03 2.59E+03 8.73E+02 2.73E+03 3.12E+03 1.25E+03 6.34E+03

84

Table 1.9 Raw Data of Dominant Hamsters from NAc

Sample Name H2 H5 H12 H19 H25 H28 H33 H38 H45 H47

2-Hydroxy-2-methylsuccinate 5.68E+05 1.54E+05 5.48E+05 5.55E+05 4.08E+05 5.20E+05 6.13E+05 5.19E+05 3.04E+05 4.90E+05

3-Phosphoglycerate 9.59E+04 2.82E+04 1.00E+02 4.82E+03 1.00E+02 4.37E+03 1.00E+02 2.11E+05 6.28E+04 1.05E+05

3_4-Dihydroxyphenylacetate 5.28E+03 1.27E+04 2.42E+04 2.76E+04 2.81E+04 1.76E+04 2.44E+04 1.80E+04 2.92E+04 6.42E+03

4-Aminobutyrate 1.01E+06 1.76E+06 5.85E+05 8.49E+05 9.67E+05 6.60E+05 1.17E+06 6.99E+05 1.08E+06 6.42E+05

5-Hydroxyindoleacetic acid 3.60E+04 4.17E+04 8.14E+04 5.64E+04 5.03E+04 2.57E+04 5.70E+04 5.01E+04 7.19E+04 4.42E+04

Aconitate 1.21E+05 9.93E+04 9.26E+04 1.37E+05 9.99E+04 1.35E+05 9.51E+04 2.07E+05 1.04E+05 1.45E+05

Alanine 1.91E+06 1.42E+06 1.45E+06 1.41E+06 1.73E+06 1.55E+06 2.02E+06 1.89E+06 1.51E+06 1.53E+06

alpha-Ketoglutarate 9.24E+04 3.46E+04 2.89E+04 1.15E+05 5.45E+04 8.54E+04 6.02E+04 6.13E+04 4.18E+04 7.54E+04

AMP 6.14E+04 1.89E+04 3.79E+05 9.11E+04 2.67E+05 5.48E+04 6.79E+04 5.20E+04 4.79E+04 5.56E+04

Arginine 1.97E+04 1.72E+04 1.23E+04 7.83E+03 1.45E+04 1.22E+04 2.15E+04 2.34E+04 2.07E+04 2.89E+04

Ascorbate 1.00E+02 1.00E+02 1.32E+06 2.39E+04 1.00E+02 1.00E+02 7.31E+04 4.29E+05 4.21E+04 3.41E+04

Asparagine 6.45E+04 2.95E+04 5.25E+04 5.33E+04 5.94E+04 6.25E+04 6.47E+04 5.08E+04 6.49E+04 6.72E+04

Aspartate 8.03E+06 4.33E+06 5.76E+06 5.59E+06 6.11E+06 5.40E+06 6.88E+06 7.40E+06 7.29E+04 6.84E+06

CDP-ethanolamine 2.39E+04 5.98E+03 2.63E+04 2.25E+04 1.69E+04 7.35E+03 1.48E+04 2.98E+04 1.36E+03 1.91E+04

Citrate/isocitrate 4.95E+06 3.04E+06 2.71E+06 4.30E+06 2.64E+06 4.66E+06 4.24E+06 1.22E+07 2.94E+06 8.30E+06

Citrulline 1.88E+04 4.49E+03 1.17E+04 7.81E+03 5.49E+03 2.17E+04 1.17E+04 1.60E+04 9.52E+03 1.96E+04

Creatine 1.80E+06 1.29E+06 9.39E+05 9.24E+05 1.55E+06 1.29E+06 1.80E+06 1.55E+06 1.05E+06 1.31E+06

Creatinine 1.21E+05 4.52E+04 3.17E+04 4.20E+04 4.66E+04 4.77E+04 6.56E+04 8.76E+04 6.44E+04 1.12E+05

Cysteine 2.42E+03 1.68E+03 4.53E+02 7.99E+02 2.78E+03 1.00E+02 3.40E+03 1.23E+05 2.04E+03 1.13E+05

Cystine 1.41E+05 1.57E+05 9.32E+04 7.39E+04 5.38E+04 5.52E+04 9.93E+04 8.44E+04 1.11E+05 3.87E+04

Cytidine 4.04E+04 1.81E+04 1.81E+04 2.13E+04 1.84E+04 2.67E+04 2.56E+04 2.72E+04 5.16E+04 1.47E+04

Cytidine 2.26E+04 4.52E+04 1.01E+04 8.90E+03 2.42E+04 3.66E+04 4.13E+04 1.71E+04 1.30E+04 1.68E+04

D-Glyceraldehdye 3-phosphate 3.06E+05 4.33E+04 8.78E+04 4.24E+04 7.15E+04 9.34E+04 4.16E+04 3.01E+05 1.63E+05 2.74E+05

Dopamine 4.51E+04 1.74E+04 5.42E+04 4.17E+04 6.39E+04 3.71E+04 1.00E+05 1.41E+04 2.79E+04 4.95E+04

Fructose 1_6-bisphosphate 5.85E+04 6.30E+03 3.29E+03 1.00E+02 1.00E+02 1.00E+02 5.18E+03 1.73E+05 1.24E+05 1.31E+05

Fumarate 4.82E+06 8.44E+05 2.79E+06 2.19E+06 2.45E+06 3.42E+06 2.69E+06 4.21E+06 2.23E+06 4.27E+06

Glutamate 1.98E+07 6.96E+06 1.53E+07 1.55E+07 1.47E+07 1.52E+07 1.77E+07 1.65E+07 9.21E+06 1.55E+07

Glutamine 1.01E+07 5.78E+06 8.06E+06 7.55E+06 7.45E+06 7.77E+06 8.11E+06 8.20E+06 8.60E+06 7.94E+06

Glutathione 1.00E+02 3.81E+03 2.46E+05 2.63E+05 2.90E+05 1.00E+02 4.65E+05 3.28E+05 2.43E+05 4.38E+05

Glutathione disulfide 9.94E+04 4.92E+03 1.35E+05 6.91E+04 1.10E+05 3.02E+05 9.54E+04 1.06E+05 8.99E+04 2.10E+05

Glycine 3.90E+05 4.34E+05 7.56E+04 1.21E+05 2.60E+05 4.23E+05 2.79E+05 2.69E+05 3.09E+05 1.98E+05

Guanosine 4.51E+05 3.16E+05 2.96E+05 2.98E+05 2.74E+05 3.87E+05 3.65E+05 3.94E+05 2.37E+05 3.64E+05

Histidine 7.23E+04 3.89E+04 5.85E+04 4.24E+04 4.79E+04 4.94E+04 9.29E+04 7.30E+04 4.43E+04 8.24E+04

85

Table 1.9 Continued

Sample Name H2 H5 H12 H19 H25 H28 H33 H38 H45 H47

Homoserine 8.17E+05 4.33E+05 6.34E+05 4.99E+05 7.30E+05 6.97E+05 8.46E+05 6.23E+05 5.62E+05 7.31E+05

Homovanillic acid 1.22E+05 5.14E+04 9.89E+04 1.40E+05 9.59E+04 9.01E+04 1.42E+05 1.38E+05 7.29E+04 1.39E+05

Hydroxybenzoate 1.50E+06 5.57E+05 3.76E+06 3.09E+06 3.02E+06 4.43E+06 4.26E+06 9.37E+05 1.80E+06 1.77E+06

Hypoxanthine 2.85E+06 1.38E+06 1.06E+06 9.18E+05 1.07E+06 1.32E+06 1.41E+06 2.44E+06 2.62E+06 2.10E+06

IMP 1.68E+04 7.72E+03 8.79E+04 2.81E+04 7.89E+04 5.76E+03 2.18E+04 7.11E+03 6.12E+03 5.40E+03

Inosine 2.82E+06 1.50E+06 2.17E+06 2.19E+06 2.20E+06 2.42E+06 2.84E+06 2.39E+06 1.13E+06 2.61E+06

Lactate 7.55E+07 4.78E+07 6.74E+07 6.05E+07 6.73E+07 6.96E+07 6.46E+07 7.60E+07 2.23E+07 7.19E+07

Leucine/Isoleucine 1.89E+05 7.16E+04 8.95E+04 4.43E+04 7.46E+04 8.71E+04 1.14E+05 1.09E+05 1.37E+05 1.04E+05

Malate 5.46E+07 1.69E+07 3.28E+07 2.91E+07 3.25E+07 3.98E+07 3.44E+07 4.81E+07 2.48E+07 4.77E+07

Methionine 6.93E+04 3.14E+04 3.75E+04 2.94E+04 3.36E+04 4.38E+04 4.73E+04 6.32E+04 5.32E+04 4.56E+04

Methylmalonate 2.46E+06 1.13E+06 2.33E+06 3.18E+06 2.75E+06 3.68E+06 3.17E+06 2.88E+06 1.92E+05 1.91E+06

myo-Inositol 4.22E+05 2.15E+05 3.16E+05 3.06E+05 3.52E+05 3.94E+05 3.27E+05 4.21E+05 4.84E+04 2.93E+05

N-Acetyl-beta-alanine 1.04E+06 5.72E+05 6.83E+05 8.38E+05 7.71E+05 6.89E+05 8.23E+05 8.52E+05 5.45E+05 9.82E+05

N-Acetylglutamate 8.01E+05 3.27E+05 7.24E+05 6.36E+05 5.69E+05 4.30E+05 6.00E+05 6.68E+05 3.41E+05 5.73E+05

N-Carbamoyl-L-aspartate 1.74E+05 4.24E+05 4.12E+05 5.80E+05 5.55E+05 2.94E+05 3.93E+05 3.68E+05 3.72E+05 6.07E+05

Pantothenate 7.61E+05 5.82E+05 1.79E+06 8.94E+05 9.32E+05 4.85E+05 9.87E+05 6.91E+05 9.62E+05 7.83E+05

Phenylalanine 8.80E+04 4.99E+04 5.51E+04 4.91E+04 5.37E+04 5.86E+04 9.73E+04 7.94E+04 3.95E+04 9.75E+04

Phosphoenolpyruvate 1.13E+05 3.60E+04 1.00E+02 9.05E+03 1.00E+02 6.03E+03 1.00E+02 1.27E+05 5.85E+04 6.39E+04

Proline 1.15E+05 6.60E+04 6.86E+04 5.86E+04 6.81E+04 8.38E+04 9.06E+04 8.57E+04 8.10E+04 8.73E+04

Pyroglutamic acid 2.61E+06 1.43E+06 1.00E+06 7.03E+05 6.31E+05 1.75E+06 1.29E+06 2.44E+06 1.62E+06 1.28E+06

Serine 1.10E+06 5.71E+05 9.86E+05 1.00E+06 1.01E+06 1.14E+06 1.09E+06 8.38E+05 8.92E+05 1.01E+06

Succinate 2.46E+06 1.13E+06 2.33E+06 3.18E+06 2.75E+06 3.68E+06 3.17E+06 2.88E+06 1.92E+05 1.91E+06

Sulfolactate 1.15E+04 1.71E+04 1.21E+05 1.72E+05 1.14E+05 1.40E+05 7.36E+04 8.75E+04 1.06E+05 1.10E+05

Sulfolactate 4.38E+04 1.06E+04 4.33E+04 7.59E+04 3.14E+04 4.77E+04 3.62E+04 1.57E+04 2.85E+04 1.99E+04

Taurine 1.54E+07 5.52E+06 1.28E+07 9.92E+06 1.01E+07 1.27E+07 1.13E+07 1.31E+07 9.20E+06 1.18E+07

Trehalose/sucrose 2.58E+04 3.52E+04 2.45E+04 3.31E+04 3.72E+04 3.56E+04 4.49E+04 1.34E+04 4.53E+04 2.29E+04

Tyrosine 8.81E+04 5.78E+04 6.44E+04 5.25E+04 8.08E+04 6.77E+04 9.92E+04 9.62E+04 1.05E+05 9.71E+04

UDP-glucose 1.02E+05 5.30E+04 3.55E+05 1.33E+05 1.52E+05 8.49E+04 1.23E+05 1.17E+05 1.31E+05 1.14E+05

UDP-N-acetylglucosamine 8.61E+04 2.55E+04 2.19E+05 1.04E+05 8.46E+04 7.24E+04 8.69E+04 7.90E+04 6.77E+04 7.03E+04

UMP 5.77E+03 6.65E+03 1.25E+05 1.87E+04 8.51E+04 5.27E+03 8.72E+03 4.14E+03 5.66E+03 1.00E+02

Uracil 1.46E+06 5.53E+05 5.50E+05 5.40E+05 5.93E+05 7.57E+05 7.82E+05 1.44E+06 8.38E+05 9.47E+05

Uric acid 2.64E+04 7.70E+03 3.33E+04 4.57E+04 2.35E+04 4.50E+04 5.42E+04 4.19E+04 1.67E+04 9.76E+04

86

Table 1.9 Continued

Sample Name H2 H5 H12 H19 H25 H28 H33 H38 H45 H47

Uridine 2.07E+05 9.29E+04 1.52E+05 1.60E+05 1.55E+05 1.70E+05 2.07E+05 1.62E+05 1.47E+05 1.80E+05

Valine 1.72E+05 7.10E+04 1.81E+05 1.29E+05 1.60E+05 2.08E+05 1.59E+05 1.31E+05 1.20E+05 1.37E+05

Xanthine 1.27E+06 3.40E+05 2.89E+05 2.78E+05 2.92E+05 4.25E+05 3.39E+05 7.76E+05 1.26E+06 6.90E+05

87

Table 1.10 Raw Data of Handled Control Hamsters from NAc

Sample Name H1 H18 H26 H31 H32 H34 H43 H44 H49 H52 H53

2-Hydroxy-2-methylsuccinate 3.99E+05 3.92E+05 7.28E+05 4.79E+05 2.31E+05 5.15E+05 2.94E+05 3.84E+05 4.14E+05 4.74E+05 2.67E+05

3-Phosphoglycerate 1.14E+05 3.73E+03 3.38E+03 1.00E+02 1.00E+02 4.38E+03 2.72E+05 6.09E+04 3.41E+05 9.09E+05 1.01E+05

3_4-Dihydroxyphenylacetate 1.97E+04 4.02E+04 1.49E+04 1.19E+04 1.30E+04 5.57E+03 1.44E+04 3.82E+03 1.47E+04 7.11E+03 6.78E+03

4-Aminobutyrate 7.86E+05 7.55E+05 5.16E+05 5.18E+05 1.33E+06 6.61E+05 1.93E+06 7.17E+05 1.08E+06 8.50E+05 1.37E+06

5-Hydroxyindoleacetic acid 3.18E+04 7.09E+04 3.07E+04 3.26E+04 3.11E+04 5.82E+04 8.02E+04 3.06E+04 3.45E+04 1.37E+04 4.28E+04

Aconitate 1.01E+05 1.23E+05 1.38E+05 9.16E+04 1.08E+05 1.08E+05 1.74E+05 9.41E+04 1.29E+05 1.48E+05 8.64E+04

Alanine 1.70E+06 1.36E+06 1.72E+06 1.53E+06 1.74E+06 1.93E+06 1.65E+06 1.36E+06 1.40E+06 1.47E+06 1.24E+06

alpha-Ketoglutarate 4.34E+04 4.90E+04 5.09E+04 2.66E+04 5.02E+04 5.24E+04 5.78E+04 4.03E+04 6.07E+04 6.33E+04 3.00E+04

AMP 1.14E+05 9.49E+04 1.19E+05 1.53E+05 1.85E+05 1.34E+05 4.55E+04 2.37E+04 3.69E+04 4.40E+04 5.16E+04

Arginine 1.86E+04 1.01E+04 2.00E+04 1.84E+04 1.72E+04 2.65E+04 1.51E+04 2.46E+04 2.14E+04 2.20E+04 8.05E+03

Ascorbate 3.87E+05 1.63E+06 5.97E+04 1.20E+06 8.82E+05 3.22E+06 5.64E+04 3.37E+04 2.30E+03 2.71E+03 2.51E+04

Asparagine 5.53E+04 4.66E+04 5.06E+04 4.13E+04 4.60E+04 5.01E+04 3.24E+04 2.88E+04 3.55E+04 3.75E+04 2.37E+04

Aspartate 5.76E+06 4.25E+06 6.80E+06 4.22E+06 4.52E+06 5.42E+06 7.39E+06 6.90E+04 5.52E+06 5.37E+06 8.92E+04

CDP-ethanolamine 2.77E+04 1.98E+04 1.36E+04 1.58E+04 4.24E+03 2.40E+04 1.99E+04 9.92E+02 1.06E+04 1.67E+04 1.00E+02

Citrate/isocitrate 2.23E+06 5.00E+06 3.26E+06 2.39E+06 2.68E+06 4.96E+06 1.18E+07 1.64E+06 8.25E+06 1.29E+07 2.00E+06

Citrulline 1.01E+04 4.05E+03 2.02E+04 2.33E+04 2.06E+04 1.03E+04 9.99E+03 1.12E+04 6.73E+03 3.71E+03 3.18E+03

Creatine 1.30E+06 8.94E+05 1.49E+06 1.42E+06 1.34E+06 1.70E+06 1.43E+06 8.88E+05 1.03E+06 1.08E+06 6.82E+05

Creatinine 1.01E+05 4.15E+04 6.15E+04 4.08E+04 4.01E+04 7.44E+04 1.04E+05 3.74E+04 8.28E+04 1.30E+05 3.55E+04

Cysteine 9.50E+03 9.66E+02 1.57E+03 2.97E+03 1.20E+03 6.21E+03 1.42E+04 3.46E+03 5.12E+04 2.36E+03 7.53E+02

Cystine 1.09E+05 8.79E+04 7.03E+04 7.69E+04 9.77E+04 1.12E+05 1.31E+05 9.13E+04 7.17E+04 1.05E+05 8.51E+04

Cytidine 2.90E+04 2.40E+04 2.90E+04 2.22E+04 1.71E+04 3.12E+04 2.92E+04 3.64E+04 3.21E+04 1.90E+04 3.79E+04

Cytidine 4.35E+04 3.63E+03 1.38E+04 3.46E+04 2.27E+04 6.21E+04 1.86E+04 8.83E+03 5.04E+03 2.06E+04 4.06E+03

D-Glyceraldehdye 3-phosphate 3.61E+05 3.66E+04 1.48E+05 1.27E+05 1.33E+05 8.14E+04 1.36E+05 1.56E+05 3.41E+05 3.30E+05 7.76E+04

Dopamine 8.61E+04 7.22E+04 4.46E+04 8.56E+04 4.41E+04 8.32E+04 1.59E+04 6.15E+03 2.22E+04 2.19E+04 4.60E+03

Fructose 1_6-bisphosphate 1.17E+05 1.00E+02 1.36E+04 6.54E+03 1.00E+02 1.52E+04 2.12E+04 1.26E+05 2.17E+05 2.49E+05 9.50E+04

Fumarate 3.87E+06 1.99E+06 2.59E+06 1.94E+06 2.11E+06 2.82E+06 1.59E+06 1.55E+06 3.21E+06 2.99E+06 1.04E+06

Glutamate 1.74E+07 1.42E+07 1.95E+07 1.55E+07 1.51E+07 1.92E+07 1.31E+07 1.17E+07 1.30E+07 1.45E+07 5.55E+06

Glutamine 9.90E+06 8.51E+06 7.95E+06 8.90E+06 9.60E+06 9.63E+06 6.81E+06 6.06E+06 5.66E+06 5.89E+06 3.48E+06

Glutathione 2.53E+05 3.56E+05 1.54E+05 4.97E+05 4.22E+05 6.30E+05 3.36E+04 1.75E+05 1.54E+05 2.97E+04 3.66E+04

Glutathione disulfide 1.16E+05 2.39E+04 1.23E+05 6.94E+04 4.75E+04 5.88E+04 9.44E+04 3.60E+04 1.19E+05 1.48E+05 1.83E+04

Glycine 4.01E+05 7.76E+04 1.13E+05 9.13E+04 3.79E+05 3.38E+05 3.09E+05 9.35E+04 3.40E+05 3.86E+05 1.19E+05

Guanosine 3.17E+05 3.41E+05 4.14E+05 3.24E+05 2.81E+05 4.31E+05 2.77E+05 2.30E+05 2.95E+05 3.19E+05 1.63E+05

Histidine 1.06E+05 5.92E+04 5.84E+04 5.35E+04 4.42E+04 6.48E+04 8.90E+04 2.30E+04 4.99E+04 6.65E+04 2.06E+04

88

Table 1.10 Continued

Sample Name H1 H18 H26 H31 H32 H34 H43 H44 H49 H52 H53

Homoserine 6.23E+05 5.80E+05 6.55E+05 7.91E+05 5.85E+05 6.96E+05 4.80E+05 3.59E+05 4.76E+05 5.83E+05 2.23E+05

Homovanillic acid 5.23E+04 1.04E+05 9.84E+04 7.27E+04 6.64E+04 1.16E+05 9.25E+04 8.64E+04 1.13E+05 1.20E+05 5.82E+04

Hydroxybenzoate 1.29E+06 1.86E+06 2.53E+06 3.09E+06 1.86E+06 2.03E+06 6.87E+05 5.74E+05 4.63E+05 1.41E+06 5.76E+05

Hypoxanthine 2.55E+06 9.43E+05 1.19E+06 9.60E+05 9.59E+05 1.39E+06 2.65E+06 2.50E+06 2.57E+06 2.56E+06 2.17E+06

IMP 2.02E+04 2.55E+04 1.92E+04 5.92E+04 3.98E+04 5.71E+04 4.99E+03 6.49E+03 1.09E+04 5.55E+03 6.15E+03

Inosine 2.24E+06 2.37E+06 2.81E+06 2.49E+06 2.61E+06 2.88E+06 2.29E+06 9.59E+05 1.82E+06 1.92E+06 8.35E+05

Lactate 7.03E+07 5.77E+07 6.16E+07 6.76E+07 6.81E+07 6.90E+07 5.60E+07 1.83E+07 5.60E+07 6.01E+07 1.52E+07

Leucine/Isoleucine 1.38E+05 7.44E+04 7.60E+04 8.75E+04 8.50E+04 1.04E+05 1.00E+05 1.23E+05 1.09E+05 1.23E+05 1.19E+05

Malate 4.68E+07 2.33E+07 3.21E+07 2.69E+07 2.78E+07 3.65E+07 2.36E+07 2.02E+07 3.61E+07 3.53E+07 1.41E+07

Methionine 7.04E+04 3.35E+04 3.98E+04 3.46E+04 3.44E+04 4.54E+04 6.42E+04 4.70E+04 5.68E+04 5.28E+04 4.11E+04

Methylmalonate 2.47E+06 1.73E+06 2.34E+06 2.25E+06 2.35E+06 2.65E+06 1.58E+06 1.64E+05 1.45E+06 1.93E+06 1.98E+05

myo-Inositol 3.35E+05 2.49E+05 2.68E+05 3.63E+05 3.38E+05 3.60E+05 2.68E+05 2.77E+04 2.85E+05 2.44E+05 2.05E+04

N-Acetyl-beta-alanine 8.08E+05 9.83E+05 8.69E+05 8.83E+05 7.31E+05 8.40E+05 7.59E+05 5.78E+05 6.05E+05 7.73E+05 4.93E+05

N-Acetylglutamate 3.99E+05 6.01E+05 5.33E+05 4.69E+05 4.62E+05 5.52E+05 6.00E+05 2.84E+05 4.73E+05 6.02E+05 2.09E+05

N-Carbamoyl-L-aspartate 4.58E+05 4.10E+05 5.34E+05 3.40E+05 5.42E+05 2.03E+05 4.88E+05 4.85E+05 3.41E+05 5.06E+05 4.51E+05

Pantothenate 7.25E+05 9.75E+05 5.66E+05 6.66E+05 6.95E+05 7.92E+05 1.04E+06 5.74E+05 7.08E+05 7.23E+05 9.92E+05

Phenylalanine 1.03E+05 6.77E+04 6.41E+04 5.46E+04 7.05E+04 6.48E+04 7.38E+04 3.48E+04 6.86E+04 6.90E+04 2.56E+04

Phosphoenolpyruvate 9.70E+04 5.72E+03 1.00E+02 3.67E+03 1.00E+02 6.25E+03 1.94E+05 8.22E+04 1.42E+05 3.00E+05 7.23E+04

Proline 1.07E+05 4.48E+04 8.94E+04 8.62E+04 8.18E+04 1.31E+05 6.54E+04 6.93E+04 7.25E+04 1.05E+05 5.22E+04

Pyroglutamic acid 1.85E+06 8.39E+05 8.58E+05 8.56E+05 6.82E+05 8.44E+05 2.75E+06 1.52E+06 1.53E+06 3.22E+06 1.29E+06

Serine 1.10E+06 6.74E+05 1.06E+06 8.19E+05 8.75E+05 9.81E+05 7.38E+05 5.21E+05 7.52E+05 7.54E+05 2.92E+05

Succinate 2.47E+06 1.73E+06 2.34E+06 2.25E+06 2.35E+06 2.65E+06 1.58E+06 1.64E+05 1.45E+06 1.93E+06 1.98E+05

Sulfolactate 1.82E+04 1.67E+05 9.15E+04 1.99E+05 8.96E+04 1.14E+05 1.16E+05 1.84E+04 1.39E+04 2.59E+04 1.57E+04

Sulfolactate 5.40E+04 2.68E+04 4.71E+04 2.93E+04 2.28E+04 7.90E+03 2.93E+04 1.86E+04 2.97E+04 2.86E+04 3.62E+04

Taurine 1.30E+07 8.82E+06 1.46E+07 1.19E+07 1.14E+07 1.40E+07 9.64E+06 9.13E+06 1.01E+07 9.43E+06 4.82E+06

Trehalose/sucrose 2.19E+05 2.53E+04 2.97E+04 4.25E+04 4.53E+04 1.40E+04 8.98E+03 8.64E+03 4.55E+03 1.38E+04 1.30E+04

Tyrosine 9.70E+04 6.24E+04 6.74E+04 6.04E+04 5.65E+04 9.13E+04 1.12E+05 6.03E+04 6.64E+04 8.55E+04 6.05E+04

UDP-glucose 2.15E+05 1.48E+05 1.19E+05 1.46E+05 8.71E+04 1.26E+05 1.07E+05 1.20E+05 1.44E+05 7.28E+04 7.06E+04

UDP-N-acetylglucosamine 9.94E+04 9.43E+04 9.17E+04 1.14E+05 8.39E+04 8.23E+04 6.72E+04 7.85E+04 7.81E+04 4.58E+04 3.80E+04

UMP 1.65E+04 2.28E+04 2.07E+04 4.31E+04 4.69E+04 2.63E+04 1.00E+02 1.00E+02 1.00E+02 1.00E+02 1.00E+02

Uracil 1.02E+06 5.35E+05 8.62E+05 5.42E+05 6.09E+05 8.13E+05 1.24E+06 9.51E+05 1.16E+06 1.41E+06 8.14E+05

89

Table 1.11 Raw Data of Subordinate Hamsters from NAc

Sample Name H6 H7 H8 H9 H14 H15 H17 H23 H24 H35 H36 H41 2-Hydroxy-2-methylsuccinate 3.49E+05 2.10E+05 1.88E+05 5.16E+05 1.81E+05 1.67E+05 4.98E+05 6.02E+05 5.30E+05 3.43E+05 5.10E+05 2.42E+05

3-Phosphoglycerate 5.38E+04 8.13E+04 1.17E+05 1.23E+05 1.00E+02 1.00E+02 2.55E+03 1.00E+02 1.00E+02 4.87E+03 4.84E+03 4.82E+04 3_4-Dihydroxyphenylacetate 1.12E+04 4.79E+03 4.07E+03 5.47E+03 8.07E+03 1.02E+04 2.25E+04 3.58E+04 7.96E+03 1.10E+04 1.77E+04 5.21E+03

4-Aminobutyrate 8.34E+05 1.05E+06 1.97E+06 7.40E+05 8.56E+05 2.92E+05 3.45E+05 8.80E+05 6.64E+05 1.60E+06 1.42E+06 5.78E+05 5-Hydroxyindoleacetic acid 5.70E+04 6.21E+04 1.17E+04 3.18E+04 3.48E+04 1.44E+04 3.44E+04 3.76E+04 1.51E+04 2.59E+04 4.09E+04 1.38E+04

Aconitate 1.68E+05 1.42E+05 1.35E+05 1.44E+05 2.32E+04 2.32E+04 9.32E+04 1.44E+05 9.13E+04 7.51E+04 6.73E+04 1.14E+05

Alanine 1.95E+06 1.50E+06 1.49E+06 1.53E+06 1.19E+06 5.71E+05 1.29E+06 1.63E+06 1.29E+06 1.46E+06 1.76E+06 1.39E+06

alpha-Ketoglutarate 5.69E+04 4.50E+04 3.88E+04 6.08E+04 1.86E+04 1.80E+04 3.85E+04 4.88E+04 4.84E+04 4.26E+04 2.34E+04 3.02E+04

AMP 3.45E+04 3.71E+04 1.95E+04 6.83E+04 1.55E+05 8.32E+04 4.45E+04 1.46E+05 1.46E+05 4.69E+04 1.47E+05 3.03E+04

Arginine 3.57E+04 1.46E+04 1.98E+04 2.34E+04 9.11E+03 2.53E+03 1.41E+04 1.86E+04 1.55E+04 2.50E+04 2.30E+04 1.29E+04

Ascorbate 2.33E+04 3.97E+04 1.00E+02 1.00E+02 6.71E+04 1.00E+02 7.85E+05 3.75E+05 2.79E+04 1.00E+02 1.63E+06 1.95E+04

Asparagine 4.71E+04 5.50E+04 3.90E+04 5.09E+04 3.55E+04 2.62E+04 6.27E+04 6.99E+04 4.19E+04 4.40E+04 4.37E+04 2.95E+04

Aspartate 8.30E+04 9.81E+04 6.05E+04 7.12E+06 3.76E+06 1.52E+06 4.36E+06 5.62E+06 3.78E+06 5.35E+06 5.98E+06 4.45E+04

CDP-ethanolamine 5.12E+02 5.28E+03 4.70E+02 1.82E+04 1.04E+04 2.92E+03 3.45E+04 2.65E+04 9.36E+03 1.26E+04 2.44E+04 7.53E+02

Citrate/isocitrate 2.55E+06 3.87E+06 2.35E+06 7.18E+06 8.34E+05 3.33E+05 4.71E+06 3.37E+06 1.76E+06 1.91E+06 4.02E+06 2.06E+06

Citrulline 1.69E+04 1.07E+04 4.68E+03 1.49E+04 8.65E+03 1.61E+03 1.51E+04 2.71E+04 2.02E+04 1.06E+04 8.16E+03 8.44E+03

Creatine 1.57E+06 1.17E+06 1.27E+06 1.32E+06 9.89E+05 3.92E+05 1.03E+06 1.50E+06 9.90E+05 1.34E+06 1.68E+06 9.98E+05

Creatinine 5.22E+04 3.94E+04 3.47E+04 6.79E+04 2.20E+04 1.13E+04 4.64E+04 4.81E+04 2.18E+04 4.37E+04 5.50E+04 3.14E+04

Cysteine 2.70E+03 8.59E+02 1.87E+03 1.48E+04 1.60E+03 1.00E+02 1.81E+03 1.50E+03 1.53E+03 1.28E+03 1.02E+04 1.30E+03

Cystine 1.59E+05 1.09E+05 1.42E+05 2.27E+05 7.13E+04 2.58E+04 9.67E+04 9.20E+04 4.69E+04 6.74E+04 9.57E+04 9.30E+04

Cytidine 2.98E+04 2.36E+04 2.53E+04 3.08E+04 1.67E+04 5.64E+03 2.39E+04 1.64E+04 1.31E+04 2.04E+04 1.55E+04 2.07E+04

Cytidine 2.05E+04 1.55E+04 4.05E+04 3.98E+04 1.49E+04 1.18E+04 2.56E+04 2.32E+04 3.99E+03 3.91E+04 3.03E+04 1.23E+04 D-Glyceraldehdye 3-phosphate 7.64E+04 6.08E+04 1.04E+05 2.89E+05 2.89E+04 7.61E+03 4.56E+04 1.11E+05 8.13E+04 3.42E+04 6.29E+04 1.06E+05

Dopamine 1.82E+04 3.97E+04 6.44E+03 2.38E+04 3.41E+04 2.12E+04 5.71E+04 9.71E+04 2.23E+04 3.61E+04 3.92E+04 1.14E+04 Fructose 1_6-bisphosphate 1.26E+04 7.91E+03 2.47E+04 5.18E+04 3.97E+03 1.00E+02 4.31E+03 1.31E+04 4.71E+03 8.16E+03 6.79E+03 2.67E+04

Fumarate 6.54E+05 6.74E+05 5.27E+05 3.48E+06 1.85E+06 4.24E+05 2.26E+06 2.89E+06 1.57E+06 9.98E+05 2.29E+06 1.21E+06

Glutamate 1.43E+07 7.00E+06 7.04E+06 1.99E+07 9.62E+06 5.05E+06 1.49E+07 1.55E+07 1.21E+07 1.15E+07 1.43E+07 1.07E+07

Glutamine 1.03E+07 7.38E+06 6.11E+06 7.41E+06 6.21E+06 3.72E+06 8.61E+06 1.09E+07 6.09E+06 7.18E+06 7.59E+06 4.98E+06

Glutathione 9.63E+04 7.38E+03 7.09E+04 3.14E+04 1.04E+05 1.04E+04 2.63E+05 3.79E+05 1.80E+05 1.76E+05 4.59E+05 2.24E+05

90

Table 1.11 Continued

Sample Name H6 H7 H8 H9 H14 H15 H17 H23 H24 H35 H36 H41

Glutathione disulfide 4.60E+04 2.27E+04 2.80E+04 5.98E+04 5.84E+04 2.67E+04 1.12E+05 6.97E+04 3.17E+04 4.95E+04 7.38E+04 9.68E+04

Glycine 2.89E+05 3.47E+05 1.19E+05 3.21E+05 1.42E+05 4.74E+04 8.32E+04 2.16E+05 1.61E+05 3.88E+05 2.76E+05 5.22E+04

Guanosine 2.59E+05 2.24E+05 1.71E+05 3.54E+05 2.13E+05 9.53E+04 3.89E+05 2.92E+05 1.64E+05 2.84E+05 2.75E+05 2.11E+05

Histidine 8.59E+04 5.40E+04 5.27E+04 9.29E+04 3.74E+04 2.32E+04 6.10E+04 9.02E+04 3.55E+04 4.87E+04 4.34E+04 2.89E+04

Homoserine 7.69E+05 5.99E+05 5.16E+05 6.43E+05 3.87E+05 2.87E+05 6.28E+05 6.24E+05 4.36E+05 6.09E+05 5.40E+05 3.90E+05

Homovanillic acid 1.35E+05 9.95E+04 4.27E+04 7.68E+04 5.37E+04 2.36E+04 1.09E+05 1.04E+05 3.68E+04 8.42E+04 9.93E+04 8.50E+04

Hydroxybenzoate 7.62E+05 6.85E+05 7.84E+05 1.03E+06 1.58E+06 2.53E+06 3.52E+06 2.37E+06 3.73E+06 1.21E+06 2.59E+06 9.06E+05

Hypoxanthine 3.14E+06 2.27E+06 2.20E+06 2.09E+06 4.93E+05 2.90E+05 9.64E+05 1.05E+06 5.00E+05 9.42E+05 9.39E+05 2.49E+06

IMP 6.39E+03 9.99E+03 1.08E+04 9.41E+03 3.60E+04 2.54E+04 1.21E+04 3.79E+04 4.44E+04 2.16E+04 5.17E+04 5.96E+03

Inosine 1.12E+06 1.80E+06 7.28E+05 2.09E+06 1.58E+06 1.23E+06 2.47E+06 2.17E+06 1.70E+06 2.28E+06 2.29E+06 9.23E+05

Lactate 2.78E+07 2.44E+07 1.93E+07 6.52E+07 5.18E+07 3.91E+07 7.72E+07 6.40E+07 6.07E+07 4.97E+07 6.41E+07 2.17E+07

Leucine/Isoleucine 1.63E+05 9.75E+04 7.46E+04 1.21E+05 4.67E+04 3.16E+04 5.74E+04 9.17E+04 4.87E+04 4.48E+04 1.05E+05 1.18E+05

Malate 1.37E+07 1.38E+07 1.18E+07 3.83E+07 2.22E+07 7.73E+06 2.66E+07 3.29E+07 2.22E+07 1.80E+07 3.13E+07 1.98E+07

Methionine 1.19E+05 3.32E+04 4.38E+04 4.13E+04 3.06E+04 1.58E+04 3.42E+04 3.23E+04 2.08E+04 3.12E+04 4.65E+04 4.09E+04

Methylmalonate 1.39E+05 1.95E+05 1.92E+05 2.12E+06 1.23E+06 1.12E+06 1.60E+06 2.30E+06 2.01E+06 1.79E+06 2.10E+06 2.08E+05

myo-Inositol 7.32E+04 3.97E+04 3.76E+04 3.26E+05 1.99E+05 1.67E+05 3.84E+05 4.02E+05 2.95E+05 2.69E+05 3.07E+05 4.48E+04

N-Acetyl-beta-alanine 8.67E+05 5.53E+05 4.67E+05 8.41E+05 6.07E+05 3.45E+05 5.57E+05 8.67E+05 5.84E+05 6.98E+05 7.75E+05 6.81E+05

N-Acetylglutamate 3.41E+05 3.13E+05 2.27E+05 5.25E+05 2.69E+05 1.64E+05 5.42E+05 5.97E+05 3.02E+05 3.48E+05 4.44E+05 2.44E+05 N-Carbamoyl-L-aspartate 4.77E+05 2.52E+05 3.74E+05 3.52E+05 2.21E+05 1.48E+05 3.51E+05 2.35E+05 4.83E+05 2.96E+05 2.20E+05 5.70E+05

Pantothenate 8.05E+05 5.34E+05 6.42E+05 5.60E+05 1.06E+06 3.24E+05 8.45E+05 8.70E+05 3.88E+05 4.55E+05 8.83E+05 4.91E+05

Phenylalanine 4.97E+04 5.82E+04 2.51E+04 7.02E+04 4.10E+04 3.25E+04 5.39E+04 5.32E+04 5.59E+04 7.87E+04 6.08E+04 4.04E+04

Phosphoenolpyruvate 1.68E+05 1.15E+05 1.99E+05 8.84E+04 1.00E+02 1.00E+02 9.28E+03 4.44E+03 1.00E+02 4.32E+03 5.43E+03 6.12E+04

Proline 1.09E+05 7.33E+04 6.08E+04 6.93E+04 4.29E+04 5.59E+04 5.38E+04 8.57E+04 5.58E+04 6.07E+04 6.92E+04 8.42E+04

Pyroglutamic acid 2.69E+06 2.00E+06 1.59E+06 3.38E+06 6.01E+05 3.97E+05 1.15E+06 6.52E+05 6.24E+05 7.32E+05 1.03E+06 9.93E+05

Serine 9.02E+05 7.68E+05 6.94E+05 1.13E+06 8.44E+05 4.45E+05 1.12E+06 9.36E+05 7.32E+05 8.56E+05 9.48E+05 3.57E+05

Succinate 1.39E+05 1.95E+05 1.92E+05 2.12E+06 1.23E+06 1.12E+06 1.60E+06 2.30E+06 2.01E+06 1.79E+06 2.10E+06 2.08E+05

Sulfolactate 1.33E+04 1.85E+04 7.88E+03 2.75E+04 1.27E+05 1.24E+05 9.66E+04 1.29E+05 1.87E+05 2.04E+05 1.47E+05 9.37E+04

Sulfolactate 3.59E+04 1.64E+04 3.07E+04 1.73E+04 2.22E+04 2.10E+04 1.81E+04 2.90E+04 2.32E+04 2.73E+04 2.07E+04 1.93E+04

Taurine 1.39E+07 8.62E+06 8.07E+06 1.30E+07 7.39E+06 5.34E+06 9.70E+06 1.04E+07 9.11E+06 9.65E+06 1.06E+07 9.20E+06

Trehalose/sucrose 5.14E+04 1.73E+04 2.15E+04 4.78E+04 2.96E+04 3.55E+04 3.09E+04 1.71E+04 1.28E+05 1.79E+04 3.97E+04 1.69E+04

Tyrosine 1.05E+05 5.98E+04 6.17E+04 8.46E+04 5.87E+04 3.80E+04 6.94E+04 5.05E+04 3.65E+04 6.81E+04 6.74E+04 5.88E+04

UDP-glucose 1.24E+05 7.68E+04 6.69E+04 9.99E+04 1.86E+05 1.27E+05 2.54E+05 1.72E+05 5.75E+04 6.87E+04 1.29E+05 8.67E+04

91

Table 1.11 Continued

Sample Name H6 H7 H8 H9 H14 H15 H17 H23 H24 H35 H36 H41 UDP-N-acetylglucosamine 5.76E+04 4.46E+04 2.03E+04 5.20E+04 1.36E+05 8.20E+04 1.97E+05 1.11E+05 4.47E+04 4.79E+04 5.38E+04 6.03E+04

UMP 1.00E+02 1.00E+02 4.76E+03 4.98E+03 4.00E+04 1.96E+04 4.87E+03 4.34E+04 2.88E+04 6.24E+03 3.37E+04 1.00E+02

Uracil 1.21E+06 8.85E+05 7.47E+05 1.06E+06 2.62E+05 1.67E+05 6.38E+05 5.99E+05 3.94E+05 4.92E+05 5.37E+05 8.75E+05

Uric acid 1.63E+04 1.59E+04 1.78E+04 1.03E+04 6.67E+03 1.01E+04 2.37E+04 2.02E+04 3.55E+04 1.91E+04 3.57E+04 1.50E+04

Uridine 2.39E+05 8.81E+04 1.80E+05 1.17E+05 1.11E+05 6.64E+04 1.71E+05 1.63E+05 1.09E+05 1.18E+05 1.50E+05 1.57E+05

Valine 2.49E+05 1.10E+05 6.98E+04 1.22E+05 9.27E+04 5.09E+04 1.44E+05 1.54E+05 1.04E+05 7.79E+04 1.41E+05 8.73E+04

Xanthine 1.18E+06 8.08E+05 9.12E+05 7.13E+05 1.18E+05 7.72E+04 4.16E+05 2.48E+05 1.27E+05 1.77E+05 2.05E+05 1.01E+06

92

Table 1.12 Raw Data of Dominant Hamsters from vmPFC

Sample Name H2 H4 H5 H19 H21 H25 H33 H38 H47

2-Hydroxy-2-methylsuccinate 4.18E+05 3.85E+05 4.92E+05 2.07E+05 1.41E+06 2.17E+05 7.77E+05 7.10E+05 1.95E+05

3_4-Dihydroxyphenylacetate 6.97E+03 3.87E+03 3.22E+03 5.06E+03 7.11E+03 8.61E+03 3.61E+03 5.36E+04 4.86E+04

4-Aminobutyrate 2.82E+05 6.26E+05 2.55E+05 2.56E+05 1.82E+05 9.78E+04 9.47E+04 1.52E+05 2.33E+05

5-Hydroxyindoleacetic acid 3.02E+04 5.26E+04 2.23E+04 1.01E+04 7.51E+03 6.63E+03 2.68E+03 1.06E+04 1.23E+04

Aconitate 3.78E+04 5.76E+04 7.01E+04 2.93E+04 8.18E+04 2.52E+04 1.87E+04 2.91E+04 1.82E+04

Alanine 1.26E+06 1.51E+06 1.37E+06 6.74E+05 1.31E+06 6.84E+05 1.06E+06 1.27E+06 1.06E+06

alpha-Ketoglutarate 2.35E+04 1.81E+04 2.48E+04 1.86E+04 5.22E+04 1.23E+04 2.37E+04 3.21E+04 1.08E+04

AMP 2.89E+05 6.13E+04 1.47E+05 7.85E+05 2.88E+06 1.06E+06 1.16E+06 1.95E+06 3.66E+05

Ascorbate 8.65E+04 2.66E+05 1.00E+06 5.18E+04 1.00E+02 1.74E+04 3.07E+05 8.26E+05 6.87E+04

Asparagine 5.23E+04 6.37E+04 7.13E+04 2.14E+04 4.55E+04 1.96E+04 3.19E+04 4.89E+04 4.90E+04

Aspartate 4.48E+06 5.52E+06 5.21E+06 1.35E+06 4.45E+06 2.26E+06 2.40E+06 4.57E+06 2.85E+06

Citrate/isocitrate 4.24E+05 7.51E+05 1.09E+06 1.48E+05 8.47E+05 7.78E+04 1.90E+05 3.94E+05 9.85E+04

Citrulline 2.57E+04 7.54E+03 3.07E+04 5.99E+03 2.45E+04 1.04E+04 1.17E+04 3.47E+04 1.43E+04

Creatine 1.05E+06 1.33E+06 8.45E+05 3.72E+05 9.27E+05 4.59E+05 6.76E+05 1.02E+06 6.59E+05

Creatinine 3.13E+04 3.37E+04 5.49E+04 7.87E+03 1.68E+04 8.36E+03 1.40E+04 2.62E+04 3.29E+04

Cysteine 1.85E+03 1.57E+05 8.89E+04 1.98E+04 1.00E+02 2.09E+03 3.40E+04 3.25E+04 6.37E+03

Cystine 8.58E+04 1.82E+05 9.57E+04 1.22E+04 1.91E+04 6.56E+03 1.52E+04 1.03E+04 1.21E+04

Cytidine 3.44E+03 5.15E+03 7.01E+03 1.48E+04 1.49E+04 1.31E+04 1.59E+04 4.74E+03 2.71E+04

Cytidine 2.02E+04 2.03E+04 1.58E+04 1.57E+03 1.92E+04 3.11E+03 1.25E+04 1.71E+04 1.00E+04

dGMP 2.89E+05 6.13E+04 1.47E+05 7.85E+05 2.88E+06 1.06E+06 1.16E+06 1.95E+06 3.66E+05

Fumarate 2.63E+06 2.98E+06 2.65E+06 3.58E+05 2.06E+06 5.57E+05 1.35E+06 2.89E+06 1.67E+06

Glucose 1-phosphate 2.50E+04 1.22E+04 8.22E+03 1.00E+02 5.88E+03 1.00E+02 5.77E+03 8.37E+03 2.18E+04

Glutamate 1.52E+07 1.40E+07 1.46E+07 9.42E+06 1.64E+07 7.56E+06 1.14E+07 1.66E+07 1.15E+07

Glutamine 9.18E+06 1.00E+07 7.42E+06 3.54E+06 6.76E+06 3.49E+06 5.04E+06 7.81E+06 5.05E+06

Glutathione 1.14E+05 1.68E+05 2.08E+05 2.65E+05 1.00E+02 2.14E+05 4.37E+05 7.61E+05 2.54E+05

Glutathione disulfide 1.52E+05 2.13E+04 3.27E+04 2.89E+04 5.98E+05 1.29E+04 1.51E+04 6.32E+04 5.16E+04

Glycerone phosphate 8.24E+04 1.43E+05 8.36E+04 1.25E+04 6.23E+03 1.36E+04 6.32E+03 2.98E+04 2.05E+04

Glycine 1.27E+05 1.71E+05 1.16E+05 8.89E+04 1.78E+05 1.05E+05 9.67E+04 8.20E+04 1.80E+05

GMP 5.44E+04 1.73E+04 3.49E+04 4.41E+04 1.08E+05 2.61E+04 4.89E+04 1.02E+05 5.97E+04

93

Table 1.12 Continued

Sample Name H2 H4 H5 H19 H21 H25 H33 H38 H47

Guanosine 1.83E+05 2.73E+05 2.31E+05 3.17E+04 5.76E+04 1.52E+04 4.57E+04 5.38E+04 5.75E+04

Histidine 3.70E+04 5.09E+04 6.60E+04 2.67E+04 5.08E+04 9.74E+03 2.40E+04 5.63E+04 3.56E+04

Homoserine 5.82E+05 6.97E+05 5.57E+05 2.51E+05 4.57E+05 2.71E+05 3.20E+05 4.72E+05 4.02E+05

Hypoxanthine 8.47E+05 1.80E+06 1.13E+06 1.84E+05 2.39E+05 8.55E+04 1.50E+05 2.42E+05 2.68E+05

IMP 4.80E+04 1.83E+04 4.74E+04 7.66E+04 2.18E+05 4.94E+04 9.19E+04 1.94E+05 6.48E+04

Inosine 1.72E+06 2.07E+06 1.50E+06 6.77E+05 8.06E+05 5.45E+05 7.49E+05 8.82E+05 9.05E+05

Lactate 5.44E+07 6.01E+07 5.65E+07 3.62E+07 5.66E+07 3.36E+07 4.12E+07 5.73E+07 5.15E+07

Leucine/Isoleucine 8.03E+04 9.54E+04 9.09E+04 2.64E+04 5.82E+04 3.19E+04 4.53E+04 3.97E+04 4.91E+04

Malate 2.87E+07 3.46E+07 3.01E+07 7.74E+06 2.41E+07 9.08E+06 1.54E+07 3.21E+07 1.94E+07

Methionine 4.86E+04 3.71E+04 4.34E+04 2.58E+04 4.54E+04 1.21E+04 1.34E+04 2.38E+04 2.27E+04

Methylmalonate 8.62E+05 5.96E+05 6.83E+05 8.00E+05 1.18E+06 6.31E+05 6.61E+05 1.58E+06 9.13E+05

myo-Inositol 2.46E+05 2.40E+05 1.99E+05 1.27E+05 2.82E+05 1.02E+05 1.25E+05 2.91E+05 2.08E+05

N-Acetylglutamate 4.90E+05 6.03E+05 4.46E+05 1.71E+05 4.96E+05 1.27E+05 2.25E+05 5.65E+05 2.31E+05

N-Carbamoyl-L-aspartate 2.68E+05 3.38E+05 2.19E+05 1.55E+05 4.58E+05 6.37E+04 2.68E+05 3.79E+05 2.07E+05

N-Carbamoyl-L-aspartate 5.47E+03 8.24E+04 6.31E+03 6.26E+03 6.02E+03 8.22E+03 6.93E+03 1.38E+05 2.14E+04

Pantothenate 5.96E+05 1.65E+06 5.87E+05 7.01E+05 3.95E+05 3.48E+05 2.98E+05 4.54E+05 2.83E+05

Phenylalanine 6.34E+04 7.00E+04 5.89E+04 1.33E+04 3.96E+04 3.97E+04 4.85E+04 5.61E+04 4.41E+04

Proline 5.85E+04 5.13E+04 7.18E+04 3.71E+04 6.99E+04 2.93E+04 2.95E+04 5.68E+04 4.61E+04

Pyroglutamic acid 5.70E+05 1.53E+06 9.63E+05 2.88E+05 2.86E+05 2.27E+05 2.89E+05 2.43E+05 3.41E+05

Ribose phosphate 1.98E+05 2.80E+05 3.61E+05 3.01E+05 1.97E+05 7.78E+04 1.48E+05 1.09E+05 8.25E+04

Serine 1.17E+06 1.19E+06 1.39E+06 6.70E+05 1.19E+06 7.81E+05 9.42E+05 1.26E+06 1.02E+06

Succinate 8.62E+05 5.96E+05 6.83E+05 8.00E+05 1.18E+06 6.31E+05 6.61E+05 1.58E+06 9.13E+05

Sulfolactate 1.61E+04 1.95E+04 2.25E+04 9.88E+04 5.10E+04 1.07E+05 8.47E+04 1.17E+05 1.15E+05

Taurine 1.15E+07 8.75E+06 1.08E+07 4.62E+06 1.09E+07 5.30E+06 7.93E+06 1.20E+07 7.73E+06

Trehalose/sucrose 3.69E+04 1.49E+05 2.60E+05 3.16E+04 4.48E+04 2.94E+04 3.02E+04 2.54E+04 8.68E+04

Tyrosine 8.07E+04 6.11E+04 8.73E+04 3.47E+04 5.68E+04 2.37E+04 5.05E+04 4.70E+04 5.95E+04

UDP-glucose 1.73E+05 3.56E+05 3.75E+05 1.84E+05 1.77E+05 1.17E+05 1.55E+05 2.04E+05 1.51E+05

UDP-N-acetylglucosamine 1.47E+05 2.54E+05 2.51E+05 1.08E+05 1.86E+05 8.85E+04 1.26E+05 1.89E+05 1.37E+05

94

Table 1.12 Continued

Sample Name H2 H4 H5 H19 H21 H25 H33 H38 H47

UMP 1.22E+05 2.24E+04 1.03E+05 1.03E+05 2.12E+05 9.21E+04 1.19E+05 1.94E+05 1.37E+05

Uracil 3.55E+05 7.34E+05 5.81E+05 1.29E+05 2.88E+05 5.38E+04 8.07E+04 3.02E+05 1.90E+05

Uridine 8.86E+04 1.08E+05 1.21E+05 3.50E+04 7.27E+04 1.39E+04 5.38E+04 5.99E+04 3.45E+04

Valine 1.44E+05 1.41E+05 1.98E+05 5.64E+04 1.38E+05 5.55E+04 7.67E+04 1.07E+05 8.98E+04

Xanthine 1.88E+05 3.98E+05 2.67E+05 7.90E+04 7.69E+04 3.11E+04 5.51E+04 7.38E+04 7.55E+04

95

Table 1.13 Raw Data of Handled Control Hamsters from vmPFC

Sample Name H1 H10 H18 H26 H31 H32 H34 H43 H44 H52 H53

2-Hydroxy-2-methylsuccinate 2.72E+05 4.02E+05 1.58E+05 3.28E+05 2.77E+05 4.06E+05 2.21E+05 2.87E+05 1.58E+05 2.81E+05 2.72E+05

3_4-Dihydroxyphenylacetate 1.24E+04 7.91E+03 1.12E+04 3.78E+03 5.48E+03 3.27E+03 4.17E+03 7.99E+03 6.72E+03 2.15E+04 7.97E+03

4-Aminobutyrate 3.14E+05 1.58E+05 9.44E+04 1.08E+05 1.96E+05 1.88E+05 5.87E+04 1.08E+05 1.80E+05 1.64E+05 3.51E+05

5-Hydroxyindoleacetic acid 1.33E+04 1.05E+04 7.68E+03 2.29E+03 1.04E+04 1.81E+04 2.59E+03 6.48E+03 8.11E+03 3.63E+03 3.19E+04

Aconitate 5.69E+04 8.15E+04 1.32E+04 1.98E+04 2.15E+04 4.85E+04 8.28E+03 1.70E+04 2.56E+04 5.96E+04 3.19E+04

Alanine 1.17E+06 9.40E+05 4.86E+05 9.17E+05 1.21E+06 1.39E+06 7.68E+05 1.05E+06 9.30E+05 1.13E+06 1.09E+06

alpha-Ketoglutarate 3.57E+04 2.91E+04 1.18E+04 2.15E+04 1.77E+04 1.81E+04 1.22E+04 1.79E+04 1.38E+04 3.29E+04 2.70E+04

AMP 9.28E+04 3.11E+06 8.85E+05 1.46E+06 2.54E+06 2.99E+06 6.29E+05 2.06E+05 3.33E+05 1.61E+05 1.93E+04

Ascorbate 1.00E+02 1.77E+06 2.25E+05 4.94E+04 2.58E+06 2.94E+06 1.00E+02 6.48E+03 1.22E+05 1.00E+02 1.00E+02

Asparagine 5.62E+04 3.96E+04 1.71E+04 3.53E+04 4.58E+04 7.60E+04 1.95E+04 2.42E+04 4.00E+04 3.52E+04 3.72E+04

Aspartate 4.32E+06 1.57E+06 6.35E+05 2.84E+06 3.45E+06 3.78E+06 1.16E+06 2.68E+06 2.88E+06 3.17E+06 3.48E+06

Citrate/isocitrate 1.27E+05 1.61E+06 1.19E+05 1.50E+05 2.52E+05 4.59E+05 5.40E+04 1.33E+05 2.06E+05 5.23E+05 4.28E+05

Citrulline 6.46E+03 2.18E+04 1.34E+04 1.41E+04 3.01E+04 2.03E+04 1.03E+04 8.56E+03 1.93E+04 2.02E+04 4.70E+03

Creatine 6.50E+05 4.76E+05 2.93E+05 6.16E+05 1.02E+06 1.16E+06 5.27E+05 8.73E+05 7.13E+05 9.30E+05 9.55E+05

Creatinine 2.54E+04 1.23E+04 4.94E+03 1.03E+04 1.91E+04 2.48E+04 6.16E+03 1.79E+04 1.74E+04 2.38E+04 3.44E+04

Cysteine 4.86E+04 5.28E+04 2.39E+04 1.52E+04 4.73E+04 6.58E+04 1.00E+02 1.13E+04 2.19E+04 4.39E+03 4.89E+03

Cystine 8.93E+04 1.51E+04 7.16E+03 1.43E+04 1.48E+04 2.06E+04 1.64E+04 8.39E+04 2.70E+04 9.18E+04 1.44E+05

Cytidine 1.24E+04 1.63E+04 9.69E+03 3.14E+04 1.57E+04 9.09E+03 1.09E+04 3.60E+04 1.04E+04 2.47E+04 6.69E+03

Cytidine 1.88E+04 7.37E+03 1.11E+03 4.53E+03 1.75E+04 2.38E+04 7.37E+03 7.25E+03 9.39E+03 1.24E+04 2.50E+04

dGMP 9.28E+04 3.11E+06 8.85E+05 1.46E+06 2.54E+06 2.99E+06 6.29E+05 2.06E+05 3.33E+05 1.61E+05 1.93E+04

Fumarate 2.44E+06 5.60E+05 1.33E+05 6.91E+05 1.45E+06 2.13E+06 6.81E+05 9.80E+05 1.14E+06 9.46E+05 2.44E+06

Glucose 1-phosphate 1.78E+05 1.00E+02 1.00E+02 4.45E+03 8.00E+03 5.52E+03 1.00E+02 5.63E+03 9.56E+03 5.26E+03 1.35E+05

Glutamate 1.47E+07 8.85E+06 5.80E+06 1.10E+07 1.44E+07 1.49E+07 8.12E+06 9.97E+06 1.18E+07 1.06E+07 1.06E+07

Glutamine 6.69E+06 6.29E+06 3.66E+06 6.34E+06 5.95E+06 8.82E+06 3.45E+06 3.73E+06 4.76E+06 5.03E+06 5.73E+06

Glutathione 3.67E+05 6.49E+05 1.97E+05 3.57E+05 8.43E+05 1.02E+06 5.29E+04 4.81E+04 2.32E+05 3.18E+04 1.00E+02

Glutathione disulfide 4.25E+04 1.07E+05 1.16E+04 3.35E+04 2.81E+04 2.98E+04 5.78E+04 9.45E+03 2.41E+04 1.47E+04 1.62E+04

Glycerone phosphate 2.11E+05 5.34E+04 5.95E+03 1.74E+04 7.47E+04 4.29E+04 5.13E+03 3.96E+04 5.83E+04 3.75E+04 2.16E+05

Glycine 8.86E+04 1.37E+05 5.86E+04 1.27E+05 1.18E+05 2.02E+05 8.74E+04 8.63E+04 1.60E+05 2.11E+05 1.02E+05

96

Table 1.13 Continued

Sample Name H1 H10 H18 H26 H31 H32 H34 H43 H44 H52 H53

GMP 1.57E+04 1.83E+05 4.61E+04 6.34E+04 9.45E+04 1.31E+05 2.51E+04 2.40E+04 5.52E+04 3.41E+04 3.00E+03

Guanosine 2.76E+05 4.72E+04 2.32E+04 4.99E+04 5.56E+04 7.41E+04 2.87E+04 9.95E+04 5.24E+04 1.15E+05 2.09E+05

Histidine 5.58E+04 1.32E+04 8.18E+03 2.85E+04 2.40E+04 2.87E+04 1.70E+04 2.62E+04 2.13E+04 3.42E+04 3.32E+04

Homoserine 4.82E+05 2.82E+05 2.40E+05 3.63E+05 4.57E+05 4.73E+05 2.92E+05 3.11E+05 3.30E+05 4.02E+05 4.40E+05

Hypoxanthine 1.56E+06 1.84E+05 9.17E+04 1.80E+05 2.49E+05 3.13E+05 9.48E+04 4.86E+05 3.95E+05 5.05E+05 4.39E+05

IMP 2.49E+04 4.38E+05 8.43E+04 8.93E+04 1.41E+05 1.65E+05 9.34E+04 9.17E+04 4.59E+04 5.67E+04 5.71E+03

Inosine 2.31E+06 3.64E+05 3.63E+05 6.80E+05 8.60E+05 9.40E+05 4.83E+05 1.35E+06 9.36E+05 1.19E+06 1.78E+06

Lactate 4.98E+07 4.06E+07 3.49E+07 4.56E+07 5.10E+07 5.87E+07 3.71E+07 4.55E+07 3.55E+07 4.31E+07 5.22E+07

Leucine/Isoleucine 8.16E+04 3.15E+04 1.46E+04 3.92E+04 5.67E+04 5.68E+04 3.10E+04 4.44E+04 4.03E+04 4.85E+04 5.00E+04

Malate 2.75E+07 9.13E+06 3.99E+06 1.01E+07 1.68E+07 2.31E+07 9.73E+06 1.27E+07 1.40E+07 1.29E+07 2.83E+07

Methionine 3.79E+04 3.67E+04 9.24E+03 1.82E+04 2.08E+04 2.12E+04 8.36E+03 2.72E+04 1.95E+04 2.45E+04 2.36E+04

Methylmalonate 6.34E+05 6.83E+05 1.17E+06 8.23E+05 6.30E+05 8.54E+05 7.65E+05 6.19E+05 3.82E+05 8.77E+05 5.90E+05

myo-Inositol 2.20E+05 1.80E+05 1.16E+05 1.93E+05 1.70E+05 2.75E+05 1.41E+05 1.69E+05 1.03E+05 1.86E+05 2.18E+05

N-Acetylglutamate 3.79E+05 4.32E+05 1.19E+05 2.09E+05 3.41E+05 4.04E+05 1.06E+05 1.61E+05 2.21E+05 2.54E+05 3.71E+05

N-Carbamoyl-L-aspartate 3.80E+05 4.63E+05 1.28E+05 2.76E+05 2.83E+05 3.85E+05 1.15E+05 1.43E+05 2.34E+05 2.33E+05 2.62E+05

N-Carbamoyl-L-aspartate 2.86E+04 3.41E+03 6.00E+03 4.49E+03 5.70E+03 4.70E+03 1.06E+04 6.38E+04 3.05E+04 1.45E+05 2.57E+04

Pantothenate 7.85E+05 4.26E+05 2.51E+05 4.02E+05 5.77E+05 7.10E+05 3.06E+05 4.67E+05 3.12E+05 3.88E+05 8.53E+05

Phenylalanine 7.27E+04 2.37E+04 2.50E+04 3.17E+04 2.53E+04 4.05E+04 3.10E+04 4.62E+04 3.50E+04 4.05E+04 4.15E+04

Proline 6.43E+04 4.05E+04 1.12E+04 4.42E+04 4.67E+04 5.50E+04 3.45E+04 5.21E+04 4.76E+04 5.19E+04 4.72E+04

Pyroglutamic acid 5.11E+05 2.36E+05 2.09E+05 2.49E+05 2.23E+05 3.05E+05 2.31E+05 4.83E+05 2.48E+05 5.47E+05 6.45E+05

Ribose phosphate 7.41E+05 2.93E+05 6.18E+04 1.38E+05 1.22E+05 2.34E+05 3.67E+04 8.85E+04 9.90E+04 9.04E+04 3.27E+05

Serine 1.21E+06 7.97E+05 6.20E+05 9.67E+05 1.01E+06 1.26E+06 8.23E+05 1.02E+06 9.02E+05 1.27E+06 9.53E+05

Succinate 6.34E+05 6.83E+05 1.17E+06 8.23E+05 6.30E+05 8.54E+05 7.65E+05 6.19E+05 3.82E+05 8.77E+05 5.90E+05

Sulfolactate 1.21E+04 7.08E+04 1.54E+05 7.91E+04 6.62E+04 7.87E+04 1.03E+05 9.35E+04 1.58E+04 2.06E+04 9.04E+03

Taurine 1.22E+07 1.01E+07 4.17E+06 7.75E+06 1.03E+07 1.02E+07 5.95E+06 8.77E+06 7.81E+06 8.06E+06 7.77E+06

Trehalose/sucrose 5.24E+05 1.81E+04 3.17E+04 2.92E+04 1.89E+04 2.91E+04 5.21E+04 3.84E+04 5.21E+04 6.61E+04 4.40E+04

Tyrosine 5.51E+04 5.11E+04 2.40E+04 3.02E+04 5.54E+04 5.70E+04 1.92E+04 2.67E+04 3.87E+04 3.94E+04 4.23E+04

UDP-glucose 4.67E+05 2.98E+05 1.27E+05 1.73E+05 1.97E+05 3.68E+05 1.09E+05 1.61E+05 1.62E+05 1.79E+05 2.84E+05

97

Table 1.13 Continued

Sample Name H1 H10 H18 H26 H31 H32 H34 H43 H44 H52 H53

UDP-N-acetylglucosamine 2.74E+05 2.88E+05 7.48E+04 1.29E+05 2.06E+05 3.12E+05 8.18E+04 1.07E+05 1.12E+05 1.10E+05 1.33E+05

UMP 4.92E+04 2.44E+05 9.38E+04 1.33E+05 2.01E+05 2.25E+05 6.72E+04 7.63E+04 1.36E+05 7.74E+04 3.34E+03

Uracil 6.11E+05 2.30E+05 5.27E+04 1.23E+05 1.46E+05 2.81E+05 6.35E+04 3.10E+05 2.23E+05 3.60E+05 5.96E+05

Uridine 1.29E+05 4.15E+04 1.82E+04 3.94E+04 8.18E+04 6.57E+04 2.04E+04 4.77E+04 2.23E+04 4.77E+04 8.31E+04

Valine 1.36E+05 8.54E+04 3.65E+04 9.48E+04 1.21E+05 1.39E+05 5.98E+04 7.57E+04 8.92E+04 1.04E+05 1.05E+05

Xanthine 3.71E+05 1.09E+05 2.31E+04 4.89E+04 8.20E+04 7.30E+04 2.59E+04 8.68E+04 7.08E+04 1.07E+05 2.38E+05

98

Table 1.14 Raw Data of Subordinate Hamsters from vmPFC

Sample Name H6 H7 H8 H9 H15 H17 H23 H24 H35 H36 H41

2-Hydroxy-2-methylsuccinate 3.31E+05 3.76E+05 1.33E+05 3.97E+05 4.85E+05 4.97E+05 7.26E+05 1.52E+06 5.92E+05 2.79E+05 5.36E+05

3_4-Dihydroxyphenylacetate 3.38E+03 3.07E+03 1.04E+04 5.39E+03 5.55E+03 5.72E+03 7.34E+03 6.79E+03 3.35E+04 4.64E+03 2.12E+04

4-Aminobutyrate 2.59E+05 3.08E+05 5.47E+05 3.12E+05 1.57E+05 1.11E+05 1.63E+05 1.50E+05 7.26E+04 1.03E+05 1.67E+05

5-Hydroxyindoleacetic acid 3.41E+04 1.02E+04 2.30E+04 1.44E+04 1.16E+04 1.33E+04 5.55E+03 1.65E+04 9.57E+03 6.80E+03 1.89E+04

Aconitate 5.88E+04 7.30E+04 3.95E+04 5.16E+04 6.99E+04 3.97E+04 3.92E+04 4.53E+04 1.94E+04 2.27E+04 3.95E+04

Alanine 1.55E+06 1.53E+06 1.03E+06 1.26E+06 1.02E+06 1.10E+06 1.12E+06 1.09E+06 9.73E+05 7.73E+05 1.37E+06

alpha-Ketoglutarate 2.14E+04 3.96E+04 1.52E+04 1.73E+04 2.30E+04 2.17E+04 2.03E+04 3.08E+04 1.68E+04 9.88E+03 2.90E+04

AMP 3.96E+05 1.07E+05 3.67E+04 2.26E+05 2.80E+06 2.95E+06 2.33E+06 2.83E+06 9.25E+05 1.07E+06 7.12E+05

Ascorbate 5.59E+05 4.51E+03 2.19E+03 2.32E+05 4.97E+05 1.00E+02 1.00E+02 3.85E+05 1.00E+02 2.24E+05 8.90E+05

Asparagine 7.14E+04 6.39E+04 4.09E+04 7.29E+04 3.14E+04 5.93E+04 3.50E+04 5.65E+04 3.14E+04 2.54E+04 7.03E+04

Aspartate 5.48E+06 5.16E+06 2.72E+06 4.90E+06 3.21E+06 3.03E+06 2.41E+05 4.74E+06 2.73E+06 9.91E+05 4.68E+06

Citrate/isocitrate 1.48E+06 1.94E+06 3.69E+05 8.65E+05 8.55E+05 4.18E+05 2.24E+05 5.77E+05 9.25E+04 1.84E+05 8.56E+05

Citrulline 2.81E+04 2.27E+04 1.13E+04 1.95E+04 1.50E+04 1.26E+04 2.34E+04 2.01E+04 1.33E+04 1.08E+04 3.56E+04

Creatine 1.15E+06 1.06E+06 6.38E+05 1.10E+06 5.84E+05 7.23E+05 1.12E+06 1.01E+06 6.14E+05 4.74E+05 1.18E+06

Creatinine 3.49E+04 2.40E+04 1.68E+04 3.20E+04 1.20E+04 8.72E+03 1.26E+04 2.25E+04 1.43E+04 7.15E+03 2.49E+04

Cysteine 7.88E+04 2.33E+03 2.08E+04 9.21E+04 5.43E+04 2.78E+04 1.00E+02 1.50E+04 1.00E+02 1.24E+04 5.59E+04

Cystine 6.89E+04 1.52E+05 8.13E+04 7.99E+04 3.55E+03 3.47E+03 2.10E+04 2.34E+04 4.27E+04 8.16E+03 4.07E+04

Cytidine 2.00E+04 1.72E+04 1.91E+04 1.69E+04 2.63E+04 3.67E+04 2.19E+04 4.16E+04 1.62E+04 9.19E+03 2.76E+04

Cytidine 1.58E+04 1.88E+04 9.13E+03 2.44E+04 8.59E+03 1.22E+04 1.41E+04 1.94E+04 1.23E+04 4.61E+03 1.51E+04

dGMP 3.96E+05 1.07E+05 3.67E+04 2.26E+05 2.80E+06 2.95E+06 2.33E+06 2.83E+06 9.25E+05 1.07E+06 7.12E+05

Fumarate 2.35E+06 2.07E+06 1.15E+06 2.40E+06 5.72E+05 6.79E+05 1.19E+06 2.40E+06 9.02E+05 7.47E+05 2.87E+06

Glucose 1-phosphate 6.08E+03 1.02E+04 5.14E+03 6.40E+03 1.00E+02 1.00E+02 4.85E+03 5.59E+03 1.00E+02 1.00E+02 8.89E+04

Glutamate 1.53E+07 1.67E+07 8.70E+06 2.07E+07 1.21E+07 1.32E+07 3.22E+06 1.55E+07 1.08E+07 6.77E+06 1.70E+07

Glutamine 6.96E+06 6.59E+06 4.34E+06 5.89E+06 4.98E+06 6.41E+06 6.27E+06 7.15E+06 4.12E+06 3.34E+06 8.80E+06

Glutathione 3.55E+05 4.36E+03 3.67E+04 4.51E+05 5.77E+05 5.88E+05 2.44E+05 6.28E+05 3.20E+04 2.58E+05 6.17E+05

Glutathione disulfide 6.29E+04 7.88E+04 4.88E+03 7.08E+04 7.99E+04 1.05E+05 4.55E+04 1.26E+05 7.41E+04 1.47E+04 7.10E+04

Glycerone phosphate 5.94E+04 9.91E+04 8.27E+04 8.63E+04 1.14E+04 1.58E+04 3.40E+04 1.47E+04 9.11E+03 1.60E+04 1.09E+05

Glycine 1.01E+05 2.48E+05 1.28E+05 1.21E+05 1.45E+05 1.18E+05 1.53E+05 2.85E+05 1.06E+05 5.79E+04 2.12E+05

99

Table 1.14 Continued

Sample Name H6 H7 H8 H9 H15 H17 H23 H24 H35 H36 H41

GMP 9.15E+04 2.17E+04 6.51E+03 4.43E+04 1.29E+05 1.21E+05 9.83E+04 1.19E+05 2.94E+04 7.23E+04 1.07E+05

Guanosine 1.21E+05 2.53E+05 1.09E+05 1.79E+05 4.95E+04 4.83E+04 3.76E+04 4.37E+04 6.02E+04 3.08E+04 9.88E+04

Histidine 4.19E+04 3.85E+04 3.27E+04 4.38E+04 3.06E+04 2.63E+04 5.05E+04 4.23E+04 2.69E+04 1.42E+04 4.57E+04

Homoserine 5.71E+05 6.82E+05 3.77E+05 5.69E+05 3.33E+05 3.88E+05 3.52E+05 4.87E+05 2.71E+05 2.35E+05 6.33E+05

Hypoxanthine 9.55E+05 1.34E+06 7.75E+05 9.11E+05 1.68E+05 2.33E+05 2.62E+05 2.87E+05 1.58E+05 9.77E+04 6.82E+05

IMP 1.60E+05 3.62E+04 1.21E+04 1.23E+05 2.34E+05 1.39E+05 1.80E+05 2.04E+05 6.06E+04 6.36E+04 9.34E+04

Inosine 1.56E+06 1.88E+06 1.18E+06 1.66E+06 5.58E+05 6.65E+05 5.20E+05 8.94E+05 8.20E+05 4.47E+05 1.42E+06

Lactate 6.46E+07 5.08E+07 4.11E+07 5.97E+07 4.87E+07 5.38E+07 4.40E+07 6.31E+07 4.08E+07 3.60E+07 5.33E+07

Leucine/Isoleucine 1.05E+05 8.10E+04 4.47E+04 8.38E+04 4.44E+04 3.78E+04 5.56E+04 1.05E+05 3.64E+04 2.95E+04 9.57E+04

Malate 2.68E+07 2.37E+07 1.41E+07 2.63E+07 9.67E+06 1.09E+07 1.50E+07 2.72E+07 1.26E+07 1.04E+07 3.24E+07

Methionine 3.11E+04 2.65E+04 1.21E+04 2.57E+04 2.58E+04 2.67E+04 2.94E+04 2.82E+04 1.30E+04 9.72E+03 4.02E+04

Methylmalonate 7.73E+05 9.02E+05 4.57E+05 6.50E+05 7.03E+05 6.75E+05 7.37E+05 1.67E+06 9.79E+05 5.26E+05 1.12E+06

myo-Inositol 3.34E+05 2.18E+05 1.48E+05 3.11E+05 1.94E+05 2.02E+05 1.10E+05 2.78E+05 2.76E+05 1.15E+05 2.59E+05

N-Acetylglutamate 5.27E+05 5.90E+05 2.07E+05 5.12E+05 3.94E+05 3.90E+05 2.90E+05 4.65E+05 2.36E+05 1.87E+05 5.20E+05

N-Carbamoyl-L-aspartate 3.33E+05 3.16E+05 1.99E+05 3.31E+05 3.57E+05 2.11E+05 2.35E+05 4.68E+05 1.55E+05 1.79E+05 2.93E+05

N-Carbamoyl-L-aspartate 1.63E+04 5.00E+04 5.03E+03 3.54E+04 6.60E+03 3.95E+03 2.37E+03 2.56E+03 6.58E+03 3.04E+03 1.59E+05

Pantothenate 7.30E+05 5.06E+05 6.41E+05 4.55E+05 5.03E+05 4.18E+05 6.01E+05 7.70E+05 3.24E+05 2.95E+05 5.24E+05

Phenylalanine 8.36E+04 5.05E+04 3.44E+04 6.57E+04 3.60E+04 2.99E+04 2.71E+04 5.64E+04 3.61E+04 3.07E+04 4.99E+04

Proline 7.45E+04 6.05E+04 3.50E+04 6.53E+04 4.72E+04 5.10E+04 6.79E+04 5.42E+04 4.74E+04 3.79E+04 6.98E+04

Pyroglutamic acid 8.25E+05 8.20E+05 5.55E+05 7.34E+05 2.59E+05 1.94E+05 2.29E+05 3.47E+05 2.17E+05 2.07E+05 3.57E+05

Ribose phosphate 1.21E+05 2.10E+05 2.77E+05 1.03E+05 2.22E+05 1.67E+05 9.96E+04 1.24E+05 1.10E+05 1.20E+05 3.09E+05

Serine 1.39E+06 1.29E+06 7.82E+05 1.41E+06 9.85E+05 1.11E+06 1.02E+06 1.35E+06 8.02E+05 6.98E+05 1.24E+06

Succinate 7.73E+05 9.02E+05 4.57E+05 6.50E+05 7.03E+05 6.75E+05 7.37E+05 1.67E+06 9.79E+05 5.26E+05 1.12E+06

Sulfolactate 1.14E+04 6.97E+03 2.29E+04 7.65E+03 1.06E+05 5.07E+04 1.31E+05 1.25E+05 7.87E+04 1.26E+05 1.04E+05

Taurine 1.08E+07 1.21E+07 5.28E+06 1.32E+07 7.59E+06 7.89E+06 8.76E+06 1.07E+07 7.82E+06 5.26E+06 1.19E+07

Trehalose/sucrose 6.24E+04 2.13E+05 4.07E+05 7.12E+04 2.08E+04 2.15E+04 3.36E+04 3.90E+04 2.80E+04 3.66E+04 2.94E+04

Tyrosine 6.44E+04 5.86E+04 2.63E+04 5.29E+04 3.72E+04 3.12E+04 4.74E+04 4.79E+04 3.86E+04 2.55E+04 6.86E+04

UDP-glucose 3.25E+05 3.26E+05 1.35E+05 2.26E+05 2.70E+05 2.12E+05 1.76E+05 2.52E+05 1.45E+05 2.72E+05 2.53E+05

100

Table 1.14 Continued

Sample Name H6 H7 H8 H9 H15 H17 H23 H24 H35 H36 H41

UDP-N-acetylglucosamine 2.12E+05 2.57E+05 1.01E+05 1.73E+05 1.55E+05 1.54E+05 1.42E+05 2.35E+05 1.00E+05 2.00E+05 2.20E+05

UMP 1.82E+05 5.88E+04 1.89E+04 1.19E+05 2.31E+05 2.25E+05 1.99E+05 2.31E+05 1.07E+05 1.16E+05 2.44E+05

Uracil 5.59E+05 7.32E+05 2.79E+05 6.26E+05 1.39E+05 2.17E+05 1.36E+05 1.82E+05 9.29E+04 5.83E+04 4.58E+05

Uridine 6.47E+04 8.30E+04 6.22E+04 6.16E+04 4.05E+04 4.93E+04 7.57E+04 5.25E+04 4.27E+04 1.77E+04 4.77E+04

Valine 1.55E+05 1.50E+05 7.90E+04 1.72E+05 9.68E+04 9.98E+04 1.37E+05 1.62E+05 6.24E+04 6.40E+04 1.73E+05

Xanthine 1.73E+05 2.93E+05 1.83E+05 1.73E+05 8.00E+04 7.85E+04 7.13E+04 9.83E+04 4.37E+04 4.14E+04 1.38E+05

101

Table 1.15 Raw Data of Resilient Mice from BLA/CeA

Sample Name M2 M13 M16 M18 M44 M45 M46 M64 M69 M70

2-Aminoadipate 3.16E+04 3.20E+04 3.12E+04 5.76E+04 3.02E+04 7.18E+04 5.92E+04 7.84E+04 5.30E+04 7.59E+04

2-Hydroxy-2-methylsuccinate 1.98E+06 2.53E+06 2.11E+06 3.47E+06 2.86E+06 4.34E+06 4.04E+06 4.92E+06 2.28E+06 5.28E+06

2-Isopropylmalate 7.59E+04 7.00E+04 7.41E+04 6.96E+04 6.98E+04 8.68E+04 9.69E+04 7.81E+04 6.29E+04 6.35E+04

3_4-Dihydroxyphenylacetate 1.98E+05 1.60E+04 3.11E+04 1.83E+04 4.14E+04 2.37E+04 3.99E+04 1.81E+04 4.86E+03 9.24E+03

4-Aminobutyrate 1.52E+06 1.70E+06 1.30E+06 1.79E+06 1.53E+06 1.96E+06 2.04E+06 1.96E+06 1.60E+06 1.78E+06

5-Hydroxyindoleacetic acid 2.18E+04 2.99E+04 3.76E+04 3.82E+04 4.48E+04 4.45E+04 4.25E+04 7.76E+04 5.63E+04 5.02E+04

Aconitate 2.19E+06 3.15E+06 4.09E+06 6.27E+06 7.10E+06 6.15E+06 8.49E+06 6.29E+06 4.18E+06 5.45E+06

Adenine 3.50E+04 2.29E+04 2.33E+04 3.20E+04 2.21E+04 4.74E+04 3.78E+04 3.39E+04 2.89E+04 2.10E+04

Adenosine 1.11E+05 6.32E+04 3.00E+04 3.29E+04 2.56E+04 1.12E+05 7.28E+04 1.82E+05 5.48E+04 2.12E+03

Alanine/Sarcosine 1.36E+06 1.76E+06 1.46E+06 2.08E+06 2.05E+06 2.21E+06 2.16E+06 2.03E+06 1.95E+06 2.27E+06

alpha-Ketoglutarate 5.28E+04 2.57E+04 2.19E+04 3.82E+04 4.05E+04 4.11E+04 5.58E+04 4.10E+04 9.29E+03 1.85E+04

AMP/dGMP 1.33E+06 2.03E+06 1.88E+06 2.85E+06 3.89E+06 3.92E+06 3.78E+06 3.73E+06 2.77E+06 3.52E+06

Ascorbate 2.66E+06 7.40E+06 8.91E+06 1.36E+07 1.33E+07 1.81E+07 2.20E+07 1.91E+07 1.20E+07 1.54E+07

Asparagine 8.14E+04 4.49E+04 5.04E+04 4.80E+04 5.01E+04 7.95E+04 9.48E+04 9.70E+04 6.84E+04 6.49E+04

Aspartate 5.08E+06 6.42E+06 4.46E+06 8.06E+06 6.10E+06 9.32E+06 8.59E+06 7.46E+06 5.90E+06 7.72E+06

cAMP 1.40E+04 1.29E+04 1.24E+04 8.75E+03 2.36E+04 1.74E+04 2.50E+04 2.76E+04 1.70E+04 9.74E+03

CDP-ethanolamine 2.87E+04 2.97E+04 2.36E+04 3.39E+04 3.46E+04 3.86E+04 5.22E+04 3.69E+04 3.42E+04 3.46E+04

Citraconate 1.44E+05 1.76E+05 1.96E+05 2.76E+05 2.79E+05 3.01E+05 3.33E+05 2.32E+05 2.08E+05 2.69E+05

Citrate/isocitrate 1.37E+06 1.75E+06 2.61E+06 3.73E+06 4.10E+06 3.43E+06 6.24E+06 4.08E+06 2.29E+06 4.13E+06

Citrulline 9.29E+03 1.42E+04 1.34E+04 1.86E+04 4.14E+04 2.49E+04 2.79E+04 1.74E+04 1.48E+04 9.64E+03

Creatine 1.70E+06 2.12E+06 1.64E+06 2.40E+06 2.61E+06 2.70E+06 2.57E+06 2.60E+06 2.24E+06 2.83E+06

Cysteine 1.21E+04 6.91E+04 5.39E+04 7.79E+04 4.95E+04 1.38E+05 1.25E+05 1.16E+05 1.01E+05 1.25E+05

Cytidine 3.19E+03 7.75E+03 7.59E+03 1.06E+04 2.09E+04 1.30E+04 2.03E+04 1.11E+04 1.41E+04 1.50E+04

D-Glyceraldehdye 3-phosphate 1.96E+03 2.47E+03 1.00E+02 5.62E+03 4.30E+03 2.75E+03 4.36E+03 2.15E+03 3.19E+03 4.98E+04

Fumarate 3.16E+05 3.00E+05 1.96E+05 1.36E+06 5.22E+05 1.51E+06 9.51E+05 1.42E+06 6.84E+05 1.33E+06

Glucose 1-phosphate 5.99E+03 2.42E+04 1.27E+04 2.12E+04 3.81E+04 1.57E+04 1.54E+04 1.66E+04 2.75E+04 2.10E+04

Glucose 6-phosphate 1.33E+04 1.21E+04 1.27E+04 2.89E+04 2.13E+04 2.52E+04 2.09E+04 2.04E+04 2.27E+04 4.00E+04

Glutamate 1.39E+07 1.23E+07 1.13E+07 2.06E+07 1.63E+07 2.51E+07 2.08E+07 1.96E+07 1.69E+07 1.86E+07

Glutamine 3.04E+06 4.36E+06 3.21E+06 4.59E+06 4.47E+06 4.91E+06 5.79E+06 5.09E+06 3.39E+06 5.03E+06

Glutathione 5.56E+05 1.61E+06 8.96E+05 1.15E+06 1.39E+06 2.32E+06 2.26E+06 2.26E+06 1.38E+06 1.67E+06

Glutathione disulfide 2.44E+05 2.22E+05 2.62E+05 3.75E+05 3.41E+05 1.63E+05 3.18E+05 2.41E+05 2.10E+05 4.28E+05

Glycerate 1.88E+05 4.48E+04 3.74E+04 7.56E+04 4.25E+04 5.29E+04 1.73E+05 2.95E+04 4.23E+04 3.61E+04

102

Table 1.15 Continued

Sample Name M2 M13 M16 M18 M44 M45 M46 M64 M69 M70

Glycine 6.41E+04 1.12E+05 9.76E+04 2.92E+04 5.43E+04 1.90E+05 1.32E+05 5.39E+04 5.60E+04 1.06E+05

GMP 1.78E+05 2.06E+05 2.45E+05 3.05E+05 3.43E+05 4.27E+05 4.37E+05 4.70E+05 2.99E+05 3.57E+05

Guanosine 2.59E+04 2.65E+04 1.51E+04 4.32E+04 1.82E+04 4.79E+04 3.09E+04 2.70E+04 2.49E+04 2.32E+04

Histidine 4.71E+03 9.25E+03 6.17E+03 1.19E+04 8.46E+03 1.14E+04 9.19E+03 2.85E+03 1.13E+04 6.57E+03

Homoserine/Threonine 1.71E+05 1.36E+05 1.06E+05 1.83E+05 2.21E+05 1.53E+05 2.54E+05 1.62E+05 1.17E+05 1.78E+05

Homovanillic acid 7.49E+04 1.14E+05 7.49E+04 9.00E+04 1.63E+05 1.35E+05 1.40E+05 1.39E+05 1.07E+05 1.60E+05

Hydroxyisocaproic acid 3.10E+05 6.58E+05 4.10E+05 2.14E+05 1.30E+05 1.61E+05 2.03E+05 1.43E+05 1.56E+05 1.71E+05

Hypoxanthine 1.11E+06 1.27E+06 1.16E+06 2.29E+06 1.54E+06 2.13E+06 2.57E+06 1.92E+06 1.52E+06 1.69E+06

IMP 2.36E+05 4.76E+05 6.22E+05 5.24E+05 6.00E+05 8.08E+05 9.33E+05 7.45E+05 6.87E+05 1.14E+06

Inosine 7.97E+05 1.10E+06 7.39E+05 1.59E+06 1.01E+06 1.33E+06 1.39E+06 1.24E+06 1.14E+06 1.12E+06

Lactate 6.72E+07 6.12E+07 5.45E+07 7.02E+07 7.16E+07 7.27E+07 7.87E+07 7.36E+07 7.99E+07 6.77E+07

Leucine/Isoleucine 3.43E+05 3.06E+05 1.16E+05 5.64E+05 3.51E+05 5.24E+05 4.45E+05 3.97E+05 3.25E+05 4.62E+05

Lysine 2.20E+03 5.31E+03 3.20E+03 3.51E+03 3.06E+03 2.99E+03 2.55E+03 4.53E+03 5.85E+03 5.85E+03

Malate 1.62E+05 1.48E+05 1.10E+05 2.14E+05 1.36E+05 2.15E+05 1.75E+05 2.10E+05 1.83E+05 2.11E+05

Malate 5.93E+06 5.47E+06 3.45E+06 9.89E+06 6.09E+06 1.07E+07 7.99E+06 1.05E+07 5.79E+06 1.04E+07

Methionine 1.06E+05 1.41E+05 8.31E+04 2.40E+05 1.62E+05 2.88E+05 2.45E+05 3.03E+05 1.55E+05 1.69E+05

myo-Inositol 3.60E+05 3.77E+05 4.29E+05 4.49E+05 4.65E+05 5.38E+05 5.15E+05 4.67E+05 6.03E+05 4.96E+05

N-Acetylglutamate 8.15E+05 9.39E+05 8.91E+05 1.89E+06 1.43E+06 2.52E+06 2.03E+06 2.87E+06 1.19E+06 1.90E+06

N-Acetylglutamine 1.37E+04 1.73E+04 4.26E+03 2.74E+04 1.69E+04 4.24E+04 2.22E+04 3.40E+04 3.25E+04 1.95E+04

N-Carbamoyl-L-aspartate 5.48E+05 5.87E+05 3.65E+05 5.30E+05 7.87E+05 7.88E+05 7.13E+05 5.60E+05 4.28E+05 7.00E+05

Orotate 5.63E+03 2.34E+03 3.24E+03 4.47E+03 9.87E+03 3.84E+04 1.58E+04 1.62E+04 5.34E+03 6.50E+03

Pantothenate 2.35E+06 2.27E+06 2.19E+06 3.71E+06 2.96E+06 4.29E+06 4.23E+06 4.71E+06 3.00E+06 3.00E+06

Phenylalanine 9.05E+04 1.20E+05 7.13E+04 2.02E+05 8.06E+04 1.82E+05 1.65E+05 1.41E+05 1.57E+05 1.12E+05

Phosphoenolpyruvate 5.77E+04 3.56E+04 5.41E+04 5.95E+04 2.88E+04 5.38E+04 4.42E+04 5.94E+04 6.05E+04 7.45E+04

Proline 5.69E+04 4.56E+04 3.68E+04 6.90E+04 7.36E+04 7.74E+04 6.28E+04 4.92E+04 5.34E+04 5.62E+04

Pyroglutamic acid 3.94E+06 1.25E+06 1.07E+06 2.53E+06 3.14E+06 2.21E+06 3.34E+06 1.87E+06 1.93E+06 2.01E+06

Pyruvate 7.81E+05 7.41E+04 9.12E+04 7.67E+04 3.66E+05 1.14E+05 1.73E+05 1.25E+05 1.20E+05 8.17E+04

Ribose phosphate 2.45E+04 4.37E+04 3.60E+04 5.45E+04 7.46E+04 5.93E+04 5.58E+04 6.06E+04 5.52E+04 7.84E+04

Serine 8.43E+05 6.88E+05 6.03E+05 1.07E+06 1.11E+06 1.11E+06 1.12E+06 8.60E+05 8.43E+05 9.08E+05

Shikimate 5.71E+04 2.18E+04 3.37E+04 3.20E+04 2.66E+04 4.09E+04 4.32E+04 4.94E+04 4.21E+04 2.65E+04

Succinate 4.98E+06 3.63E+06 2.00E+06 3.80E+06 2.64E+06 3.81E+06 3.92E+06 3.08E+06 1.86E+06 1.66E+06

Sulfolactate 8.90E+04 6.70E+04 4.81E+04 3.88E+04 6.82E+04 9.01E+04 5.19E+04 5.19E+04 5.65E+04 7.37E+04

103

Table 1.15 Continued

Sample Name M2 M13 M16 M18 M44 M45 M46 M64 M69 M70

Taurine 1.71E+07 2.06E+07 1.87E+07 2.40E+07 2.08E+07 2.65E+07 2.68E+07 2.78E+07 2.01E+07 2.43E+07

Trehalose/sucrose 1.16E+05 1.65E+04 1.57E+04 6.96E+03 5.28E+04 1.20E+04 2.23E+04 3.39E+04 3.00E+04 1.14E+04

Tryptophan 2.62E+04 2.48E+04 1.17E+04 5.03E+04 3.41E+04 2.69E+04 8.02E+04 3.50E+04 3.51E+04 3.59E+04

Tyrosine 1.25E+05 1.32E+05 1.18E+05 2.21E+05 2.02E+05 1.87E+05 2.60E+05 2.29E+05 1.64E+05 1.41E+05

UDP-glucose 5.84E+04 8.08E+04 1.44E+05 1.81E+05 1.85E+05 2.46E+05 1.76E+05 1.90E+05 1.97E+05 1.28E+05

UDP-N-acetylglucosamine 6.71E+04 8.24E+04 8.70E+04 1.22E+05 1.60E+05 1.94E+05 1.37E+05 1.96E+05 1.57E+05 1.10E+05

UMP 8.59E+04 1.60E+05 1.78E+05 1.84E+05 2.58E+05 2.54E+05 2.51E+05 2.32E+05 1.58E+05 2.16E+05

Uracil 1.17E+05 1.47E+05 1.46E+05 2.93E+05 3.43E+05 3.90E+05 4.12E+05 3.25E+05 1.76E+05 3.12E+05

Uric acid 7.44E+04 3.05E+04 2.14E+04 2.35E+04 5.26E+04 3.57E+04 3.37E+04 2.11E+04 2.85E+04 3.26E+04

Uridine 2.23E+05 3.82E+05 2.39E+05 4.93E+05 3.33E+05 6.10E+05 5.73E+05 4.75E+05 4.61E+05 4.38E+05

Valine 2.80E+05 2.27E+05 1.83E+05 4.28E+05 3.45E+05 3.41E+05 3.96E+05 3.43E+05 2.97E+05 3.44E+05

Xanthine 3.15E+05 2.20E+05 1.44E+05 4.67E+05 2.48E+05 4.09E+05 6.98E+05 4.16E+05 1.84E+05 3.53E+05

104

Table 1.16 Raw Data of Control Mice from BLA/CeA

Sample Name M3 M5 M10 M12 M14 M26 M30 M32 M38

2-Aminoadipate 3.51E+04 6.24E+04 4.89E+04 6.51E+04 2.92E+04 8.09E+04 3.89E+04 7.26E+04 1.42E+05

2-Hydroxy-2-methylsuccinate 2.45E+06 4.54E+06 3.83E+06 3.64E+06 2.43E+06 3.73E+06 4.07E+06 4.12E+06 7.22E+06

2-Isopropylmalate 5.20E+04 4.51E+04 4.69E+04 3.88E+04 5.55E+04 6.73E+04 5.05E+04 4.98E+04 3.40E+04

3_4-Dihydroxyphenylacetate 1.79E+04 2.27E+04 6.35E+04 1.24E+04 2.32E+04 9.38E+03 1.72E+04 2.26E+04 6.97E+04

4-Aminobutyrate 1.34E+06 1.82E+06 1.61E+06 2.10E+06 1.33E+06 1.95E+06 1.71E+06 1.88E+06 2.34E+06

5-Hydroxyindoleacetic acid 1.73E+04 6.58E+04 5.54E+04 6.10E+04 2.89E+04 5.41E+04 6.44E+04 6.72E+04 7.29E+04

Aconitate 4.66E+06 7.50E+06 5.99E+06 6.69E+06 4.96E+06 7.74E+06 7.27E+06 6.19E+06 9.21E+06

Adenine 2.14E+04 3.12E+04 3.33E+04 3.41E+04 2.63E+04 3.01E+04 2.40E+04 2.00E+04 5.54E+04

Adenosine 4.34E+04 6.56E+04 7.34E+04 5.97E+04 4.55E+04 4.35E+03 2.23E+04 2.11E+03 1.62E+05

Alanine/Sarcosine 1.51E+06 1.84E+06 1.90E+06 2.09E+06 1.77E+06 2.19E+06 1.89E+06 2.36E+06 2.75E+06

alpha-Ketoglutarate 2.05E+04 5.24E+04 4.17E+04 4.09E+04 2.30E+04 4.19E+04 2.29E+04 3.11E+04 4.62E+04

AMP/dGMP 2.34E+06 3.58E+06 3.47E+06 4.09E+06 2.86E+06 3.85E+06 3.71E+06 3.29E+06 6.60E+06

Ascorbate 6.71E+06 1.51E+07 8.17E+06 1.98E+07 6.85E+06 1.86E+07 1.62E+07 2.26E+07 2.88E+07

Asparagine 6.02E+04 8.30E+04 8.30E+04 7.76E+04 6.06E+04 7.14E+04 5.13E+04 8.67E+04 9.86E+04

Aspartate 5.76E+06 9.02E+06 7.71E+06 8.73E+06 7.12E+06 9.39E+06 7.34E+06 8.46E+06 1.23E+07

cAMP 1.29E+04 2.98E+04 2.36E+04 3.74E+04 2.11E+04 4.05E+04 2.12E+04 1.98E+04 4.31E+04

CDP-ethanolamine 3.22E+04 3.92E+04 4.35E+04 4.15E+04 4.27E+04 3.81E+04 4.45E+04 3.79E+04 7.32E+04

Citraconate 2.02E+05 3.24E+05 2.51E+05 2.81E+05 2.03E+05 3.32E+05 2.83E+05 2.60E+05 4.19E+05

Citrate/isocitrate 2.10E+06 6.24E+06 3.81E+06 4.94E+06 2.46E+06 4.68E+06 6.02E+06 4.89E+06 5.89E+06

Citrulline 1.67E+04 1.73E+04 1.51E+04 2.72E+04 1.37E+04 3.25E+04 2.89E+04 1.34E+04 3.58E+04

Creatine 1.88E+06 2.16E+06 2.18E+06 2.51E+06 2.07E+06 2.85E+06 2.15E+06 2.63E+06 3.07E+06

Cysteine 6.22E+04 8.36E+04 7.50E+04 1.10E+05 5.14E+04 1.56E+05 1.04E+05 1.04E+05 2.24E+05

Cytidine 9.88E+03 1.35E+04 9.02E+03 1.54E+04 1.03E+04 2.31E+04 1.23E+04 8.55E+03 1.67E+04

D-Glyceraldehdye 3-phosphate 4.31E+03 2.14E+03 3.08E+03 3.26E+03 4.62E+03 1.59E+04 3.84E+03 1.50E+04 1.80E+04

Fumarate 4.68E+05 6.06E+05 6.25E+05 1.10E+06 3.38E+05 1.02E+06 7.86E+05 1.69E+06 2.60E+06

Glucose 1-phosphate 1.43E+04 2.13E+04 1.78E+04 1.27E+04 2.49E+04 3.64E+04 3.37E+04 3.71E+04 3.02E+04

Glucose 6-phosphate 1.32E+04 2.79E+04 2.46E+04 1.96E+04 2.00E+04 2.59E+04 2.20E+04 2.07E+04 4.38E+04

Glutamate 1.68E+07 1.99E+07 1.90E+07 2.35E+07 1.99E+07 2.18E+07 1.75E+07 1.91E+07 2.63E+07

Glutamine 3.39E+06 4.10E+06 3.63E+06 4.99E+06 4.57E+06 5.55E+06 4.77E+06 5.09E+06 5.54E+06

Glutathione 1.10E+06 1.33E+06 1.30E+06 2.18E+06 9.76E+05 2.04E+06 1.68E+06 1.96E+06 3.21E+06

Glutathione disulfide 2.22E+05 4.58E+05 4.49E+05 3.45E+05 3.94E+05 2.83E+05 3.96E+05 3.62E+05 2.57E+05

105

Table 1.16 Continued

Sample Name M3 M5 M10 M12 M14 M26 M30 M32 M38

Glycerate 4.55E+04 5.38E+04 8.72E+05 3.71E+04 5.62E+04 3.77E+04 3.94E+04 7.38E+04 4.96E+04

Glycine 3.16E+05 7.40E+04 3.26E+05 8.43E+04 1.91E+05 6.06E+04 2.44E+05 2.19E+05 7.02E+04

GMP 2.39E+05 3.72E+05 3.97E+05 3.72E+05 2.86E+05 4.09E+05 4.07E+05 3.85E+05 5.95E+05

Guanosine 1.89E+04 2.46E+04 2.99E+04 2.49E+04 1.65E+04 2.69E+04 2.06E+04 2.83E+04 3.53E+04

Histidine 9.37E+03 4.42E+03 3.11E+03 7.62E+03 8.09E+03 1.14E+04 1.12E+04 1.07E+04 1.66E+04

Homoserine/Threonine 1.70E+05 2.07E+05 1.95E+05 1.54E+05 1.46E+05 1.83E+05 2.00E+05 1.92E+05 2.52E+05

Homovanillic acid 6.73E+04 7.54E+04 8.08E+04 1.12E+05 8.31E+04 1.50E+05 1.40E+05 8.89E+04 2.17E+05

Hydroxyisocaproic acid 2.33E+05 1.86E+05 3.70E+05 2.72E+05 2.55E+05 1.98E+05 2.25E+05 1.50E+05 1.63E+05

Hypoxanthine 1.44E+06 2.12E+06 1.88E+06 1.98E+06 1.53E+06 2.45E+06 2.11E+06 2.04E+06 2.48E+06

IMP 4.64E+05 9.71E+05 8.00E+05 8.74E+05 6.87E+05 1.12E+06 9.29E+05 1.34E+06 6.86E+05

Inosine 9.05E+05 1.18E+06 1.11E+06 1.24E+06 1.02E+06 1.38E+06 1.20E+06 1.30E+06 1.43E+06

Lactate 5.78E+07 6.50E+07 7.69E+07 7.07E+07 5.64E+07 7.21E+07 7.03E+07 7.86E+07 1.03E+08

Leucine/Isoleucine 2.72E+05 4.27E+05 5.24E+05 4.41E+05 2.68E+05 6.48E+05 4.02E+05 6.56E+05 7.80E+05

Lysine 4.75E+03 3.62E+03 3.37E+03 2.79E+03 3.38E+03 6.46E+03 4.98E+03 7.25E+03 1.20E+04

Malate 1.59E+05 1.67E+05 1.66E+05 1.80E+05 1.78E+05 1.79E+05 1.76E+05 2.34E+05 2.12E+05

Malate 4.12E+06 7.30E+06 7.16E+06 6.30E+06 4.68E+06 7.31E+06 6.85E+06 1.30E+07 1.78E+07

Methionine 1.12E+05 1.64E+05 2.04E+05 2.41E+05 2.11E+05 3.41E+05 2.20E+05 3.50E+05 3.86E+05

myo-Inositol 4.32E+05 4.11E+05 5.22E+05 6.26E+05 4.21E+05 4.86E+05 4.42E+05 4.73E+05 7.14E+05

N-Acetylglutamate 1.53E+06 2.04E+06 2.09E+06 2.04E+06 1.19E+06 2.09E+06 1.88E+06 2.33E+06 3.55E+06

N-Acetylglutamine 1.97E+04 2.32E+04 2.76E+04 2.15E+04 2.27E+04 3.83E+04 3.47E+04 2.66E+04 4.07E+04

N-Carbamoyl-L-aspartate 3.45E+05 8.11E+05 2.68E+05 5.22E+05 4.64E+05 5.10E+05 3.75E+05 9.28E+05 3.71E+05

Orotate 4.01E+03 9.78E+03 2.32E+04 1.25E+04 2.75E+03 1.03E+04 8.73E+03 5.57E+03 1.56E+04

Pantothenate 2.65E+06 3.80E+06 3.24E+06 4.13E+06 2.92E+06 4.71E+06 4.12E+06 4.07E+06 7.00E+06

Phenylalanine 8.95E+04 1.52E+05 1.01E+05 1.68E+05 1.33E+05 2.32E+05 1.36E+05 1.90E+05 2.32E+05

Phosphoenolpyruvate 3.95E+04 3.36E+04 6.19E+04 3.45E+04 2.41E+04 4.89E+04 6.96E+04 3.61E+04 4.91E+04

Proline 5.72E+04 6.07E+04 7.22E+04 5.40E+04 5.57E+04 6.03E+04 6.41E+04 7.63E+04 1.02E+05

Pyroglutamic acid 2.57E+06 3.76E+06 1.32E+07 1.69E+06 2.58E+06 3.64E+06 2.99E+06 3.16E+06 4.30E+06

Pyruvate 1.54E+05 2.56E+05 4.60E+05 6.66E+04 1.75E+05 2.54E+05 1.74E+05 2.11E+05 5.78E+05

Ribose phosphate 4.39E+04 4.93E+04 6.91E+04 6.43E+04 5.10E+04 1.38E+05 6.45E+04 6.94E+04 8.25E+04

Serine 1.15E+06 1.03E+06 1.37E+06 9.09E+05 8.16E+05 1.49E+06 1.08E+06 1.22E+06 1.75E+06

Shikimate 2.40E+04 2.98E+04 7.64E+04 1.58E+04 2.26E+04 2.52E+04 1.99E+04 1.74E+04 1.71E+05

Succinate 2.20E+06 4.36E+06 7.78E+06 3.23E+06 3.68E+06 2.57E+06 2.25E+06 2.46E+06 6.10E+06

106

Table 1.16 Continued

Sample Name M3 M5 M10 M12 M14 M26 M30 M32 M38

Sulfolactate 5.64E+04 7.06E+04 2.62E+05 5.29E+04 7.22E+04 5.58E+04 5.32E+04 6.70E+04 7.92E+04

Taurine 1.97E+07 2.40E+07 2.23E+07 2.47E+07 2.12E+07 2.59E+07 2.32E+07 2.41E+07 3.20E+07

Trehalose/sucrose 4.00E+04 5.11E+04 1.42E+05 2.37E+04 3.48E+04 3.88E+04 2.56E+04 5.57E+04 4.44E+04

Tryptophan 2.50E+04 3.94E+04 3.27E+04 3.46E+04 2.17E+04 5.45E+04 3.69E+04 5.00E+04 7.72E+04

Tyrosine 1.37E+05 1.46E+05 1.49E+05 1.65E+05 1.77E+05 2.09E+05 3.34E+05 1.60E+05 3.27E+05

UDP-glucose 9.87E+04 1.39E+05 1.50E+05 1.51E+05 1.38E+05 2.39E+05 1.56E+05 1.70E+05 3.63E+05

UDP-N-acetylglucosamine 7.74E+04 1.14E+05 1.32E+05 1.41E+05 9.45E+04 1.83E+05 1.11E+05 1.76E+05 3.28E+05

UMP 1.99E+05 1.89E+05 2.08E+05 2.57E+05 1.85E+05 3.13E+05 2.42E+05 2.74E+05 3.15E+05

Uracil 1.83E+05 3.07E+05 3.27E+05 3.36E+05 2.94E+05 5.14E+05 3.28E+05 3.62E+05 4.64E+05

Uric acid 2.66E+04 3.60E+04 8.61E+04 1.90E+04 2.94E+04 3.67E+04 3.89E+04 4.79E+04 9.56E+04

Uridine 3.38E+05 5.09E+05 5.91E+05 4.97E+05 2.58E+05 4.79E+05 3.60E+05 3.76E+05 7.38E+05

Valine 2.97E+05 3.90E+05 3.84E+05 3.82E+05 2.85E+05 4.29E+05 3.59E+05 4.53E+05 5.84E+05

Xanthine 2.31E+05 4.03E+05 3.25E+05 3.59E+05 2.34E+05 2.89E+05 2.29E+05 1.89E+05 5.22E+05

107

Table 1.17 Raw Data of Susceptible Mice from BLA/CeA

Sample Name M1 M4 M15 M17 M20 M22 M23 M24 M25 M27

2-Aminoadipate 3.81E+04 8.97E+04 2.01E+04 3.90E+04 7.79E+04 1.49E+05 8.38E+04 1.31E+04 7.67E+04 4.16E+04

2-Hydroxy-2-methylsuccinate 2.29E+06 4.19E+06 2.38E+06 2.37E+06 3.85E+06 5.70E+06 4.37E+06 1.04E+06 4.80E+06 3.06E+06

2-Isopropylmalate 5.96E+04 7.65E+04 1.01E+05 5.10E+04 6.80E+04 6.20E+04 5.45E+04 4.77E+04 5.25E+04 7.02E+04

3_4-Dihydroxyphenylacetate 1.73E+04 2.79E+04 1.24E+04 2.05E+04 1.51E+04 2.20E+04 1.28E+04 1.90E+04 2.30E+04 3.72E+04

4-Aminobutyrate 1.51E+06 2.13E+06 1.28E+06 1.37E+06 1.98E+06 2.27E+06 2.19E+06 5.77E+05 1.80E+06 1.48E+06

5-Hydroxyindoleacetic acid 3.75E+04 5.22E+04 2.55E+04 1.79E+04 6.31E+04 7.64E+04 6.31E+04 2.23E+04 3.34E+04 1.28E+04

Aconitate 3.71E+06 6.41E+06 3.94E+06 3.10E+06 5.76E+06 8.76E+06 5.67E+06 3.12E+06 6.05E+06 7.00E+06

Adenine 1.65E+04 3.56E+04 2.44E+04 2.50E+04 4.40E+04 3.71E+04 2.41E+04 1.14E+04 1.70E+04 1.30E+04

Adenosine 3.56E+04 7.74E+03 4.64E+04 5.03E+04 6.16E+04 7.49E+04 4.94E+03 1.00E+02 6.31E+03 1.81E+04

Alanine/Sarcosine 1.68E+06 2.36E+06 1.58E+06 1.68E+06 2.56E+06 2.33E+06 2.34E+06 5.81E+05 2.28E+06 1.87E+06

alpha-Ketoglutarate 2.19E+04 3.41E+04 2.73E+04 4.02E+04 2.88E+04 1.92E+04 2.94E+04 3.58E+04 4.76E+04 3.19E+04

AMP/dGMP 2.20E+06 3.28E+06 2.23E+06 2.13E+06 3.69E+06 4.97E+06 3.96E+06 1.05E+06 4.60E+06 2.79E+06

Ascorbate 1.02E+07 1.95E+07 5.49E+06 1.09E+07 2.07E+07 2.43E+07 1.58E+07 4.23E+06 1.63E+07 6.33E+06

Asparagine 5.13E+04 7.48E+04 6.16E+04 4.69E+04 7.54E+04 5.72E+04 9.76E+04 2.94E+04 9.19E+04 8.43E+04

Aspartate 6.33E+06 9.52E+06 6.25E+06 6.06E+06 8.43E+06 9.60E+06 9.12E+06 3.30E+06 9.32E+06 7.52E+06

cAMP 1.46E+04 2.66E+04 1.45E+04 2.00E+04 3.41E+04 4.06E+04 2.14E+04 2.77E+03 2.75E+04 2.49E+04

CDP-ethanolamine 3.10E+04 5.44E+04 3.23E+04 2.90E+04 3.77E+04 5.00E+04 4.71E+04 1.39E+04 5.83E+04 3.61E+04

Citraconate 2.21E+05 2.88E+05 2.13E+05 1.52E+05 2.68E+05 3.14E+05 2.55E+05 1.35E+05 2.66E+05 3.27E+05

Citrate/isocitrate 2.62E+06 4.67E+06 2.12E+06 1.73E+06 3.68E+06 6.41E+06 2.92E+06 1.96E+06 4.56E+06 3.66E+06

Citrulline 1.53E+04 1.78E+04 8.71E+03 2.10E+04 2.65E+04 3.27E+04 2.01E+04 1.45E+04 2.56E+04 2.88E+04

Creatine 2.00E+06 2.88E+06 1.88E+06 2.00E+06 3.11E+06 2.75E+06 2.71E+06 6.06E+05 3.05E+06 2.17E+06

Cysteine 6.50E+04 1.62E+05 3.80E+04 4.82E+04 1.28E+05 2.18E+05 1.28E+05 1.99E+03 6.99E+04 9.62E+04

Cytidine 1.18E+04 1.02E+04 1.08E+04 9.67E+03 2.02E+04 1.76E+04 2.82E+04 9.25E+03 9.04E+03 1.07E+04

D-Glyceraldehdye 3-phosphate 2.34E+03 3.46E+03 1.06E+04 2.73E+03 3.37E+03 8.20E+03 2.04E+04 1.00E+02 2.68E+04 2.93E+03

Fumarate 3.81E+05 1.30E+06 3.23E+05 7.91E+05 1.35E+06 1.46E+06 1.70E+06 1.53E+05 9.68E+05 5.50E+05

Glucose 1-phosphate 3.20E+04 1.54E+04 1.89E+04 2.54E+04 1.28E+04 3.15E+04 3.75E+04 3.48E+03 4.70E+04 3.03E+04

Glucose 6-phosphate 1.69E+04 2.94E+04 8.90E+03 1.10E+04 3.50E+04 2.36E+04 2.69E+04 4.73E+03 4.86E+04 2.63E+04

Glutamate 1.71E+07 2.15E+07 1.54E+07 1.60E+07 2.14E+07 2.22E+07 2.44E+07 8.10E+06 2.10E+07 1.76E+07

Glutamine 3.81E+06 4.98E+06 3.55E+06 3.67E+06 5.75E+06 4.60E+06 5.09E+06 2.13E+06 5.18E+06 4.88E+06

Glutathione 1.11E+06 1.65E+06 6.58E+05 1.44E+06 2.69E+06 2.86E+06 2.17E+06 3.36E+05 1.61E+06 1.54E+06

Glutathione disulfide 2.41E+05 3.92E+05 3.83E+05 1.65E+05 2.55E+05 3.11E+05 2.44E+05 2.24E+05 7.07E+05 2.50E+05

Glycerate 5.45E+04 4.75E+04 4.78E+04 2.99E+04 3.96E+04 4.06E+04 4.23E+04 5.64E+04 5.16E+04 5.80E+04

108

Table 1.17 Continued

Sample Name M1 M4 M15 M17 M20 M22 M23 M24 M25 M27

Glycine 1.15E+05 1.82E+05 8.50E+04 1.36E+05 9.56E+04 2.67E+05 5.79E+05 2.18E+05 2.99E+05 2.92E+05

GMP 2.61E+05 3.54E+05 2.82E+05 2.23E+05 3.98E+05 4.81E+05 4.04E+05 1.37E+05 4.87E+05 3.01E+05

Guanosine 1.47E+04 3.38E+04 2.01E+04 2.40E+04 2.16E+04 2.42E+04 3.11E+04 6.04E+03 2.53E+04 3.82E+04

Histidine 6.44E+03 1.09E+04 8.35E+03 4.18E+03 1.09E+04 1.16E+04 8.56E+03 5.11E+03 1.54E+04 1.79E+04

Homoserine/Threonine 1.49E+05 2.34E+05 1.53E+05 1.11E+05 1.99E+05 1.66E+05 2.14E+05 1.31E+05 2.57E+05 2.67E+05

Homovanillic acid 5.85E+04 1.36E+05 8.12E+04 8.08E+04 1.52E+05 1.76E+05 1.22E+05 6.17E+04 1.47E+05 1.01E+05

Hydroxyisocaproic acid 1.90E+05 1.63E+05 3.38E+05 5.53E+05 1.92E+05 1.95E+05 1.34E+05 1.71E+05 1.54E+05 2.54E+05

Hypoxanthine 1.30E+06 2.45E+06 1.41E+06 1.52E+06 2.22E+06 2.25E+06 2.67E+06 5.29E+05 1.89E+06 1.87E+06

IMP 7.24E+05 1.06E+06 4.88E+05 4.78E+05 1.05E+06 1.53E+06 1.33E+06 4.06E+05 2.28E+06 8.93E+05

Inosine 8.69E+05 1.56E+06 9.46E+05 9.04E+05 1.78E+06 1.55E+06 1.25E+06 4.55E+05 1.17E+06 1.19E+06

Lactate 5.94E+07 7.15E+07 5.88E+07 6.32E+07 8.36E+07 8.41E+07 8.34E+07 5.08E+07 9.13E+07 8.31E+07

Leucine/Isoleucine 2.03E+05 4.77E+05 2.87E+05 1.86E+05 3.65E+05 4.72E+05 5.02E+05 1.69E+05 6.39E+05 6.04E+05

Lysine 3.37E+03 6.84E+03 4.70E+03 1.58E+03 1.07E+04 9.20E+03 6.81E+03 1.61E+03 7.71E+03 2.76E+03

Malate 1.34E+05 1.85E+05 1.74E+05 1.64E+05 2.37E+05 2.09E+05 2.65E+05 1.03E+05 2.10E+05 1.63E+05

Malate 4.28E+06 8.73E+06 5.20E+06 6.90E+06 1.02E+07 8.98E+06 7.97E+06 1.62E+06 1.45E+07 5.64E+06

Methionine 1.33E+05 2.95E+05 1.62E+05 1.36E+05 3.32E+05 2.96E+05 2.74E+05 5.71E+04 3.05E+05 2.69E+05

myo-Inositol 4.36E+05 4.55E+05 4.13E+05 4.58E+05 5.65E+05 6.24E+05 5.45E+05 3.09E+05 6.21E+05 5.57E+05

N-Acetylglutamate 1.09E+06 2.02E+06 8.21E+05 1.36E+06 2.43E+06 2.85E+06 2.11E+06 5.19E+05 2.11E+06 1.16E+06

N-Acetylglutamine 1.30E+04 3.66E+04 1.25E+04 1.47E+04 3.39E+04 3.21E+04 2.81E+04 1.91E+03 2.37E+04 1.20E+04

N-Carbamoyl-L-aspartate 6.39E+05 2.65E+05 3.59E+05 6.71E+05 5.42E+05 8.71E+05 5.16E+05 2.59E+05 5.02E+05 6.74E+05

Orotate 4.35E+03 8.39E+03 2.46E+03 7.70E+03 1.69E+04 1.41E+04 1.73E+04 2.54E+03 1.09E+04 5.99E+03

Pantothenate 2.26E+06 4.02E+06 2.38E+06 2.76E+06 5.01E+06 4.62E+06 4.18E+06 1.75E+06 4.15E+06 3.57E+06

Phenylalanine 8.35E+04 1.61E+05 1.02E+05 1.37E+05 2.06E+05 1.67E+05 1.77E+05 9.28E+04 2.18E+05 2.07E+05

Phosphoenolpyruvate 4.46E+04 4.62E+04 4.61E+04 3.45E+04 6.21E+04 2.46E+04 2.81E+04 6.85E+04 4.38E+04 3.46E+04

Proline 4.74E+04 6.94E+04 4.10E+04 4.19E+04 5.44E+04 6.95E+04 6.89E+04 3.66E+04 1.05E+05 8.31E+04

Pyroglutamic acid 1.71E+06 2.76E+06 2.57E+06 1.47E+06 1.75E+06 3.14E+06 3.39E+06 3.31E+06 6.34E+06 6.44E+06

Pyruvate 1.63E+05 1.02E+05 1.44E+05 1.03E+05 1.02E+05 1.83E+05 3.20E+05 3.31E+05 1.10E+06 8.41E+05

Ribose phosphate 4.77E+04 6.08E+04 5.20E+04 4.08E+04 7.21E+04 9.25E+04 8.07E+04 1.24E+04 8.73E+04 5.88E+04

Serine 6.35E+05 1.11E+06 7.31E+05 6.44E+05 1.39E+06 1.10E+06 1.43E+06 1.06E+06 1.71E+06 1.71E+06

Shikimate 2.59E+04 1.70E+04 2.63E+04 2.51E+04 5.32E+04 2.03E+04 3.72E+04 1.93E+04 2.21E+04 3.00E+04

Succinate 3.06E+06 2.79E+06 2.44E+06 4.59E+06 2.91E+06 2.21E+06 3.26E+06 2.08E+06 3.22E+06 2.87E+06

Sulfolactate 5.38E+04 5.00E+04 6.11E+04 5.70E+04 6.54E+04 4.73E+04 7.75E+04 5.72E+04 6.05E+04 8.96E+04

109

Table 1.17 Continued

Sample Name M1 M4 M15 M17 M20 M22 M23 M24 M25 M27

Taurine 1.93E+07 2.61E+07 1.84E+07 1.96E+07 2.84E+07 2.77E+07 2.76E+07 1.25E+07 2.56E+07 2.18E+07

Trehalose/sucrose 1.96E+04 1.44E+04 4.51E+04 3.25E+04 1.01E+04 2.21E+04 4.42E+04 1.52E+06 6.72E+04 8.36E+04

Tryptophan 1.48E+04 4.49E+04 2.08E+04 5.61E+04 4.72E+04 3.98E+04 5.32E+04 1.74E+04 4.37E+04 6.70E+04

Tyrosine 9.01E+04 1.63E+05 9.67E+04 1.83E+05 3.22E+05 2.31E+05 1.99E+05 8.53E+04 3.84E+05 2.46E+05

UDP-glucose 1.10E+05 1.19E+05 1.22E+05 1.22E+05 2.14E+05 2.63E+05 2.23E+05 5.29E+04 3.90E+05 1.24E+05

UDP-N-acetylglucosamine 7.45E+04 1.19E+05 8.53E+04 9.84E+04 2.10E+05 2.16E+05 1.80E+05 3.42E+04 2.57E+05 1.25E+05

UMP 1.21E+05 2.24E+05 1.55E+05 1.25E+05 2.43E+05 2.97E+05 2.90E+05 7.18E+04 4.01E+05 2.38E+05

Uracil 1.47E+05 3.39E+05 2.17E+05 1.81E+05 3.59E+05 3.94E+05 3.55E+05 5.20E+04 3.23E+05 3.75E+05

Uric acid 3.49E+04 3.37E+04 1.59E+04 3.25E+04 2.48E+04 3.64E+04 3.04E+04 6.51E+04 8.73E+04 6.09E+04

Uridine 2.86E+05 4.59E+05 3.16E+05 3.57E+05 6.30E+05 7.70E+05 4.31E+05 1.46E+05 3.60E+05 3.01E+05

Valine 2.41E+05 4.11E+05 1.97E+05 2.06E+05 3.74E+05 4.25E+05 4.60E+05 1.23E+05 5.25E+05 4.29E+05

Xanthine 1.30E+05 5.50E+05 1.85E+05 2.79E+05 4.02E+05 4.00E+05 3.60E+05 4.23E+04 1.69E+05 2.56E+05

110

Table 1.18 Raw Data of Resilient Mice from HPC

Sample Name M2 M13 M16 M44 M46 M69 M70

2-Hydroxy-2-methylsuccinate 1.02E+05 1.11E+05 1.43E+05 2.10E+05 1.78E+05 2.26E+05 2.32E+05

4-Aminobutyrate 7.28E+04 1.92E+05 1.08E+06 5.56E+05 1.52E+06 1.45E+06 1.38E+06

5-Hydroxyindoleacetic acid 1.00E+02 3.74E+03 8.84E+03 1.08E+04 1.52E+04 1.59E+04 1.11E+04

Acadesine 8.06E+03 1.26E+04 1.29E+04 1.24E+04 1.75E+04 1.37E+04 1.38E+04

Aconitate 2.97E+04 2.33E+04 5.48E+04 1.09E+05 7.70E+04 5.19E+04 7.28E+04

Adenosine 1.00E+02 1.00E+02 8.68E+04 1.00E+02 1.34E+05 1.54E+05 5.75E+04

Alanine 5.30E+05 6.96E+05 1.20E+06 1.06E+06 1.51E+06 1.57E+06 1.45E+06

AMP 2.69E+06 3.38E+06 5.06E+06 5.71E+06 5.42E+06 6.97E+06 6.06E+06

Arginine 1.84E+04 2.27E+04 1.84E+04 4.37E+04 1.65E+04 1.39E+04 2.88E+04

Ascorbate 2.10E+06 4.55E+05 6.40E+06 3.45E+06 7.54E+06 5.97E+06 8.99E+06

Asparagine 1.17E+04 1.37E+04 2.92E+04 2.16E+04 2.95E+04 2.28E+04 3.30E+04

Aspartate 2.31E+06 1.98E+06 4.40E+06 5.30E+06 6.05E+06 4.57E+06 5.53E+06

CDP-ethanolamine 5.70E+04 4.60E+04 6.85E+04 5.89E+04 4.70E+04 6.44E+04 5.17E+04

Citrate/isocitrate 7.51E+05 3.73E+05 1.72E+07 2.39E+06 3.96E+06 1.65E+06 2.07E+06

Citrulline 8.60E+03 6.23E+03 7.34E+03 7.91E+03 7.90E+03 4.85E+03 7.66E+03

CMP 3.79E+04 5.09E+04 6.24E+04 9.37E+04 5.57E+04 8.25E+04 6.23E+04

Creatine 6.55E+05 7.86E+05 1.40E+06 1.50E+06 1.91E+06 2.12E+06 1.99E+06

Creatinine 4.23E+04 2.03E+04 4.04E+04 3.91E+04 4.99E+04 4.20E+04 6.69E+04

Cysteine 1.00E+02 1.00E+02 5.16E+03 3.17E+04 2.58E+04 1.45E+04 2.38E+04

Cytidine 8.45E+03 1.47E+04 1.30E+04 1.66E+04 1.45E+04 1.16E+04 2.17E+04

Cytidine 8.57E+04 1.23E+05 1.43E+05 1.42E+05 1.73E+05 1.86E+05 1.90E+05

Diiodothyronine 3.86E+03 6.74E+03 4.54E+04 3.25E+04 4.66E+04 6.87E+04 5.54E+04

Glutamate 1.38E+07 1.46E+07 2.61E+07 2.53E+07 3.27E+07 3.85E+07 3.98E+07

Glutamine 3.02E+06 3.48E+06 6.57E+06 6.46E+06 7.83E+06 8.30E+06 9.22E+06

Glutathione 4.28E+05 2.68E+05 1.28E+06 1.43E+06 1.41E+06 1.88E+06 1.91E+06

Glutathione disulfide 1.00E+02 5.09E+03 8.59E+04 2.50E+04 9.12E+04 1.16E+05 8.18E+04

Glycerone phosphate 6.04E+03 4.08E+04 9.09E+04 7.61E+04 1.06E+05 1.25E+05 1.21E+05

GMP 1.47E+05 1.32E+05 1.76E+05 2.86E+05 2.20E+05 2.77E+05 3.54E+05

Guanosine 4.00E+04 1.93E+04 2.99E+04 7.36E+04 5.74E+04 6.50E+04 7.47E+04

Histidine 2.51E+04 3.23E+04 5.17E+04 4.07E+04 3.66E+04 4.96E+04 3.40E+04

Homoserine 1.70E+05 2.17E+05 3.01E+05 2.84E+05 3.75E+05 3.68E+05 3.57E+05

Homovanillic acid 2.43E+04 1.50E+04 3.39E+04 3.29E+04 4.48E+04 4.57E+04 5.49E+04

111

Table 1.18 Continued

Sample Name M2 M13 M16 M44 M46 M69 M70

Hydroxyphenylpyruvate 2.14E+06 2.07E+06 2.25E+06 2.22E+06 2.08E+06 2.21E+06 2.26E+06

Hypoxanthine 3.18E+05 3.51E+05 6.91E+05 8.04E+05 7.02E+05 4.89E+05 6.97E+05

IMP 1.81E+05 3.06E+05 3.08E+05 4.21E+05 4.08E+05 5.03E+05 5.05E+05

Inosine 1.43E+06 1.51E+06 2.45E+06 2.63E+06 2.53E+06 2.27E+06 2.83E+06

Lactate 3.12E+07 3.29E+07 3.96E+07 4.65E+07 4.88E+07 6.62E+07 5.01E+07

Leucine/Isoleucine 4.42E+04 4.19E+04 6.80E+04 4.31E+04 4.67E+04 5.77E+04 6.21E+04

Malate 7.14E+06 9.78E+06 1.74E+07 1.61E+07 2.06E+07 3.31E+07 2.76E+07

Methionine 2.42E+04 2.71E+04 6.22E+04 3.70E+04 5.16E+04 5.52E+04 5.49E+04

Methionine sulfoxide 3.82E+04 1.88E+04 2.60E+04 2.97E+04 5.25E+04 4.05E+04 6.11E+04

Methylmalonate 9.32E+05 1.05E+06 8.69E+05 8.01E+05 9.04E+05 8.11E+05 6.26E+05

myo-Inositol 3.72E+04 4.72E+04 7.60E+04 8.58E+04 9.09E+04 1.77E+05 1.13E+05

N-Acetylglutamate 3.47E+04 5.33E+04 1.15E+05 9.66E+04 1.26E+05 1.80E+05 1.82E+05

N-Carbamoyl-L-aspartate 3.11E+04 3.97E+04 9.63E+04 8.31E+04 1.80E+05 1.47E+05 1.18E+05

Normetanephrine 2.06E+05 1.99E+05 1.78E+05 2.05E+05 1.94E+05 2.38E+05 2.00E+05

Pantothenate 1.44E+05 1.32E+05 3.56E+05 2.74E+05 3.33E+05 3.41E+05 2.86E+05

Phenylalanine 7.86E+04 7.50E+04 9.55E+04 1.04E+05 1.19E+05 1.29E+05 1.27E+05

Proline 2.54E+04 2.91E+04 4.46E+04 4.22E+04 4.16E+04 3.93E+04 4.68E+04

Pyroglutamic acid 2.89E+05 2.68E+05 1.93E+05 3.23E+05 4.10E+05 2.30E+05 2.44E+05

S-Methyl-5--thioadenosine 2.91E+05 3.10E+05 3.53E+05 4.13E+05 3.68E+05 4.15E+05 4.16E+05

Serine 6.20E+05 6.57E+05 6.75E+05 8.85E+05 8.85E+05 9.71E+05 8.73E+05

Taurine 9.43E+06 1.13E+07 1.88E+07 1.89E+07 2.54E+07 3.07E+07 2.84E+07

Trehalose/sucrose 6.37E+04 5.39E+04 3.66E+04 1.07E+05 2.16E+04 3.16E+04 2.29E+04

Tyrosine 5.79E+04 5.46E+04 9.01E+04 6.50E+04 6.27E+04 7.21E+04 7.28E+04

UMP 2.35E+05 2.34E+05 2.38E+05 3.38E+05 2.43E+05 2.64E+05 3.17E+05

Uracil 9.02E+04 5.18E+04 2.12E+05 7.41E+04 1.97E+05 2.55E+05 2.29E+05

Uridine 1.18E+05 1.13E+05 3.27E+05 2.15E+05 2.69E+05 3.60E+05 3.17E+05

Valine 1.39E+05 1.15E+05 1.89E+05 1.32E+05 1.92E+05 2.18E+05 2.64E+05

Xanthine 9.52E+04 6.58E+04 1.27E+05 8.75E+04 1.09E+05 1.37E+05 1.15E+05

112

Table 1.19 Raw Data of Control Mice from HPC

Sample Name M3 M5 M10 M12 M14 M26 M30 M32 M38 M40

2-Hydroxy-2-methylsuccinate 2.63E+04 1.72E+05 1.97E+05 1.18E+05 1.49E+05 2.67E+05 1.58E+05 1.72E+05 2.56E+05 1.90E+05

4-Aminobutyrate 1.73E+05 1.22E+06 1.69E+06 9.91E+05 4.92E+05 1.55E+06 1.05E+06 1.44E+06 1.72E+06 1.31E+06

5-Hydroxyindoleacetic acid 2.81E+03 1.25E+04 1.72E+04 1.18E+04 1.20E+04 1.20E+04 1.29E+04 1.32E+04 1.57E+04 9.19E+03

Acadesine 9.22E+02 1.28E+04 1.96E+04 1.50E+04 7.29E+03 1.94E+04 1.42E+04 1.56E+04 2.20E+04 2.06E+04

Aconitate 7.63E+03 9.72E+04 6.83E+04 5.58E+04 3.78E+04 7.87E+04 3.64E+04 6.83E+04 8.05E+04 6.03E+04

Adenosine 1.53E+04 2.37E+04 1.18E+05 3.17E+04 1.00E+02 1.50E+05 5.07E+04 1.42E+04 6.82E+04 2.36E+04

Alanine 2.38E+05 9.94E+05 1.45E+06 1.17E+06 7.56E+05 1.56E+06 1.15E+06 1.12E+06 1.69E+06 1.44E+06

AMP 8.88E+05 5.45E+06 7.00E+06 5.11E+06 3.11E+06 8.44E+06 4.67E+06 5.64E+06 7.28E+06 7.70E+06

Arginine 1.43E+03 2.58E+04 2.87E+04 2.57E+04 1.30E+04 8.80E+03 2.76E+04 1.42E+04 2.18E+04 1.17E+04

Ascorbate 8.25E+05 5.46E+06 1.16E+07 5.58E+06 7.60E+05 1.22E+07 3.38E+06 5.93E+06 2.59E+06 8.02E+06

Asparagine 2.65E+03 1.92E+04 3.73E+04 2.61E+04 2.06E+04 3.01E+04 2.71E+04 2.47E+04 4.09E+04 3.27E+04

Aspartate 3.81E+05 5.27E+06 7.53E+06 3.91E+06 2.17E+06 6.79E+06 4.98E+06 4.95E+06 7.83E+06 4.99E+06

CDP-ethanolamine 4.65E+03 5.92E+04 6.98E+04 5.92E+04 3.43E+04 6.11E+04 4.98E+04 6.15E+04 6.44E+04 9.23E+04

Citrate/isocitrate 2.89E+04 5.63E+06 5.19E+06 1.98E+06 9.60E+05 4.22E+06 1.64E+06 1.35E+06 2.01E+06 2.74E+06

Citrulline 4.37E+03 6.38E+03 1.42E+04 3.74E+03 3.25E+03 7.17E+03 9.68E+03 4.89E+03 1.14E+04 4.80E+03

CMP 1.32E+04 4.97E+04 7.63E+04 3.79E+04 2.52E+04 7.54E+04 2.61E+04 5.85E+04 6.08E+04 6.75E+04

Creatine 1.89E+05 1.23E+06 1.82E+06 1.49E+06 8.94E+05 1.97E+06 1.44E+06 1.53E+06 2.25E+06 1.88E+06

Creatinine 2.00E+04 1.03E+05 4.97E+04 3.11E+04 3.57E+04 4.98E+04 3.63E+04 3.25E+04 4.93E+04 4.76E+04

Cysteine 1.00E+02 1.00E+02 1.40E+03 9.41E+02 5.20E+02 1.07E+04 9.35E+03 6.20E+03 2.94E+04 1.13E+04

Cytidine 2.44E+03 1.14E+04 1.83E+04 1.16E+04 6.98E+03 8.80E+03 1.48E+04 1.49E+04 2.12E+04 1.16E+04

Cytidine 2.40E+03 1.04E+05 1.44E+05 1.09E+05 5.76E+04 2.05E+05 7.95E+04 1.21E+05 1.88E+05 1.75E+05

Diiodothyronine 1.00E+02 2.17E+04 8.05E+04 2.92E+04 1.27E+04 6.85E+04 3.43E+04 2.92E+04 6.95E+04 5.89E+04

Glutamate 6.64E+06 2.67E+07 3.98E+07 2.58E+07 1.85E+07 3.71E+07 3.03E+07 3.03E+07 4.06E+07 3.65E+07

Glutamine 1.15E+06 6.20E+06 7.95E+06 6.33E+06 4.21E+06 6.94E+06 5.94E+06 6.77E+06 8.98E+06 6.74E+06

Glutathione 1.52E+05 6.72E+05 1.44E+06 1.07E+06 5.00E+05 1.62E+06 1.25E+06 1.47E+06 2.22E+06 1.46E+06

Glutathione disulfide 3.79E+03 1.11E+05 1.37E+05 7.91E+04 3.13E+04 1.91E+05 5.21E+04 5.74E+04 6.09E+04 1.36E+05

Glycerone phosphate 5.59E+03 6.36E+04 1.03E+05 7.29E+04 1.19E+04 1.22E+05 9.66E+04 1.03E+05 1.73E+05 1.54E+05

GMP 1.69E+04 2.52E+05 2.25E+05 1.76E+05 1.05E+05 2.93E+05 1.54E+05 2.34E+05 3.38E+05 3.05E+05

Guanosine 4.74E+03 5.90E+04 6.83E+04 6.19E+04 4.36E+04 5.43E+04 4.07E+04 3.98E+04 7.59E+04 4.54E+04

Histidine 4.60E+03 3.39E+04 5.49E+04 3.19E+04 2.85E+04 4.65E+04 4.64E+04 4.31E+04 6.45E+04 4.17E+04

Homoserine 4.46E+04 2.88E+05 3.44E+05 2.68E+05 1.84E+05 3.34E+05 2.79E+05 3.47E+05 5.80E+05 3.66E+05

Homovanillic acid 1.47E+04 4.57E+04 2.34E+04 1.99E+04 2.15E+04 7.68E+04 3.01E+04 2.77E+04 5.34E+04 3.46E+04

113

Table 1.19 Continued

Sample Name M3 M5 M10 M12 M14 M26 M30 M32 M38 M40

Hydroxyphenylpyruvate 2.00E+06 1.92E+06 1.96E+06 2.02E+06 2.11E+06 2.01E+06 2.11E+06 2.25E+06 2.09E+06 2.25E+06

Hypoxanthine 6.49E+04 5.74E+05 5.86E+05 4.19E+05 3.07E+05 5.50E+05 5.61E+05 5.56E+05 1.08E+06 5.29E+05

IMP 5.86E+04 5.83E+05 5.15E+05 3.40E+05 3.51E+05 7.22E+05 3.59E+05 3.68E+05 3.87E+05 1.14E+06

Inosine 4.08E+05 2.31E+06 2.39E+06 2.31E+06 1.53E+06 2.35E+06 2.26E+06 2.47E+06 3.09E+06 2.09E+06

Lactate 1.77E+07 3.49E+07 5.04E+07 3.30E+07 2.80E+07 4.91E+07 4.43E+07 4.81E+07 7.73E+07 4.70E+07

Leucine/Isoleucine 1.23E+04 5.43E+04 4.99E+04 4.29E+04 3.17E+04 5.31E+04 5.11E+04 7.01E+04 8.51E+04 3.59E+04

Malate 1.76E+06 1.08E+07 1.92E+07 1.52E+07 8.08E+06 2.51E+07 1.69E+07 1.77E+07 3.13E+07 1.89E+07

Methionine 2.90E+03 3.74E+04 3.82E+04 2.92E+04 2.33E+04 3.30E+04 3.99E+04 3.61E+04 4.74E+04 3.50E+04

Methionine sulfoxide 4.06E+04 1.12E+04 2.68E+04 1.82E+04 2.93E+04 3.74E+04 4.37E+04 4.39E+04 3.89E+04 3.39E+04

Methylmalonate 6.80E+05 8.20E+05 1.28E+06 7.50E+05 6.66E+05 9.74E+05 6.74E+05 6.93E+05 1.82E+06 7.75E+05

myo-Inositol 4.78E+03 5.01E+04 7.50E+04 4.34E+04 2.80E+04 1.25E+05 7.39E+04 1.22E+05 2.01E+05 9.51E+04

N-Acetylglutamate 1.37E+04 1.52E+05 2.00E+05 1.10E+05 7.80E+04 2.19E+05 1.18E+05 1.04E+05 1.71E+05 1.26E+05

N-Carbamoyl-L-aspartate 1.18E+04 1.09E+05 1.71E+05 9.67E+04 4.65E+04 1.64E+05 1.11E+05 1.37E+05 1.76E+05 1.44E+05

Normetanephrine 1.86E+05 2.32E+05 2.27E+05 2.24E+05 2.07E+05 2.28E+05 2.66E+05 2.31E+05 2.00E+05 2.66E+05

Pantothenate 6.12E+04 2.29E+05 2.64E+05 1.98E+05 1.62E+05 4.06E+05 2.44E+05 2.72E+05 3.61E+05 3.52E+05

Phenylalanine 2.05E+04 1.09E+05 1.28E+05 8.42E+04 9.75E+04 1.51E+05 1.10E+05 1.21E+05 1.76E+05 1.13E+05

Proline 1.57E+04 3.52E+04 5.24E+04 3.05E+04 2.16E+04 4.29E+04 4.71E+04 3.49E+04 5.83E+04 5.37E+04

Pyroglutamic acid 1.27E+05 2.29E+05 3.33E+05 2.32E+05 2.23E+05 1.84E+05 2.24E+05 2.05E+05 2.62E+05 3.18E+05

S-Methyl-5--thioadenosine 2.98E+05 2.81E+05 3.28E+05 2.92E+05 3.29E+05 4.12E+05 3.25E+05 3.83E+05 4.21E+05 3.92E+05

Serine 1.65E+05 6.24E+05 1.18E+06 8.31E+05 4.72E+05 8.93E+05 7.90E+05 7.89E+05 1.36E+06 9.83E+05

Taurine 5.81E+06 1.70E+07 2.35E+07 1.63E+07 1.06E+07 2.71E+07 1.63E+07 2.21E+07 2.59E+07 2.63E+07

Trehalose/sucrose 5.47E+04 4.74E+04 4.06E+04 4.87E+04 5.19E+04 2.51E+04 3.07E+04 3.73E+04 7.83E+04 4.73E+04

Tyrosine 1.25E+04 5.65E+04 6.45E+04 6.31E+04 5.94E+04 9.40E+04 6.83E+04 6.15E+04 1.23E+05 5.81E+04

UMP 4.23E+04 2.00E+05 2.65E+05 2.54E+05 1.35E+05 2.67E+05 1.66E+05 2.00E+05 2.81E+05 2.98E+05

Uracil 2.23E+04 1.11E+05 1.66E+05 8.27E+04 5.42E+04 2.24E+05 1.30E+05 1.82E+05 2.03E+05 3.10E+05

Uridine 7.68E+04 2.42E+05 3.32E+05 2.30E+05 1.80E+05 3.07E+05 2.43E+05 2.55E+05 3.62E+05 1.96E+05

Valine 5.55E+04 1.81E+05 2.19E+05 1.16E+05 1.17E+05 2.65E+05 1.53E+05 1.87E+05 3.31E+05 2.33E+05

Xanthine 2.82E+04 1.23E+05 1.46E+05 7.09E+04 8.59E+04 1.48E+05 8.81E+04 1.02E+05 1.39E+05 9.50E+04

114

Table 1.20 Raw Data of Susceptible Mice from HPC

Sample Name M1 M4 M15 M17 M20 M22 M23 M24 M25 M27 M28

2-Hydroxy-2-methylsuccinate 2.55E+05 1.47E+05 4.84E+05 1.83E+05 3.06E+05 2.62E+05 1.25E+05 1.86E+05 1.13E+05 1.44E+05 1.83E+05

4-Aminobutyrate 1.52E+06 1.13E+06 1.32E+06 1.70E+06 1.69E+06 1.34E+06 1.03E+06 1.68E+06 9.70E+05 1.18E+06 1.61E+06

5-Hydroxyindoleacetic acid 2.70E+04 7.85E+03 1.84E+04 2.82E+04 1.91E+04 1.60E+04 4.96E+03 2.72E+04 4.59E+03 6.74E+03 1.57E+04

Acadesine 1.22E+04 1.69E+04 7.51E+03 2.26E+04 2.15E+04 1.98E+04 1.04E+04 2.19E+04 1.72E+04 1.47E+04 1.31E+04

Aconitate 8.11E+04 3.61E+04 5.00E+04 8.72E+04 1.09E+05 6.89E+04 4.26E+04 7.25E+04 4.01E+04 6.91E+04 9.10E+04

Adenosine 2.19E+04 6.08E+04 7.35E+03 1.15E+05 9.50E+04 5.99E+04 6.69E+04 3.90E+04 1.86E+04 1.74E+04 6.44E+03

Alanine 1.18E+06 9.28E+05 1.07E+06 1.59E+06 1.55E+06 1.48E+06 9.75E+05 1.16E+06 1.00E+06 1.11E+06 1.29E+06

AMP 7.62E+06 5.78E+06 2.85E+06 7.82E+06 7.98E+06 7.86E+06 4.19E+06 6.27E+06 5.30E+06 5.78E+06 6.36E+06

Arginine 2.74E+04 7.40E+03 8.95E+03 3.58E+04 1.53E+04 1.88E+04 7.26E+03 1.85E+04 6.18E+03 7.73E+03 2.61E+04

Ascorbate 1.08E+07 7.60E+06 1.35E+03 1.06E+07 1.07E+07 7.87E+06 4.61E+06 5.94E+06 1.56E+06 4.86E+06 6.23E+06

Asparagine 2.04E+04 2.37E+04 1.18E+04 3.36E+04 2.96E+04 3.39E+04 1.68E+04 3.17E+04 1.89E+04 1.50E+04 2.90E+04

Aspartate 6.56E+06 4.06E+06 6.78E+05 6.97E+06 7.25E+06 6.90E+06 3.22E+06 5.64E+06 2.35E+06 3.63E+06 5.75E+06

CDP-ethanolamine 6.34E+04 4.60E+04 4.82E+02 8.31E+04 5.34E+04 9.05E+04 5.18E+04 5.12E+04 3.62E+04 3.88E+04 4.50E+04

Citrate/isocitrate 7.58E+06 1.98E+06 9.57E+04 4.46E+06 3.84E+06 3.22E+06 9.97E+05 4.58E+06 6.36E+05 1.49E+06 3.23E+06

Citrulline 9.84E+03 1.54E+04 7.01E+03 8.62E+03 1.95E+03 1.03E+04 5.48E+03 1.58E+04 8.21E+03 7.10E+03 6.86E+03

CMP 7.60E+04 3.39E+04 1.00E+02 5.89E+04 5.97E+04 9.00E+04 3.75E+04 5.18E+04 4.43E+04 6.94E+04 4.75E+04

Creatine 1.49E+06 1.16E+06 1.29E+06 1.99E+06 1.97E+06 1.90E+06 1.23E+06 1.63E+06 1.23E+06 1.44E+06 1.68E+06

Creatinine 3.50E+04 5.43E+04 3.63E+04 4.68E+04 3.19E+04 3.38E+04 2.90E+04 4.43E+04 2.21E+04 3.03E+04 4.09E+04

Cysteine 1.00E+02 1.00E+02 1.00E+02 1.19E+04 8.89E+03 1.52E+04 6.83E+02 9.04E+03 6.83E+02 3.20E+03 1.21E+04

Cytidine 1.24E+04 9.68E+03 8.30E+03 2.15E+04 1.17E+04 1.60E+04 7.22E+03 2.98E+04 7.08E+03 1.14E+04 2.14E+04

Cytidine 1.16E+05 8.85E+04 5.57E+04 1.44E+05 1.67E+05 1.50E+05 9.43E+04 1.53E+05 7.75E+04 7.98E+04 1.19E+05

Diiodothyronine 4.15E+04 1.77E+04 1.92E+04 6.63E+04 8.32E+04 6.17E+04 2.31E+04 5.27E+04 2.83E+04 2.77E+04 5.04E+04

Glutamate 2.97E+07 2.69E+07 9.59E+06 3.83E+07 3.85E+07 3.83E+07 2.29E+07 3.09E+07 2.57E+07 2.71E+07 3.25E+07

Glutamine 7.47E+06 5.27E+06 5.34E+06 9.83E+06 9.46E+06 8.90E+06 5.12E+06 7.68E+06 4.46E+06 6.03E+06 9.42E+06

Glutathione 9.30E+05 1.05E+06 4.89E+05 1.77E+06 1.88E+06 1.85E+06 9.95E+05 1.22E+06 7.08E+05 1.19E+06 1.56E+06

Glutathione disulfide 8.70E+04 9.03E+04 5.65E+04 1.05E+05 9.55E+04 7.80E+04 8.58E+04 1.33E+05 1.01E+05 1.00E+05 8.46E+04

Glycerone phosphate 9.61E+04 8.17E+04 2.83E+03 8.69E+04 1.03E+05 1.03E+05 7.94E+04 1.41E+05 9.36E+04 1.25E+05 1.06E+05

GMP 2.65E+05 1.67E+05 7.79E+04 2.88E+05 2.96E+05 2.59E+05 1.14E+05 2.01E+05 1.73E+05 2.26E+05 2.40E+05

Guanosine 5.25E+04 3.91E+04 1.91E+04 5.37E+04 5.10E+04 5.76E+04 2.28E+04 5.36E+04 2.00E+04 3.69E+04 4.70E+04

Histidine 3.00E+04 3.43E+04 6.92E+03 5.82E+04 4.33E+04 4.68E+04 3.41E+04 5.46E+04 3.25E+04 2.38E+04 5.34E+04

Homoserine 2.79E+05 2.87E+05 1.63E+05 3.90E+05 3.81E+05 3.98E+05 2.02E+05 3.99E+05 1.76E+05 2.38E+05 3.29E+05

Homovanillic acid 4.49E+04 3.66E+04 3.66E+04 6.20E+04 6.42E+04 3.54E+04 2.41E+04 5.65E+04 3.12E+04 3.33E+04 4.88E+04

115

Table 1.20 Continued

Sample Name M1 M4 M15 M17 M20 M22 M23 M24 M25 M27 M28

Hydroxyphenylpyruvate 2.04E+06 2.19E+06 1.97E+06 2.17E+06 1.94E+06 2.15E+06 2.07E+06 2.22E+06 2.16E+06 2.00E+06 1.95E+06

Hypoxanthine 6.49E+05 3.87E+05 3.30E+05 7.47E+05 6.52E+05 7.04E+05 2.90E+05 7.06E+05 2.50E+05 4.20E+05 6.42E+05

IMP 8.02E+05 3.59E+05 1.48E+05 6.04E+05 6.64E+05 6.24E+05 2.94E+05 4.24E+05 5.94E+05 4.88E+05 4.47E+05

Inosine 2.42E+06 1.57E+06 1.06E+06 2.53E+06 2.45E+06 2.85E+06 1.72E+06 3.00E+06 1.40E+06 1.79E+06 2.75E+06

Lactate 4.12E+07 4.22E+07 5.51E+06 5.94E+07 5.65E+07 5.36E+07 3.91E+07 7.03E+07 4.20E+07 4.51E+07 5.17E+07

Leucine/Isoleucine 5.02E+04 3.68E+04 5.89E+04 5.15E+04 5.24E+04 6.40E+04 3.99E+04 8.18E+04 4.25E+04 4.06E+04 6.86E+04

Malate 1.90E+07 1.53E+07 1.35E+07 2.84E+07 2.36E+07 2.44E+07 1.46E+07 2.09E+07 1.32E+07 1.61E+07 2.26E+07

Methionine 3.79E+04 3.25E+04 4.03E+04 7.09E+04 4.58E+04 5.01E+04 2.25E+04 3.98E+04 3.14E+04 2.71E+04 5.23E+04

Methionine sulfoxide 3.69E+04 1.56E+04 3.96E+04 4.05E+04 3.82E+04 2.91E+04 3.40E+04 4.07E+04 2.17E+04 4.87E+04 2.51E+04

Methylmalonate 7.38E+05 7.97E+05 7.12E+05 8.61E+05 1.12E+06 9.74E+05 8.87E+05 7.88E+05 8.54E+05 1.07E+06 7.73E+05

myo-Inositol 4.92E+04 9.00E+04 1.13E+03 1.31E+05 1.47E+05 9.70E+04 6.55E+04 1.74E+05 5.94E+04 7.29E+04 1.15E+05

N-Acetylglutamate 1.84E+05 1.08E+05 3.37E+04 1.92E+05 1.84E+05 1.52E+05 1.04E+05 1.46E+05 1.07E+05 1.05E+05 1.48E+05

N-Carbamoyl-L-aspartate 1.01E+05 6.91E+04 4.13E+04 1.48E+05 1.70E+05 1.21E+05 1.00E+05 1.49E+05 9.49E+04 1.02E+05 1.13E+05

Normetanephrine 2.18E+05 2.20E+05 2.14E+05 2.58E+05 1.97E+05 2.12E+05 2.29E+05 2.43E+05 2.15E+05 2.20E+05 2.53E+05

Pantothenate 2.78E+05 2.15E+05 1.89E+05 4.01E+05 4.37E+05 2.42E+05 2.24E+05 3.60E+05 2.10E+05 2.31E+05 3.65E+05

Phenylalanine 9.89E+04 1.08E+05 4.65E+04 1.62E+05 1.47E+05 1.22E+05 8.10E+04 1.52E+05 7.87E+04 1.10E+05 1.26E+05

Proline 3.42E+04 3.74E+04 2.80E+04 4.52E+04 4.77E+04 3.89E+04 3.38E+04 5.68E+04 3.34E+04 3.59E+04 3.86E+04

Pyroglutamic acid 2.34E+05 2.70E+05 1.59E+05 2.97E+05 2.83E+05 2.62E+05 2.41E+05 4.89E+05 2.71E+05 2.21E+05 2.88E+05

S-Methyl-5--thioadenosine 2.68E+05 2.86E+05 2.63E+05 3.36E+05 3.43E+05 3.81E+05 3.24E+05 3.66E+05 3.52E+05 3.88E+05 3.31E+05

Serine 6.69E+05 9.94E+05 5.03E+05 1.07E+06 1.10E+06 1.12E+06 6.34E+05 1.41E+06 7.52E+05 7.01E+05 8.87E+05

Taurine 2.07E+07 1.50E+07 1.89E+07 2.41E+07 2.82E+07 2.37E+07 1.81E+07 2.23E+07 1.71E+07 1.64E+07 1.89E+07

Trehalose/sucrose 3.07E+04 5.91E+04 2.52E+04 5.06E+04 4.99E+04 4.51E+04 6.73E+04 1.10E+05 1.27E+05 4.83E+04 4.08E+04

Tyrosine 5.69E+04 7.90E+04 4.94E+04 9.44E+04 7.51E+04 1.01E+05 4.67E+04 1.09E+05 4.47E+04 6.44E+04 9.15E+04

UMP 2.73E+05 1.73E+05 8.64E+04 2.94E+05 2.43E+05 3.43E+05 1.47E+05 1.66E+05 1.94E+05 2.78E+05 2.41E+05

Uracil 1.71E+05 9.04E+04 1.07E+05 1.82E+05 2.85E+05 1.38E+05 1.37E+05 2.29E+05 1.03E+05 1.68E+05 1.51E+05

Uridine 2.71E+05 2.16E+05 1.88E+05 3.84E+05 3.50E+05 2.96E+05 2.00E+05 3.06E+05 1.71E+05 1.51E+05 2.71E+05

Valine 1.85E+05 1.95E+05 1.28E+05 2.28E+05 2.51E+05 2.10E+05 1.32E+05 3.49E+05 1.31E+05 1.65E+05 2.06E+05

Xanthine 1.03E+05 9.93E+04 1.12E+05 1.53E+05 1.16E+05 9.94E+04 6.26E+04 1.39E+05 5.40E+04 8.71E+04 1.06E+05

116

Table 1.21 Raw Data of Resilient Mice from NAc

Sample Name M2 M8 M13 M16 M18 M44 M45 M46 M64 M69 M70

2-Aminoadipate 3.51E+04 2.16E+04 2.77E+04 3.18E+04 5.82E+04 1.09E+04 8.31E+04 1.68E+05 5.51E+04 1.02E+05 3.00E+04

2-Hydroxy-2-methylsuccinate 5.00E+06 2.62E+06 5.04E+06 4.78E+06 2.80E+06 3.72E+06 3.77E+06 5.97E+06 3.18E+06 1.84E+06 3.53E+06

2-Isopropylmalate 7.47E+04 5.32E+04 5.32E+04 5.93E+04 5.61E+04 5.42E+04 6.07E+04 5.98E+04 5.79E+04 5.45E+04 5.92E+04

3-Phosphoglycerate 3.77E+04 1.21E+04 2.47E+04 5.80E+03 1.21E+04 1.78E+04 2.10E+04 1.99E+04 1.75E+04 2.63E+04 3.42E+04

3_4-Dihydroxyphenylacetate 4.14E+04 2.33E+04 7.10E+04 2.31E+04 4.62E+04 7.16E+04 5.51E+04 4.67E+06 3.46E+04 2.01E+04 3.20E+04

4-Aminobutyrate 2.07E+06 2.81E+06 1.39E+06 1.55E+06 2.51E+06 3.07E+06 2.23E+06 2.32E+06 1.74E+06 2.79E+06 3.65E+06

5-Hydroxyindoleacetic acid 1.88E+04 2.83E+04 1.57E+04 2.09E+04 3.43E+04 3.00E+04 2.01E+04 2.92E+04 1.45E+04 1.55E+04 3.18E+04

Aconitate 5.13E+06 3.71E+06 8.16E+06 5.79E+06 7.30E+06 8.38E+06 7.08E+06 8.50E+06 5.85E+06 4.45E+06 5.09E+06

Adenine 3.14E+04 2.32E+04 3.45E+04 2.77E+04 4.38E+04 3.75E+04 3.63E+04 3.54E+04 3.45E+04 4.83E+04 3.53E+04

Adenosine 2.25E+05 5.50E+04 2.79E+05 1.89E+05 5.35E+04 1.11E+05 8.11E+04 5.98E+04 5.60E+04 4.63E+04 8.21E+04

Alanine/Sarcosine 1.32E+06 1.09E+06 1.14E+06 9.88E+05 1.29E+06 1.38E+06 1.28E+06 1.20E+06 1.26E+06 1.13E+06 1.33E+06

alpha-Ketoglutarate 3.07E+04 2.91E+04 1.67E+04 3.18E+04 3.88E+04 3.83E+04 2.98E+04 6.05E+04 1.94E+04 1.62E+04 2.56E+04

AMP/dGMP 3.22E+05 4.90E+05 3.32E+05 4.97E+05 2.04E+05 1.63E+05 2.07E+05 2.19E+05 1.88E+05 1.14E+05 9.87E+04

Arginine 4.76E+03 3.03E+04 5.52E+03 4.91E+03 3.66E+03 8.55E+03 6.63E+03 2.13E+03 6.53E+03 3.77E+03 7.83E+03

Ascorbate 4.89E+06 2.46E+06 7.26E+06 3.31E+06 4.41E+06 4.60E+06 4.23E+06 1.98E+06 1.23E+06 1.60E+06 4.24E+06

Asparagine 2.86E+04 2.33E+04 3.73E+04 2.88E+04 4.02E+04 4.34E+04 3.28E+04 2.94E+04 4.70E+04 5.35E+04 3.02E+04

Aspartate 6.04E+06 6.24E+06 6.12E+06 6.71E+06 2.37E+06 6.10E+06 4.05E+06 4.07E+06 4.83E+06 2.67E+06 7.02E+06

cAMP 1.49E+04 2.97E+04 4.13E+04 1.39E+04 3.69E+04 3.53E+04 3.25E+04 1.95E+04 3.71E+04 1.26E+04 1.25E+04

CDP-ethanolamine 2.60E+04 2.14E+04 2.47E+04 1.54E+04 1.34E+04 2.73E+04 1.48E+04 1.38E+04 1.67E+04 8.77E+03 2.19E+04

Citraconate 1.30E+05 1.22E+05 2.33E+05 1.97E+05 2.21E+05 1.98E+05 2.66E+05 2.84E+05 1.78E+05 1.58E+05 1.97E+05

Citrate/isocitrate 3.01E+06 1.79E+06 5.46E+06 3.01E+06 5.70E+06 5.84E+06 4.64E+06 5.29E+06 3.72E+06 2.54E+06 2.88E+06

Creatine 1.45E+06 1.40E+06 1.64E+06 1.32E+06 1.65E+06 1.60E+06 1.52E+06 1.23E+06 1.68E+06 1.62E+06 1.61E+06

Cysteine 7.47E+04 7.38E+04 1.07E+05 7.58E+04 2.65E+04 4.12E+04 2.86E+04 2.44E+04 3.81E+04 3.62E+04 1.28E+05

Cystine 4.34E+03 1.00E+02 1.00E+02 8.45E+03 6.83E+04 7.56E+04 6.13E+04 4.51E+04 5.54E+04 5.04E+04 1.85E+04

D-Gluconate 1.07E+04 8.82E+03 1.10E+04 4.97E+03 1.41E+04 2.38E+04 2.67E+04 2.56E+04 1.27E+04 1.55E+04 1.12E+04

D-Glyceraldehdye 3-phosphate 1.39E+04 3.72E+04 2.70E+03 1.88E+03 3.24E+03 3.32E+03 1.72E+04 1.63E+03 1.50E+04 1.74E+04 3.17E+04

Dopamine 1.25E+04 4.17E+03 2.00E+04 2.06E+03 2.19E+04 1.51E+04 1.53E+04 2.55E+03 6.87E+03 5.35E+03 8.68E+03

Fructose 1_6-bisphosphate 2.89E+03 1.20E+04 2.52E+03 1.00E+02 1.00E+02 1.00E+02 2.92E+03 1.00E+02 4.69E+03 4.12E+03 1.04E+04

117

Table 1.21 Continued

Sample Name M2 M8 M13 M16 M18 M44 M45 M46 M64 M69 M70

Fumarate 1.71E+06 1.19E+06 1.24E+06 1.17E+06 7.44E+05 1.31E+06 1.82E+06 1.48E+06 1.09E+06 1.00E+06 1.47E+06

Glucose 1-phosphate 4.88E+03 1.76E+04 8.33E+03 3.52E+03 2.01E+03 4.06E+03 1.45E+03 1.41E+03 2.69E+03 4.94E+03 1.05E+04

Glutamate 9.62E+06 7.52E+06 8.97E+06 8.91E+06 9.43E+06 3.70E+06 6.48E+06 6.11E+06 4.54E+06 4.38E+06 5.92E+06

Glutamate 5.66E+04 1.04E+05 5.02E+04 5.29E+04 2.03E+04 3.28E+04 2.68E+04 2.02E+04 1.33E+04 1.67E+04 1.78E+04

Glutamine 4.24E+06 2.35E+06 2.17E+06 2.67E+06 3.15E+06 4.16E+06 2.83E+06 1.48E+06 2.88E+06 2.91E+06 2.67E+06

Glutathione 8.75E+05 5.51E+05 1.17E+06 6.33E+05 7.32E+05 9.85E+05 6.26E+05 5.07E+05 6.55E+05 5.11E+05 6.56E+05

Glutathione disulfide 3.94E+05 3.22E+05 2.86E+05 2.53E+05 3.41E+05 3.97E+05 3.15E+05 2.42E+05 2.51E+05 2.45E+05 2.23E+05

Glycerate 9.44E+04 2.11E+04 3.40E+04 4.26E+04 1.41E+05 1.45E+05 1.54E+05 1.21E+05 1.43E+05 1.44E+05 7.42E+04

Glycine 5.77E+04 6.97E+04 1.11E+05 4.45E+04 6.00E+04 5.36E+04 1.35E+05 1.20E+05 3.60E+04 9.46E+04 1.01E+05

GMP 9.27E+04 1.23E+05 1.10E+05 1.04E+05 6.92E+04 8.44E+04 9.77E+04 6.07E+04 5.63E+04 4.34E+04 2.42E+04

Guanosine 1.07E+05 7.40E+04 9.82E+04 5.77E+04 9.06E+04 8.67E+04 8.51E+04 8.25E+04 9.13E+04 9.69E+04 9.29E+04

Histidine 3.60E+03 1.07E+04 6.30E+03 1.72E+03 6.60E+03 4.69E+03 6.31E+03 3.89E+03 3.91E+03 2.38E+03 4.08E+03

Homoserine/Threonine 1.50E+05 1.72E+05 1.00E+05 1.15E+05 1.38E+05 1.49E+05 1.15E+05 1.33E+05 9.52E+04 1.29E+05 1.43E+05

Homovanillic acid 1.56E+05 6.87E+04 2.55E+05 1.21E+05 2.17E+05 3.43E+05 2.66E+05 6.48E+05 1.83E+05 1.15E+05 1.51E+05

Hydroxyisocaproic acid 1.24E+05 1.01E+05 1.87E+05 1.02E+05 2.97E+05 1.70E+05 1.98E+05 2.41E+05 1.62E+05 1.03E+05 2.01E+05

Hypoxanthine 1.33E+06 1.46E+06 1.31E+06 1.01E+06 1.49E+06 1.48E+06 6.15E+05 6.24E+05 1.61E+06 1.05E+06 1.85E+06

IMP 9.75E+04 1.33E+05 1.78E+05 1.76E+05 1.27E+05 1.40E+05 1.41E+05 9.92E+04 1.07E+05 7.47E+04 5.55E+04

Inosine 1.07E+06 1.06E+06 1.06E+06 1.16E+06 1.07E+06 1.28E+06 9.84E+05 8.51E+05 1.29E+06 1.28E+06 1.34E+06

Lactate 4.85E+07 4.71E+07 4.43E+07 3.76E+07 6.18E+06 9.70E+06 7.32E+06 6.42E+06 7.38E+06 5.66E+06 2.08E+07

Leucine/Isoleucine 2.25E+05 1.97E+05 1.37E+05 1.34E+05 6.44E+04 1.98E+05 1.69E+05 1.49E+05 1.75E+05 1.35E+05 2.85E+05

Malate 1.77E+05 1.55E+05 1.27E+05 1.37E+05 8.93E+04 1.35E+05 1.97E+05 1.83E+05 1.45E+05 1.31E+05 1.60E+05

Malate 1.05E+07 5.98E+06 5.71E+06 6.24E+06 2.42E+06 4.61E+06 5.45E+06 5.94E+06 5.70E+06 4.04E+06 7.82E+06

Methionine 1.05E+05 8.90E+04 1.74E+05 8.38E+04 1.55E+05 1.37E+05 1.31E+05 1.29E+05 1.50E+05 1.05E+05 1.34E+05

myo-Inositol 4.67E+05 6.58E+05 3.90E+05 3.53E+05 2.35E+04 2.85E+04 2.99E+04 2.89E+04 2.96E+04 2.87E+04 1.05E+05

N-Acetyl-beta-alanine 1.11E+04 9.54E+03 8.29E+03 2.69E+03 4.15E+03 6.17E+03 6.88E+03 9.03E+03 4.16E+03 9.51E+03 1.90E+04

N-Acetylglutamate 7.77E+05 7.70E+05 9.93E+05 1.20E+06 6.21E+05 8.30E+05 7.88E+05 1.05E+06 6.62E+05 5.13E+05 9.25E+05

N-Acetylglutamine 1.12E+04 5.18E+03 9.02E+03 4.48E+03 3.37E+03 6.45E+03 4.93E+03 6.64E+03 5.36E+03 2.05E+03 1.13E+04

N-Carbamoyl-L-aspartate 6.88E+05 1.67E+05 7.08E+05 1.90E+05 4.61E+05 4.09E+05 4.43E+05 5.21E+05 3.81E+05 4.06E+05 6.40E+05

118

Table 1.21 Continued

Sample Name M2 M8 M13 M16 M18 M44 M45 M46 M64 M69 M70

O-Acetyl-L-serine 9.62E+06 7.52E+06 8.97E+06 8.91E+06 9.43E+06 3.70E+06 6.48E+06 6.11E+06 4.54E+06 4.38E+06 5.92E+06

Pantothenate 3.51E+06 3.74E+06 4.14E+06 2.71E+06 4.02E+06 5.08E+06 3.74E+06 4.41E+06 3.72E+06 3.95E+06 4.41E+06

Phenylalanine 1.60E+05 7.35E+04 6.40E+04 4.26E+04 1.66E+05 5.80E+04 8.80E+04 7.06E+04 6.57E+04 8.06E+04 5.79E+04

Proline 3.36E+04 2.83E+04 3.63E+04 3.68E+04 2.95E+04 3.50E+04 2.49E+04 3.36E+04 2.70E+04 2.52E+04 2.63E+04

Pyroglutamic acid 2.39E+06 3.11E+06 1.77E+06 2.09E+06 1.18E+06 1.65E+06 1.21E+06 1.15E+06 1.43E+06 8.44E+05 2.68E+06

Pyruvate 2.10E+05 2.25E+05 7.67E+04 1.25E+05 1.01E+05 1.22E+05 1.51E+05 1.34E+05 9.50E+04 6.13E+04 1.17E+05

Ribose phosphate 2.03E+04 3.43E+04 3.28E+04 1.36E+04 1.44E+04 1.97E+04 1.77E+04 1.20E+04 2.67E+04 2.02E+04 1.78E+04

Serine 3.56E+05 5.30E+05 3.84E+05 4.05E+05 4.78E+05 4.84E+05 5.36E+05 4.24E+05 3.53E+05 3.84E+05 3.20E+05

Succinate/Methylmalonate 1.77E+06 1.37E+06 1.70E+06 1.82E+06 4.09E+05 7.62E+05 1.25E+06 2.92E+06 6.42E+05 2.81E+05 1.22E+06

Sulfolactate 6.55E+04 4.90E+04 2.80E+04 4.76E+04 2.97E+04 3.00E+04 3.90E+04 1.00E+05 3.26E+04 3.57E+04 2.48E+04

Taurine 1.84E+07 1.17E+07 1.52E+07 1.42E+07 1.77E+07 1.79E+07 1.74E+07 1.61E+07 1.75E+07 1.52E+07 1.38E+07

Trehalose/sucrose 9.41E+03 3.61E+04 4.51E+03 1.19E+04 2.99E+03 4.26E+03 1.10E+04 5.69E+03 7.98E+03 2.19E+03 4.65E+03

Tryptophan 3.39E+04 1.81E+04 1.09E+04 7.77E+03 2.70E+04 3.29E+04 2.43E+04 1.71E+04 2.53E+04 1.61E+04 3.18E+04

Tyrosine 1.09E+05 6.09E+04 8.98E+04 7.38E+04 1.04E+05 8.72E+04 4.46E+04 4.20E+04 1.06E+05 8.22E+04 6.93E+04

UDP-glucose 9.66E+04 6.43E+04 1.62E+05 9.03E+04 1.13E+05 1.65E+05 1.56E+05 1.23E+05 1.14E+05 9.98E+04 1.20E+05

UDP-N-acetylglucosamine 8.65E+04 5.89E+04 9.89E+04 8.33E+04 8.93E+04 1.12E+05 1.32E+05 1.07E+05 8.71E+04 8.54E+04 8.38E+04

UMP 2.51E+04 2.07E+04 1.96E+04 3.88E+04 1.54E+04 1.44E+04 2.49E+04 1.84E+04 3.09E+04 6.01E+03 5.68E+03

Uracil 3.62E+05 2.78E+05 3.98E+05 4.36E+05 4.96E+05 6.42E+05 6.08E+05 5.95E+05 4.72E+05 4.15E+05 4.52E+05

Uric acid 1.35E+04 1.69E+04 2.44E+04 1.37E+04 1.90E+04 8.87E+03 1.73E+04 1.15E+04 7.55E+03 7.92E+03 6.24E+03

Uridine 1.06E+04 7.71E+03 1.70E+04 6.10E+03 1.23E+04 1.12E+04 1.32E+04 1.30E+04 1.27E+04 8.85E+03 9.64E+03

Valine 2.18E+05 2.24E+05 1.95E+05 1.69E+05 1.86E+05 2.34E+05 1.87E+05 1.39E+05 1.62E+05 1.53E+05 1.92E+05

Xanthine 4.21E+05 3.29E+05 5.54E+05 3.92E+05 4.22E+05 4.95E+05 5.61E+05 4.61E+05 3.82E+05 2.34E+05 4.57E+05

Xanthurenic acid 2.35E+04 1.76E+04 1.95E+04 1.80E+04 3.97E+04 2.59E+04 1.21E+04 2.72E+04 2.06E+04 1.12E+04 3.07E+04

119

Table 1.22 Raw Data of Control Mice from NAc

Sample Name M3 M5 M10 M12 M14 M19 M26 M31 M32 M38 M40

2-Aminoadipate 2.43E+04 2.16E+04 1.09E+04 2.33E+04 3.44E+04 3.10E+04 1.65E+04 2.73E+04 2.12E+04 3.72E+04 3.80E+04

2-Hydroxy-2-methylsuccinate 3.20E+06 4.13E+06 1.43E+06 3.16E+06 1.26E+06 2.55E+06 1.57E+06 4.53E+06 4.25E+06 4.18E+06 4.89E+06

2-Isopropylmalate 4.02E+04 5.59E+04 4.74E+04 2.95E+04 5.29E+04 3.77E+04 3.11E+04 5.79E+04 2.58E+04 2.65E+04 3.74E+04

3-Phosphoglycerate 1.42E+04 1.09E+04 8.35E+03 2.37E+04 1.33E+04 3.77E+03 6.30E+03 2.51E+04 3.49E+04 2.12E+04 1.98E+04

3_4-Dihydroxyphenylacetate 2.29E+04 5.53E+04 2.44E+04 3.20E+04 2.03E+04 2.85E+04 2.92E+04 3.22E+05 3.48E+04 3.99E+04 1.76E+04

4-Aminobutyrate 3.45E+06 2.32E+06 1.08E+06 2.14E+06 1.52E+06 2.57E+06 1.52E+06 3.55E+06 3.66E+06 3.40E+06 4.81E+06

5-Hydroxyindoleacetic acid 2.19E+04 2.78E+04 9.33E+03 1.23E+04 8.98E+03 1.97E+04 6.49E+03 3.60E+04 2.63E+04 3.81E+04 3.40E+04

Aconitate 3.80E+06 7.04E+06 2.95E+06 7.11E+06 4.16E+06 5.08E+06 4.44E+06 6.16E+06 7.24E+06 5.88E+06 7.88E+06

Adenine 2.08E+04 2.35E+04 1.66E+04 3.41E+04 2.48E+04 3.21E+04 2.23E+04 3.06E+04 4.92E+04 2.75E+04 3.99E+04

Adenosine 1.03E+05 1.85E+05 1.71E+05 2.31E+05 2.89E+04 6.10E+04 1.60E+05 1.77E+05 2.47E+05 2.34E+05 1.87E+05

Alanine/Sarcosine 1.10E+06 1.20E+06 7.81E+05 1.02E+06 1.16E+06 1.00E+06 9.76E+05 1.40E+06 1.31E+06 1.26E+06 1.47E+06

alpha-Ketoglutarate 1.31E+04 1.63E+04 2.94E+04 3.40E+04 2.00E+04 2.67E+04 1.95E+04 1.83E+04 3.95E+04 2.97E+04 2.74E+04

AMP/dGMP 2.57E+05 1.93E+05 6.01E+04 9.03E+04 9.34E+04 6.54E+04 5.27E+04 7.20E+04 9.96E+04 1.11E+05 1.72E+05

Arginine 4.91E+03 3.32E+03 2.79E+03 8.76E+02 2.15E+03 2.93E+03 4.55E+03 7.88E+03 7.55E+03 8.21E+03 7.51E+03

Ascorbate 1.84E+06 4.50E+06 1.15E+06 3.53E+04 1.60E+06 2.13E+06 1.30E+06 6.03E+06 5.75E+06 5.29E+06 3.33E+06

Asparagine 2.07E+04 2.52E+04 1.35E+04 3.74E+04 2.30E+04 5.35E+04 2.10E+04 3.64E+04 4.33E+04 5.34E+04 3.57E+04

Aspartate 6.53E+06 6.42E+06 3.03E+06 4.30E+06 1.13E+06 4.29E+06 4.98E+06 8.20E+06 7.44E+06 7.21E+06 9.47E+06

cAMP 1.04E+04 2.93E+04 2.02E+04 2.97E+04 4.17E+03 2.35E+04 2.33E+04 3.05E+04 3.61E+04 2.70E+04 2.10E+04

CDP-ethanolamine 2.06E+04 2.48E+04 1.29E+04 2.11E+04 4.02E+03 2.63E+04 1.44E+04 2.94E+04 3.19E+04 2.48E+04 2.29E+04

Citraconate 1.53E+05 2.22E+05 1.05E+05 2.62E+05 1.21E+05 1.76E+05 1.58E+05 2.00E+05 2.45E+05 2.22E+05 2.60E+05

Citrate/isocitrate 1.57E+06 4.33E+06 1.58E+06 5.01E+06 2.20E+06 3.68E+06 2.04E+06 3.17E+06 5.19E+06 2.55E+06 4.60E+06

Creatine 1.49E+06 1.53E+06 9.77E+05 1.19E+06 1.54E+06 1.37E+06 1.28E+06 1.67E+06 1.77E+06 1.58E+06 1.85E+06

Cysteine 8.11E+04 9.82E+04 3.54E+04 3.72E+04 1.95E+04 3.67E+04 4.70E+04 1.58E+05 1.47E+05 1.47E+05 1.58E+05

Cystine 4.70E+03 1.00E+02 2.46E+03 3.76E+03 3.08E+04 7.94E+04 6.26E+03 1.00E+02 1.00E+02 2.22E+03 1.05E+04

D-Gluconate 3.87E+03 8.62E+03 6.67E+03 5.02E+03 7.61E+03 1.41E+04 1.03E+04 1.17E+04 1.03E+04 6.82E+03 1.35E+04

D-Glyceraldehdye 3-phosphate 3.77E+04 1.46E+04 2.12E+03 4.45E+03 1.00E+02 5.95E+03 1.91E+03 2.06E+04 1.12E+04 4.18E+04 3.62E+04

Dopamine 2.54E+03 9.30E+03 3.20E+03 1.24E+04 7.82E+03 1.14E+04 6.93E+03 7.19E+03 1.84E+04 1.08E+04 1.45E+03

Fructose 1_6-bisphosphate 4.05E+03 2.72E+03 1.00E+02 1.00E+02 1.00E+02 5.86E+03 1.00E+02 3.91E+03 4.10E+03 1.35E+04 1.85E+04

120

Table 1.22 Continued

Sample Name M3 M5 M10 M12 M14 M19 M26 M31 M32 M38 M40

Fumarate 9.62E+05 1.25E+06 3.24E+05 6.63E+05 4.06E+05 1.04E+06 2.91E+05 1.57E+06 1.34E+06 1.88E+06 1.59E+06

Glucose 1-phosphate 9.64E+03 1.16E+04 9.74E+02 1.87E+03 1.10E+03 8.70E+02 1.82E+03 9.88E+03 1.33E+04 7.15E+03 7.50E+03

Glutamate 5.31E+06 8.71E+06 5.32E+06 7.19E+06 1.32E+07 3.34E+06 4.84E+06 8.07E+06 8.94E+06 8.72E+06 7.60E+06

Glutamate 5.02E+04 8.23E+04 7.27E+04 4.51E+04 3.24E+04 2.22E+04 3.01E+04 1.33E+05 1.25E+05 1.06E+05 8.19E+04

Glutamine 2.46E+06 2.52E+06 2.36E+06 2.19E+06 3.71E+06 2.57E+06 2.05E+06 2.93E+06 2.80E+06 2.61E+06 3.15E+06

Glutathione 5.47E+05 9.38E+05 3.60E+05 4.84E+05 2.09E+05 4.66E+05 2.97E+05 1.13E+06 1.09E+06 8.95E+05 6.75E+05

Glutathione disulfide 2.25E+05 3.30E+05 2.06E+05 3.59E+05 1.86E+05 3.21E+05 2.44E+05 3.12E+05 2.92E+05 2.81E+05 3.61E+05

Glycerate 3.33E+04 3.11E+04 3.62E+04 3.91E+04 1.78E+05 1.44E+05 3.48E+04 4.57E+04 4.39E+04 2.47E+04 4.86E+04

Glycine 1.34E+05 7.04E+04 7.06E+04 1.14E+05 2.78E+04 1.22E+04 1.96E+04 1.34E+05 8.74E+04 1.38E+05 2.05E+05

GMP 8.54E+04 1.06E+05 1.63E+04 3.71E+04 1.87E+04 5.56E+04 2.05E+04 4.63E+04 2.80E+04 7.38E+04 6.44E+04

Guanosine 8.13E+04 1.00E+05 4.83E+04 9.86E+04 5.72E+04 6.51E+04 7.73E+04 1.39E+05 1.42E+05 1.08E+05 1.31E+05

Histidine 2.74E+03 2.19E+03 2.72E+03 1.02E+04 8.88E+02 4.23E+03 2.79E+03 8.91E+03 9.40E+03 2.67E+03 3.73E+03

Homoserine/Threonine 1.31E+05 1.51E+05 1.07E+05 1.07E+05 1.53E+05 1.58E+05 9.88E+04 1.39E+05 1.52E+05 1.64E+05 1.85E+05

Homovanillic acid 8.24E+04 1.75E+05 9.16E+04 1.33E+05 7.63E+04 1.88E+05 1.17E+05 1.81E+05 1.73E+05 1.60E+05 1.80E+05

Hydroxyisocaproic acid 4.89E+05 2.59E+05 2.54E+05 1.62E+05 1.40E+05 1.60E+05 1.48E+05 1.26E+05 1.48E+05 1.72E+05 2.38E+05

Hypoxanthine 1.40E+06 1.43E+06 8.31E+05 1.12E+06 6.62E+05 1.49E+06 8.68E+05 1.88E+06 1.71E+06 2.26E+06 2.37E+06

IMP 8.46E+04 1.39E+05 3.13E+04 6.54E+04 4.18E+04 8.06E+04 4.25E+04 8.37E+04 4.36E+04 5.92E+04 1.35E+05

Inosine 9.70E+05 1.05E+06 6.05E+05 7.07E+05 5.27E+05 1.18E+06 7.88E+05 1.64E+06 1.29E+06 1.00E+06 1.54E+06

Lactate 3.83E+07 3.45E+07 3.57E+07 3.69E+07 3.66E+06 6.33E+06 3.69E+07 5.23E+07 5.25E+07 4.55E+07 4.71E+07

Leucine/Isoleucine 1.46E+05 1.75E+05 1.04E+05 1.73E+05 5.46E+04 1.03E+05 1.06E+05 2.64E+05 3.22E+05 2.40E+05 2.55E+05

Malate 2.00E+05 1.35E+05 8.56E+04 1.26E+05 8.10E+04 1.20E+05 9.63E+04 1.98E+05 1.73E+05 1.81E+05 1.45E+05

Malate 5.10E+06 4.27E+06 9.36E+05 2.48E+06 8.47E+05 3.34E+06 9.23E+05 9.07E+06 6.81E+06 6.96E+06 8.02E+06

Methionine 9.00E+04 2.17E+05 9.61E+04 1.25E+05 6.06E+04 1.37E+05 6.90E+04 2.26E+05 1.57E+05 1.33E+05 1.36E+05

myo-Inositol 3.34E+05 3.15E+05 3.44E+05 3.34E+05 1.51E+04 1.64E+04 3.32E+05 5.13E+05 4.69E+05 4.73E+05 3.96E+05

N-Acetyl-beta-alanine 1.20E+04 8.92E+03 4.18E+03 4.35E+03 1.58E+03 6.55E+03 2.16E+03 1.71E+04 1.28E+04 1.02E+04 2.27E+04

N-Acetylglutamate 7.91E+05 8.88E+05 2.81E+05 4.44E+05 2.95E+05 4.95E+05 2.94E+05 9.17E+05 8.50E+05 8.59E+05 1.36E+06

N-Acetylglutamine 7.22E+03 1.38E+04 1.61E+03 7.47E+03 4.81E+03 2.23E+03 3.51E+03 1.70E+04 1.20E+04 1.15E+04 1.61E+04

N-Carbamoyl-L-aspartate 5.14E+05 3.72E+05 3.03E+05 5.57E+05 1.24E+05 5.11E+05 2.80E+05 5.82E+05 6.44E+05 5.87E+05 5.43E+05

121

Table 1.22 Continued

Sample Name M3 M5 M10 M12 M14 M19 M26 M31 M32 M38 M40

O-Acetyl-L-serine 5.31E+06 8.71E+06 5.32E+06 7.19E+06 1.32E+07 3.34E+06 4.84E+06 8.07E+06 8.94E+06 8.72E+06 7.60E+06

Pantothenate 2.92E+06 4.72E+06 2.36E+06 3.70E+06 2.75E+06 3.52E+06 2.11E+06 4.96E+06 5.15E+06 4.74E+06 5.85E+06

Phenylalanine 9.86E+04 8.27E+04 4.33E+04 7.50E+04 6.34E+04 8.87E+04 5.66E+04 1.07E+05 9.24E+04 9.25E+04 8.21E+04

Proline 3.21E+04 3.17E+04 2.01E+04 3.13E+04 3.06E+04 2.62E+04 2.18E+04 4.30E+04 4.38E+04 3.73E+04 3.93E+04

Pyroglutamic acid 1.56E+06 2.34E+06 1.69E+06 2.47E+06 6.29E+05 1.44E+06 1.93E+06 3.23E+06 2.87E+06 3.60E+06 4.33E+06

Pyruvate 7.58E+04 1.32E+05 1.99E+05 9.60E+04 9.74E+04 9.20E+04 8.55E+04 2.95E+05 1.77E+05 1.57E+05 1.07E+05

Ribose phosphate 4.52E+04 3.42E+04 1.62E+04 2.80E+04 7.64E+03 8.42E+03 1.11E+04 3.44E+04 4.82E+04 2.78E+04 3.49E+04

Serine 3.82E+05 4.53E+05 3.65E+05 3.49E+05 3.54E+05 3.74E+05 3.47E+05 5.53E+05 4.75E+05 4.52E+05 4.29E+05

Succinate/Methylmalonate 7.10E+05 1.45E+06 8.92E+05 1.12E+06 4.07E+05 5.22E+05 1.01E+06 2.06E+06 1.17E+06 1.81E+06 1.37E+06

Sulfolactate 5.05E+04 4.42E+04 4.65E+04 4.99E+04 3.64E+04 2.66E+04 2.66E+04 2.47E+04 4.51E+04 3.78E+04 3.63E+04

Taurine 1.31E+07 1.44E+07 1.08E+07 1.30E+07 1.62E+07 1.50E+07 1.23E+07 1.70E+07 1.65E+07 1.44E+07 1.81E+07

Trehalose/sucrose 2.02E+04 1.51E+04 4.78E+04 1.69E+04 4.44E+03 4.32E+03 1.52E+04 1.36E+04 1.31E+04 6.07E+03 1.11E+04

Tryptophan 1.54E+04 2.64E+04 6.84E+03 1.04E+04 1.09E+04 2.42E+04 1.09E+04 2.83E+04 2.07E+04 1.75E+04 2.37E+04

Tyrosine 9.11E+04 9.47E+04 4.86E+04 7.13E+04 4.39E+04 1.02E+05 5.18E+04 1.28E+05 7.46E+04 9.79E+04 8.49E+04

UDP-glucose 1.05E+05 1.55E+05 5.90E+04 1.10E+05 5.92E+04 9.34E+04 6.37E+04 1.68E+05 1.42E+05 1.52E+05 1.43E+05

UDP-N-acetylglucosamine 5.38E+04 1.01E+05 4.62E+04 6.80E+04 4.32E+04 8.25E+04 4.34E+04 1.27E+05 1.07E+05 9.75E+04 1.15E+05

UMP 1.27E+04 1.40E+04 4.27E+03 3.99E+03 4.94E+03 5.09E+03 3.96E+03 1.00E+02 4.22E+03 7.09E+03 6.31E+03

Uracil 3.05E+05 3.59E+05 2.16E+05 3.97E+05 4.18E+05 4.70E+05 2.69E+05 4.75E+05 5.59E+05 5.35E+05 7.07E+05

Uric acid 1.89E+04 1.96E+04 1.43E+04 1.45E+04 1.48E+04 1.18E+04 1.46E+04 3.70E+04 1.60E+04 2.61E+04 1.72E+04

Uridine 8.38E+03 7.48E+03 4.52E+03 6.41E+03 5.38E+03 7.58E+03 6.00E+03 1.30E+04 8.84E+03 7.53E+03 8.57E+03

Valine 1.65E+05 1.90E+05 1.23E+05 1.29E+05 1.06E+05 1.52E+05 1.36E+05 2.81E+05 2.48E+05 2.63E+05 2.34E+05

Xanthine 4.65E+05 4.88E+05 3.33E+05 5.85E+05 3.11E+05 4.30E+05 3.81E+05 8.47E+05 5.56E+05 5.74E+05 7.00E+05

Xanthurenic acid 4.58E+04 3.58E+04 1.22E+04 2.34E+04 2.27E+04 2.05E+04 1.57E+04 4.29E+04 1.78E+04 5.37E+04 4.51E+04

122

Table 1.23 Raw Data of Susceptible Mice from NAc

Sample Name M1 M4 M15 M17 M20 M22 M23 M24 M25 M27 M28

2-Aminoadipate 3.18E+04 2.26E+04 2.89E+04 2.29E+04 1.87E+04 2.40E+04 3.00E+04 2.25E+04 2.30E+04 2.79E+04 2.58E+04

2-Hydroxy-2-methylsuccinate 5.47E+06 3.51E+06 3.64E+06 2.43E+06 2.97E+06 3.53E+06 3.69E+06 3.74E+06 3.75E+06 4.57E+06 3.27E+06

2-Isopropylmalate 3.02E+04 4.45E+04 6.37E+04 7.37E+04 5.09E+04 5.24E+04 6.63E+04 3.96E+04 6.06E+04 5.02E+04 5.11E+04

3-Phosphoglycerate 1.04E+04 2.58E+04 7.23E+03 4.55E+04 7.45E+03 6.13E+03 1.48E+04 1.56E+04 2.76E+03 1.36E+04 2.63E+03

3_4-Dihydroxyphenylacetate 1.99E+04 2.86E+04 3.57E+04 2.93E+04 1.58E+05 2.59E+04 2.89E+04 5.42E+04 3.72E+04 5.02E+04 7.70E+04

4-Aminobutyrate 1.51E+06 2.39E+06 1.55E+06 2.90E+06 1.61E+06 2.03E+06 2.13E+06 1.68E+06 2.64E+06 2.02E+06 1.93E+06

5-Hydroxyindoleacetic acid 2.02E+04 1.51E+04 1.76E+04 2.35E+04 3.12E+04 4.23E+04 3.52E+04 1.74E+04 2.25E+04 9.55E+03 3.13E+04

Aconitate 9.25E+06 6.53E+06 6.39E+06 3.92E+06 5.17E+06 6.50E+06 6.43E+06 6.64E+06 6.35E+06 6.99E+06 7.05E+06

Adenine 2.43E+04 3.70E+04 3.01E+04 2.15E+04 2.01E+04 2.29E+04 2.77E+04 3.00E+04 3.72E+04 4.56E+04 3.58E+04

Adenosine 1.32E+05 4.66E+05 1.94E+05 9.63E+04 1.04E+05 8.88E+04 1.92E+05 1.59E+05 1.37E+05 3.45E+05 1.93E+05

Alanine/Sarcosine 1.08E+06 1.14E+06 1.12E+06 8.58E+05 9.79E+05 1.15E+06 1.00E+06 1.18E+06 1.32E+06 1.34E+06 1.19E+06

alpha-Ketoglutarate 4.32E+04 2.71E+04 4.13E+04 1.51E+04 3.36E+04 3.02E+04 4.78E+04 3.47E+04 2.35E+04 3.11E+04 2.27E+04

AMP/dGMP 8.09E+05 3.30E+05 5.27E+05 2.67E+05 5.94E+05 1.25E+06 1.49E+05 1.46E+05 2.85E+05 1.35E+05 1.35E+05

Arginine 5.45E+03 3.78E+03 3.71E+03 2.91E+03 4.95E+03 3.74E+03 4.63E+03 5.63E+03 3.27E+03 4.93E+03 1.06E+04

Ascorbate 4.83E+06 1.81E+05 1.43E+06 2.20E+06 3.61E+06 2.43E+06 4.78E+06 1.55E+06 4.85E+06 1.49E+06 3.61E+06

Asparagine 1.42E+04 3.19E+04 2.95E+04 4.41E+04 2.20E+04 2.75E+04 6.96E+04 4.06E+04 4.53E+04 3.08E+04 3.78E+04

Aspartate 6.65E+06 6.03E+06 5.78E+06 4.71E+06 4.72E+06 6.22E+06 5.66E+06 6.04E+06 6.18E+06 6.60E+06 6.29E+06

cAMP 2.37E+04 3.85E+04 2.02E+04 2.18E+04 3.16E+04 2.80E+04 3.66E+04 2.67E+04 2.57E+04 2.48E+04 3.21E+04

CDP-ethanolamine 2.43E+04 2.77E+04 2.52E+04 2.03E+04 1.66E+04 2.59E+04 2.65E+04 2.38E+04 2.45E+04 2.53E+04 2.64E+04

Citraconate 2.59E+05 2.26E+05 2.34E+05 1.25E+05 1.79E+05 2.12E+05 1.93E+05 1.88E+05 2.22E+05 2.01E+05 2.24E+05

Citrate/isocitrate 5.16E+06 3.04E+06 3.65E+06 1.77E+06 2.51E+06 2.82E+06 3.54E+06 2.53E+06 3.03E+06 3.62E+06 3.29E+06

Creatine 1.37E+06 1.56E+06 1.33E+06 1.03E+06 1.11E+06 1.67E+06 1.25E+06 1.58E+06 1.64E+06 1.85E+06 1.44E+06

Cysteine 1.21E+05 3.97E+04 7.07E+04 4.93E+04 7.11E+04 1.14E+05 7.78E+04 4.48E+04 1.11E+05 1.26E+05 1.11E+05

Cystine 1.00E+02 1.52E+03 1.00E+02 1.00E+02 2.47E+03 3.79E+03 1.00E+02 2.19E+04 1.00E+02 5.20E+03 3.71E+03

D-Gluconate 4.76E+03 8.94E+03 7.23E+03 7.30E+03 8.82E+03 7.64E+03 1.04E+04 9.78E+03 8.25E+03 8.76E+03 1.07E+04

D-Glyceraldehdye 3-phosphate 4.66E+03 5.46E+03 2.27E+03 2.88E+04 9.93E+03 2.58E+04 9.81E+03 2.43E+03 1.12E+04 2.52E+03 2.09E+03

Dopamine 2.01E+03 2.42E+04 5.54E+03 3.78E+03 1.64E+04 2.39E+03 1.21E+04 1.02E+04 8.76E+03 1.21E+04 1.48E+04

Fructose 1_6-bisphosphate 1.00E+02 3.33E+03 2.90E+03 1.30E+04 2.64E+03 4.53E+03 2.55E+03 1.00E+02 4.15E+03 3.38E+03 1.00E+02

123

Table 1.23 Continued

Sample Name M1 M4 M15 M17 M20 M22 M23 M24 M25 M27 M28

Fumarate 7.71E+05 6.69E+05 7.95E+05 7.30E+05 9.17E+05 9.52E+05 1.32E+06 1.20E+06 1.55E+06 1.56E+06 7.15E+05

Glucose 1-phosphate 7.03E+03 1.11E+04 3.58E+03 2.24E+04 1.75E+03 1.96E+04 9.44E+03 5.20E+03 8.92E+03 8.28E+03 2.00E+03

Glutamate 1.19E+07 8.07E+06 8.81E+06 4.21E+06 6.15E+06 7.51E+06 7.67E+06 8.69E+06 6.71E+06 8.59E+06 9.22E+06

Glutamate 6.01E+04 6.57E+04 5.96E+04 4.93E+04 2.42E+05 4.58E+04 7.03E+04 8.45E+04 5.02E+04 3.15E+04 5.95E+04

Glutamine 1.84E+06 2.71E+06 4.00E+06 1.89E+06 2.08E+06 2.27E+06 3.17E+06 2.64E+06 3.37E+06 3.40E+06 2.91E+06

Glutathione 7.50E+05 6.90E+05 7.32E+05 3.92E+05 5.69E+05 5.53E+05 9.18E+05 4.81E+05 1.13E+06 1.07E+06 1.08E+06

Glutathione disulfide 1.63E+05 4.89E+05 3.85E+05 2.98E+05 1.80E+05 3.22E+05 4.61E+05 3.83E+05 3.35E+05 2.99E+05 2.07E+05

Glycerate 3.55E+04 4.74E+04 4.27E+04 4.92E+04 4.54E+04 3.93E+04 4.92E+04 4.68E+04 3.69E+04 6.03E+04 3.35E+04

Glycine 1.33E+05 7.58E+04 4.36E+04 1.10E+05 1.41E+05 1.35E+05 1.32E+05 1.11E+05 6.68E+04 7.12E+04 6.63E+04

GMP 1.44E+05 9.07E+04 1.05E+05 7.67E+04 1.03E+05 1.70E+05 4.97E+04 4.46E+04 1.46E+05 4.37E+04 9.55E+04

Guanosine 5.11E+04 9.02E+04 6.05E+04 7.23E+04 3.68E+04 5.52E+04 9.65E+04 9.81E+04 8.07E+04 1.14E+05 1.08E+05

Histidine 3.45E+03 4.36E+03 5.01E+03 4.67E+03 2.70E+03 2.41E+03 2.88E+03 5.57E+03 7.65E+03 4.71E+03 7.00E+03

Homoserine/Threonine 1.13E+05 1.77E+05 1.26E+05 1.23E+05 1.23E+05 1.07E+05 1.49E+05 1.30E+05 1.60E+05 1.19E+05 1.34E+05

Homovanillic acid 1.04E+05 1.68E+05 1.66E+05 7.67E+04 1.85E+05 1.21E+05 2.29E+05 1.59E+05 1.69E+05 2.09E+05 2.02E+05

Hydroxyisocaproic acid 1.94E+05 1.11E+05 1.87E+05 1.88E+05 1.88E+05 2.65E+05 3.43E+05 1.17E+05 1.99E+05 2.98E+05 1.79E+05

Hypoxanthine 1.31E+06 1.41E+06 9.76E+05 1.18E+06 1.08E+06 1.31E+06 1.43E+06 1.46E+06 1.82E+06 1.49E+06 1.52E+06

IMP 1.68E+05 1.19E+05 1.65E+05 7.42E+04 2.17E+05 4.50E+05 8.42E+04 1.01E+05 2.87E+05 8.06E+04 1.99E+05

Inosine 7.36E+05 7.70E+05 6.50E+05 6.84E+05 7.46E+05 9.31E+05 1.18E+06 1.26E+06 1.24E+06 1.02E+06 1.18E+06

Lactate 4.34E+07 4.33E+07 4.80E+07 3.58E+07 3.71E+07 3.51E+07 4.43E+07 4.85E+07 4.63E+07 4.56E+07 4.59E+07

Leucine/Isoleucine 2.02E+05 1.51E+05 1.15E+05 1.08E+05 1.60E+05 1.13E+05 1.79E+05 2.26E+05 1.81E+05 2.37E+05 1.62E+05

Malate 1.34E+05 1.19E+05 1.46E+05 1.22E+05 1.42E+05 1.24E+05 1.76E+05 1.39E+05 1.52E+05 1.70E+05 1.10E+05

Malate 3.83E+06 4.34E+06 5.54E+06 4.69E+06 3.87E+06 5.27E+06 6.08E+06 4.69E+06 7.02E+06 8.10E+06 3.34E+06

Methionine 6.05E+04 1.11E+05 1.92E+05 1.17E+05 7.56E+04 1.48E+05 1.24E+05 1.30E+05 1.57E+05 1.67E+05 1.59E+05

myo-Inositol 4.10E+05 4.41E+05 4.33E+05 3.11E+05 3.26E+05 2.84E+05 3.80E+05 3.56E+05 3.96E+05 3.91E+05 3.53E+05

N-Acetyl-beta-alanine 7.91E+03 5.06E+03 1.00E+04 7.93E+03 9.32E+03 5.55E+03 1.01E+04 7.10E+03 5.68E+03 6.85E+03 9.28E+03

N-Acetylglutamate 1.55E+06 7.19E+05 6.17E+05 5.80E+05 6.43E+05 7.53E+05 6.14E+05 6.82E+05 7.09E+05 5.07E+05 5.56E+05

N-Acetylglutamine 1.00E+04 1.12E+04 5.88E+03 8.37E+03 8.37E+03 1.04E+04 8.03E+03 1.36E+04 1.92E+04 1.03E+04 9.39E+03

N-Carbamoyl-L-aspartate 5.03E+05 3.24E+05 3.71E+05 4.76E+05 3.93E+05 6.35E+05 6.00E+05 4.99E+05 6.64E+05 2.28E+05 3.77E+05

124

Table 1.23 Continued

Sample Name M1 M4 M15 M17 M20 M22 M23 M24 M25 M27 M28

O-Acetyl-L-serine 1.19E+07 8.07E+06 8.81E+06 4.21E+06 6.15E+06 7.51E+06 7.67E+06 8.69E+06 6.71E+06 8.59E+06 9.22E+06

Pantothenate 3.52E+06 3.89E+06 3.04E+06 3.34E+06 3.50E+06 3.54E+06 4.70E+06 3.99E+06 4.40E+06 3.96E+06 3.22E+06

Phenylalanine 7.21E+04 8.29E+04 6.47E+04 5.96E+04 8.53E+04 6.16E+04 5.92E+04 6.24E+04 9.92E+04 9.40E+04 1.00E+05

Proline 3.42E+04 3.87E+04 2.87E+04 1.95E+04 3.23E+04 3.11E+04 3.48E+04 2.93E+04 2.71E+04 3.65E+04 2.61E+04

Pyroglutamic acid 2.27E+06 2.14E+06 2.10E+06 2.22E+06 3.88E+06 2.27E+06 2.57E+06 2.44E+06 2.57E+06 2.06E+06 2.30E+06

Pyruvate 2.95E+05 9.40E+04 1.17E+05 1.17E+05 2.81E+05 3.65E+04 1.60E+05 3.37E+05 8.81E+04 1.23E+05 6.24E+04

Ribose phosphate 3.84E+04 3.29E+04 1.87E+04 2.66E+04 2.14E+04 5.24E+04 1.60E+04 2.21E+04 2.88E+04 1.31E+04 1.79E+04

Serine 3.71E+05 4.77E+05 3.02E+05 3.29E+05 5.77E+05 3.11E+05 4.78E+05 4.73E+05 3.61E+05 4.30E+05 4.22E+05

Succinate/Methylmalonate 1.56E+06 1.61E+06 1.84E+06 1.06E+06 3.55E+06 1.47E+06 1.93E+06 1.55E+06 1.41E+06 1.84E+06 9.45E+05

Sulfolactate 4.18E+04 4.28E+04 3.59E+04 3.66E+04 1.57E+05 2.52E+04 5.45E+04 3.41E+04 5.58E+04 2.95E+04 1.85E+04

Taurine 1.39E+07 1.62E+07 1.72E+07 1.04E+07 1.16E+07 1.27E+07 1.53E+07 1.55E+07 1.59E+07 1.85E+07 1.51E+07

Trehalose/sucrose 9.32E+04 1.97E+04 5.02E+03 7.00E+03 1.01E+04 3.25E+04 9.52E+03 2.98E+04 6.42E+03 1.97E+04 9.48E+02

Tryptophan 9.30E+03 2.44E+04 1.64E+04 1.00E+04 2.69E+04 1.98E+04 2.57E+04 1.11E+04 2.11E+04 2.73E+04 2.48E+04

Tyrosine 5.45E+04 1.57E+05 6.22E+04 7.73E+04 8.90E+04 6.38E+04 7.22E+04 9.07E+04 9.41E+04 1.41E+05 1.56E+05

UDP-glucose 1.03E+05 9.80E+04 8.40E+04 7.10E+04 1.05E+05 1.31E+05 1.59E+05 1.04E+05 1.58E+05 1.32E+05 1.40E+05

UDP-N-acetylglucosamine 1.02E+05 6.45E+04 6.72E+04 7.02E+04 6.61E+04 7.57E+04 1.17E+05 9.25E+04 9.16E+04 1.21E+05 8.32E+04

UMP 8.13E+04 2.28E+04 4.06E+04 6.89E+03 3.76E+04 5.35E+04 4.69E+03 6.23E+03 2.89E+04 1.34E+04 1.22E+04

Uracil 3.89E+05 3.33E+05 3.83E+05 3.07E+05 2.92E+05 3.95E+05 3.97E+05 4.01E+05 4.31E+05 5.18E+05 3.69E+05

Uric acid 3.43E+04 1.72E+04 1.21E+04 1.09E+04 1.79E+04 1.28E+04 1.30E+04 2.00E+04 1.19E+04 1.73E+04 2.05E+04

Uridine 8.64E+03 9.91E+03 5.80E+03 4.73E+03 4.16E+03 8.17E+03 1.06E+04 7.41E+03 6.58E+03 8.30E+03 8.60E+03

Valine 1.90E+05 2.23E+05 1.59E+05 1.40E+05 2.12E+05 1.42E+05 2.09E+05 2.06E+05 2.10E+05 2.13E+05 1.71E+05

Xanthine 2.14E+05 5.25E+05 5.06E+05 3.64E+05 1.95E+05 2.89E+05 5.25E+05 5.31E+05 3.75E+05 5.50E+05 6.47E+05

Xanthurenic acid 1.16E+04 2.10E+04 2.10E+04 1.65E+04 1.33E+04 2.70E+04 1.80E+04 1.97E+04 3.30E+04 2.57E+04 1.78E+04

125

Table 1.24 Raw Data of Resilient Mice from vmPFC

Sample Name M2 M8 M13 M16 M18 M44 M45 M46 M64 M70

2-Aminoadipate 5.54E+03 1.19E+05 2.06E+04 7.58E+03 4.11E+04 1.41E+04 2.33E+04 6.41E+04 8.33E+04 1.89E+04

2-Hydroxy-2-methylsuccinate 4.79E+06 1.37E+06 3.05E+06 3.55E+06 2.31E+06 4.42E+06 5.63E+06 2.10E+06 1.59E+06 2.86E+06

2-Isopropylmalate 7.47E+04 5.88E+04 5.91E+04 8.57E+04 8.59E+04 6.34E+04 8.49E+04 8.94E+04 8.66E+04 7.42E+04

3_4-Dihydroxyphenylacetate 1.31E+04 1.49E+04 3.90E+03 7.91E+03 2.27E+04 5.96E+03 1.15E+04 8.11E+03

3-Phosphoglycerate 5.37E+04 8.39E+04 1.74E+04 2.86E+04 2.09E+05 3.81E+04 4.38E+04 7.20E+03 4.47E+03 1.31E+05

4-Aminobutyrate 1.88E+06 2.86E+06 1.41E+06 2.29E+06 3.13E+06 1.64E+06 1.37E+06 1.55E+06 2.04E+06 1.54E+06

5-Hydroxyindoleacetic acid 3.59E+04 7.40E+03 1.43E+04 2.50E+04 1.57E+04 1.35E+04 2.24E+04 1.66E+04 2.22E+04 1.07E+04

Aconitate 6.10E+06 4.12E+06 5.21E+06 6.74E+06 7.27E+06 8.06E+06 8.70E+06 6.66E+06 4.85E+06 5.11E+06

Alanine/Sarcosine 1.88E+06 1.31E+06 1.60E+06 1.87E+06 2.05E+06 1.77E+06 1.67E+06 1.58E+06 1.97E+06 1.51E+06

alpha-Ketoglutarate 3.36E+04 7.88E+03 2.40E+04 2.03E+04 3.42E+04 3.91E+04 8.00E+04 2.84E+04 6.12E+03 2.14E+04

AMP/dGMP 8.44E+05 9.08E+04 9.21E+05 6.80E+05 1.23E+05 1.63E+06 1.02E+06 8.72E+05 7.88E+05 5.31E+05

Arginine 1.47E+04 4.72E+03 8.67E+03 1.99E+04 1.36E+04 7.89E+03 1.77E+04 6.51E+03 1.15E+04 1.65E+04

Ascorbate 2.03E+06 1.36E+04 1.26E+06 9.64E+04 2.48E+05 5.89E+03 8.46E+05 6.29E+05 7.42E+05

Asparagine 4.62E+04 5.51E+04 6.25E+04 5.55E+04 8.99E+04 6.12E+04 6.47E+04 4.64E+04 6.17E+04 4.86E+04

Aspartate 9.19E+06 3.68E+06 6.20E+06 7.26E+06 1.99E+06 6.66E+06 1.11E+07 3.42E+06 2.33E+06 6.15E+06

cAMP 1.60E+04 1.60E+04 1.23E+04 3.06E+04 1.57E+04 1.48E+04 2.59E+04 1.17E+04 1.17E+04 1.43E+04

CDP-ethanolamine 2.95E+04 1.05E+04 3.20E+04 2.92E+04 9.45E+03 3.69E+04 4.34E+04 1.56E+04 1.23E+04 2.95E+04

Citraconate 2.28E+05 2.08E+05 2.19E+05 2.51E+05 2.28E+05 2.98E+05 3.48E+05 2.73E+05 2.20E+05 2.33E+05

Citrate/isocitrate 3.75E+06 2.61E+06 2.46E+06 4.87E+06 6.62E+06 6.26E+06 6.84E+06 6.24E+06 2.41E+06 2.68E+06

Creatine 2.18E+06 1.67E+06 1.85E+06 2.08E+06 2.25E+06 2.01E+06 1.80E+06 1.82E+06 2.29E+06 1.81E+06

Cysteine 4.10E+04 3.06E+04 3.50E+03 2.92E+04 2.82E+04 2.72E+04 4.04E+04 2.28E+04 4.16E+04 8.04E+04

Cystine 6.19E+04 5.86E+04 3.24E+04 6.36E+04 1.38E+05 1.70E+04 5.93E+04 8.25E+04 7.77E+04 1.17E+04

D-Gluconate 2.27E+04 2.01E+04 1.87E+04 2.41E+04 2.14E+04 1.24E+04 7.15E+04 1.22E+04 2.18E+04 1.47E+04

Fumarate 1.76E+06 6.00E+05 7.03E+05 9.82E+05 8.45E+05 9.19E+05 1.36E+06 3.70E+05 9.10E+05 6.54E+05

Glucose 6-phosphate 7.24E+03 1.46E+03 1.25E+04 6.14E+03 3.99E+03 2.30E+04 2.64E+04 3.55E+03 8.87E+03 5.51E+04

Glutamate 8.05E+06 2.99E+06 1.10E+07 4.82E+06 2.54E+07 9.41E+06 1.36E+07 5.95E+06 2.31E+07 1.17E+07

Glutamine 2.99E+06 3.62E+06 2.09E+06 3.37E+06 5.52E+06 2.76E+06 2.97E+06 2.86E+06 3.70E+06 3.11E+06

Glutathione 3.10E+05 6.05E+04 9.02E+04 1.64E+05 1.21E+05 1.70E+05 2.30E+05 7.59E+04 1.17E+05 1.72E+05

126

Table 1.24 Continued

Sample Name M2 M8 M13 M16 M18 M44 M45 M46 M64 M70

Glutathione disulfide 4.29E+05 2.71E+05 3.65E+05 5.64E+05 3.75E+05 4.17E+05 4.71E+05 2.24E+05 2.21E+05 2.48E+05

Glycerone phosphate 3.10E+03 1.68E+04 1.72E+04 1.00E+04 3.16E+03 2.40E+04 1.61E+04 2.86E+03 2.51E+04 4.76E+04

Glycine 2.64E+05 9.24E+04 2.82E+05 2.44E+05 1.12E+05 1.10E+05 2.38E+05 2.05E+05 2.85E+05 2.51E+05

GMP 2.20E+05 2.14E+04 2.41E+05 2.20E+05 4.31E+04 2.78E+05 3.13E+05 1.83E+05 2.03E+05 1.51E+05

Guanosine 7.12E+04 8.66E+04 3.72E+04 7.05E+04 7.04E+04 5.14E+04 8.47E+04 2.38E+04 3.51E+04 6.71E+04

Histidine 9.69E+03 1.51E+03 1.06E+04 1.42E+04 7.29E+03 8.49E+03 1.59E+04 4.64E+03 1.15E+04 6.48E+03

Homoserine/Threonine 1.93E+05 2.23E+05 1.28E+05 1.69E+05 1.67E+05 1.20E+05 2.94E+05 1.34E+05 1.43E+05 2.08E+05

Homovanillic acid 2.04E+05 7.13E+04 1.16E+05 1.29E+05 1.30E+05 1.74E+05 2.23E+05 9.75E+04 1.51E+05 1.03E+05

Hypoxanthine 3.45E+06 1.75E+06 2.48E+06 3.17E+06 2.96E+06 2.60E+06 3.27E+06 1.98E+06 2.67E+06 2.72E+06

IMP 2.53E+05 4.71E+04 5.39E+05 4.43E+05 4.68E+04 7.08E+05 7.28E+05 5.46E+05 5.78E+05 2.82E+05

Inosine 2.08E+06 1.54E+06 1.20E+06 1.77E+06 1.88E+06 1.24E+06 1.79E+06 9.37E+05 1.14E+06 1.21E+06

Lactate 1.70E+07 7.10E+06 6.16E+07 1.46E+07 6.10E+06 5.62E+07 1.08E+08 6.99E+06 6.94E+06 5.11E+07

Leucine/Isoleucine 8.02E+05 2.04E+05 5.49E+05 6.45E+05 2.33E+05 3.85E+05 7.86E+05 1.66E+05 2.92E+05 6.03E+05

Malate 9.35E+06 3.06E+06 5.97E+06 5.61E+06 2.54E+06 7.09E+06 1.38E+07 1.38E+06 3.22E+06 4.59E+06

Malate 1.66E+05 1.24E+05 1.46E+05 1.41E+05 9.73E+04 1.48E+05 1.94E+05 8.33E+04 1.36E+05 1.34E+05

Methionine 2.61E+05 2.06E+05 1.69E+05 1.92E+05 3.30E+05 1.72E+05 3.01E+05 1.07E+05 3.31E+05 3.18E+05

myo-Inositol 3.67E+04 1.94E+04 3.81E+05 3.45E+04 1.72E+04 2.84E+05 5.34E+05 1.82E+04 2.67E+04 3.24E+05

N-Acetyl-beta-alanine 5.24E+04 7.58E+03 2.35E+04 1.65E+04 1.58E+04 2.52E+04 3.98E+04 1.17E+04 1.87E+04 4.77E+04

N-Acetylglutamate 1.94E+06 3.99E+05 1.18E+06 1.57E+06 8.02E+05 1.53E+06 1.78E+06 9.32E+05 1.10E+06 9.67E+05

N-Carbamoyl-L-aspartate 5.68E+05 4.87E+05 5.41E+05 4.03E+05 2.77E+05 3.75E+05 3.84E+05 2.93E+05 4.64E+05 2.81E+05

O-Acetyl-L-serine 6.23E+02 2.99E+06 5.92E+02 6.04E+02 2.54E+07 6.02E+02 9.65E+02 5.95E+06 2.31E+07 4.58E+02

Pantothenate 2.73E+06 3.54E+06 2.03E+06 2.66E+06 3.37E+06 2.37E+06 2.94E+06 2.15E+06 2.37E+06 2.21E+06

Phenylalanine 7.99E+04 7.84E+04 1.39E+05 8.09E+04 1.34E+05 1.33E+05 1.67E+05 8.59E+04 1.16E+05 1.15E+05

Phosphoenolpyruvate 4.22E+04 3.04E+04 2.42E+04 2.85E+04 5.29E+04 6.31E+04 5.44E+04 3.94E+04 3.64E+04 9.07E+04

Proline 7.64E+04 4.22E+04 5.97E+04 8.41E+04 5.86E+04 6.52E+04 9.67E+04 4.82E+04 9.10E+04 6.20E+04

Pyroglutamic acid 2.97E+06 2.32E+06 3.76E+06 3.23E+06 2.14E+06 4.14E+06 1.22E+07 1.66E+06 1.71E+06 3.95E+06

Pyruvate 1.40E+05 1.48E+05 1.66E+05 1.69E+05 1.94E+05 1.17E+05 2.44E+06 5.55E+04 1.51E+05 8.97E+04

Ribose phosphate 1.41E+05 1.03E+05 8.11E+04 1.08E+05 1.22E+05 1.56E+05 1.47E+05 5.55E+04 6.26E+04 1.81E+05

127

Table 1.24 Continued

Sample Name M2 M8 M13 M16 M18 M44 M45 M46 M64 M70

Serine 9.34E+05 7.55E+05 9.67E+05 9.96E+05 1.11E+06 7.60E+05 2.14E+06 9.64E+05 9.57E+05 7.63E+05

Succinate 1.33E+06 2.59E+05 1.44E+06 8.07E+05 2.46E+05 1.53E+06 3.74E+06 2.96E+05 3.51E+05 7.69E+05

Taurine 2.31E+07 1.95E+07 1.89E+07 2.29E+07 2.15E+07 2.03E+07 2.07E+07 1.73E+07 2.10E+07 2.02E+07

Trehalose/sucrose 5.76E+03 6.79E+03 1.16E+04 1.58E+04 4.70E+03 1.36E+04 1.06E+05 1.06E+04 1.06E+04 6.67E+03

Tryptophan 4.03E+04 2.00E+04 2.97E+04 3.28E+04 2.95E+04 3.17E+04 4.79E+04 2.73E+04 3.41E+04 2.79E+04

Tyrosine 1.49E+05 6.69E+04 1.27E+05 1.16E+05 1.11E+05 1.02E+05 2.49E+05 6.05E+04 1.29E+05 1.74E+05

UDP-glucose 1.13E+05 6.49E+04 1.13E+05 1.38E+05 1.33E+05 1.34E+05 1.37E+05 7.71E+04 9.84E+04 1.08E+05

UDP-N-acetylglucosamine 8.02E+04 3.77E+04 6.23E+04 7.85E+04 7.04E+04 9.46E+04 6.73E+04 5.48E+04 6.64E+04 4.17E+04

UMP 9.61E+04 7.89E+03 1.08E+05 9.78E+04 4.99E+03 1.62E+05 1.40E+05 9.02E+04 9.50E+04 7.79E+04

Uracil 8.05E+05 6.83E+05 5.16E+05 6.77E+05 8.85E+05 7.64E+05 8.33E+05 8.02E+05 7.93E+05 5.40E+05

Uric acid 1.63E+04 1.44E+04 4.45E+04 1.54E+04 2.82E+04 2.14E+04 8.95E+04 1.13E+04 3.86E+04 1.96E+04

Uridine 4.14E+05 2.91E+05 2.79E+05 3.71E+05 3.49E+05 1.78E+05 4.34E+05 2.58E+05 2.07E+05 2.05E+05

Valine 3.46E+05 2.32E+05 3.06E+05 3.01E+05 3.25E+05 2.85E+05 5.21E+05 2.51E+05 3.43E+05 2.86E+05

Xanthine 5.41E+05 8.61E+05 3.66E+05 4.90E+05 8.97E+05 3.84E+05 5.70E+05 2.18E+05 4.09E+05 5.79E+05

128

Table 1.25 Raw Data of Control Mice from vmPFC

Sample Name M3 M5 M10 M12 M14 M19 M26 M30 M32 M40

2-Aminoadipate 1.50E+05 7.66E+04 2.83E+04 1.95E+04 5.57E+04 1.54E+04 1.35E+04 1.82E+04 3.20E+04 9.04E+03

2-Hydroxy-2-methylsuccinate 2.12E+06 8.79E+05 3.72E+06 2.06E+06 1.60E+06 2.89E+06 1.35E+06 2.92E+06 2.27E+06 3.80E+06

2-Isopropylmalate 5.00E+04 5.21E+04 3.93E+04 5.30E+04 6.79E+04 4.56E+04 6.10E+04 5.67E+04 2.74E+04 6.69E+04

3_4-Dihydroxyphenylacetate 2.12E+04 9.44E+03 5.05E+03 8.55E+03 1.51E+04 4.30E+04 1.86E+04 9.96E+04

3-Phosphoglycerate 4.36E+04 5.59E+04 4.41E+04 5.73E+04 7.45E+04 1.30E+05 1.39E+04 1.67E+05 1.68E+04 2.88E+05

4-Aminobutyrate 2.61E+06 1.71E+06 3.53E+06 1.52E+06 2.13E+06 2.15E+06 1.45E+06 3.30E+06 2.59E+06 1.77E+06

5-Hydroxyindoleacetic acid 1.44E+04 9.87E+03 5.73E+04 8.51E+03 1.18E+04 3.02E+04 1.13E+04 1.09E+04 3.23E+04 9.83E+03

Aconitate 7.61E+06 4.83E+06 6.73E+06 7.02E+06 6.01E+06 8.58E+06 4.85E+06 8.28E+06 5.80E+06 1.09E+07

Alanine/Sarcosine 1.79E+06 1.34E+06 1.91E+06 1.36E+06 1.57E+06 1.64E+06 1.26E+06 1.70E+06 1.35E+06 1.55E+06

alpha-Ketoglutarate 2.02E+04 1.35E+04 2.59E+04 3.30E+04 9.58E+03 1.73E+04 2.10E+04 1.69E+04 1.50E+04 1.82E+04

AMP/dGMP 1.80E+05 1.34E+05 7.54E+05 1.68E+05 1.91E+05 1.01E+05 7.81E+05 1.00E+05 3.41E+05 5.51E+04

Arginine 1.23E+04 3.33E+03 1.47E+04 9.45E+03 9.19E+03 2.05E+04 6.29E+03 7.08E+03 1.24E+04 1.32E+04

Ascorbate 1.17E+06 5.33E+04 6.08E+04 1.35E+05 2.70E+05 2.80E+05 4.36E+03 4.26E+04 1.02E+05

Asparagine 6.38E+04 4.07E+04 7.57E+04 1.16E+05 4.77E+04 6.29E+04 3.62E+04 6.32E+04 5.32E+04 5.76E+04

Aspartate 3.53E+06 2.00E+06 9.92E+06 6.08E+06 1.33E+06 6.74E+06 4.83E+06 6.22E+06 5.62E+06 7.81E+06

cAMP 1.67E+04 6.64E+03 1.15E+04 5.25E+03 1.23E+04 2.13E+04 1.39E+04 2.50E+04 1.33E+04 1.35E+04

CDP-ethanolamine 1.80E+04 1.33E+04 3.64E+04 2.72E+04 1.01E+04 2.25E+04 1.99E+04 2.77E+04 2.18E+04 3.48E+04

Citraconate 3.09E+05 1.82E+05 2.56E+05 3.00E+05 2.23E+05 3.16E+05 2.00E+05 3.04E+05 2.39E+05 4.24E+05

Citrate/isocitrate 4.63E+06 2.66E+06 2.72E+06 3.60E+06 3.23E+06 7.54E+06 2.60E+06 6.28E+06 3.35E+06 9.35E+06

Creatine 2.08E+06 1.59E+06 2.15E+06 1.59E+06 1.85E+06 2.11E+06 1.49E+06 1.86E+06 1.58E+06 2.00E+06

Cysteine 2.10E+04 2.52E+04 1.85E+04 1.32E+03 3.39E+04 3.62E+04 2.70E+04 4.54E+04 3.16E+04 5.41E+04

Cystine 8.45E+04 4.78E+04 1.40E+05 7.96E+04 5.77E+04 8.76E+04 2.92E+04 9.49E+04 5.35E+04 9.33E+04

D-Gluconate 2.74E+04 1.53E+04 1.91E+04 2.17E+04 2.14E+04 3.73E+04 1.20E+04 2.28E+04 8.71E+03 1.05E+04

Fumarate 4.56E+05 1.84E+05 9.40E+05 3.55E+05 3.70E+05 2.38E+05 2.64E+05 9.05E+05 6.78E+05 1.95E+05

Glucose 6-phosphate 1.89E+03 2.21E+03 2.93E+04 5.32E+03 4.56E+03 2.30E+03 5.17E+03 2.87E+03 1.10E+04 4.88E+03

Glutamate 7.26E+06 3.92E+06 7.26E+06 9.10E+06 1.44E+07 4.13E+06 4.30E+06 3.22E+06 5.29E+06 1.03E+07

Glutamine 3.88E+06 3.01E+06 4.39E+06 4.56E+06 3.08E+06 2.93E+06 2.11E+06 3.20E+06 3.28E+06 5.14E+06

Glutathione 1.47E+05 4.98E+04 1.67E+04 2.90E+04 5.61E+04 1.07E+05 8.10E+04 1.25E+05 6.91E+04 1.05E+05

129

Table 1.25 Continued

Sample Name M3 M5 M10 M12 M14 M19 M26 M30 M32 M40

Glutathione disulfide 3.68E+05 2.83E+05 2.85E+05 2.87E+05 2.90E+05 2.76E+05 3.34E+05 3.73E+05 2.37E+05 2.69E+05

Glycerone phosphate 4.94E+03 3.28E+03 6.02E+04 4.45E+03 4.63E+03 1.63E+03 7.23E+03 1.11E+04 3.56E+04 2.87E+03

Glycine 4.01E+05 1.37E+05 1.48E+05 9.68E+04 1.76E+05 2.59E+05 2.29E+05 4.92E+04 1.14E+05 8.40E+04

GMP 4.11E+04 5.21E+04 2.16E+05 6.60E+04 6.15E+04 3.70E+04 1.96E+05 2.42E+04 1.27E+05 1.03E+04

Guanosine 1.74E+05 5.58E+04 9.81E+04 1.57E+05 9.05E+04 1.49E+05 4.15E+04 1.22E+05 6.43E+04 2.13E+05

Histidine 9.79E+03 6.98E+03 8.32E+03 7.70E+03 7.44E+03 4.83E+03 3.74E+03 2.31E+03 1.20E+04 1.07E+04

Homoserine/Threonine 2.18E+05 1.87E+05 2.24E+05 1.39E+05 1.60E+05 2.07E+05 1.51E+05 2.18E+05 1.69E+05 1.56E+05

Homovanillic acid 8.07E+04 5.93E+04 1.07E+05 1.00E+05 5.43E+04 1.11E+05 7.28E+04 9.70E+04 6.29E+04 1.14E+05

Hypoxanthine 2.97E+06 1.86E+06 3.69E+06 2.28E+06 2.61E+06 2.82E+06 1.92E+06 3.04E+06 2.41E+06 3.46E+06

IMP 1.12E+05 8.94E+04 4.89E+05 1.01E+05 8.75E+04 3.96E+04 3.34E+05 3.61E+04 3.43E+05 1.21E+04

Inosine 2.14E+06 1.18E+06 1.50E+06 1.33E+06 1.55E+06 1.72E+06 1.03E+06 2.10E+06 1.13E+06 2.25E+06

Lactate 7.77E+06 6.05E+06 5.80E+07 5.08E+07 5.73E+06 9.15E+06 7.07E+06 1.13E+07 5.51E+07 5.14E+07

Leucine/Isoleucine 1.61E+05 1.23E+05 6.43E+05 3.91E+05 1.57E+05 2.66E+05 1.50E+05 5.24E+05 3.59E+05 3.30E+05

Malate 2.31E+06 6.26E+05 7.48E+06 1.81E+06 1.82E+06 8.28E+05 1.30E+06 4.37E+06 3.91E+06 8.26E+05

Malate 1.19E+05 1.18E+05 1.67E+05 1.23E+05 1.33E+05 9.55E+04 1.07E+05 1.51E+05 1.64E+05 8.04E+04

Methionine 1.77E+05 1.06E+05 2.58E+05 1.71E+05 2.13E+05 1.31E+05 1.76E+05 2.58E+05 1.60E+05 2.25E+05

myo-Inositol 2.63E+04 1.51E+04 3.78E+05 3.41E+05 1.23E+04 1.94E+04 1.69E+04 2.64E+04 3.29E+05 3.55E+05

N-Acetyl-beta-alanine 1.40E+04 8.08E+03 4.65E+04 3.03E+04 1.05E+04 1.58E+04 1.10E+04 2.33E+04 2.60E+04 3.85E+04

N-Acetylglutamate 4.82E+05 3.49E+05 1.07E+06 6.09E+05 5.35E+05 8.12E+05 8.38E+05 6.91E+05 6.58E+05 5.01E+05

N-Carbamoyl-L-aspartate 4.67E+05 3.55E+05 2.02E+05 3.68E+05 2.77E+05 2.67E+05 4.60E+05 6.68E+05 4.76E+05 4.95E+05

O-Acetyl-L-serine 7.26E+06 3.92E+06 4.95E+02 4.68E+02 1.44E+07 6.29E+02 5.97E+02 5.97E+02 4.50E+02 5.13E+02

Pantothenate 2.95E+06 2.50E+06 3.92E+06 2.06E+06 3.12E+06 2.65E+06 2.05E+06 3.99E+06 3.26E+06 2.88E+06

Phenylalanine 1.05E+05 6.81E+04 1.34E+05 1.16E+05 9.98E+04 7.97E+04 6.02E+04 6.82E+04 7.72E+04 1.37E+05

Phosphoenolpyruvate 3.83E+04 3.83E+04 4.35E+04 3.76E+04 2.72E+04 4.41E+04 3.01E+04 5.99E+04 3.59E+04 1.17E+05

Proline 4.81E+04 4.70E+04 4.46E+04 6.63E+04 5.43E+04 6.89E+04 4.50E+04 4.77E+04 4.26E+04 5.36E+04

Pyroglutamic acid 2.29E+06 1.77E+06 9.37E+06 5.68E+06 1.74E+06 3.20E+06 1.72E+06 3.89E+06 4.08E+06 5.84E+06

Pyruvate 1.80E+05 1.64E+05 1.93E+05 4.97E+05 1.15E+05 1.64E+05 6.38E+04 2.09E+05 6.89E+04 8.94E+04

Ribose phosphate 1.28E+05 1.12E+05 1.80E+05 1.35E+05 1.45E+05 1.42E+05 7.97E+04 1.98E+05 9.64E+04 3.98E+05

130

Table 1.25 Continued

Sample Name M3 M5 M10 M12 M14 M19 M26 M30 M32 M40

Serine 9.59E+05 6.53E+05 5.32E+05 1.29E+06 8.24E+05 7.56E+05 6.99E+05 8.82E+05 6.44E+05 7.29E+05

Succinate 3.59E+05 2.02E+05 1.07E+06 1.21E+06 1.83E+05 3.50E+05 4.15E+05 3.42E+05 5.01E+05 7.66E+05

Taurine 2.22E+07 1.69E+07 1.80E+07 1.56E+07 1.92E+07 1.88E+07 1.64E+07 1.97E+07 1.46E+07 1.82E+07

Trehalose/sucrose 1.14E+06 7.79E+03 2.65E+04 2.28E+04 6.83E+03 5.11E+03 6.78E+03 5.55E+03 4.24E+03 3.33E+03

Tryptophan 2.93E+04 1.75E+04 3.29E+04 1.72E+04 2.20E+04 3.77E+04 1.38E+04 3.74E+04 2.81E+04 3.92E+04

Tyrosine 7.59E+04 6.12E+04 1.64E+05 1.15E+05 8.97E+04 7.63E+04 9.09E+04 1.20E+05 1.05E+05 9.63E+04

UDP-glucose 9.10E+04 7.66E+04 9.76E+04 6.49E+04 9.29E+04 7.08E+04 6.79E+04 1.25E+05 8.20E+04 9.61E+04

UDP-N-acetylglucosamine 5.12E+04 2.94E+04 5.46E+04 5.44E+04 4.64E+04 4.19E+04 4.40E+04 6.51E+04 3.27E+04 4.26E+04

UMP 2.55E+04 6.48E+03 8.60E+04 1.33E+04 1.58E+04 6.24E+03 7.92E+04 1.23E+04 3.97E+04 4.97E+03

Uracil 8.86E+05 4.97E+05 8.94E+05 4.25E+05 6.25E+05 7.37E+05 4.26E+05 9.17E+05 6.14E+05 9.35E+05

Uric acid 2.49E+04 1.76E+04 3.08E+04 4.04E+04 1.78E+04 1.44E+04 1.25E+04 9.35E+03 1.20E+04 2.27E+04

Uridine 2.47E+05 1.62E+05 1.28E+05 2.30E+05 2.75E+05 3.89E+05 1.51E+05 2.53E+05 8.54E+04 2.81E+05

Valine 2.09E+05 1.89E+05 3.11E+05 2.89E+05 2.63E+05 2.42E+05 1.80E+05 2.55E+05 2.30E+05 2.71E+05

Xanthine 5.46E+05 5.20E+05 6.60E+05 5.37E+05 5.61E+05 7.31E+05 1.79E+05 8.33E+05 3.44E+05 1.04E+06

131

Table 1.26 Raw Data of Susceptible Mice from vmPFC

Sample Name M1 M4 M15 M17 M20 M22 M23 M24 M25 M27 M28

2-Aminoadipate 1.54E+04 2.14E+04 4.35E+04 1.58E+04 2.59E+04 4.57E+04 4.65E+04 2.82E+04 4.82E+04 1.59E+05 9.01E+03

2-Hydroxy-2-methylsuccinate 3.81E+06 3.92E+06 1.10E+06 7.28E+05 3.37E+06 4.13E+06 4.86E+06 3.37E+06 1.00E+06 2.50E+06 3.40E+06

2-Isopropylmalate 7.25E+04 7.25E+04 7.45E+04 4.87E+04 8.60E+04 6.65E+04 1.00E+05 1.03E+05 5.40E+04 4.88E+04 7.51E+04

3_4-Dihydroxyphenylacetate 3.35E+04 1.69E+04 1.48E+04 1.57E+04 7.49E+03 1.56E+04 1.43E+04 3.53E+04 1.85E+04 6.10E+03 4.90E+03

3-Phosphoglycerate 1.58E+05 7.47E+05 3.89E+04 8.96E+04 1.75E+04 2.44E+05 3.22E+04 1.42E+05 1.38E+05 4.24E+05 2.17E+04

4-Aminobutyrate 3.30E+06 2.86E+06 2.11E+06 1.16E+06 1.71E+06 3.12E+06 2.36E+06 1.85E+06 1.86E+06 3.44E+06 1.67E+06

5-Hydroxyindoleacetic acid 3.15E+04 1.26E+04 1.34E+04 2.97E+03 2.66E+04 3.46E+04 3.00E+04 3.05E+04 1.39E+04 4.79E+04 1.92E+04

Aconitate 1.04E+07 9.23E+06 3.85E+06 3.78E+06 7.45E+06 7.89E+06 9.07E+06 9.69E+06 5.84E+06 7.82E+06 7.02E+06

Alanine/Sarcosine 2.16E+06 1.72E+06 1.39E+06 1.20E+06 1.82E+06 1.91E+06 1.91E+06 1.51E+06 1.40E+06 1.68E+06 1.48E+06

alpha-Ketoglutarate 3.16E+04 4.05E+04 1.18E+04 1.79E+04 1.94E+04 1.98E+04 2.87E+04 1.58E+04 9.89E+03 3.44E+04 2.40E+04

AMP/dGMP 2.05E+05 1.48E+05 1.95E+05 9.02E+04 9.59E+05 6.73E+04 2.79E+05 3.04E+05 8.26E+04 1.22E+05 8.56E+05

Arginine 1.25E+04 1.35E+04 3.65E+03 6.33E+03 1.20E+04 9.90E+03 7.86E+03 1.78E+04 6.78E+03 1.20E+04 3.52E+03

Ascorbate 2.33E+06 7.09E+05 1.89E+04 1.94E+05 6.77E+04 3.12E+05 2.38E+05 2.42E+05 2.02E+05 1.59E+06

Asparagine 1.05E+05 5.02E+04 4.91E+04 3.57E+04 5.30E+04 6.04E+04 7.60E+04 2.39E+04 5.91E+04 7.27E+04 4.16E+04

Aspartate 1.09E+07 8.55E+06 2.77E+06 1.09E+06 7.16E+06 7.53E+06 8.26E+06 6.87E+06 1.59E+06 3.05E+06 6.00E+06

cAMP 1.94E+04 2.08E+04 2.90E+03 3.05E+03 2.35E+04 2.45E+04 1.76E+04 1.45E+04 6.99E+03 1.60E+04 5.18E+03

CDP-ethanolamine 3.90E+04 3.04E+04 9.44E+03 4.23E+03 3.39E+04 3.48E+04 3.06E+04 2.72E+04 1.03E+04 1.24E+04 2.77E+04

Citraconate 4.34E+05 3.92E+05 1.68E+05 1.72E+05 2.79E+05 3.71E+05 3.63E+05 4.01E+05 2.52E+05 3.06E+05 2.73E+05

Citrate/isocitrate 7.22E+06 8.22E+06 1.91E+06 2.08E+06 4.40E+06 6.48E+06 7.64E+06 6.51E+06 3.64E+06 6.82E+06 5.28E+06

Creatine 2.72E+06 1.84E+06 1.68E+06 1.53E+06 2.14E+06 2.18E+06 2.24E+06 1.77E+06 1.63E+06 1.96E+06 1.45E+06

Cysteine 3.99E+04 3.87E+04 2.13E+04 1.57E+04 9.40E+03 3.44E+04 4.82E+04 4.45E+04 2.25E+04 3.21E+04 5.14E+04

Cystine 1.28E+05 8.81E+04 5.59E+04 3.99E+04 5.18E+04 5.99E+04 3.34E+04 2.64E+04 6.83E+04 9.60E+04 5.07E+04

D-Gluconate 2.95E+04 4.21E+04 1.50E+04 1.12E+04 1.47E+04 1.69E+04 1.52E+04 5.48E+03 2.08E+04 3.11E+04 1.03E+04

Fumarate 7.10E+05 6.77E+05 2.69E+05 1.56E+05 8.62E+05 1.47E+06 1.25E+06 2.82E+05 3.57E+05 1.17E+06 6.47E+05

Glucose 6-phosphate 6.67E+03 6.31E+03 2.21E+03 1.87E+03 1.96E+04 7.75E+03 7.06E+03 4.74E+03 3.50E+03 5.77E+03 4.41E+03

Glutamate 5.41E+06 3.68E+06 3.09E+06 2.30E+07 1.13E+07 8.52E+06 1.32E+07 1.18E+07 8.69E+06 8.40E+06 9.08E+06

Glutamine 4.08E+06 3.15E+06 3.37E+06 2.62E+06 2.95E+06 3.36E+06 3.66E+06 3.73E+06 3.42E+06 3.93E+06 2.85E+06

Glutathione 2.43E+05 1.73E+05 4.27E+04 3.61E+04 7.66E+04 1.19E+05 1.89E+05 1.45E+05 7.07E+04 1.30E+05 2.82E+05

132

Table 1.26 Continued

Sample Name M1 M4 M15 M17 M20 M22 M23 M24 M25 M27 M28

Glutathione disulfide 5.46E+05 6.47E+05 1.93E+05 2.06E+05 2.72E+05 4.21E+05 4.62E+05 3.25E+05 3.39E+05 3.75E+05 3.58E+05

Glycerone phosphate 6.06E+03 9.83E+03 5.86E+03 2.12E+03 1.85E+04 2.22E+04 2.78E+03 2.18E+04 2.19E+04 3.50E+04 1.19E+04

Glycine 3.50E+05 1.13E+05 2.15E+05 1.29E+05 1.48E+05 1.62E+05 3.08E+05 7.02E+04 3.84E+05 8.47E+04 6.63E+04

GMP 7.31E+04 3.33E+04 7.44E+04 2.36E+04 2.30E+05 1.59E+04 1.24E+05 7.99E+04 2.79E+04 2.91E+04 2.34E+05

Guanosine 1.66E+05 1.16E+05 6.22E+04 5.63E+04 4.94E+04 1.47E+05 1.97E+05 1.31E+05 5.73E+04 9.73E+04 2.42E+04

Histidine 3.39E+03 8.38E+03 7.87E+03 4.56E+03 5.28E+03 9.78E+03 9.52E+03 9.79E+03 3.65E+03 8.76E+03 9.57E+03

Homoserine/Threonine 2.97E+05 2.27E+05 1.54E+05 1.32E+05 1.56E+05 1.41E+05 2.10E+05 1.45E+05 1.63E+05 1.64E+05 1.73E+05

Homovanillic acid 9.08E+04 1.75E+05 7.72E+04 6.88E+04 1.47E+05 1.78E+05 1.47E+05 1.09E+05 7.84E+04 1.26E+05 1.40E+05

Hypoxanthine 4.26E+06 3.26E+06 1.48E+06 1.41E+06 3.18E+06 5.00E+06 3.69E+06 3.16E+06 2.12E+06 3.65E+06 2.59E+06

IMP 9.98E+04 3.64E+04 1.35E+05 7.84E+04 3.91E+05 2.76E+04 1.73E+05 1.47E+05 2.65E+04 2.83E+04 5.71E+05

Inosine 2.81E+06 2.61E+06 1.20E+06 1.02E+06 1.51E+06 2.36E+06 2.96E+06 1.57E+06 1.44E+06 1.90E+06 1.28E+06

Lactate 1.36E+07 1.34E+07 6.96E+06 4.21E+06 5.85E+07 5.23E+07 5.84E+07 4.90E+07 5.13E+06 7.61E+06 2.25E+07

Leucine/Isoleucine 5.68E+05 5.69E+05 1.42E+05 1.05E+05 3.80E+05 4.02E+05 5.13E+05 3.19E+05 1.41E+05 2.01E+05 4.20E+05

Malate 4.34E+06 5.50E+06 1.21E+06 4.52E+05 5.96E+06 8.38E+06 7.04E+06 2.46E+06 9.99E+05 6.82E+06 4.57E+06

Malate 1.79E+05 1.52E+05 9.56E+04 8.53E+04 1.42E+05 2.01E+05 1.53E+05 1.06E+05 1.13E+05 1.68E+05 1.60E+05

Methionine 3.30E+05 2.61E+05 1.73E+05 2.26E+05 1.86E+05 2.81E+05 2.54E+05 1.71E+05 1.40E+05 3.43E+05 2.47E+05

myo-Inositol 2.27E+04 3.07E+04 1.76E+04 7.80E+03 3.81E+05 2.92E+05 3.79E+05 2.85E+05 1.29E+04 2.33E+04 3.17E+04

N-Acetyl-beta-alanine 3.93E+04 3.93E+04 9.28E+03 8.61E+03 2.07E+04 1.93E+04 2.41E+04 1.25E+04 1.43E+04 2.29E+04 1.70E+04

N-Acetylglutamate 1.50E+06 7.98E+05 2.91E+05 1.83E+05 1.40E+06 9.80E+05 2.01E+06 7.69E+05 3.20E+05 6.62E+05 1.60E+06

N-Carbamoyl-L-aspartate 3.60E+05 3.92E+05 2.53E+05 1.66E+05 4.47E+05 4.52E+05 4.32E+05 2.88E+05 2.09E+05 6.22E+05 3.85E+05

O-Acetyl-L-serine 6.34E+02 3.09E+06 2.30E+07 5.57E+02 4.33E+02 4.10E+02 3.73E+02 8.69E+06 8.40E+06 4.72E+02

Pantothenate 3.45E+06 3.44E+06 2.38E+06 2.34E+06 3.01E+06 3.78E+06 3.30E+06 2.87E+06 2.60E+06 3.82E+06 2.42E+06

Phenylalanine 1.28E+05 1.98E+05 9.37E+04 6.31E+04 9.53E+04 1.46E+05 1.43E+05 1.14E+05 8.73E+04 1.47E+05 6.37E+04

Phosphoenolpyruvate 6.49E+04 2.75E+05 4.24E+04 3.28E+04 3.07E+04 7.40E+04 6.18E+04 6.15E+04 7.51E+04 1.93E+05 2.56E+04

Proline 6.79E+04 5.51E+04 4.15E+04 3.17E+04 6.54E+04 6.25E+04 6.12E+04 4.63E+04 3.70E+04 6.35E+04 5.29E+04

Pyroglutamic acid 4.04E+06 5.02E+06 1.87E+06 1.03E+06 4.12E+06 6.53E+06 4.39E+06 3.63E+06 1.65E+06 3.05E+06 3.12E+06

Pyruvate 2.37E+05 1.41E+06 8.54E+04 6.25E+04 1.21E+05 2.34E+05 1.43E+05 5.86E+04 1.57E+05 5.77E+05 1.10E+05

Ribose phosphate 3.58E+05 3.25E+05 9.98E+04 8.13E+04 1.19E+05 2.55E+05 1.85E+05 2.62E+05 2.48E+05 1.40E+05 8.95E+04

133

Table 1.26 Continued

Sample Name M1 M4 M15 M17 M20 M22 M23 M24 M25 M27 M28

Ribose phosphate 3.58E+05 3.25E+05 9.98E+04 8.13E+04 1.19E+05 2.55E+05 1.85E+05 2.62E+05 2.48E+05 1.40E+05 8.95E+04

Serine 1.24E+06 1.17E+06 7.00E+05 6.67E+05 9.28E+05 6.33E+05 9.52E+05 5.29E+05 8.90E+05 1.00E+06 6.59E+05

Succinate 3.86E+05 8.15E+05 3.61E+05 1.79E+05 1.09E+06 1.22E+06 1.60E+06 8.53E+05 2.38E+05 3.63E+05 1.68E+06

Taurine 2.74E+07 2.24E+07 1.66E+07 1.69E+07 2.01E+07 2.11E+07 2.31E+07 1.75E+07 1.70E+07 1.94E+07 1.86E+07

Trehalose/sucrose 1.23E+04 4.12E+04 1.21E+04 8.68E+03 6.61E+03 6.73E+03 4.53E+03 4.13E+03 1.91E+04 5.37E+04 5.18E+03

Tryptophan 3.15E+04 3.51E+04 1.31E+04 1.46E+04 2.25E+04 4.58E+04 2.91E+04 2.61E+04 1.68E+04 3.20E+04 4.30E+04

Tyrosine 1.37E+05 1.32E+05 7.82E+04 7.44E+04 1.12E+05 2.82E+05 8.92E+04 9.59E+04 6.12E+04 1.37E+05 1.02E+05

UDP-glucose 1.52E+05 1.55E+05 6.19E+04 6.93E+04 1.40E+05 9.15E+04 1.70E+05 9.92E+04 8.44E+04 1.40E+05 1.03E+05

UDP-N-acetylglucosamine 7.73E+04 9.48E+04 3.71E+04 4.40E+04 6.36E+04 5.47E+04 8.13E+04 4.44E+04 4.02E+04 8.21E+04 7.32E+04

UMP 2.69E+04 1.54E+04 1.65E+04 8.43E+03 1.12E+05 7.33E+03 6.04E+04 5.78E+04 1.13E+04 2.16E+04 1.19E+05

Uracil 9.50E+05 9.02E+05 4.84E+05 4.94E+05 6.40E+05 8.73E+05 7.17E+05 6.26E+05 5.95E+05 1.02E+06 6.19E+05

Uric acid 1.08E+04 3.11E+04 1.46E+04 2.21E+04 2.17E+04 2.31E+04 1.99E+04 2.81E+04 1.98E+04 4.20E+04 1.16E+04

Uridine 6.54E+05 4.11E+05 1.66E+05 2.30E+05 1.78E+05 4.43E+05 3.83E+05 2.34E+05 2.43E+05 3.76E+05 2.34E+05

Valine 3.59E+05 5.12E+05 1.77E+05 1.63E+05 2.57E+05 3.13E+05 3.66E+05 2.44E+05 1.73E+05 3.25E+05 2.85E+05

Xanthine 1.06E+06 1.51E+06 3.73E+05 4.48E+05 4.93E+05 1.08E+06 1.20E+06 7.27E+05 6.19E+05 9.02E+05 2.00E+05

134

CHAPTER 2: NEUROMETABOLOMICS OF ACUTE SLEEP

DEPRIVATION THROUGH TEMPORAL ANALYSIS OF B6 MICE

135

PREFACE

Upon arriving to the University of Tennessee, Knoxville, I had the pleasure of

collaborating with Drs. Ralph Lydic and Helen Baghdoyan. These two neuroscientists are

highly-recognized researchers within the field of sleep regulation and function. A primary

goal of their research was to gain a higher-level understanding of how neurochemicals

fluctuate during various states of consciousness, which was accomplished by combing

the well-established sampling technique of microdialysis with the versatility of LC-HRMS

untargeted metabolomics.

While quantitative and qualitative analysis of neurotransmitters has been studied

for decades, analytical limitations had prevented a holistic approach. Using HPLC-UV/Vis

or electrochemical detection (e.g. voltammetry), researchers were able to analyze one,

or two, neurotransmitters simultaneously from a single sample. Although the information

gained from these studies are integral to the understanding of neurochemistry, the

dynamic changes observed from the entire metabolome would provide a snapshot of how

neurons are chemically changing for communication across the interstitial space.

Microdialysis is a proficient sampling technique used by neuroscientists to obtain

information about temporal neurochemical changes. Through minimally invasive surgery,

a small probe can be strategically implanted into a specific region of the brain. Following

probe conditioning, dialysate is collected in small fractions that contain neurochemicals

from the extracellular space. The result of this analysis can provide valuable information

about the release and reuptake of specific neurotransmitters, and other small molecules

that are used for the regulation of neuronal synapses. This sampling technique was the

perfect tool for analyzing states of consciousness, as a single subject can be analyzed

across time to determine how neurochemicals change during natural states of sleep and

wake, through perturbed states, such as sleep deprivation or under the effects of

anesthesia.

Samples were collected with assistance from Dr. Chiara Cirelli et al., University of

Wisconsin, simultaneously from the prefrontal cortex and motor cortex of B6 mice at 15-

minute intervals. Experimental conditions included mice during natural sleep followed by

136

enforced wakefulness (S6-W3; N = 7), natural wake followed by enforced wakefulness

(W6-W3; N = 6), and sleep deprivation followed by natural sleep (SD6-S3; N = 6).

Untreated dialysate were diluted to 50 µL to provide repeat injections. Our untargeted

metabolomics method, using LC-HRMS, analyzed over 1,200 samples across 14 days.

Following peak identification with MAVEN software, raw ion intensity data was normalized

with assistance from Dr. William Marshall, University of Wisconsin.

This research provided insight about the current state of analytical technology and

advanced the field of sleep regulation and consciousness. Our results revealed that an

untargeted metabolomics technique could successfully identify 30+ known metabolites

from our current standard list of ~300 metabolites and thousands of unidentified spectral

features. This analysis marks the first time a global metabolic snapshot was observed

from microdialysate samples, which provided the challenge of small sample volume and

reduced metabolite concentration. By analyze metabolism in a temporal fashion, we were

able to observe how neurochemicals fluctuate during various states of consciousness.

With access to literature that identifies changes to neurotransmitters during these states,

we can now begin piecing together how these small water-soluble metabolites are related.

Additionally, we are providing the neuroscience community with a large set of unexplored

territory in the form of the unidentified spectral features.

Small molecule discovery can identify new, safe targets for the treatment or

prevention of sleep-related illnesses. Across the globe, irregular sleeping habits are

becoming common, and the medical consequences of these habits are well documented.

Sleep deprivation has been shown to effect both cardiac and respiratory function,

increase work-related injury due to drowsiness, and cause weight loss or gain. With the

completion of this research project, we have provided a new set of small molecules for

neuroscientist to continue researching for their role in consciousness.

137

A version of this chapter is being prepared for submission by Allen K. Bourdon, Giovanna

M. Spano, Michele Bellesi, William Marshall, Giulio Tononi, Pier Andrea Serra, Helen A.

Baghdoyan, Ralph Lydic, Shawn R. Campagna, and Chiara Cirelli:

Contributions:

Microdialysis samples were collected by Cirelli et al. from the University of Wisconsin,

Madison (GMS, MB, GT, CC). Sample analysis was completed in the UTK BSMMSC by

AKB. Statistical analysis was completed separately by UTK (AKB) and UWM (WM). All

authors contributed to data analysis and interpretation, and AKB, GMS, MB, CC, HAB,

SRC, and RL wrote the manuscript.

138

2.1 ABSTRACT

Cerebral metabolism plays an essential role in sleep-waking states, yet the primary

information available involves the analysis of a subset of small molecules known as

neurotransmitters. To date, most neurochemical analyses have involved the detection of

one, or two metabolites simultaneously. The lack of breadth knowledge has limited

neuroscientists from developing a greater understanding of how global metabolism

regulates these states of consciousness. This study has focused on developing a deeper

understanding of how central carbon metabolites fluctuate across sleep-waking states,

as well as expanding our knowledge about how sleep deprivation can impact

homeostasis. Using an untargeted UPLC-HRMS metabolomics method and sequential

statistical analyses resulted in 11 significant metabolites that fluctuated between the

sleep-waking cycle and sleep deprivation.

2.2 INTRODUCTION

Genome-wide transcriptomic studies have identified hundreds of mRNAs with

expression changes in neurons and glia that are associated with sleep and wakefulness,

independent of circadian time (Bellesi et al., 2015; Bellesi et al., 2013; Cirelli et al., 2004;

Mackiewicz et al., 2007; Maret et al., 2007; Mongrain et al., 2010). These studies have

suggested new hypotheses about the restorative functions of sleep, from synaptic

homeostasis to the synthesis of cellular components and membranes (Mackiewicz et al.,

2007; Maret et al., 2007; Tononi and Cirelli, 2014). Proteomic approaches also have been

used, although they are difficult to apply to brain homogenates (e.g.(Basheer et al., 2005;

Cirelli et al., 2009; Kim et al., 2014; Pawlyk et al., 2007; Poirrier et al., 2008)).

Metabolomics, or the study of small-molecule metabolites, is a powerful approach

for identifying endogenous molecules in brain extracellular fluid. Because metabolomics

provides functional information about cellular physiology, measuring the cortical

metabolome may help to clarify how changes in neurochemistry contribute to the

generation of sleep and wakefulness (Baghdoyan and Lydic, 2012). Metabolomics also

139

has the potential to provide insights about the functions of sleep. New detection methods

are now available to analyze brain microdialysis samples with high sensitivity and

specificity (Dunn et al., 2011; Snyder et al., 2013). According to the human metabolome

database, 440 compounds have been detected (quantified or not) in the cerebrospinal

fluid (Wishart et al., 2013). How these metabolites relate to metabolites present in the

brain extracellular fluid is unknown. The goal of the present study was to characterize

changes in the composition of the extracellular fluid that were associated with states of

sleep and wakefulness, independent of circadian time or stress caused by sleep

deprivation. To accomplish this aim we used Ultra Performance Liquid Chromatography-

High Resolution Mass Spectrometry (UPLC-HRMS) to identify and quantify molecules

comprising metabolomics profiles in mouse medial prefrontal cortex (mPFC) and primary

motor cortex (M1). In vivo microdialysis was used to collect samples from mice during

electrographically identified states of sleep and wakefulness during times when mice are

normally asleep (light period), normally awake (dark period), and during sleep deprivation.

We focused on mPFC and M1 because we recently found that noradrenaline levels

increased during waking and decreased during sleep in both regions, but they started

declining by the end of 6 hours of sleep deprivation only in mPFC. This decline correlated

with an increase in low EEG frequencies, suggesting that the build-up of sleep pressure

during waking may occur faster in mPFC (Bellesi et al., 2016).

2.3 MATERIALS AND METHODS

2.3.1 Animals

Adult, male C57BL/6J (B6, wild type) mice (25 to 30 g; n = 19) were used. All

animal procedures and experimental protocols followed the National Institutes of Health

Guide for the Care and Use of Laboratory Animals (2011) and were approved by the

University of Wisconsin-Madison licensing committee. Animal facilities were reviewed

and approved by the institutional animal care and use committee (IACUC) of the

University of Wisconsin-Madison and were inspected and accredited by association for

assessment and accreditation of laboratory animal care (AAALAC).

140

2.3.2 Stereotaxic Surgery

Implantation of recording electrodes and microdialysis guide tubes was performed

under isoflurane anesthesia (2% for induction, 1 to 1.5% for maintenance). Each mouse

was implanted with two microdialysis guide cannulae (Figure 1A). One cannula was

aimed for the left medial prefrontal cortex (mPFC) using stereotaxic coordinates Bregma

AP +1.94, ML -0.3; (Bicks et al., 2015). A second cannula was aimed for the right primary

motor cortex (M1) with stereotaxic coordinates of AP +1.5, ML +2 (Franklin and Paxinos,

2008). For electroencephalographic (EEG) recordings, screw electrodes were implanted

over left and right parietal cortex (AP -2, ML +/-2) and cerebellum (reference electrode).

To record the electromyogram (EMG), two stainless steel wires were implanted into the

nuchal muscles. Cannulae and electrodes were fixed to the skull with dental cement. After

surgery, mice were individually housed in transparent Plexiglas cages. Environmental

lighting provided a 12h:12h light/dark cycle (lights on at 8 am; 23 ± 1 °C) with food and

water available ad libitum and replaced daily at 8 am. Approximately one week was

allowed for recovery from surgery, and microdialysis experiments started only after the

temporal organization of sleep and wakefulness had normalized.

2.3.3 Quantifying States of Sleep and Wakefulness

For one week after surgery the mice were conditioned for sleep studies by

connecting them via a flexible cable to a multichannel neurophysiology recording and

stimulation system that enabled EEG and EMG recordings (Figure 1B) (Tucker-Davis

Technologies Inc.). EEG and EMG signals were amplified and filtered as follows: EEG,

high-pass filter at 0.1 Hz; low-pass filter at 100 Hz; EMG, high-pass filter at 10 Hz; low-

pass filter at 100 Hz). All signals were sampled and stored at 256 Hz. States of sleep and

wakefulness were scored off-line in 4-sec epochs using standard criteria.

2.3.4 Microdialysis Experiments

The day before the experiment, each mouse was briefly anesthetized with

isoflurane and the microdialysis probes (15 KDa pore size) were inserted into the guide

cannulae (Bellesi et al., 2016). Microdialysis probes in the mouse homologue of

prefmPFC and M1 were connected to the microfluidic circuit (Figure 1B) and perfused

141

with artificial extracellular fluid (aECF) comprised of mM concentrations of: NaCL 147,

KCl 2.7, CaCl2 1.2, MgCl2 0.85. The microperfusion pump (CMA/400, CMA Microdialysis),

maintained aECF flow rate of 1.1 µL / min. Experiments were conducted from 7am until

6pm or from 9pm until 6am, during which time microdialysis samples from each cortical

probe were collected every 15 min in 250 μL plastic vials (ESA, PN 70-1695; ESA, Inc.).

At the conclusion of each dialysis experiment, microdialysis sites were histologically

confirmed to be located in the targeted brain area. Dialysis samples were stored at -80ºC

until they were shipped to the University of Tennessee to be analyzed using Ultra

Performance Liquid Chromatography-High Resolution Mass Spectrometry (UPLC-

HRMS) and an established metabolomics method (Lu et al., 2010). At the University of

Tennessee samples were also maintained at -80ºC until they were thawed and measured.

2.3.5 Experimental Groups

Three different experimental groups were used (Figure 1C). In all cases mice were

first placed on a slowly rotating treadmill that kept them awake for 2h, and in statistical

analysis 2 (see below) dialysis samples collected during the second hour served as

reference to compare samples collected during the following 9h of the light period (first

two groups) or of the dark period (third group). Figure 1D shows the percent of time mice

in each of the three groups spent awake during each 15-min sampling bin.

Group 1: Sleep for 6h followed by wakefulness on treadmill for 3h (S6-W3; n=7 mice)

At 7am, one hour before lights-on, each mouse was placed on a slowly moving

treadmill (speed ≈ 0.7 cm/sec) and the flow for microdialysis probe was activated (1.1 µL

/ min). The mouse was awake while slowly moving on the platform, and four microdialysis

samples were collected during the second hour to serve as reference. The mouse was

then returned to its cage and allowed to sleep for 6h. After ad libitum sleep, at 3pm the

mouse was placed back on the slowly moving treadmill for 3h, to obtain EEG recordings

and microdialysis samples during a “standardized” period of wakefulness, in which the

mouse behavior was as homogenous as possible.

142

Group 2: Sleep deprivation for 6h followed by sleep for 3h (SD6-S3; n = 6 mice)

As described above, mice were placed on the slowly moving treadmill starting at

7am and the second hour was used as reference. Mice were then returned to their cage

and kept awake by exposure to novel objects for 6h, followed at 3pm by ad libitum sleep

for 3h.

Group 3: Spontaneous wakefulness for 6h followed by wakefulness on treadmill for 3h

(W6-W3; n = 6 mice)

Mice were placed on the slowly moving treadmill for 2h starting at 7pm, one hour

before lights-off, and the second hour served as reference. At 9pm mice returned to their

cage and as expected, were spontaneously awake for most of the time. A novel object

was placed in the cage every ~30 min to help maintain a sustained period of wake, but if

the mouse slept, it was allowed to do so and microdialysis samples were not used for

subsequent analyses. At 3am mice were placed back on the treadmill for 3h.

2.3.6 Untargeted Metabolomics using UPLC-HRMS

Mass spectrometry (MS) is a key approach for metabolic profiling of the brain by

making possible the simultaneous measurement of thousands of molecules from a small

volume sample (Patti et al., 2012). The present study used an untargeted approach to

determine how many metabolites could be identified in each dialysis sample, and a

targeted approach to query the structure of some unidentified spectral features. Prior to

untargeted analyses, a 15-μL aliquot of each microdialysis sample was diluted to 50 μL

of total volume using Ringer’s solution. Instrumentation for untargeted metabolomics

analysis included an Ultimate 3000 LC pump in line with an Exactive Plus Orbitrap™

mass spectrometer (Thermo Scientific). Ultra-performance liquid chromatography

(UPLC) was accomplished under previously established chromatography (Stough et al.,

2016) using a Synergi Hydro-RP column (100 mm x 2.1 mm, 2.5 μm, 100 Å). Metabolites

were detected using high-resolution mass spectrometry (HRMS) in negative mode with

an electrospray ionization (ESI) source.

143

Following detection, raw data were compiled using the Metabolomic Analysis and

Visualization Engine (MAVEN) software package (Melamud et al., 2010). Known

metabolites were selected from a pre-existing list of ~300 compounds based on exact

mass and previously determined retention times (Lu et al., 2010). Metabolite selection

resulted in the reliable identification of more than 40 small molecules in more than 80%

of subjects; Group 1 (31 ± 16, mean ± SD), Group 2 (47 ± 8), and Group 3 (45 ± 5).

Additionally, MAVEN enabled the extraction of all spectral features detected during

analysis. Each spectral feature refers to a potential metabolite with an exact parent mass

detected at a specific retention time. After removal of “known” metabolites and carbon-13

isomers, the remaining spectral features were classified as “unknown”. Total unknown

features: Group 1 (2436 ± 850, mean ± SD; range, 998 - 3755), Group 2 (2388 ± 1529;

range, 388 - 5016), and Group 3 (2297 ± 846; range, 947 - 2899).

2.3.7 Statistical Analysis

Pre-processing normalization

Known metabolites were filtered independently of brain region and must be

observed in at least three mice per treatment condition. This selection criteria provided a

list of 36 and 33 metabolites in mPFC and M1, respectively. It should be noted that 2/3 of

the missing data is accounted for by 3 mice from the sleep treatment condition. Samples

from these subjects were collected without error, analyzed without technical

complications, and statistically provided no evidence as significant outliers. For these

reasons, these subjects were included in the final data analyses. Raw ion intensities were

normalized to the baseline samples collected during the first hour of analysis. To generate

a z-score normalized matrix, raw values were subtracted from the per

mouse/location/metabolite mean, then divided by the standard deviation. To minimize the

number of missing data points, the time domain was coarse-grained into 1-hour segments

(i.e. 4, 15-minute sample collections), reducing the data set to 9-time points. To complete

multivariate analysis, a full dataset was required, and the remaining missing data points

were replaced in the following manner. For metabolites that were not detected in a mouse,

these values were replaced with the metabolites within treatment/location/time average.

The remaining missing data points were filled in with the k = 2 nearest neighbor.

144

Multivariate Analysis

Partial least squares discriminant analysis (PLSDA) was used as a classification

model. This analysis included the combined data from mPFC and M1 comparing the 6-

hour metabolic profiles of sleep (S6; blue), wake (W6; green), and sleep deprivation (SD6;

red). PLSDA computation was accomplished using the DiscriMiner package and plsDA()

function in R. Figures were generated using the ggbiplot package. Model predictive

accuracy was performed to validate the results using a repeated, stratified k-fold (k = 3)

cross validation. This approach applied a learning set to prevent over-fitting of the data.

A unique function of this technique is the feature classification model that produces a list

of variable importance of projection (VIP) scores for each metabolite. VIP scores were

extracted from the plsDA() function and plotted in Excel.

Heatmap Analysis

Heatmap analysis allows for facile interpretation of metabolic changes across

treatment conditions by converting a numerical value to a defined color scale. Treatment

group differences were calculated from the normalized z-score data (i.e. Δ z-score) and

expressed temporally using the 9-hour coarse-grained data. The first 9-hour segment

compares 9am to 3pm (i.e. 1 thru 6) of S6 and SD6, then 3pm to 6pm (i.e. 7 thru 9) of S6-

W3 and SD6-S3; second segment, 9am to 3pm of S6 and 9pm to 3am of W6, then 3pm

to 6pm of S6-W3 and 3am to 6am of W6-W3; and third segment, 9am to 3pm of SD6 and

9pm to 3am of W6, then 3pm to 6pm of SD6-S3 and 3am to 6am of W6-W3. The saturated

color scale ranges from ±3, where the metabolites concentration is blue when higher in

sleep, red when higher in sleep deprivation, or green when higher in wake. Heatmaps

were generated in R with the ggplot2 and colorspace packages.

Linear Mixed Effects Model

Statistical analyses of the microdialysis samples were performed using LME

models (Laird and Ware, 1982; Lindstrom and Bates, 1988). LME models are one of the

few statistical techniques that are appropriate for analyzing repeated measures data, as

most traditional parametric statistical techniques rely on the assumption of independence

between data points. The other common approach for this type of data is a repeated

145

measures ANOVA, but the LME analysis is more flexible with respect to missing data,

and our analysis included many missing values, due to the absence of a compound at a

specific time point or brain region, and/or due to a mouse that did not meet the criteria for

sleep or wake at a given time point.

A linear mixed effect model includes both “fixed” and “random” effects, allowing to

determine the effect of a variable with a fixed number of states (in our case, the 3

behavioral conditions of either sleep, spontaneous wake or sleep deprivation), while

simultaneously controlling for the effects of another variable for which only a random

sample of possible values are observed (e.g., a random sample of mice). A mixed effect

model has the form

𝑌𝑖,𝑡 = 𝛽0 + 𝑏𝑖,0 + ∑ 𝛽𝑝𝑋𝑖,𝑡,𝑝

𝑃

𝑝=1

+ ∑ 𝑏𝑖,𝑞𝑍𝑖,𝑡,𝑞

𝑄

𝑞=1

+ 𝜖𝑖,𝑡

where,

𝑏𝑖,𝑞 ∼ 𝑁(0, 𝜎𝑞2),

and

𝜖𝑖,𝑡 ∼ 𝑁(0, 𝜎2).

In this model, Yi,t is the response variable, in our case the compound sample of the ith

mouse at the tth time point. The residuals ϵi,t were assumed to be independent and

normally distributed with constant variance. To ensure the assumptions of normality and

constant variance were satisfied, response values for some compounds were

transformed using a log or square root transformation. The βp values correspond to the

fixed effects in the model and b0,q are the random effects, which are assumed to be

normally distributed, with mean zero and constant variance. The design matrices X and

Z contain the values for each fixed and random explanatory variable respectively.

Parameters for the LME models were estimated numerically using the lme4 library for the

R software package (Bates et al., 2015).

146

All data were baseline corrected before modeling by subtracting out the average

value of the compound in the second baseline hour on the treadmill. A model selection

procedure was applied separately for each analysis. Following (Bolker et al., 2008), we

included as many random effects terms in each model as the data supported; when the

variance of a random effect went to zero or two random effects became perfectly

correlated then the model was over parameterized. Once the structure of the random

effects was determined, the Akaike Information Criterion (Akaike, 1974) was used to

select the set of fixed effects in the model.

Statistical analysis of the LMEs was performed using likelihood ratio tests,

comparing the full model as identified by the model selection procedure with a reduced

model with the effect of condition removed. Depending on the specific form of the fixed

effects in the model, this could result in a test for a main effect of condition, a condition x

time interaction, a condition x brain region interaction, or a condition x time x brain region

three-way interaction.

Classification Analysis

Microdialysis samples were further analyzed using machine learning algorithms in

an effort to determine whether behavioral state sampling epochs could be accurately

classified as sleep, spontaneous wake or enforced wake. Baseline correction was applied

before classification, as with the above LME analysis. Because the number of explanatory

variables was so much greater than the number of mice in the study, we applied the

LASSO to fit a sparse model and prevent over-fitting the data (Tibshirani, 1996).

Classification accuracy was assessed using a 4-fold stratified cross-validation. Briefly, the

population was divided into 4 groups, with the number of mice from each condition

approximately equal for each group. Three of the groups were used to train the model

(training set) and the remaining group was used to test the accuracy (test set). This

process was repeated, so that every group (and thus every mouse) was used as the test

set exactly once. All machine learning analysis were performed using the Python package

Scikit-learn.

147

Significance testing for the classifiers was performed using a nonparametric

permutation test. The condition labels for the mice were randomly permutated to remove

any distinctions between the groups, and then the classifiers were reapplied, capturing

the expected accuracy under the hypothesis of no differences. This method captures both

the fact that chance levels of accuracy are 50% (33% for 3-way classification) and the

structure of the design matrix, i.e., the number of predictor variables compared to the

number of observations. The structure of the design matrix is important to consider

because with so many predictors, one might expect to do better than chance, even in the

absence of a true difference between groups.

2.4 RESULTS

Microdialysis samples were collected simultaneously in the mPFC and M1 of B6

mice over a 10-hour time period in 15-minute increments, resulting in a total of 1, 571

dialysate samples for analysis (Figure 2.1A, B). Experiments were performed in 3

separate groups of animals, all of which well entrained to the light/dark cycle. All mice

spent the first 2 hours awake, slowly moving on a treadmill, and were then studied during

the following 9 hours in different sleep/wake conditions (Figure 2.1C). The first 2 groups

were studied during the light phase, one group during a sustained period (~6h) of sleep

followed by 3h of wake on the treadmill (S6-W3), and the other group during 6h of sleep

deprivation enforced by exposure to novel objects, followed by 3h of sleep (SD6-S3).

Thus, these two groups of animals were studied at the same time of day and in the same

lighting conditions (lights on) but on average, they spent each of the last 9 hours of the

experiment in opposite behavioral states (sleep or wake). The third group of mice was

studied at the opposite circadian time, during the dark phase, and spent the last 9 hours

awake, the first 6 hours in their cages, and the last 3 hours on the treadmill (W6-W3). In

each mouse microdialysis samples were collected every 15 minutes (Figure 2.1D). The

combination of these 3 groups, including enforced wake during the day and spontaneous

wakefulness at night, allowed us to assess the effects of sleep and wakefulness

independent of possible confounding factors due to time of day, light exposure, and

148

Figure 2.1 Experimental design

(A) schematic diagram showing the placement of the microdialysis probes, EEG

electrodes and EMG wires; (B) set-up for EEG recording and microdialysis; (C) the 3

experimental groups. (D) mean % of wake for each group in 15-min intervals. For each

group, time points in black indicate the first two hours of the experiment, when all mice

were on the treadmill, to obtain a “reference” condition of standardized wakefulness. Blue

time points indicate the periods when mice had the opportunity to sleep. Time points in

red indicate the period of sleep deprivation using novel objects. Time points in orange

show when mice were either spontaneous awake at night or placed on the treadmill for

the last 3 hours of the experiment.

149

stimulation (novel objects) used to enforce wakefulness during the day, when mice would

spontaneously sleep.

From the mPFC and M1, respectively, of each experimental group, the following

microdialysis samples totals were collected; 286 and 290 from Group 1 (N = 7), 242 and

251 from Group 2 (N = 6), and 249 and 252 from Group 3 (N = 6). Following collection, a

10 µL injection of each sample was analyzed by an untargeted metabolomics method

using UPLC-HRMS.

2.4.1 Temporal Fluctuation of Identified Metabolites

First, known metabolites were compared in a pairwise fashion between treatment

groups using Δz-score of metabolite intensities as a proxy for relative metabolite

concentrations (Figure 2.1). To visualize these data, heatmaps (Saldanha, 2004) were

constructed that compared metabolite levels across each possible pair of experimental

groups in mPFC and M1. This visualization, shown in Figure 2, conserves the temporal

sampling provided by in vivo microdialysis while allowing for the interpretation of

metabolic trends between treatment conditions. The saturated color scale ranges from

±3, and the heatmaps were generated in R with the ggplot2 and colorspace packages.

Metabolites have been organized into their respective metabolic pathways and changes

in both brain regions have been aligned to assist in visual comparison of metabolic

changes. Note that the heatmap is designed to help visualize the temporal patterns of

metabolite levels but does not capture the statistical reliability of such patterns, which was

done using LME models (see below). Metabolites identified as statistically significant by

the LME models have been marked with an asterisk and bold text.

2.4.2 Results of LME Analysis

We applied 3 linear mixed effect models to each metabolite, one “between groups”

model that compared the levels of the compound during the first 6 consecutive hours of

either sleep, spontaneous wakefulness or enforced wakefulness (S6, SW6, EW6), and

two “within group” models that compared the levels of each metabolite during 9

consecutive hours (S6-EW3, EW6-S3). To be considered as state-dependent, a known

metabolite (or unidentified spectral features) was required to meet the following strict

150

Figure 2.1 Heatmap analysis of mPFC and M1

Graphical representation of the Δ z-score metabolite levels between microdialysis samples collected from mPFC and M1

during 6 hours of sleep (S6), sleep deprivation (SD6), and spontaneous wakefulness (W6), and 3 hours of post-sleep

wakefulness (S6-W3), post-sleep deprivation sleep (SD6-S3), and post-wake wakefulness (W6-W3). Each cell represents

1-hour coarse grained average ion intensity. Array comparisons are labeled above each panel, and a ±3 color legend is

found on the right (S6 and S6-S3, blue; SD6 and SD6-S3, red; W6 and W6-W3, green). To facilitate interpretation,

metabolites have been organized by metabolic pathway (pathway names down the middle of respective heatmaps) and text

was made bold, with an asterix (*) when identified as significant by LME analyses.

151

criteria: 1) show a statistically significant change in at least one model (p < 0.05); 2)

show biologically consistent changes, even if they did not reach significance, in the

other models.

Among the known metabolites (36 in mPFC and 33 in M1) 11 of them (11/36, 30%)

were modulated by sleep and wakefulness according to the strict criteria discussed

above, i.e. consistently across the 3 comparisons (Table 2.1): D-gluconate, glutamate,

homovanillic acid, lactate, N-acetyl-beta-alanine, N-acetylglutamine, orotate, pyruvate,

succinate/methylmalonate, tryptophan, and uridine. All analytes decreased throughout

the sleep period relative to both wake conditions (Figure 2.2A and B). One analyte

(homovanillc acid) had a significant condition by brain region interaction, showing state-

dependent changes primarily in mPFC. Several other metabolites, including

homoserine/threonine, uracil, and valine, showed highly significant temporal effects in all

3 behavioral states, with levels decreasing from hour 1 to hour 9. We assume this profile

likely reflects some form of “depletion” during prolonged sampling and these analytes are

not further discussed.

2.4.3 Classification Analysis

Next, we used partial least squares discriminant analyses (PLSDA) to determine

whether global metabolic profiles during the first 6 hours of sleep, enforced wakefulness,

and spontaneous wakefulness could be used to accurately distinguish between the 3

behavioral states. PLSDA is a commonly used statistical approach in metabolomics

because is properly suited for an uneven design matrix, in which the number of dependent

variables (e.g. detected metabolites) is larger than the number of independent variables

(e.g. number of samples). Indeed, we found that the metabolite profile from all 3

experimental groups (S6, EW6, SW6) was sufficient to classify the state of arousal using

data from both mPFC and M1., The PLSDA model perfectly classifies the mice into their

respective experimental conditions, As shown in Figure 2.2A plotting the PLSDA score

values of PLS Component 1 and PLS Component 2 demonstrates visible clustering and

clear separation between the 3 experimental groups. Additionally, PLSDA identifies the

metabolites that drive the separation among conditions by ascribing a variable importance

of projection score (VIP). As the weighted sum of the squared correlations between

152

Table 2.1 Significant Metabolites for Regulation of Behavioral States

Significance levels of the 11 known metabolites with consistent differences between

behavioral states. The p-values generally reflect a behavioral state * time interaction, with

the sleep conditions decreasing while the wake conditions remain constant (or increase).

Pyruvate (S6-SW6-EW6), Orotate (S6-EW3) were the exceptions, where the reported p-

value represent a main effect of state (no time interaction). (*) p < 0.05, (**) p < 0.01, (***)

p < 0.001.

Metabolite Between Groups

(S6-SW6-EW6)

Within Group

(S6-EW3)

Within Group

(EW6-S3)

D-Gluconate 0.0032 (**) 0.0007 (***) 0.1291

Glutamate 0.0253 (*) 0.0965 0.0037 (**)

Homovanillic acid 0.0051 (**) 0.0125 (*) 0.0000 (***)

Lactate 0.0020 (**) 0.0386 (*) 0.0000 (***)

N-acetyl-beta-alanine 0.0013 (**) 0.0264 (*) 0.0169 (*)

N-acetyl-glutamine 0.0894 0.0336 (*) 0.0554

Orotate 0.1067 0.0006 (***) 0.0057 (**)

Pyruvate 0.8409 0.0012 (**) 0.0040 (**)

Succinate/Methylmalonate 0.0000 (***) 0.2814 0.3415

Tryptophan 0.4869 0.0000 (***) 0.4829

Uridine 0.0363 (*) 0.0000 (***) 0.6407

153

Figure 2.2 Observation of z-score fluctuation in LME significant metabolites

Line graphs represent the absolute z-score values across the 3 treatment conditions; S6-

W3, SD6-S3, and W6-W3, for the 11-significant metabolite, as determined by LME

analysis. Middle line represents the mean z-score, and outside fill section refer to the

standard deviation. Data from both (A) mPFC and (B) M1 brain regions. States of

consciousness are color coded to show states of sleep (S/RS) as blue, spontaneous wake

(SW) as green, and extended wake (EW) as red. S6-W3; blue, first six hours and red,

final three hours. SD-S3; red, first 6 hours and blue, final three hours. W6-W3; green, first

six hours and red, final three hours.

154

Figure 2.2A Continued

(A)

155

Figure 2.2 B Continued

(B)

156

PLSDA components and the original variables, these values represent the percentage of

variation explained by the component in the model. Generally, a VIP greater than 1.0 is

considered most significant (i.e., metabolites with VIP > 1 strongly contribute to the

observed differences among groups). The 15 metabolites with the highest VIP scores are

listed in Figure 2.3B (mPFC) and 2.3C (M1).

With so many explanatory variables and a relatively small number of mice,

overfitting the PLSDA model was a concern. To better understand how the results will

generalize, a K-fold stratified cross-validation procedure was used to estimate the

accuracy of the classifier and statistical significance was assessed using non-parametric

permutations tests. The cross-validation analysis resulted in an estimated accuracy of

76.4%, which was significantly greater than chance (p < 0.05). We then explored

alternative classification models to see if we could improve on the accuracy of PLSDA.

The best accuracy was achieved using a logistic regression classifier with an ℓ2

regularization penalty with sparsity parameter C = 0.001 (smaller values of C restrict the

model and promote more sparsity). For this classifier the cross-validation procedure

resulted in an estimated accuracy of 83%, which was significantly greater than chance (p

< 0.001). Further exploring the ability for this classifier to pair-wise discriminate between

conditions, we found that the sleep condition was distinguished from the two wake

conditions with greater accuracy (S vs. SW accuracy 91.8%, p < 0.01; S vs. EW accuracy

100%, p < 0.01) than the two wake conditions could be distinguished from each other

(SW vs. EW accuracy 82.1%, p = 0.003). This is consistent with the visualization of the

PLSDA model (Figure 2.3A), in which the clusters corresponding to the 2 wake conditions

are closer to each other than they are to the sleep cluster.

157

Figure 2.3 PLSDA accurately classifies states of arousal and associated VIP

classification model ascribes significant features

By combining the mPFC and M1 analyses, data from S6, SD6, and W6 were used in the

PLSDA to determine the overall variation between treatment conditions. (A) The PLSDA

plot shows significant separation of SD6 from S6 and W6 in Component 1, and additional

separation of S6 from W6 and SD6 in Component 2. Ellipses represent a confidence

interval of 95%. VIP score plots were generated from PLSDA calculation, where a value

greater than 1.0 is considered most significant for the observed separation. In the mPFC

(B) and M1 (C), the top-15 metabolites are highlighted as potential points of difference.

An asterisk (*), and bold text represents metabolites that were significant based on linear

mixed effects model.

158

Figure 2.3A Continued

(A)

159

Figure 2.3B Continued

(B)

160

Figure 2.3C Continued

(C)

161

2.5 DISCUSSION

Many previous microdialysis studies measured neurotransmitters, neuropeptides

and metabolites in the rodent brain across the sleep/wake cycle. In some experiments

the high temporal resolution of biosensors was used to detect rapid changes in cortical

levels of glutamate, lactate and glucose during wake, NREM sleep and REM sleep (Dash

et al., 2013; Dash et al., 2009; Dash et al., 2012; Naylor et al., 2012; Wisor et al., 2013).

In these reports, however, one or at most a few analytes were measured (Lena et al.,

2005; Watson et al., 2011). A recent study did apply liquid chromatography and online

mass spectrometry to the mouse prefrontal cortex to test a metabolomics platform of

almost 300 metabolites, of which approximately 120 were identified in the extracellular

fluid (Kao et al., 2015), but sleep/waking changes were not studied. Thus, to our

knowledge, this is the first study providing a broader view of metabolome changes in the

cortical extracellular space across the sleep/waking cycle and after sleep deprivation.

We reliably (in at least 50% of mice) detected 33 metabolites in M1 and 36 in

mPFC. According to the LME model analysis, 11 of these metabolites were present at

significantly higher levels after wake, in most cases after both spontaneous and forced

wake and in both cortical regions, while no metabolite was detected at higher levels after

sleep. A similar trend was present among the 14 differentially regulated unidentified

spectral features, with 12 upregulated in wake and 2 in sleep. This “imbalance” between

waking-related and sleep-related compounds is not new. Among the hundreds of

transcripts modulated by sleep and wake in neurons, astrocytes, and oligodendrocytes of

rat and mouse cortex, the majority were “wake” transcripts whose expression was higher

in both spontaneous and forced wake than in sleep (Bellesi et al., 2015; Cirelli et al.,

2004), reflecting either increased transcription and/or decreased degradation of mRNAs

during waking. In the current study, higher wake levels of analytes could reflect increased

synthesis, decreased utilization, and/or decreased elimination by the glymphatic system

that drives exchange of interstitial fluid with cerebrospinal fluid (Iliff et al., 2012; Xie et al.,

2013). Wake-related metabolites reflect different signaling pathways and cellular

processes and most, but not all, of them were already known to be differentially expressed

162

across behavioral states. Below we first discuss each metabolite, and then summarize

our results in light of other metabolic studies in peripheral tissues.

Glutamate is the primary excitatory neurotransmitter released into the

extrasynaptic space. The extracellular concentrations of glutamate are positively

correlated to the regulation of sleep-wake states (Dash et al., 2009). The glutamate-

glutamine cycle is primary cellular nitrogen metabolism where glutamate is converted to

glutamine in the astrocytes, then released into the extracellular matrix for re-uptake into

a neuron and conversion back to glutamate or to GABA. Additionally, the glutamate-

leucine cycle is essential for the formation of glutamate in the cell because leucine can

pass the blood brain barrier followed by conversion to glutamate in the astrocyte. In

combination, these two metabolic cycles are essential for the formation of glutamate and

proper function of the cell. Our study correlates positively to the research of Dash et al.,

2009 where they found that glutamate levels were increased during periods of wake and

sleep deprivation. In the SD6-S3 mice, glutamate levels spike as sleep pressure

increases, then return to normal levels as the subjects move to recovery sleep. A similar

pattern exists across both brain regions.

Two other energy metabolites were upregulated in wake relative to sleep, pyruvate

and lactate, consistent with previous studies in rats and mice (Dash et al., 2012; Naylor

et al., 2012; Reich et al., 1972; Shram et al., 2002). Lactate is mainly derived from glucose

and glycogen via aerobic glycolysis inside neurons (Lundgaard et al., 2015) and

astrocytes (Belanger et al., 2011), although astrocytes can also produce lactate from the

metabolism of glutamate via the Krebs cycle (McKenna, 2012). The sleep-related drop in

lactate levels, which depends on the activity of the glymphatic system (Lundgaard et al.,

2015), is correlated with changes in SWA, a marker of sleep pressure (Dash et al., 2012).

These findings suggest that the regulation of sleep need is linked to glycolytic processes

(Wigren et al., 2009) and astrocytic functions (Haydon, 2017; Magistretti, 2009, 2011),

but the underlying mechanisms remain unclear. The oxygen to glucose ratio in the brain

is 5.1-5.4:1, below what would be expected from the full oxidation of glucose (6 mol of

oxygen are needed to fully oxidize 1 mol of glucose). This ratio further declines with

neuronal activation (Dienel and Cruz, 2016), indicating that the awake brain relies more

163

on glycolytic processes than the sleeping brain (Dienel and Cruz, 2016; DiNuzzo and

Nedergaard, 2017). From a purely energetic point of view this seems paradoxical, since

aerobic glycolysis produces far fewer ATP molecules than oxidative phosphorylation.

However, aerobic glycolysis is stimulated in conditions of synaptic growth, is blocked by

inhibition of the noradrenergic system (Dienel and Cruz, 2016), and lactate released from

astrocytes excites locus coeruleus neurons and increases NA release (Tang et al., 2014).

Lactate may also serve as a volume transmitter and the G protein coupled lactate receptor

GPR81 is concentrated in the synaptic membranes of excitatory synapses (Lauritzen et

al., 2014). Thus, lactate upregulation during wake may reflect more the need for synaptic

growth and potentiation than increased energy demand. The latter could be met via

increases in oxidative phosphorylation, and indeed mitochondrial enzymes of the

respiratory chain are upregulated during waking (Nikonova et al., 2010).

The gluconate shunt is a less known metabolic pathway that can facilitate the

breakdown of glucose. It has been studied mainly in plants and microorganisms but key

enzymes of the shunt, glucose dehydrogenase and gluconate kinase, have been

identified in mammals (Rohatgi et al., 2014). In this pathway glucose is oxidized by

glucose dehydrogenase to gluconic acid (or gluconate). Gluconate is then phosphorylated

by gluconate kinase to produce 6-phosphogluconate, the second intermediate of the

pentose phosphate pathway, thus bypassing the first rate-limiting step of this pathway

(Corkins et al., 2017). The main function of the pentose phosphate shunt is anabolic rather

than catabolic, producing pentose sugars for the synthesis of nucleic acids and amino

acids. Thus, like lactate, increased gluconate levels during wake may signal the need for

growth, rather than energy.

From the pyrimidine pathway, two metabolites were identified as significant.

Orotate (orotic acid) is an essential intermediate in the de novo pyrimidine pathway that

provides critical components for the synthesis of DNA, RNA, sugars, glycogen as well as

phosphatidylcholine and phosphatidylethanolamine, the major phospholipids of the

cellular membranes (Gerlach et al., 2011; Loffler et al., 2015). Orotate is the product of

dihydroorotate dehydrogenase, the only enzyme in the pathway directly connected to the

respiratory chain via its localization to the inner mitochondrial membrane. All genes

164

responsible for the synthesis of pyrimidines are expressed at high levels in cortex and

other brain regions (Gerlach et al., 2011), suggesting that the brain’s need for pyrimidines

may be met not only by the uptake of uridine from the blood, as previously believed, but

also by in situ production. Like lactate and gluconate increased orotate levels during wake

may signal the need for the synthesis of many essential components, from nucleic acids

to cellular membranes. Uridine is a pyrimidine-analogue that is one of the five standard

nucleosides but is only found in ribonucleic acid (RNA). This metabolite is actively

produced as uridine monophosphate through a de novo synthesis involving the

decarboxylation of orotidine monophosphate (the primary metabolite of orotate). These

two metabolites are directly linked in pyrimidine metabolism and exhibit a positive

correlation from our results, where the highest concentration is found in extended wake

following natural wake (i.e. W6-W3).

Two other metabolites upregulated during waking, homovanillic acid (HVA) and

tryptophan, reflect the activity of two well-known groups of wake-active neurons. HVA is

one of the major dopamine (DA) metabolites and a valid indicator of DA turnover. DA

extracellular levels in the mPFC are increased by novelty and higher during waking than

during sleep (Feenstra et al., 2000; Lena et al., 2005), consistent with the fact that DA

neurons in the ventral tegmental area, which project to mPFC, are more active during

wake than during sleep and promote arousal (Eban-Rothschild et al., 2016; Taylor et al.,

2016). Tryptophan is an essential amino acid and the precursor of the neurotransmitter

serotonin. Like DA neurons in the VTA, serotonin neurons in the dorsal raphe are more

active during waking than during sleep and extracellular levels of serotonin are higher in

waking than in sleep in different brain regions, including prefrontal cortex (Ursin, 2002).

N-acetylglutamine (NAg), commonly referred to as Aceglutamide, is an acetylated

analogue of glutamine. Sold under the brand name Neuroamina, this compound is

currently an experimental pharmaceutical used as a psychostimulant and nootropic (class

of compounds that reportedly improve cognitive function by modulating neurotransmitter

activity) to improve memory and concentration (Ganellin and Triggle, 1996). Information

on this compound are challenging to find currently, as research is actively being

conducted on this compound. In parallel with our results, we see a large increase of NAg

165

across both wake models, and no decrease during recovery sleep. This interpretation

makes NAg an interesting compound for further analysis as this may play a significant

role in cognitive awareness during wake.

N-acetyl-beta-alanine is an endogenous β amino acid that can be converted to

acetate and β alanine by N-acetyl-β alanine dehydrogenase (Fujimoto et al 1968;

Chesnoy-Marchais, 2016). In the brain, however, the best characterized pathway leading

to β-alanine synthesis is the deamination and carboxylation of the pyrimidine uracil

(Hayaishi et al., 1961; Tiedje et al., 2010), while very little is known about N-acetyl-β

alanine dehydrogenase. β-alanine is a molecular intermediary of GABA and glycine with

a very similar mechanism of action, and is considered an inhibitor neurotransmitter (Juge

et al., 2013). Thus, the upregulation of N-acetyl-beta-alanine during waking is difficult to

interpret, and it is not clear whether it linked to changes in β-alanine.

The metabolomics field can establish tremendous insights from the known

compounds using untargeted techniques, but the investigation of the unexplored space

of unidentified spectral features offers a unique opportunity. Although annotation of these

features presents challenges, as the field progresses, the information gained from these

early untargeted studies could lead to the discovery of major influence from novel

pathways and metabolites. The unidentified spectral features highlighted in this

manuscript revealed similar trends to the known metabolites, meaning they had an

elevated concentration in states of wake when compared to sleep. These trends reveal

that an unexplored space of metabolomics could lead to new information about various

states of consciousness.

2.5.1 Comparisons with Previous Metabolomics Studies

One study applied both liquid and gas chromatography coupled with mass

spectrometry to mouse cortical homogenates and identified 226 compounds, of which 20

changed in mice sleep deprived for 6 hours relative to controls allowed to sleep, mostly

belonging to the glycolytic pathways (SD increase in alanine and lactate) and to lipid

metabolism (SD increase in lysolipids due to breakdown of membrane phospholipids)

(Hinard et al., 2012).

166

In humans, metabolomics analysis of plasma found that the majority of the

identified compounds (109/171) showed time of day variations, but only 27 of them were

affected by 24 hours of sleep deprivation. These included tryptophan, serotonin, taurine,

8 acylcarnitines, 13 glycerophospholipids, and 3 sphingolipids, all of which increased after

24 hours of sleep deprivation (Davies et al., 2014). In the same subjects, metabolomic

analysis of urine samples found that out of 32 identified metabolites, 7 (22%) changed

due to time of day, and 16 due to sleep deprivation, with 8 increasing and 8 decreasing

due to sleep loss (Giskeodegard et al., 2015).

Another study used serum from sleep restricted rats from 2 independent

experiments (5 days; 20h/day): 3,380 unique metabolic species were measured, 407

identified, and 38 of them changed due to acute (1 day) sleep restriction; of them, 28 were

identified and were mainly (18/28) lipids, especially phospholipids (Weljie et al., 2015).

Among the non-lipid metabolites, isocitrate (Krebs/lipogenesis), urocanic acid (histidine

catabolism) and oxalic acid (glycolate metabolism) were reduced, while valine, leucine,

N-methyl-alanine were increased. After chronic (5 days) sleep restriction, 18 known

metabolites changed, including 15 lipids, as well as glycine (decreased) and sucrose and

malate (increased). Of note, the number of metabolites consistently affected in the 2

experiments was only ~10% of all analytes found to be changing in each separate

experiment, stressing the importance of using multiple experimental groups to identify

biologically significant differences, as we did here by comparing 3 independent groups of

animals.

In a parallel study of 5 days of sleep restriction in humans, 92 metabolites were

identified as potentially significant, 32 of which as lipids or fatty acid related compounds;

tryptophan and phenylalanine increased, and oxalic acid decreased with sleep loss;

overall, two metabolites were decreased with sleep loss in both species, oxalic acid and

diacylglycerol 36:3.

167

2.6 CONCLUSION

The completion of this study marks the first global metabolomics experiment from

a temporal analysis of two brain regions simultaneously comparing the sleep/wake cycle

to sleep deprivation. We have conclusively shown that many metabolites can be detected

from a limited sample volume, confirming that a temporal resolution of 15-minutes using

microdialysis coupled with LC-MS untargeted metabolomics is achievable. In this study,

the issue of missing data points was exemplified due to small sample volume and

metabolite concentrations. We have provided a standard protocol for the statistical

handling of temporal data from microdialysis samples that should be utilized in future

analyses.

The results of this study conclude that sleep deprivation perpetuates a demanding

strain on the neuronal cellular metabolism. We have provided a list of 11 small molecules

that should be analyzed in detail during future studies.

168

REFERENCES

1. Cirelli, C.; Gutierrez, C. M.; Tononi, G., Extensive and divergent effects of sleep and wakefulness on brain gene expression. Neuron 2004, 41 (1), 35-43.

2. Bellesi, M.; Pfister-Genskow, M.; Maret, S.; Keles, S.; Tononi, G.; Cirelli, C., Effects of sleep and wake on oligodendrocytes and their precursors. The Journal of neuroscience : the official journal of the Society for Neuroscience 2013, 33 (36), 14288-300.

3. Mackiewicz, M.; Shockley, K. R.; Romer, M. A.; Galante, R. J.; Zimmerman, J. E.; Naidoo, N.; Baldwin, D. A.; Jensen, S. T.; Churchill, G. A.; Pack, A. I., Macromolecule biosynthesis - a key function of sleep. Physiol Genomics 2007, 31, 441-57.

4. Maret, S.; Dorsaz, S.; Gurcel, L.; Pradervand, S.; Petit, B.; Pfister, C.; Hagenbuchle, O.; O'Hara, B. F.; Franken, P.; Tafti, M., Homer1a is a core brain molecular correlate of sleep loss. Proceedings of the National Academy of Sciences of the United States of America 2007, 104 (50), 20090-5.

5. Mongrain, V.; Hernandez, S. A.; Pradervand, S.; Dorsaz, S.; Curie, T.; Hagiwara, G.; Gip, P.; Heller, H. C.; Franken, P., Separating the contribution of glucocorticoids and wakefulness to the molecular and electrophysiological correlates of sleep homeostasis. Sleep 2010, 33 (9), 1147-57.

6. Bellesi, M.; de Vivo, L.; Tononi, G.; Cirelli, C., Effects of sleep and wake on astrocytes: clues from molecular and ultrastructural studies. BMC biology 2015, 13, 66.

7. Tononi, G.; Cirelli, C., Sleep and the price of plasticity: from synaptic and cellular homeostasis to memory consolidation and integration. Neuron 2014, 81 (1), 12-34.

8. Basheer, R.; Brown, R.; Ramesh, V.; Begum, S.; McCarley, R. W., Sleep deprivation-induced protein changes in basal forebrain: Implications for synaptic plasticity. J Neurosci Res. 2005, 82 (5), 650-8.

9. Pawlyk, A. C.; Ferber, M.; Shah, A.; Pack, A. I.; Naidoo, N., Proteomic analysis of the effects and interactions of sleep deprivation and aging in mouse cerebral cortex. Journal of neurochemistry 2007, 103 (6), 2301-13.

10. Poirrier, J. E.; Guillonneau, F.; Renaut, J.; Sergeant, K.; Luxen, A.; Maquet, P.; Leprince, P., Proteomic changes in rat hippocampus and adrenals following short-term sleep deprivation. Proteome Sci 2008, 6, 14.

11. Cirelli, C.; Pfister-Genskow, M.; McCarthy, D.; Woodbury, R.; Tononi, G., Proteomic profiling of the rat cerebral cortex in sleep and waking. Arch Ital Biol 2009, 147 (3), 59-68.

12. Kim, J. H.; Kim, J. H.; Cho, Y. E.; Baek, M. C.; Jung, J. Y.; Lee, M. G.; Jang, I. S.; Lee, H. W.; Suk, K., Chronic sleep deprivation-induced proteome changes in astrocytes of the rat hypothalamus. J Proteome Res 2014, 13 (9), 4047-61.

169

13. Baghdoyan, H. A.; Lydic, R., The neurochemistry of sleep and wakefulness. In Basic Neurochemistry, 8th ed.; Siegel, G. J.; Albers, R. W.; Price, D. L., Eds. Elsevier: 2012; pp 982-999.

14. Dunn, W. B.; Broadhurst, D.; Begley, P.; Zelena, E.; Francis-McIntyre, S.; Anderson, N.; Brown, M.; Knowles, J. D.; Halsall, A.; Haselden, J. N.; Nicholls, A. W.; Wilson, I. D.; Kell, D. B.; Goodacre, R.; Human Serum Metabolome, C., Procedures for large-scale metabolic profiling of serum and plasma using gas chromatography and liquid chromatography coupled to mass spectrometry. Nat Protoc 2011, 6 (7), 1060-83.

15. Snyder, N. W.; Khezam, M.; Mesaros, C. A.; Worth, A.; Blair, I. A., Untargeted metabolomics from biological sources using ultraperformance liquid chromatography-high resolution mass spectrometry (UPLC-HRMS). J Vis Exp 2013, (75), e50433.

16. Wishart, D. S.; Jewison, T.; Guo, A. C.; Wilson, M.; Knox, C.; Liu, Y.; Djoumbou, Y.; Mandal, R.; Aziat, F.; Dong, E.; Bouatra, S.; Sinelnikov, I.; Arndt, D.; Xia, J.; Liu, P.; Yallou, F.; Bjorndahl, T.; Perez-Pineiro, R.; Eisner, R.; Allen, F.; Neveu, V.; Greiner, R.; Scalbert, A., HMDB 3.0--The Human Metabolome Database in 2013. Nucleic Acids Res 2013, 41 (Database issue), D801-7.

17. Bellesi, M.; Tononi, G.; Cirelli, C.; Serra, P. A., Region-Specific Dissociation between Cortical Noradrenaline Levels and the Sleep/Wake Cycle. Sleep 2016, 39 (1), 143-54.

18. Guide for the Care and Use of Laboratory Animals 8th ed.; The National Academies Press: Washiungton, DC, 2011.

19. Bicks, L. K.; Koike, H.; Akbarian, S.; Morishita, H., Prefrontal Cortex and Social Cognition in Mouse and Man. Front Psychol 2015, 6, 1805.

20. Franklin, K. B. J.; Paxinos, G., The Mouse Brain in Stereotaxic Coordinates. Academic Press: 2008.

21. Lu, W.; Clasquin, M. F.; Melamud, E.; Amador-Noguez, D.; Caudy, A. A.; Rabinowitz, J. D., Metabolomic analysis via reversed-phase ion-pairing liquid chromatography coupled to a stand alone orbitrap mass spectrometer. Anal Chem 2010, 82 (8), 3212-21.

22. Lindstrom, M. J.; Bates, D. M., Newton-Raphson and EM algorithms for linear mixed-effects models for repeated measures data. J of the American Statistical Association 1988, 83, 1014-1022.

23. Laird, N. M.; Ware, J. H., Random effects models for longitudinal data. Biometrics 1982, 38, 963-74.

24. Bates, D.; Maechler, M.; Bolker, B.; Walker, S., Fitting Linear Mixed-Effects Models Using lme4. Journal of Statistical Software 2015, 67, 1-48.

25. Bolker, B. M.; Brooks, M. E.; Clark, C. J.; Geange, S. W.; Poulsen, J. R.; Stevens, M. H. H.; White, J.-S. S., Generalized linear mixed models: a practical guide for ecology and evolution. Trends in Ecology and Evolution 2008, 24, 127-135.

170

26. Akaike, H., A new look at the statistical model identification. EEE Transactions on Automatic Control 1974, 19, 716-723.

27. Tibshirani, R., Regression shrinkage and selection via the Lasso. J of the Royal Statistical Society. Series B. 1996, 58, 267-288.

28. Saldanha, A. J., Java Treeview--extensible visualization of microarray data. Bioinformatics 2004, 20 (17), 3246-8.

29. Dash, M. B.; Tononi, G.; Cirelli, C., Extracellular levels of lactate, but not oxygen, reflect sleep homeostasis in the rat cerebral cortex. Sleep 2012, 35, 909-919.

30. Naylor, E.; Aillon, D. V.; Barrett, B. S.; Wilson, G. S.; Johnson, D. A.; Harmon, H. P.; Gabbert, S.; Petillo, P. A., Lactate as a biomarker for sleep. Sleep 2012, 35 (9), 1209-22.

31. Dash, M. B.; Bellesi, M.; Tononi, G.; Cirelli, C., Sleep/wake dependent changes in cortical glucose concentrations. Journal of neurochemistry 2013, 124 (1), 79-89.

32. Wisor, J. P.; Rempe, M. J.; Schmidt, M. A.; Moore, M. E.; Clegern, W. C., Sleep slow-wave activity regulates cerebral glycolytic metabolism. Cerebral cortex 2013, 23 (8), 1978-87.

33. Dash, M. B.; Douglas, C. L.; Vyazovskiy, V. V.; Cirelli, C.; Tononi, G., Long-Term Homeostasis of Extracellular Glutamate in the Rat Cerebral Cortex across Sleep and Waking States. The Journal of Neuroscience 2009, 29 (3), 620-629.

34. Lena, I.; Parrot, S.; Deschaux, O.; Muffat-Joly, S.; Sauvinet, V.; Renaud, B.; Suaud-Chagny, M. F.; Gottesmann, C., Variations in extracellular levels of dopamine, noradrenaline, glutamate, and aspartate across the sleep--wake cycle in the medial prefrontal cortex and nucleus accumbens of freely moving rats. J Neurosci Res 2005, 81 (6), 891-9.

35. Watson, C. J.; Lydic, R.; Baghdoyan, H. A., Sleep duration varies as a function of glutamate and GABA in rat pontine reticular formation. Journal of neurochemistry 2011, 118 (4), 571-80.

36. Kao, C. Y.; Anderzhanova, E.; Asara, J. M.; Wotjak, C. T.; Turck, C. W., NextGen brain microdialysis: applying modern metabolomics technology to the analysis of the extracellular fluid of the central nervous system. . Molecular Neuropsychiatry 2015, 1, 60-67.

37. Iliff, J. J.; Wang, M.; Liao, Y.; Plogg, B. A.; Peng, W.; Gundersen, G. A.; Benveniste, H.; Vates, G. E.; Deane, R.; Goldman, S. A.; Nagelhus, E. A.; Nedergaard, M., A paravascular pathway facilitates CSF flow through the brain parenchyma and the clearance of interstitial solutes, including amyloid beta. Sci Transl Med 2012, 4 (147), 147ra111.

38. Xie, L.; Kang, H.; Xu, Q.; Chen, M. J.; Liao, Y.; Thiyagarajan, M.; O'Donnell, J.; Christensen, D. J.; Nicholson, C.; Iliff, J. J.; Takano, T.; Deane, R.; Nedergaard, M., Sleep drives metabolite clearance from the adult brain. Science 2013, 342 (6156), 373-7.

171

39. Shram, N.; Netchiporouk, L.; Cespuglio, R., Lactate in the brain of the freely moving rat: voltammetric monitoring of the changes related to the sleep-wake states. The European journal of neuroscience 2002, 16 (3), 461-6.

40. Reich, P.; Geyer, S. J.; Karnovsky, M. L., Metabolism of brain during sleep and wakefulness. Journal of neurochemistry 1972, 19 (2), 487-97.

41. Lundgaard, I.; Li, B.; Xie, L.; Kang, H.; Sanggaard, S.; Haswell, J. D.; Sun, W.; Goldman, S.; Blekot, S.; Nielsen, M.; Takano, T.; Deane, R.; Nedergaard, M., Direct neuronal glucose uptake heralds activity-dependent increases in cerebral metabolism. Nature communications 2015, 6, 6807.

42. Belanger, M.; Allaman, I.; Magistretti, P. J., Brain energy metabolism: focus on astrocyte-neuron metabolic cooperation. Cell Metab 2011, 14 (6), 724-38.

43. McKenna, M. C., Substrate competition studies demonstrate oxidative metabolism of glucose, glutamate, glutamine, lactate and 3-hydroxybutyrate in cortical astrocytes from rat brain. Neurochem Res 2012, 37 (11), 2613-26.

44. Wigren, H. K.; Rytkonen, K. M.; Porkka-Heiskanen, T., Basal forebrain lactate release and promotion of cortical arousal during prolonged waking is attenuated in aging. The Journal of neuroscience : the official journal of the Society for Neuroscience 2009, 29 (37), 11698-707.

45. Magistretti, P. J., Neuron-glia metabolic coupling and plasticity. Experimental physiology 2011, 96 (4), 407-10.

46. Magistretti, P. J., Role of glutamate in neuron-glia metabolic coupling. Am J Clin Nutr 2009, 90 (3), 875S-880S.

47. Haydon, P. G., Astrocytes and the modulation of sleep. Curr Opin Neurobiol 2017, 44, 28-33.

48. Dienel, G. A.; Cruz, N. F., Aerobic glycolysis during brain activation: adrenergic regulation and influence of norepinephrine on astrocytic metabolism. Journal of neurochemistry 2016, 138 (1), 14-52.

49. DiNuzzo, M.; Nedergaard, M., Brain energetics during the sleep-wake cycle. Curr Opin Neurobiol 2017, 47, 65-72.

50. Tang, F.; Lane, S.; Korsak, A.; Paton, J. F.; Gourine, A. V.; Kasparov, S.; Teschemacher, A. G., Lactate-mediated glia-neuronal signalling in the mammalian brain. Nature communications 2014, 5, 3284.

51. Lauritzen, K. H.; Morland, C.; Puchades, M.; Holm-Hansen, S.; Hagelin, E. M.; Lauritzen, F.; Attramadal, H.; Storm-Mathisen, J.; Gjedde, A.; Bergersen, L. H., Lactate receptor sites link neurotransmission, neurovascular coupling, and brain energy metabolism. Cerebral cortex 2014, 24 (10), 2784-95.

52. Nikonova, E. V.; Naidoo, N.; Zhang, L.; Romer, M.; Cater, J. R.; Scharf, M. T.; Galante, R. J.; Pack, A. I., Changes in components of energy regulation in mouse cortex with increases in wakefulness. Sleep 2010, 33 (7), 889-900.

172

53. Rohatgi, N.; Nielsen, T. K.; Bjorn, S. P.; Axelsson, I.; Paglia, G.; Voldborg, B. G.; Palsson, B. O.; Rolfsson, O., Biochemical characterization of human gluconokinase and the proposed metabolic impact of gluconic acid as determined by constraint based metabolic network analysis. PloS one 2014, 9 (6), e98760.

54. Corkins, M. E.; Wilson, S.; Cocuron, J. C.; Alonso, A. P.; Bird, A. J., The gluconate shunt is an alternative route for directing glucose into the pentose phosphate pathway in fission yeast. J Biol Chem 2017, 292 (33), 13823-13832.

55. Gerlach, J.; Loffler, M.; Schafer, M. K., Gene expression of enzymes required for the de novo synthesis and degradation of pyrimidines in rat peripheral tissues and brain. Nucleosides Nucleotides Nucleic Acids 2011, 30 (12), 1147-54.

56. Loffler, M.; Carrey, E. A.; Zameitat, E., Orotic Acid, More Than Just an Intermediate of Pyrimidine de novo Synthesis. J Genet Genomics 2015, 42 (5), 207-19.

57. Feenstra, M. G.; Botterblom, M. H.; Mastenbroek, S., Dopamine and noradrenaline efflux in the prefrontal cortex in the light and dark period: effects of novelty and handling and comparison to the nucleus accumbens. Neuroscience 2000, 100 (4), 741-8.

58. Taylor, N. E.; Van Dort, C. J.; Kenny, J. D.; Pei, J.; Guidera, J. A.; Vlasov, K. Y.; Lee, J. T.; Boyden, E. S.; Brown, E. N.; Solt, K., Optogenetic activation of dopamine neurons in the ventral tegmental area induces reanimation from general anesthesia. Proceedings of the National Academy of Sciences of the United States of America 2016.

59. Eban-Rothschild, A.; Rothschild, G.; Giardino, W. J.; Jones, J. R.; de Lecea, L., VTA dopaminergic neurons regulate ethologically relevant sleep-wake behaviors. Nature neuroscience 2016, 19 (10), 1356-+.

60. Ursin, R., Serotonin and sleep. Sleep Med Rev 2002, 6 (1), 55-69.

61. Ganellin, C.; Triggle, D. J., Dictionary of pharmacological agents. CRC Press: 1996.

62. Chesnoy-Marchais, D., Persistent GABAA/C responses to gabazine, taurine and beta-alanine in rat hypoglossal motoneurons. Neuroscience 2016, 330 (Supplement C), 191-204.

63. Hayaishi, O.; Nishizuka, Y.; Tatibana, M.; Takeshita, M.; Kuno, S., Enzymatic studies on the metabolism of beta-alanine. The Journal of biological chemistry 1961, 236, 781-90.

64. Tiedje, K. E.; Stevens, K.; Barnes, S.; Weaver, D. F., Beta-alanine as a small molecule neurotransmitter. Neurochemistry international 2010, 57 (3), 177-88.

65. Juge, N.; Omote, H.; Moriyama, Y., Vesicular GABA transporter (VGAT) transports beta-alanine. Journal of neurochemistry 2013, 127 (4), 482-6.

66. Hinard, V.; Mikhail, C.; Pradervand, S.; Curie, T.; Houtkooper, R. H.; Auwerx, J.; Franken, P.; Tafti, M., Key electrophysiological, molecular, and metabolic signatures of sleep and wakefulness revealed in primary cortical cultures. The

173

Journal of neuroscience : the official journal of the Society for Neuroscience 2012, 32 (36), 12506-17.

67. Davies, S. K.; Ang, J. E.; Revell, V. L.; Holmes, B.; Mann, A.; Robertson, F. P.; Cui, N.; Middleton, B.; Ackermann, K.; Kayser, M.; Thumser, A. E.; Raynaud, F. I.; Skene, D. J., Effect of sleep deprivation on the human metabolome. Proceedings of the National Academy of Sciences of the United States of America 2014, 111 (29), 10761-6.

68. Giskeodegard, G. F.; Davies, S. K.; Revell, V. L.; Keun, H.; Skene, D. J., Diurnal rhythms in the human urine metabolome during sleep and total sleep deprivation. Sci Rep 2015, 5, 14843.

69. Weljie, A. M.; Meerlo, P.; Goel, N.; Sengupta, A.; Kayser, M. S.; Abel, T.; Birnbaum, M. J.; Dinges, D. F.; Sehgal, A., Oxalic acid and diacylglycerol 36:3 are cross-species markers of sleep debt. Proceedings of the National Academy of Sciences of the United States of America 2015, 112 (8), 2569-74.

174

CHAPTER 3: CHARACTERIZATION OF NATIVE COBAMIDE FROM

DESULFITOBACTERIUM HAFNIENSE

175

PREFACE

In the spring of 2014, I was presented with an opportunity to collaborate with the

Lӧffler group to elucidate the structure of a novel, biosynthesized cobamide. Dr. Lӧffler

was a pioneer in the study of reductive dehalogenase microbial cultures, where he

assisted in the discovery of the first identified species, Dehalococcoides mccartyi. This

genus has the rare ability to use chlorine for respiration, where they frequently start with

perchloroethene and reduce this compound to ethene. Given this unique feature, a

combination of these species are now commonly used at bioremediation sites to remove

toxic levels of these chlorinated compounds.

Relative to this study, another unique feature of this genus is that they can

biosynthetically produce corrinoids, which are prosthetic groups for the enzymatically-

controlled reductive dechlorination. Prior to our study, 16 known cobamides had been

identified as naturally occurring compounds. The most commonly known cobamide is

vitamin B12, with all of these structures having an identical corrinoid ring; containing a

corrin cyclic system coordinated to cobalt, an alpha-ribazole phosphate moiety, and

accompanied lower base. The structure of the lower is base is commonly the unique

component of the naturally-occurring cobamide compounds.

Following the discovery of a novel cobamide compound by the Lӧffler group, I was

presented with the challenge of confirming the complete structure and identifying the

connectivity of the lower base. To accomplish the novel structure elucidation, I used high-

resolution mass spectrometry, isotope-labeling mass spectrometry, and nuclear magnetic

resonance spectroscopy.

The successful completion of this project marks the discovery of the 17th naturally-

occurring cobamide; the purinyl-cobamide was only the second compound discovered in

biology to contain unsubstituted purine. This compound was confirmed as a prosthetic

group for reductive dechlorination and could ultimately have additional biological function.

Personally, this project has additional meaning for research goals. By completing this

project, I have proven my skillset in the field of structure elucidation and provided a

technical set of tools for further analysis of novel cobamides, or other biological

176

compounds. When given a sufficient quantity of purified sample, and the correct set of

analytical instrumentation, a novel structure can successfully be elucidated.

177

A version of this chapter was originally published by Yan, et al.:

Reproduced with permission Yan, J.; Bi, M.; Bourdon, A. K.; Farmer, A. T.; Wang,

P.; Molenda, O.; Quaile, A.; Jiang, N.; Yang, Y.; Yin, Y.; Simsir, B.; Campagna, S. R.;

Edwards, E. A.; Loffler, F. Purinyl-cobamide is a Novel Native Prosthetic Group of

Reductive Dehalogenases. Nature Chemical Biology 2017, doi: 10.1038/nchembio.2512

Contributions:

FEL, JY, and SRC conceptualized the research and designed experiments. JY, MB, BS,

Y. Yang, and Y. Yin performed cultivation work, corrinoid extraction and purification, and

phylogenetic analyses. AKB and ATF performed LC–MS and structural analyses. PW,

OM and AQ performed BN–PAGE, enzyme assays, and proteomic analysis. NJ

generated cobT expression clones. All authors contributed to data analysis and

interpretation, and JY, AKB, SRC, EAE, and FEL wrote the manuscript.

178

3.1 ABSTRACT

Cobamides such as vitamin B12 are structurally conserved, cobalt-containing

tetrapyrrole biomolecules that have essential biochemical functions in all domains of life.

In organohalide respiration, a vital biological process for the global cycling of natural and

anthropogenic organohalogens, cobamides are the requisite prosthetic groups for

carbon–halogen bond-cleaving reductive dehalogenases. This study reports the

biosynthesis of a new cobamide with unsubstituted purine as the lower base and assigns

unsubstituted purine a biological function by demonstrating that Coα-purinyl-cobamide

(purinyl-Cba) is the native prosthetic group in catalytically active tetrachloroethene

reductive dehalogenases of Desulfitobacterium hafniense. Cobamides featuring different

lower bases are not functionally equivalent, and purinyl-Cba elicits different physiological

responses in corrinoid-auxotrophic, organohalide-respiring bacteria. Given that

cobamide-dependent enzymes catalyze key steps in essential metabolic pathways, the

discovery of a novel cobamide structure and the realization that lower bases can

effectively modulate enzyme activities generate opportunities to manipulate

functionalities of microbiomes.

179

3.2 INTRODUCTION

Corrinoids are the most complicated organometallic cofactors used in biology to

catalyze essential biochemical reactions including methyl group transfer, carbon skeleton

rearrangement and reductive dehalogenation1. Complete corrinoids (i.e., cobamides)

consist of an upper Coβ ligand, a central cobalt-containing corrin ring, and a lower Coα

base as part of the nucleotide loop that is connected to the corrin ring2. For example,

vitamin B12 (cyanocobalamin) carries the artificial cyano group as an upper Coβ ligand

and 5,6-dimethylbenzimidazole (DMB) as the lower base (Figure 3.1). Variations in

cobamide (Cba) structure exist in the upper ligand, the lower base, and, in one

documented case, the side chain in the nucleotide loop3. Physiologically functional

cobamides use a methyl group or a 5′-deoxyadenosyl moiety as the upper ligand and one

of 16 known lower bases connected to the nucleotide loop2 (Fig. 1). Reductive

dehalogenation reactions can be mediated abiotically by vitamin B12 and its analogs in

the presence of a strong reductant capable of generating the cobalt(I) supernucleophile4

or can be catalyzed by corrinoid-dependent reductive dehalogenases (RDases)5. In either

case, the cobalt(I) supernucleophile is critical for the initiation of carbon–halogen bond

cleavage6.

Recently resolved RDase crystal structures of NpRdhA (PDB ID 4RAS) from

Nitratireductor pacificus and PceA (PDB ID 4UR0) from Sulfurospirillum multivorans

demonstrate that their prosthetic groups coenzyme B12 and norpseudo-B12, respectively,

are in the base-off configurations, indicating that their respective lower bases, DMB and

adenine, are uncoordinated and distant from the redoxactive cobalt atom7,8. Therefore,

the lower base is not assigned a direct role in catalysis or electron transfer for restoring

the reactive cobalt(I) state. Contrary to expectations, lower-base structure does impact

reductive dechlorination rates and growth of obligate organohalide-respiring, corrinoid-

auxotrophic Dehalococcoides mccartyi (Dhc) strains9,10. Maximum reductive

dichlorination activity and Dhc growth require the addition of cobamides carrying DMB or

5-methylbenzimidazole (5-MeBza) as the lower base, and cobamides with other lower-

base structures compromise growth (e.g., 5-methoxybenzimidazole, 5-OMeBza;

benzimidazole, Bza) or cause complete loss of reductive dechlorination activity (e.g., 5-

180

hydroxybenzimidazole, 5-OHBza; adenine)10,11. The lower base structure also affects

substrate utilization in the homoacetogen Sporomusa ovata, which uses phenolic

cobamide-dependent methyltransferases for energy conservation and carbon

assimilation using the Wood–Ljungdahl pathway12. The addition of 5-Me- Bza or DMB to

the medium results in the formation of non-native 5-methylbenzimidazolyl-cobamide (5-

MeBza-Cba) or cobalamin, respectively, severely inhibiting growth with methanol or 3,4-

dimethoxybenzoate as substrates12. These findings indicate that the lower bases can

affect enzyme activity and cause substantial consequences to the host organisms;

however, the mechanistic understanding is lacking. To date, 16 naturally occurring lower

bases have been identified, mostly from anaerobic bacteria, with the most recent

structure, phenol in phenolyl-cobamide of Sporomusa ovata (Figure 3.1), discovered in

198913.

Members of the genus Desulfitobacterium (Dsf) are strictly anaerobic,

metabolically versatile, Gram-positive bacteria common in subsurface environments,

where they contribute to the reductive dehalogenation of organohalogens, including

groundwater contaminants such as chlorinated solvents14,15. The tetrachloroethene

(PCE) RDases have a strict requirement for cobamide as a prosthetic group, and

generate predominantly cis-1,2-dichloroethene (cDCE) and inorganic chloride as

products16. The characterized PCE-dehalogenating Dsf pure cultures grow in defined

medium without exogenous corrinoids, indicating that these Dsf strains are capable of de

novo corrinoid biosynthesis17. Genome sequence analysis corroborates that Dsf strains

possess the complete set of genes required for cobinamide biosynthesis and lower base

activation and attachment, but the identity of the lower base of native Dsf cobamide(s)

remains elusive18.

Here we report the discovery and characterization of purinyl-Cba (1) as the native

cobamide produced in axenic PCE-dechlorinating Dsf cultures and demonstrate its

distinct functionality in different corrinoid-auxotrophic organohalide-respiring bacteria.

Direct detection of purinyl-Cba was achieved in catalytically active PCE RDase following

181

Figure 3.1 Cobamide general structure and the 16 known lower bases found in

naturally occurring cobamides

Variations in cobamide structures are found in the Coβ upper ligand, the side chain at

position C176, and Coα lower base. 5-OHBza, 5-hydroxybenzimidazole; 5-OMeBza, 5-

methoxybenzimidazole; 5-OMe-6-MeBza, 5-methoxy-6-methylbenzimidazole; DMB, 5,6-

dimethylbenzimidazole; Bza, benzimidazole; 5-MeBza, 5-methylbenzimidazole; 2-

MeAde, 2-methyladenine; 2-SMeAde, 2-methylmercaptoadenine; 2-SOMeAde,2-

methylsulfinyladenine; 2-SO2MeAde, 2-methylsulfonyladenine.

182

electrophoretic separation, illustrating an innovative approach for rapid characterization

of corrinoid prosthetic groups. The results obtained expand the diversity of naturally

occurring cobamide structures and assign a biological function to unsubstituted purine.

3.3 RESULTS

3.3.1 Discovery and structure of a novel cobamide

HPLC analysis of the cyanated form (for example, a cyano group as the upper β

ligand) of corrinoid extracts from PCE-grown Dsf pure cultures (i.e., Dsf strains Y51, JH1,

Viet1 and PCE1) revealed the presence of three candidate corrinoids with retention times

of 11.79 min (1), 15.74 min (2) and 15.95 min (3) (Figure 3.2A and 3.3A). Integrated peak

areas at 361 nm of the total fractions eluting between 10 and 18 min (i.e., the range of

retention times for seven Cba standards, 4–10; Figure 3.2A) showed that the

predominant corrinoid produced in the Dsf cultures was associated with the 11.79 min

fraction. This retention time was different from that of cobinamide (Cbi; which eluted at

8.77 min as monocyano-Cbi and 15.63 min as dicyano-Cbi19; Figure 3.3B) and any of

the cobamide standards, indicating that the Dsf strains produced a distinct corrinoid. The

UV-visible (Vis) spectrum of the predominant D. hafniense strain Y51 corrinoid (1)

substantially overlapped with that of vitamin B12 (10), including the 361 nm absorption

maximum, but was distinct from the Cbi spectrum with a 355 nm absorption maximum

(Figure 3.2B). Two minor fractions that eluted after the predominant Dsf corrinoid showed

absorption spectra and retention times (15.74 and 15.95 min) similar to those of Cbi,

suggesting that these minor fractions may represent Cbi precursors (Figure 3.4).

Mass spectra of the D. hafniense strain Y51 corrinoid and of vitamin B12 standard

obtained using LC–MS displayed strong base peaks with m/z values of 1,329.54 and

1,355.58, respectively, corresponding to intact corrinoid ions [M+H]+ (Figure 3.5A, B).

The base peaks with m/z values of 1,351.52 and 1,377.56 represented the [M+Na]+ ion

form of the strain Y51 corrinoid and vitamin B12, respectively. The mass spectra of the

predominant corrinoids from Dsf strains JH1, Viet1 and PCE1 matched that of D.

183

hafniense strain Y51, showing base peaks with m/z values of 1,329.54 and 1,351.52

corresponding to their [M+H]+ and [M+Na]+ ion forms, respectively (Figure 3.5C–E). As

the molecular mass of the α-ribazole-5′-phosphate (α-RP) moiety in natural cobamides

ranges from 306.2 (with phenol as the lower base) to 425.31 Da (with 2-

methylsulfonyladenine as the lower base), a mass difference of 312.42 Da between the

measured molecular mass of the Dsf corrinoid and the calculated molecular mass of Cbi

(1,016.12 Da in the monocyano form) indicated that the predominant Dsf corrinoid was a

cobamide carrying an α-RP moiety with a yet-unidentified lower base. Comparison to the

calculated masses of naturally occurring cobamides in their cyanated form suggested that

the organohalide-respiring Dsf strains produce a unique cobamide that is distinct from

any currently known natural cobamide. Based on mass information, a possible molecular

formula for the Dsf cobamide was deduced as C59H82CoN16O14P.

In the nor-type corrinoid produced by Sulfurospirillum multivorans, C176 of the side

chain is demethylated3 (Figure 3.1). To test whether demethylation or any other

modification exists in the cobinamide structure of this novel Dsf cobamide, we grew D.

hafniense strain Y51 cultures with PCE as an electron acceptor in the presence of 25 μM

DMB. The addition of DMB was shown to trigger the synthesis of a non-native

cobamide12,20. This guided cobamide biosynthesis approach with strain Y51 resulted in

the formation of cobalamin, as determined by HPLC retention time, UV-Vis spectrum

(Figure 3.2C, D), and mass spectral features with two strong peaks having m/z values of

1,355.58 ([M+H]+) and 1,377.56 ([M+Na]+) (Figure 3.5F). Similarly, we detected Bza-Cba

(5) exclusively in strain Y51 cultures that received Bza (Figure 3.6). Guided cobamide

biosynthesis does not change the assembly of the cobinic acid skeleton as prior studies

have suggested20,21. Thus, similar PCE-to-cDCE dechlorination performance in strain

Y51 cultures producing the Dsf native cobamide, cobalamin, or Bza-Cba indicated that

the different prosthetic groups supported functionality of the Dsf PceA RDase.

Collectively, these findings confirmed that the new cobamide natively synthesized in Dsf

strains did not possess any unusual modifications. Based on this information, the

molecular mass of the lower base compound in the Dsf cobamide was estimated to be

184

Figure 3.2 Spectrophotometric and structural features of Desulfitobacterium native

corrinoids

(A) HPLC chromatograms of the native corrinoids produced by D. hafniense strain Y51

eluted at 11.79 min (1), 15.74 min (2), and 15.94 min (3). The predominant corrinoid peak

at 11.79 min accounted for 86% of the total corrinoids produced by strain Y51 based on

361 nm peak area integration. Cobamide standards (5 mg/L each) were norpseudo

vitamin B12 (4), 11.23 min; Bza-Cba (5), 13.34 min; 5-OMeBza-Cba (6), 13.88 min; p-

cresol-Cba (7), 17.23 min and 17.64 min; 5-OHBza-Cba (8), 13.13 min; 5-MeBza-Cba

(9), 13.89 min; vitamin B12 (10), 15.02 min. mAU, milli-absorbance units. (B) UV-Vis

spectra (250–600 nm) of cobinamide (cbi), vitamin B12 and the 11.79-min native Dsf

corrinoid. (C) HPLC chromatogram and (D) UV-Vis spectrum of the non-native cobamide

produced in strain Y51 cultures with 25 μM DMB amendment. Dotted lines in B and D

indicate the maximum absorbance wavelengths (λmax) of a cobinamide or a cobamide,

respectively. (E) Mass spectra of 15N-labeled and unlabeled native Dsf corrinoid. Mass

shifts in [M+H]+ and [M+Na]+ values (as shown by red arrows) confirmed that the Dsf

cobamide contains four N atoms in the lower base structure. (F) The superimposed 1H

NMR spectra of the Dsf corrinoid (black line) and the vitamin B12 standard (blue line). The

letters A, B and C in red correlate the protons on the structure to the corresponding 1H

NMR signals.

185

Figure 3.2A-B Continued

(A)

(B)

186

Figure 3.2C-D Continued

(C)

(D)

187

Figure 3.2E-F Continued

(E)

(F)

188

Figure 3.3 The native corrinoids produced by several PCE-dechlorinating

Desulfitobacterium (Dsf) strains

(A) HPLC chromatograms of the corrinoids extracted from axenic cultures of Dsf

hafniense strain JH1, Dsf sp. strain Viet1, and Dsf sp. strain PCE1.

(B) The HPLC chromatogram of a cobinamide standard (5 mg/L), which was separated

into the monocyano- (8.77 min) and dicyano- (15.63 min) forms.

189

Figure 3.3A-B Continued

(A)

(B)

190

Figure 3.4 UV-Vis of novel cobamides

The UV-Vis spectra (250-600 nm) of the two compounds that eluted after 15.74 min and

15.94 min showed absorption peaks at 355 nm, distinct from complete cobamides in the

cyano form. These compounds likely represent cobinamide precursors.

191

Figure 3.5 The mass spectra of cobamides produced by different Dsf strains and

authentic vitamin B12

(A) The mass spectrum of the predominant Dsf native corrinoid produced by Dsf

hafniense strain Y51. (B) The mass spectrum of authentic vitamin B12. The mass spectra

of the predominant corrinoid produced by (C) Dsf hafniense strain JH1, (D) Dsf sp. strain

Viet1, and (E) Dsf sp. strain PCE1. (F) The mass spectrum of the non-native cobamide

produced in Dsf hafniense strain Y51 cultures with 25 μM DMB amendment.

192

Figure 3.5A-C Continued

(A)

(B)

(C)

193

Figure 3.5D-F Continued

(D)

(E)

(F)

194

Figure 3.6 Guided cobamide biosynthesis by Dsf hafniense strain Y51

(A) HPLC chromatograms of a benzimidazolyl-cobamide (Bza-Cba) standard (5 mg/L)

and the non-native cobamide formed in strain Y51 cultures amended with 25 μM

benzimidazole (Bza). (B) UV-Vis spectra (250-600 nm) of the Bza-Cba standard and the

non-native cobamide synthesized in strain Y51 cultures with an adsorption maximum of

361 nm.

(A)

(B)

195

120.15 (1,329.54 ([M+H]+ of cyanated Dsf cobamide) – [1,355.58 ([M+H]+ of

cyanocobalamin) – 146.19 (DMB)]), which is suggestive of unsubstituted purine.

3.3.2 Confirmation of the novel lower base structure

The cobinic acid skeleton in the cyanated form carries a constant number of 12

nitrogen atoms. Depending on the lower base, naturally occurring cobamides possess 12

to 17 nitrogen atoms. Thus, the number of nitrogen atoms distinguishes a cobamide with

an unsubstituted purine as the lower base (12 + 4 = 16 nitrogen atoms) from cobamides

that carry nucleobases (for example, adenine or guanine; 12 + 5 = 17 nitrogen atoms),

Bza (12 + 2 = 14 nitrogen atoms) or phenol derivatives (12 + 0 = 12 nitrogen atoms).

Based on these structural characteristics, we conducted 15N isotope-labeling experiments

with D. hafniense strain Y51 to determine the number of nitrogen atoms in the unknown

lower base structure. The m/z values for the base peaks of the [M+H]+ and [M+Na]+ ion

forms of the 15N-labeled cobamide shifted from 1,329.54 to 1,344.48 and 1,351.52 to

1,366.46, respectively, corresponding to a 14.94 Da mass increase (Figure 3.2E). Based

on this mass shift, we calculated that the total number of nitrogen atoms in the native Dsf

cobamide is 16 (15 plus one unlabeled nitrogen in the upper CN ligand), indicating that

the lower base contains 4 nitrogen atoms (i.e., 16–12). Hypoxanthine, a purine derivative

with 4 N atoms, is the lower base of a native cobamide in Desulfovibrio vulgaris22;

however, hypoxanthine-Cba in its cyanated form has a calculated molecular mass of

1,345.29, which is different from the measured [M+H]+ m/z value of 1,329.54 for the Dsf

cobamide. Collectively, 15N isotope labeling followed by MS analysis provided additional

evidence that unsubstituted purine served as the lower base in the native Dsf cobamide.

To confirm unsubstituted purine as a new naturally occurring lower base, we

conducted 1D and 2D NMR spectroscopy experiments using the native Dsf cobamide.

The superimposed 1H NMR spectra (Figure 3.2F) of authentic vitamin B12 (10) and the

purified native Dsf cobamide (1) revealed that the only notable changes (i.e., chemical

shifts) occurred in the aromatic region (9.0–6.0 ppm.), which was primarily associated

with the DMB portion of vitamin B12. Homonuclear correlation spectroscopy (COSY)

experiments with the Dsf cobamide and vitamin B12 (Figure 3.7) revealed spin–spin

196

coupling between neighboring protons, but the spectra differed in the aromatic region.

The lower base aromatic protons in the Dsf cobamide lacked a correlation with other

protons in the molecule, suggesting that the aromatic moiety does not have any adjacent

protons. Hydrogen atoms A, B, and C in Figure 3.2F directly correlate with the three

hydrogen atoms of purine. In comparison, the vitamin B12 COSY spectrum demonstrated

direct correlations between the benzyl protons (7.3 and 6.5 ppm) and the adjacent methyl

group (2.2 ppm) of the DMB moiety. These experiments support the assignment of

unsubstituted purine as the lower base of native Dsf cobamide. Purine-containing

compounds can exist as four regioisomers through covalent bonding at each of the N

heteroatoms, but the limited amount of purinyl-Cba extractable from Dsf cultures did not

allow stereoisomer confirmation by 13C and/or 15N NMR spectroscopic analyses. Prior

research has shown that the 9H and 7H purine tautomers of purine are favored over 3H

and 1H purine because of increased aromaticity (tautomer stability: 9H > 7H > 3H > 1H)23.

Based on these observations and on precedence for purines to form bonds with an

imidazole nitrogen24, the N-glycosidic bond was inferred to be analogous to that observed

in other biomolecules. This combined suite of analytical techniques offers a practical

approach for lower base characterization and can aid in the discovery of new corrinoids.

3.3.3 Purinyl-Cba is the prosthetic group of Dsf PceA RDases

Mature Dsf PceA RDases are in the 50–60 kDa mass range14,16, but maximum

reductive dechlorination activity is generally associated with bands excised from blue

native PAGE (BN–PAGE) gels in the 242–480 kDa region, presumably because of

complexation with other proteins25. Following the nondenaturing separation of D.

hafniense strain JH1 crude extracts (Figure 3.8), the highest dechlorination activity was

found to be associated with gel slice #4, whereas the other five gel slices exhibited no

detectable or negligible (<8%) cDCE production from TCE (Figure 3.9A). Subsequent in-

gel extraction recovered corrinoid from gel slice #4, but not from slices #3 and #5, and

ultra-performance liquid chromatography-high resolution mass spectrometry (UPLC–

HRMS) revealed that the corrinoid associated with gel slice #4 and the purinyl-Cba

standard (Figure 3.9B, C) had matching retention times and m/z values. The proteomic

analysis of gel slices #3, #4, and #5 demonstrated that the Dsf PceA RDase

197

Figure 3.7 Results from homonuclear correlation spectroscopy (COSY)

experiments

Gradient-selected COSY nuclear magnetic resonance spectra of (A) the Dsf corrinoid

(0.7 mg in 250 μL methanol-d4 solution) and (B) a vitamin B12 standard (0.7 mg in 250

μL methanol-d4 solution).

198

Figure 3.7A-B Continued

(A)

(B)

199

Figure 3.8 BN-PAGE of Dsf hafniense strain JH1

Representative image of a blue native polyacrylamide gel electrophoresis (BN-PAGE) gel

used for Dsf hafniense strain JH1 crude protein separation and subsequent in-gel

analysis of PceA reductive dechlorination activity.

200

Figure 3.9 Identification of purinyl-Cba as the native prosthetic group in Dsf PCE

RDase following nondenaturing, gel-electrophoretic separation of Dsf crude

protein extracts using BN–PAGE

(A) TCE -to-cDCE dechlorination activity of different BN–PAGE gel slices measured using

dehalogenation enzyme assays.

(B,C) UPLC separation and MS analysis of the corrinoid recovered from BN–PAGE gel

slice #4 showing the highest dechlorination activity (B) and the purinyl-Cba standard (0.25

mg/L) (C).

201

Figure 3.9A Continued

(A)

202

Figure 3.9B-C Continued

(B)

(C)

203

(WP_011460641.1) was enriched in gel slice #4 along with carbon monoxide

dehydrogenase (CODH) and flavin adenine dinucleotide (FAD)-dependent fumarate

reductase, which are both corrinoid-independent enzymes (Table 3.1)26,27. CODH may

occur in complexes with corrinoid-dependent, Wood–Ljungdahl pathway enzymes (e.g.,

5-methyltetrahydrofolate-homocysteine methyltransferase), but no such proteins were

detected in gel slice #4. Purinyl-Cba was the only corrinoid detected in this gel slice,

confirming that the Dsf PceA RDase uses purinyl-Cba as the native prosthetic group.

3.3.4 Dsf CobT substrate specificity and phylogenetic analysis

The nicotinate-nucleotide-dimethylbenzimidazole phosphoribosyltransferase

(CobT) activates lower bases to their respective α-RP forms (Figure 3.10A), and the

CobT substrate specificity determines the type of cobamide produced19. CobT sequences

encoded in sequenced Dsf genomes are highly conserved (81.3–100% amino acid

identity) except for Desulfitobacterium metallireducens strain DSM 15288, whose CobT

shares no more than 58.5% amino acid identity with other available Dsf CobT sequences.

A broader phylogenetic analysis clustered bacterial CobT sequences into distinct clades

reflecting the substrate specificities (i.e., lower base type activated) of characterized

CobT, and provided clues about the native cobamides produced by the respective host

organisms (Figure 3.10B and Table 3.2). This analysis further revealed that the Dsf CobT

clade was distinct (<52% amino acid identity) from any other CobT implicated in phenol–

p-cresol, adenine, guanine–hypoxanthine or Bza-type lower base activation. The most

closely related sequences to the Dsf CobT clade (except for D. metallireducens CobT)

were found in Dehalobacter (Dhb) and Desulfosporosinus (e.g., Desulfosporosinus

youngiae strain DSM 17734, CM001441.1; Desulfosporosinus meridiei strain DSM

13257, CP003629.1; Desulfosporosinus orientis strain DSM 765, CP003108.1) genomes,

with 57.8–59.3% and 56.6–61.7% amino acid identity, respectively (Figure 3.10B);

however, the native corrinoids produced in either Dhb or Desulfosporosinus spp. strains

have not yet been identified. The high CobT sequence identities among these members

204

Table 3.1 Proteomic analysis of the Desulfitobacterium (Dsf) hafniense strain JH1

proteins associated with different BN-PAGE slices

Gel slice #

Protein ladder range (kDa)a

No. of distinct

peptidesb

Total species countsb

Protein description NCBI accession

no.

1 ≥ 720 - - - -

2 480 - 720 - - - -

3 346 - 480 5 11 Pyruvate ferredoxin

oxidoreductase WP_019849101.1

5 18 Acetyl-CoA synthase WP_005812973.1

4 204 - 346

6 8 CO dehydrogenase WP_011459977.1

4 6 Tetrachloroethene dehalogenase WP_011460641.1

5 11 FAD-dependent fumarate

reductase WP_005817128.1

5 112 - 204

2 6 Pyridoxamine 5'-phosphate

oxidase WP_005815111.1

7 10 FAD-dependent fumarate

reductase WP_005817128.1

3 4 Substrate-binding ABC

transporter WP_005812007.1

2 2 Peptidoglycan-binding protein

LysM WP_015943955.1

6 ≤ 112 - - - -

a BN-PAGE lanes were separated into slices based on the position of proteins in a MW

ladder. The MW ranges were estimated from a standard curve created by interpolating

the log MW of individual ladder proteins (146, 242, 480, 720 and 1,048 KDa) versus the

ratio (Rf) of migration distance of each ladder protein to the migration distance of the

Coomassie Blue dye front. Note that the actual MWs of Dsf proteins do not necessarily

match the calculated MWs based on BN-PAGE separation.

b In-gel peptide digestion and proteomic analysis were performed on gel slices # 3, 4, and

5, but not # 1, 2, and 6.

205

Figure 3.10 Phylogenetic analysis of CobT homologous proteins and substrate

specificity of Dsf CobT

(A) The Dsf CobT activated DMB or purine to their respective α-ribazole-5′-phosphate (α-

RP) forms. NaMN, nicotinic acid mononucleotide.

(B) Phylogenetic relationship of 40 CobT and homologous proteins from phylogenetically

diverse corrinoid-auxotrophic and prototrophic bacteria. Solid black dots indicate CobT

enzymes with biochemically determined substrate specificities. CobT enzymes of other

members of the Peptococcaceae may share catalytic features with the Dsf CobT and

activate purine as a lower base for cobamide biosynthesis (indicated by the dashed line–

enclosed pink area).

(C) HPLC analysis demonstrating purified CobT activity with NaMN and a lower base as

the substrates. The small peak to the left of nicotinic acid in the bottom trace (Dhc CobT

assay with purine) has a retention time similar to that of α-RP [purine] shown in the panel

above, but spectral analysis revealed distinct absorbance features.

(D) The formation of α-RP [DMB] or α-RP [purine] in CobT assays with DMB or purine

provided as a lower base substrate. The α-RP concentrations were calculated on the

basis of the concentration decreases of the respective lower base substrates. Data are

averages of measurements from duplicate assays. The (*) indicates that no α-RP [purine]

production was observed in Dhc CobT assays with purine as the lower base.

(E) MS analysis of α-RP [DMB] and α-RP [purine] formed in CobT enzyme assays.

206

Figure 3.10A Continued

(A)

207

Figure 3.10B Continued

(B)

208

Figure 3.10C Continued

(C)

209

Figure 3.10D Continued

(D)

210

Figure 3.10E Continued

(E)

211

Table 3.2 Information about CobT and homologous proteins used for phylogenetic

tree construction (Figure 4.4B in main text)

Indicated are the host organisms, the designations of the CobT homologous proteins, the

experimentally determined or inferred (based on the native types lower bases produced

in the respective host organisms) substrate specificity, the locus tag numbers of the

corresponding genes, and the NCBI accession numbers of the proteins.

Organism CobT

homologue Substrate specificity

Locus tag NCBI accession

no. Ref.

Acetobacterium woodii

DSM 1030 CobT Bza type Awo_c14620 AFA48245.1 1

Eubacterium limosum

strain KIST612 CobT Bza type ELI_4217 ADO39159.1 1

Geobacter sulfurreducens

strain PCA CobT Bza type GSU3009 AAR36401.1 1

Geobacter lovleyi

strain SZ CobT Bza type Glov_3678 ACD97377.1 1

Pelobacter propionicus DSM 2379

CobT Bza type Ppro_2806 ABL00406.1 2

Moorella thermoacetica ATCC 39073

CobT Bza type Moth_1721 ABC20023.1 3

Dehalococcoides mccartyi strain 195

CobT Bza type DET0657 AAW40094.1 4

Clostridium sticklandii DSM 519

CobT Adenine

type CLOST_0282 CBH20412.1 5

Sulfurospirillum multivorans DSM 12446

CobT Adenine

type SMUL_1547 AHJ12807.1 6

Clostridium cochlearium DSM 1285

CobT Adenine

type SAMN05216497_10222

6 SDK92407.1 7

Veillonella parvula

DSM 2008 CobT

Adenine type

Vpar_1602 ACZ25278.1 4

Lactobacillus reuteri

DSM 20016 CobT

Adenine type

Lreu_1695 ABQ83934.1 4

212

Table 3.2 Continued

Organism CobT

homologue Substrate specificity

Locus tag NCBI accession

no. Ref.

Salmonella enterica strain LT2

CobT Adenine

type STM2016 AAL20920.1 4

Pelosinus fermentans strain

R7 ArsA

Phenol type

N/A WP_007950675.1 8

Sporomusa ovata DSM 2662

ArsA Phenol

type N/A AEG78648.1 9

Veillonella parvula DSM 2008

ArsA Phenol

type Vpar_1456 ACZ25133.1 4

Pelosinus fermentans strain

R7 ArsB

Phenol type

N/A WP_007950676.1 8

Sporomusa ovata DSM 2662

ArsB Phenol

type N/A WP_021169525.1 9

Veillonella parvula DSM 2008

ArsB Phenol

type Vpar_1457 ACZ25134.1 4

Desulfovibrio vulgaris strain Hildenborough

CobT Guanine

type DVU_3279 AAS97749.1 10

Desulfobacterium sp. strain PCE1

CobT Purine DESPCE1_RS0113770 WP_014794544.1 This study

Desulfobacterium hafniense strain

Y51 CobT Purine DSY_RS11275 WP_018211350.1

This study

Desulfobacterium dichloroeliminans

strain LMG-P21439

CobT Unknown Desdi_2285 AGA69715.1 This study

Desulfobacterium dehalogenases ATCC 51507

CobT Unknown Desde_2751 AFM01064.1 This study

Desulfobacterium sp. strain PCP-1

CobT Unknown N/A WP_005812799.1 This study

Desulfobacterium hafniense strain

PCS-S CobT Unknown DPCES_2346 CDX02233.1

This study

Desulfobacterium hafniense strain

DCB-2 CobT Unknown DHAF_RS16390 WP_018211350.1

This study

Desulfobacterium hafniense strain

TCP-A CobT Unknown DESHAF_RS0103255 WP_018211350.1

This study

Desulfobacterium metallireducens

DSM 15288 CobT Unknown DESME_08705 AHF07147.1

This study

213

Table 3.2 Continued

Organism CobT

homologue

Substrate specificit

y Locus tag

NCBI accession no.

Ref.

Dehlaobacter sp. strain CF

CobT Unknown DCF50_p694 AFV04701.1 This study

Dehlaobacter sp. strain DCA

CobT Unknown DHBDCA_p636 AFV01665.1 This study

Dehlaobacter restrictus

strain PER-K23 CobT Unknown DEHRE_07530 AHF09955.1

This study

Dehlaobacter sp. strain UNSWDHB

CobT Unknown N/A WP_015042707.1 This study

Dehlaobacter sp. strain E1

CobT Unknown N/A WP_019225400.1 This study

Desulfosporosinus orientis

DSM 765 CobT Unknown Desor_1444 AET67101.1

This study

Desulfosporosinus meridiei

DSM 13257 CobT Unknown Desmer_1443 AFQ43436.1

This study

Desulfosporosinus youngiae

DSM 17734 CobT Unknown

DesyoDRAFT_1368

EHQ88526.1 This study

Desulfosporosinus sp. strain BRH_c37

CobT Unknown APF81_21415 KUO78188.1 This study

Desulfosporosinus sp. strain I2

CobT Unknown N/A WP_045573178.1 This study

Desulfosporosinus sp. strain HMP52

CobT Unknown N/A WP_034602331.1 This study

214

of the Peptococcaceae suggested that purine activation to the α-RP derivative is a shared

feature of this family (Figure 3.10B).

Cultivation work indicates that Dhc CobT utilizes a variety of benzimidazole-type

lower bases with a preference for DMB10,11. In vitro enzyme assays with purified Dsf CobT

and Dhc CobT (Figure 3.11A) with nicotinic acid mononucleotide (NaMN) and purine or

DMB as substrates verified that Dsf CobT and Dhc CobT both activated DMB to the α-

RP form of DMB (α-RP [DMB]; Figure 3.10C), consistent with the observation that

exogenous DMB guided Dsf to produce cobalamin as a non-native prosthetic group of

the PceA RDase. The Dsf and Dhc CobT enzymes activated DMB (250 μM), and 166.9

± 2.70 and 159.4 ± 1.13 μM α-RP [DMB], respectively, were produced following a 30-min

incubation period (Figure 3.10D). In Dsf CobT assays in which purine (250 µM) replaced

DMB, the conversion yield to α-RP [purine] exceeded 99% after a 30-min incubation

period (Figure 3.10C, D). In assays with Dhc CobT, purine was not consumed, α-RP

[purine] was not produced, and only small amounts of nicotinate were observed,

indicating that Dhc CobT was unable to activate unsubstituted purine (Figure 3.10C, D).

No α-RP formation occurred in controls lacking NaMN, a lower base, or CobT,

corroborating that Dsf CobT catalyzed the activation of unsubstituted purine to α-RP

[purine] (Figure 3.11B). MS analysis performed on fractions containing CobT enzyme

assay products showed strong adducts with m/z ([M+H]+) values of 359.10 and 333.06

matching the calculated molecular mass of α-RP [DMB] and α-RP [purine], respectively

(Figure 3.10E). These findings demonstrated an unprecedented Dsf CobT specificity for

unsubstituted purine, consistent with the discovery of purinyl-Cba as the native prosthetic

group of Dsf PceA.

3.3.5 Effects of purinyl-Cba on dechlorinating activity

To test whether purinyl-Cba supports corrinoid-dependent reductive dechlorination

in corrinoid-auxotrophic organohalide-respiring bacteria, we grew axenic Dehalobacter

restrictus strain PER-K23 and Dhc cultures with purinyl-Cba. Strain PER-K23 harbors a

PceA RDase with 98.7% amino acid identity to the PceA of D. hafniense strain Y51. Strain

215

Figure 3.11 Heterologous expression of Dsf CobT and Dhc CobT in E. coli and

requirements for lower base activation

(A) SDS-PAGE image of Dsf CobT and Dhc CobT carrying an N-terminal hexa-histidine

tag purified from recombinant E. coli cells.

(B) HPLC chromatograms of CobT enzyme assay controls demonstrating that the

formation of alpha-ribazole-5’-phosphate requires nicotinic acid mononucleotide (NaMN),

a lower base, and CobT.

216

Figure 3.11A-B Continued

(A)

(B)

217

PER-K23 cultures that received 36.9 nM of vitamin B12 (positive control) or purinyl-Cba

completely dechlorinated the initial amount of 64.4 ± 2.3 μmol of PCE to cDCE within 6 d

at statistically indifferent rates of 427 ± 25 and 471 ± 39 μM Cl− released per day,

respectively (Figure 3.12A). Much lower dechlorination rates of 23.7 ± 9.3 μM Cl−

released per day, resulting in the formation of small amounts of trichloroethene (TCE; 8.2

± 2.5 μmol) and cDCE (5.4 ± 2.5 μmol), occurred in control incubations without exogenous

corrinoid (Figure 3.12A). Strain PER-K23 cell numbers increased about 50-fold in purinyl-

Cba- and vitamin B12-amended cultures, whereas growth was negligible in control

cultures without corrinoid addition (Table 3.3). Biomass from purinyl-Cba- and vitamin

B12-fed Dhb cultures exclusively contained purinyl-Cba and vitamin B12, respectively,

indicating that cobamide or lower base modifications did not occur (Figure 3.12B). These

findings demonstrated that both D. restrictus strain PER-K23 and D. hafniense strain Y51

PceA RDases were fully functional with either purinyl-Cba or cobalamin as the prosthetic

group.

Corrinoid-auxotrophic Dhc pure cultures demonstrated a different response to

purinyl-Cba. Dhc strains BAV1 and GT express the BvcA and VcrA RDase, respectively,

which share less than 20% amino acid identity with the Dsf and Dhb PceA RDases.

Complete reductive dechlorination of cDCE to ethene occurred in vitamin B12-amended

Dhc strain BAV1 and strain GT cultures at rates of 201 ± 11 and 197 ± 10 μM Cl− released

per day, respectively (Figure 3.12C and 3.13). Strain BAV1 and strain GT cultures with

purinyl-Cba as the sole corrinoid amendment exhibited much slower cDCE dechlorination

rates of 17.6 ± 1.2 and 11.7 ± 0.7 μM Cl− released per day, respectively (Figure 3.12C

and 3.13). After a 32-d incubation period, the cultures dechlorinated about half of the

initially supplied cDCE (83 μmol) but produced no ethene. In control cultures without

exogenous corrinoid, strain BAV1 and strain GT dechlorinated no more than 22% and

7.3%, respectively, of the initial cDCE to vinyl chloride (presumably enabled by corrinoid

carryover with the inoculum), and formed no ethene (Figure 3.12C and 3.13). Consistent

with the observed reductive dechlorination activity, 16S rRNA gene enumeration indicated

robust Dhc growth in cultures amended with vitamin B12 but not in cultures that received

218

Figure 3.12 Effects of purinyl-Cba substitution for vitamin B12 on the activity of

corrinoid-auxotrophic, organohalide-respiring bacteria.

(A) Reductive dechlorination activity in D. restrictus cultures supplied with PCE as the

electron acceptor and 36.9 nM vitamin B12 (positive control), 36.9 nM purinyl-Cba, or no

corrinoid addition (negative control).

(B) HPLC chromatograms of the total intracellular corrinoids extracted from vitamin B12-

or purinyl-Cba-amended Dhb cultures. Purinyl-Cba was the only cobamide recovered

from purinyl-Cba-amended Dhb cultures.

(C) Reductive dehalogenation of cDCE to ethene in Dhc strain BAV1 cultures amended

with 36.9 nM vitamin B12 (positive control), 36.9 nM purinyl-Cba, or no corrinoid addition

(negative control). Unfilled squares, PCE; filled diamonds, TCE; filled triangles, cDCE;

inverted unfilled triangles, vinyl chloride; filled circles, ethene. Error bars represent mean

values ± standard deviation from three independent cultures.

219

Figure 3.12A Continued

(A)

220

Figure 3.12B Continued

(B)

221

Figure 3.12C Continued

(C)

222

Table 3.3 Growth of corrinoid-auxotrophic organohalide-respiring Dehalobacter

restrictus (Dhb) and Dehlaococcoides mccartyi (Dhc) pure cultures with different

cobamides

Organism (e- acceptor)

Cobamide

Dhc 16S rRNA or Dhb pceA gene copies per mL culturea

Average fold

increase Initial Final

Dhb

(PCE)

Vitamin B12 7.52 ± 0.25 x 106 3.89 ± 0.49 x 108 51.7

Purinyl-Cba 7.52 ± 0.25 x 106 3.75 ± 0.47 x 108 49.9

None 7.52 ± 0.25 x 106 1.70 ± 0.85 x 107 2.3

Dhc strain BAV1

(cDCE)

Vitamin B12 4.63 ± 0.22 x 106 1.83 ± 0.09 x 108 39.5

Purinyl-Cba 4.63 ± 0.22 x 106 1.29 ± 0.15 x 107 2.8

None 4.63 ± 0.22 x 106 6.26 ± 1.62 x 106 1.4

Dhc strain GT

(cDCE)

Vitamin B12 3.88 ± 0.70 x 106 1.68 ± 0.14 x 108 43.3

Purinyl-Cba 3.88 ± 0.70 x 106 2.00 ± 0.31 x 107 5.2

None 3.88 ± 0.70 x 106 4.62 ± 0.51 x 106 1.2

a Based on the available genome information, Dhc possess a single copy of the 16S rRNA

gene and Dhb possess a single copy of the pceA gene. Average and standard deviation

of gene copy numbers were calculated from qPCR measurements of triplicate cultures.

223

Figure 3.13 Reductive dechlorination of cDCE to ethene in Dhc strain GT cultures

Reductive dechlorination of cDCE to ethene in Dhc strain GT cultures receiving vitamin

B12 (36.9 nM, top panel), purinyl-Cba (36.9 nM, middle panel), or no corrinoid addition

(negative control, bottom panel). Solid triangles, cDCE; open, inverted triangles, vinyl

chloride; solid circles, ethene. Error bars represent the mean values ± standard deviation

from three independent cultures.

224

purinyl-Cba (Table 3.3). In contrast to the PceA RDases, the Dhc RDases BvcA and VcrA

had a pronounced preference for DMB over unsubstituted purine as the lower base,

emphasizing that the lower base can modulate the activity of corrinoid-dependent

RDases10.

3.4 DISCUSSION

The purine structure is the most widely distributed nitrogen-containing heterocycle

in nature, and purine derivatives fulfill many essential functions in biological systems28.

Obvious examples of purine derivatives include adenine and guanine, which are essential

building blocks of nucleic acids, and ubiquitous molecules such as adenosine 5′

triphosphate (ATP), nicotinamide adenine dinucleotide (NAD+ and NADH), and flavin

adenine dinucleotide (FAD and FADH2)28. Remarkably, compounds containing an

unsubstituted purine moiety are rare, and a specific biological function has never been

assigned to purine itself. To date, nebularine (purine nucleoside) is the only known

biological compound that contains unsubstituted purine. Nebularine was first isolated from

the fungus Clitocybe nebularis29 and is also produced by Streptomyces yokosukanensis30

and a Microbispora isolate31. Nebularine is a potent antibiotic against various

Mycobacterium species, exhibits cytotoxic effects in cell cultures and plants32,33, and is

toxic to the schistosomiasis (bilharzia) parasite34; however, its biological functions in the

hosts are unclear. In S. yokosukanensis, nebularine biosynthesis involves catalysis of the

reductive deamination of adenosine by a single enzyme35. Apparently, at least some

members of the domains Bacteria and Eukaryota synthesize unsubstituted purine,

indicating that purine is not a xenobiotic, a finding that has potential human health

implications. Purinergic membrane receptors, which include the adenosine-responsive

P1 purinoceptors, are found in almost all mammalian tissues, wherein they fulfill crucial

functions that can affect disease progression36–38. Although the occurrence of

unsubstituted purine in mammals is not established, the simple enzymatic conversion of

adenosine to nebularine has been demonstrated35, and enzymatic hydrolysis of the N-

glycosidic bond catalyzed by common nucleoside hydrolases (i.e., purine nucleosidases)

225

releases the corresponding free bases24. Thus, the formation of unsubstituted purine (or

purine nucleoside) could affect the regulation of cellular functions (purinergic signaling),

potentially enabling new disease therapies. Purinyl-Cba synthesis using Dsf CobT will

facilitate detailed investigations of its therapeutic potentials.

Corrinoid-dependent enzyme systems fulfill essential metabolic functions for

organisms in all branches of life, but only some members of Bacteria and Archaea have

the machinery for de novo corrinoid biosynthesis1,2,39–42. The discovery of a new member

of the corrinoid family of molecules, purinyl-Cba in organohaliderespiring members of the

Peptococcaceae, expands the number of naturally occurring, functional lower base

structures and assigns a function to unsubstituted purine in biological systems. From this

study and from recent reports, a concept emerges that lower base structures are

modulators of corrinoid-dependent enzyme function10,12,20,21. This concept applies to the

Dhc RDases, but may possibly expand to many other corrinoid-dependent enzyme

systems, emphasizing that enzyme-specific corrinoid cofactor requirements must be

understood to predict, and possibly manipulate, catalytic activity (for example, Dhc

reductive dechlorination rates and extents)43. The exact role(s) of the lower base in

RDase function is not resolved, but recent findings reveal a base-off configuration during

catalysis7,8. If not directly involved in catalysis, the lower base structures may affect

holoenzyme maturation, or, in the case of periplasmic enzymes such as respiratory

RDases, export through the cytoplasmic membrane. Cobamides fulfill essential metabolic

functions for the majority of organisms, including mammals, and the principle of lower

base-controlled activity of key corrinoid-dependent enzyme systems may provide new

avenues to manipulate environmental (for example, bioremediation) and biotechnological

(for example, anaerobic digestion, biogas production) processes and to expand treatment

options to affect progression of relevant human diseases.

226

3.5 METHODS

3.5.1 Chemicals

Vitamin B12 (≥98%), dicyanocobinamide (Cbi; ≥93%), 5,6-dimethylbenzimidazole

(DMB) (99%), 5-methylbenzimidazole (5-MeBza; 98%), 5-methoxybenzimidazole (5-

OMeBza) (97%), benzimidazole (Bza; 98%), and purine (98%) were purchased from

Sigma-Aldrich. 15NH4Cl (99%) was obtained from Cambridge Isotope Laboratories. Yeast

extract and peptone were purchased from Becton, Dickinson and Company. Bza-Cba, 5-

MeBza-Cba and 5-OMeBza-Cba were prepared via guided cobamide biosynthesis10.

Factor III (5-OHBza-Cba), norpseudo vitamin B12 and phenolic cobamides (i.e., Phenol-

Cba and p-Cresol-Cba) were extracted and purified from Methanosarcina barkeri strain

Fusaro (DSM 804), Sulfurospirillum multivorans (DSM 12446) and Sporomusa sp. strain

KB-1 (16S rRNA gene GenBank accession number AY780559.1) cells, respectively.

Concentrations of purified cobamides were determined at 361 nm with a Lambda 35 UV-

Vis spectrometer (PerkinElmer) using a molar extinction coefficient of 28,060 mol−1 cm−1

(ref. 12). Ethene (≥99.9%) and vinyl chloride (≥99.5%) were purchased from Sigma-

Aldrich. All other chemicals used were reagent grade or higher.

3.5.2 Cultures

Pure cultures were grown in 160 ml glass serum bottles containing 100 ml of

bicarbonate (30 mM) or phosphate (50 mM) buffered, defined mineral salts medium, the

Wolin vitamin mix excluding vitamin B12, and a N2/CO2 (80/20; v/v) headspace. D.

hafniense strains Y51 and JH1 and Dsf sp. Strains Viet1 and PCE1 cultures were

supplemented with pyruvate (10 mM) as fermentable substrate and with PCE (68 μmol

per bottle, 0.48 mM aqueous concentration) as electron acceptor44. Dhc strain BAV1 and

strain GT cultures were amended with 5 mM acetate as a carbon source, 10 ml hydrogen

as an electron donor, neat cDCE (79 μmol per bottle, 0.60 mM aqueous concentration)

as an electron acceptor, and a cobamide (for example, vitamin B12) as described10.

Geobacter sulfurreducens strain PCA cultures received 5 mM acetate as an electron

donor and 10 mM fumarate as an electron acceptor as described45. Sulfurospirillum

227

multivorans strain DSM 12446 cultures were grown with pyruvate (10 mM) and neat PCE

(0.48 mM) as electron acceptor as described21. D. restrictus strain PER-K23 cultures were

amended with 5 mM acetate as carbon source, 10 ml hydrogen as an electron donor,

neat PCE (0.48 mM) as electron acceptor, and peptone (0.5 g/L) as source of required

amino acids46. Sporomusa sp. strain KB-1 cultures were amended with betaine (50 mM)

as the sole substrate20. Methanosarcina barkeri strain Fusaro was grown with 123 mM

methanol as the sole substrate20. All vessels were incubated without agitation in the dark

at 30 °C. For 15N isotope experiments, 15NH4Cl (0.3 g/L) replaced unlabeled NH4Cl as the

nitrogen source. L-cysteine, a reductant added to the medium, is a potential nitrogen

source and was omitted in the labeling experiments. 15NH4Cl grown cultures were

transferred (1% inoculum; v/v) twice in 160 ml serum bottles containing 100 ml of medium

before scaling up to a 2.2 L vessel containing 1.8 L of medium to extract sufficient 15N-

labeled corrinoid for LC–MS analysis. Initial experiments with Geobacter sulfurreducens

strain PCA, a bacterium that natively produces 5-OHBza-Cba (14 N atoms in the cyano

form)47, demonstrated the utility of the 15N isotope labeling approach to determine the

number of N atoms in the lower base structure. We found that the mass spectra of 15N-

labeled versus unlabeled 5-OHBza-Cba produced in G. sulfurreducens cultures amended

with 15NH4Cl versus NH4Cl returned a mass shift of 12.96 Da, close to the expected value

of 13 total N atoms (14 minus one unlabeled N in the upper CN ligand, which was added

during the KCN extraction process) (Figure 3.14).

3.5.3 Corrinoid extraction

Cells were harvested from 0.3–1.8 L culture suspensions by centrifugation at

15,000 × g for 15 min at 4 °C, or by filtration onto 47-mm diameter 0.22-μm pore size

polyethersulfone membrane filters (Pall Life Sciences). The intracellular corrinoids were

extracted from the biomass following an established KCN extraction protocol and purified

using a C18 Sep-Pak cartridge (Waters Corp)10. To extract corrinoids from proteins

separated by BN–PAGE, gel slices were excised and transferred to individual 2 ml plastic

tubes with 1 ml of 90% (v/v) methanol containing 50 mM acetic acid and 10 mM KCN

(final pH 5.5) for corrinoid extraction. The closed tubes were incubated at 60 °C for 2 h to

solubilize corrinoids, before the solution was transferred to new 2 ml plastic tubes and

228

Figure 3.14 Demonstration of the utility of stable isotope 15N-labeling to obtain

lower base compositional information

Mass spectra of (A) unlabeled and (B) 15N-labeled 5-OHBza-Cba (i.e., factor III) produced

by Geobacter sulfurreducens strain PCA. The 15N-labeled 5-OHBza-Cba was purified

from Geobacter sulfurreducens cells grown with 15N-NH4Cl as the sole nitrogen source.

Mass shifts of 12.95 Dalton in the m/z values of [M+H]+ and [M+Na]+ base peaks matched

the predicted mass increase based on the total number of two N atoms in the Bza lower

base structure.

(A)

(B)

229

vacuum dried using a rotary evaporator at 45 °C for 2 h. The dry residues were suspended

in 75 μL ice-cold ammonium acetate (20 mM, pH 6.0), and centrifugation at 13,000 × g

for 5 min at 4 °C removed insoluble Coomassie Blue dye and gel residuals.

3.5.4 Corrinoid analysis

Intracellular corrrinoids were analyzed by HPLC, UV-Vis spectroscopy, and

UPLC–HRMS. HPLC analysis was performed with an Eclipse XDB-C18 column (Agilent

Technologies, 5 μm pore size, 4.6 mm inner diameter × 250 mm length) operated at a

flow rate of 1 ml per min at 30 °C using 0.1% (v/v) formic acid (≥88%, w/v; Thermo Fisher,

Waltham, MA, USA) in water as eluent A and 0.1% (v/v) formic acid in methanol as eluent

B. The initial mobile phase composition was 82% eluent A and 18% eluent B, before the

fraction of eluent B increased linearly to 25% over a 12-min and further to 75% over an

additional 3-min time period, held at 75% B for 5 min before being restored to initial

column conditions. UV-Vis spectra between 250 to 600 nm were collected using a diode

array detector. The upper ligand, cobalt oxidation state, and lower base coordination

influence the corrinoid absorbance spectrum in the UV region42. All corrinoid samples and

standards in this study carried the cobalt atom in the fully oxidized +3 state and a cyano

group as the upper ligand. Cbi lacks the entire α-ribazole-5′-phosphate (α-RP) moiety and

exhibited an UV-Vis spectrum with an absorption peak at 355 nm, distinct from the 361

nm absorption peak of vitamin B12 (Figure 3.2B). The corrinoids extracted from BN–

PAGE gels were analyzed using an UltiMate 3000 UPLC system in tandem with a high-

resolution Exactive Plus Orbitrap mass spectrometer (Thermo Fisher) and a UV-Vis

detector set to 361 nm as described48. Corrinoids were separated on a Hypersil Gold C18

column (Thermo Fisher; 1.9 μm pore size, 2.1 mm inner diameter × 50 mm length) at a

flow rate of 0.2 ml min−1 at 30 °C using 2.5 mM ammonium acetate in water as eluent A

and 100% methanol as eluent B. The mobile phase was 100% eluent A and 0% eluent B

for 0.46 min, followed by linear increases to 15% eluent B after 0.81 min, 50% eluent B

after 3.32 min, and 90% eluent B after 5.56 min with a 0.3-min hold before equilibration

to initial column conditions. Corrinoid mass spectra were collected in positive ionization

mode using a HESI II electrospray ionization source (Thermo Fisher) with a m/z scan

230

ranging from 1,000–1,500 and a resolution of 140,000. The detection limit for this LC–MS

method was 2.5 ng of corrinoid.

3.5.5 NMR spectroscopy

Growth of D. hafniense strain Y51 in twelve 2.2 L vessels yielded approximately

22 L of cell culture suspension. Each vessel received neat TCE (400 μL; 2.3 mM aqueous

concentration), yeast extract (2 g/L) and Cbi (0.5 μM) to enhance corrinoid production.

Cells were harvested after three TCE amendments (a total of 1,200 μL) were completely

dechlorinated to cDCE. Total intracellular corrinoids were extracted, and the predominant

corrinoid containing fraction was obtained following HPLC separation and manual

collection from the detector outlet informed by the detector response at 361 nm.

Approximately 0.7 mg of purified corrinoid was dissolved in methanol-d4 (250 μL) to

conduct 1H and COSY NMR experiments using an INOVA 600 MHz NMR spectroscopy

system (Varian). The 1H NMR experiments consisted of 1,024 scans, using PRESAT

solvent suppression multiple peak selection and a total measuring time of 1 h. The

gradient-selected COSY NMR experiments consisted of 256 scans per increment at 96

increments. The delay time between scans was 1.5 s, and the total measuring time was

1 h.

3.5.6 Blue native PAGE (BN–PAGE), enzyme assays and proteomic analysis

D. hafniense strain JH1 cells were harvested from 100 ml cultures and the crude

protein extracts were prepared as described49. BN–PAGE using pre-cast 4 to 16%

gradient Bis–Tris gel (Thermo Fisher) stained with Coomassie Blue was performed

following the NativePAGE Bis–Tris Gel Protocol49. Gel lanes were loaded with 25 μL of

protein standards or crude protein extracts containing approximately 6 μg of total protein

as estimated with the Bradford assay50. Electrophoresis was done using chilled buffers

and a BN–PAGE chamber placed in an ice bath, and separation occurred for 60 min at

150 V and then for another 45 min at 200 V. The blank, ladder and sample lanes were

separated and stained according to the fast Coomassie G-250 staining protocol (Thermo

Fisher). The gel slices were cut based on molecular mass ranges as visualized by the

protein standards in the ladder lane. Enzyme assays to detect dechlorinating activity were

231

conducted with D. hafniense strain JH1 cell lysate (positive control) and individual gel

slices inside an anoxic chamber (Coy Laboratory) as described49. The assays (1 ml) were

conducted in 2 ml sealed glass vials containing 100 mM Tris–HCl buffer (pH 7.4)

amended with 2 mM titanium citrate, 2 mM methyl viologen, and 2 mM TCE. Each assay

mixture was incubated in an anoxic chamber for 24 h and analyzed for cDCE formation

using gas chromatography49. In-gel digestion and MS analysis were performed at the

BioZone Mass Spectrometry Facility (University of Toronto, Toronto, Canada) using X!

Tandem for peptide/protein identification (The GPM, thegpm.org; version X! Tandem

Vengeance (2015.12.15.2))49. X! Tandem was set up to search for tryptic peptides based

on the D. hafniense strain Y51 genome, all characterized RDases, other Dsf proteins in

the NCBI database, as well as common contaminants such as human keratins and trypsin

(total of 33,950 proteins) using a fragment ion mass tolerance of 0.40 Da and a parent

ion tolerance of 2.5 Da. Deamidation of asparagine and glutamine, oxidation of

methionine and tryptophan, N-terminal ammonia loss, or cyclization of glutamine or

glutamic acid to pyroglutamine or pyroglutamic acid were allowed in X! Tandem as

possible peptide modifications. Further validation and refinement was performed using

Scaffold software version 4.5.3 (Proteome Software, Inc.) with a reverse decoy database

to establish a false discovery rate. Peptide identifications were accepted as valid at a

Peptide Prophet probability of greater than 95%51. Subsequent protein identifications

were considered valid at a Protein Prophet probability of greater than 99%52, which were

filtered to include those that had at least two unique peptide identifications.

3.5.7 Primer and probe design

Primers and TaqMan probe targeting the pceA gene in D. hafniense strain Y51

(locus # DSY2839), D. restrictus strain PERK23 (locus # DEHRE_12145), and pceA

homologs (>95% sequence identity) identified in other Dsf and Dhb strains (GenBank

accession numbers CAD28792.1, CDX02974.1, AAO60101.1 and AIA58680.1) were

designed using Primer Express software (Applied Biosystems). A consensus region of

the Dsf and Dhb pceA gene sequences was selected to meet the quantitative PCR

(qPCR) design criteria of (i) an amplicon size between 50–150 bp, (ii) a primer melting

temperature (Tm) of 58–60 °C, and (iii) a probe Tm of 68–70 °C53. The G+C content of the

232

primers and probe was between 30 to 80 mol %, with no more than three consecutive G

or C bases in either the primer or the probe sequences. The specificity of the forward

primer Df_pceA_1223F (5′-CGGACAAGCCGAGAAAATTC-3′), the reverse primer

Df_pceA_1286R (5′-GCATCCGCACATTTTTTGC-3′) and the probe Df_pceA_1247

probe (5′-6FAM-TACGCGAGTTCTGCCG-MGB-3′) to pceA genes was verified by using

BLAST search against the NCBI database.

3.5.8 Chemical and molecular analyses

Ethene and chlorinated compounds were quantified in triplicate cultures using an

Agilent 7890 gas chromatograph as described10. The two-step dechlorination processes

PCE-to-cDCE (Dhb) and cDCE-to-ethene (Dhc) were measured based on the

quantification of daughter and end products, TCE/cDCE and VC/ethene, respectively.

Each dichlorination step is associated with the release of one chloride ion and the PCE-

to-cDCE and cDCE-to-ethene dechlorination rates were reported as micromolar Cl−

released per day. The list of potential molecular formulas for the lower base of the Dsf

cobamide was generated using the web-based platform ChemCalc54. To obtain genomic

DNA, cells from 1 ml culture suspension were harvested via vacuum filtration onto a 0.22

μm polyvinylidene difluoride membrane filter (Merck Millipore Ltd.) and processed using

the MO BIO Soil DNA Isolation kit (MO BIO) as described45. Dhc 16S rRNA gene-targeted

qPCR was performed following established protocols using primer set

Dhc1200F/Dhc1271R and TaqMan probe Dhc1240probe53. The qPCR assay targeting

the Dhb pceA gene with the newly designed primers and probe used identical qPCR

conditions. Standard curves were generated using a serial dilution of plasmid pMK-RQ

(Life Technologies) with a D. hafniense strain Y51 pceA fragment (1,656 bp) insertion.

The pceA qPCR assay standard curve had a slope of −3.785, a y-intercept of 40.41, a R2

of 0.999, and a PCR amplification efficiency of 83.8%. The assay spanned a linear range

from 4.64 × 101 to 4.64 × 108 pceA gene copies per reaction, with 4.6 pceA gene copies

per reaction as the detection limit. All qPCR assays used template DNA samples

extracted from triplicate cultures, and standard curves were generated from three

independently prepared serial dilutions of the respective plasmid DNA standards.

233

3.5.9 Statistical analysis

The PCE-to-cDCE dechlorination rates from three independent Dhb cultures

grown with purinyl-Cba or vitamin B12 were statistically compared. The two-sample t-test

was carried out using the data analysis tool provided in Microsoft Excel 2016.

3.5.10 Bioinformatics and phylogenetic analyses

RDase sequence alignments and identity comparisons were performed with

Clustal Omega (www.ebi.ac.uk/Tools/msa/clustalo)55. Reciprocal BLAST analysis was

used to query the sequenced Dsf genomes and search for orthologous bza genes

implicated in anaerobic DMB biosynthesis47. Twenty CobT amino acid sequences from

the genomes of nine Dsf strains, five Dhb strains and six Desulfosporosinus strains, along

with 20 CobT and homologous protein (i.e., ArsA and ArsB) sequences from other

bacteria (Table 3.2) were retrieved from GenBank, and aligned using the MUSCLE plug-

in in Geneious 8.1.7 with 10 iterations. The phylogenetic tree of CobT and homologous

proteins was constructed using the PHMYL maximum likelihood tree builder plug-in in

Geneious 8.1.7 with 100 bootstraps and the Le and Gascuel substitution model56.

3.5.11 Heterologous expression and purification of CobT

The pET-28a(+) vector (EMD Millipore) was used to clone and express cobT

carrying an N-terminal hexa-histidine tag. Dsf cobT (locus # DSY2114) and Dhc cobT

(locus # DehaBAV1_0626) were amplified using Phusion Flash High-Fidelity PCR Master

Mix (Thermo Fisher) and primer sets NJ459-NJ460 and NJ461-NJ462 (Table 3.4),

respectively, using genomic DNA from Dsf strain Y51 and Dhc strain BAV1 axenic

cultures. PCR products were cleaned using the UltraClean PCR Clean-Up Kit (MO BIO).

The pET-28a(+) vector backbone was digested with EcoRI and NdeI, dephosphorylated

with rSAP, and gel extracted to remove remaining supercoiled constructs. The prepared

plasmids pNJ050 and pNJ049 (Table 3.5), which contain Dsf cobT and Dhc cobT inserts,

respectively, were then transformed into BW25113 electrocompetent cells with pre-

induced λ Red recombinase from plasmid pKD46 for homologous recombination57.

234

Following sequence verification, recombinant vectors were introduced into E. coli strain

BL21(DE3) (New England BioLabs) for overexpression and purification.

Enzyme expression and purification were performed as described with

modifications58. In brief, E. coli strain BL21(DE3) carrying a cobT expression plasmid was

grown in 1 L of Terrific Broth (Thermo Fisher) with 50 μg/mL kanamycin at 37 °C and 180

rpm to an optical density at 600 nm (OD600) of 0.8. Cultures were induced with 0.4 mM

isopropyl β-D-1-thiogalactopyranoside (Thermo Fisher) and incubated overnight at 16 °C

and 180 rpm. Cells were collected by centrifugation at 9,000 × g for 20 min, suspended

in HEPES buffer (50 mM HEPES, 300 mM NaCl and 10 mM imidazole, pH 7.5), and

sonicated in an ice bath for 45 min (3-s on and 4-s off). The lysate was centrifuged at

38,000 × g for 20 min and the supernatant was passed through a 25 ml glass column

containing about 0.5 ml Ni-NTA resin (Qiagen). After washing with HEPES buffer (20 mM

imidazole), proteins were eluted with 5–7 mL of HEPES buffer containing 250 mM

imidazole and 5% (w/v) glycerol. Protein concentrations were estimated using the

Bradford assay50 and protein purity was examined by SDS–PAGE and Coomassie Blue

staining. The protein stock solutions (Dsf Y51 CobT, 15 mg/mL; Dhc BAV1 CobT, 10

mg/mL) were frozen in liquid nitrogen and stored at −80 °C. The N-terminal hexa-histidine

tag was retained for all experiments.

3.5.12 In vitro CobT activity

CobT assays were performed as described59. Briefly, each reaction (300 μL)

contained 30 μg CobT (corresponding to a final enzyme concentration of ~2.6 μM), 2 mM

NaMN, 10 mM MgCl2, and 0.25 mM of either purine or DMB in 50 mM pH 7.5 Tris–HCl

buffer. The assay vials were incubated at 30 °C for 30 min before the reactions were

terminated by the addition of 15 μL formic acid (≥88%; w/v) and then transferred to a

boiling water bath for 1 min. Following neutralizing the pH with 5 M NaOH, precipitated

protein was removed by centrifugation at 13,000 × g for 5 min. Lower bases and their

respective α-RPs were analyzed by injecting 10 μL samples into an Agilent Technologies

1200 series HPLC system equipped with a diode array detector set to 262 nm. Separation

was performed with an Eclipse XDB-C18 column (5 μm pore size; 4.6 mm inner diameter

235

× 250 mm length) at a flow rate of 1 ml per min at 30 °C using 0.1% (v/v) formic acid in

water as eluent A and 0.1% (v/v) formic acid in methanol as eluent B. The initial mobile

phase and time parameters for the gradient elution were as follows: t = 0, 15% eluent B;

t = 5 min, 25% eluent B; t = 11 min, 85% eluent B; t = 11.1 to 15 min, 15% eluent B. To

obtain material for subsequent MS analysis, semi-preparative HPLC was performed using

the method outlined above with minor modification as follows. The injection volume was

increased to 100 μL, and a 1 ml fraction containing α-RP [DMB] or α-RP [purine] was

manually collected from the detector outlet once the target peak was detected. Three

such injections were performed and the α-RP fractions from each were combined, and

then concentrated 10-fold from 3 mL to 300 μL using a Savant ISS110 vacuum dryer

(Thermo Fisher). Aliquots (10 μL) of the concentrated α-RP solutions were introduced into

an Exactive Plus Orbitrap MS via direct injection. The analytes were ionized using

electrospray ionization operated in positive mode and detected via high-resolution MS

with a mass range of 200 to 400 m/z10.

236

Table 3.4 Nucleotide sequences of the primers designed for PCR amplification of

the cobT genes to construct overexpression plasmids.

Primer set NJ459/NJ460 was used to amplify the Dsf cobT gene (locus # DSY2114) from

Dsf strain Y51 genomic DNA. Primer set NJ461/NJ462 was used to amplify the Dhc cobT

gene (locus # DehaBAV1_0626) from Dhc strain BAV1 genomic DNA. The homology

regions for vector recombination are in red color font.

Primer Sequence (5'-3')

NJ459 TCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATGTGGATGACTTCTTAAGACAGGAAAAC

NJ460 TGGTGCTCGAGTGCGGCCGCAAGCTTGTCGACGGAGCTCGTTAGTTTTTACCGCTGACTCCTGC

NJ461 TCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGGAACTATTAAACGCAACACTTGC

NJ462 TGGTGCTCGAGTGCGGCCGCAAGCTTGTCGACGGAGCTCGCTAACTTTGCTTTTCGGAAACCC

237

Table 3.5 Information about the plasmids used for the overexpression of CobT

enzymes.

Plasmid Description Source or reference

pET-28a(+) General E. coli expression vector with IPTG induction EMD

Millipore

pKD46 Red swap plasmid carrying λ Red recombinase Datsenko

2000

pNJ050 pET-28a(+) with IPTG-inducible expression of Dsf cobT (locus #

DSY2114) carrying N-terminal 6X-HIS tag This study

pNJ049 pET-28a(+) with IPTG-inducible expression of Dsf cobT (locus #

DehaBAV1_0626) carrying N-terminal 6X-HIS tag This study

IPTG: isopropyl β-D-1-thiogalactopyranoside

238

REFERENCES

1. Renz, P. in Chemistry and biochemistry of B12 (ed. Banerjee, R.) 558–572 (John Wiley

& Sons, Inc.: 1999).

2. Gruber, K.; Puffer, B.; Kräutler, B., Vitamin B 12-derivatives—enzyme cofactors and

ligands of proteins and nucleic acids. Chemical Society Reviews 2011, 40 (8),

4346-4363.

3. Kräutler, B.; Fieber, W.; Ostermann, S.; Fasching, M.; Ongania, K. H.; Gruber, K.;

Kratky, C.; Mikl, C.; Siebert, A.; Diekert, G., The Cofactor of Tetrachloroethene

Reductive Dehalogenase of Dehalospirillum multivorans is Norpseudo‐B12, a New

Type of a Natural Corrinoid. Helvetica Chimica Acta 2003, 86 (11), 3698-3716.

4. Im, J.; Walshe-Langford, G. E.; Moon, J.-W.; Loffler, F. E., Environmental fate of the

next generation refrigerant 2, 3, 3, 3-tetrafluoropropene (HFO-1234yf).

Environmental science & technology 2014, 48 (22), 13181-13187.

5. Maillard, J.; Schumacher, W.; Vazquez, F.; Regeard, C.; Hagen, W. R.; Holliger, C.,

Characterization of the corrinoid iron-sulfur protein tetrachloroethene reductive

dehalogenase of Dehalobacter restrictus. Applied and Environmental Microbiology

2003, 69 (8), 4628-4638.

6. Liao, R.-Z.; Chen, S.-L.; Siegbahn, P. E., Which Oxidation State Initiates

Dehalogenation in the B12-Dependent Enzyme NpRdhA: CoII, CoI, or Co0? ACS

Catalysis 2015, 5 (12), 7350-7358.

7. Bommer, M.; Kunze, C.; Fesseler, J.; Schubert, T.; Diekert, G.; Dobbek, H., Structural

basis for organohalide respiration. Science 2014, 1258118.

8. Payne, K. A.; Quezada, C. P.; Fisher, K.; Dunstan, M. S.; Collins, F. A.; Sjuts, H.; Levy,

C.; Hay, S.; Rigby, S. E.; Leys, D., Reductive dehalogenase structure suggests a

mechanism for B12-dependent dehalogenation. Nature 2015, 517 (7535), 513-

516.

9. Löffler, F. E.; Yan, J.; Ritalahti, K. M.; Adrian, L.; Edwards, E. A.; Konstantinidis, K. T.;

Müller, J. A.; Fullerton, H.; Zinder, S. H.; Spormann, A. M., Dehalococcoides

239

mccartyi gen. nov., sp. nov., obligately organohalide-respiring anaerobic bacteria

relevant to halogen cycling and bioremediation, belong to a novel bacterial class,

Dehalococcoidia classis nov., order Dehalococcoidales ord. nov. and family

Dehalococcoidaceae fam. nov., within the phylum Chloroflexi. International journal

of systematic and evolutionary microbiology 2013, 63 (2), 625-635.

10. Yan, J.; Şimşir, B.; Farmer, A. T.; Bi, M.; Yang, Y.; Campagna, S. R.; Löffler, F. E.,

The corrinoid cofactor of reductive dehalogenases affects dechlorination rates and

extents in organohalide-respiring Dehalococcoides mccartyi. The ISME journal

2016, 10 (5), 1092-1101.

11. Yi, S.; Seth, E. C.; Men, Y.-J.; Stabler, S. P.; Allen, R. H.; Alvarez-Cohen, L.; Taga,

M. E., Versatility in corrinoid salvaging and remodeling pathways supports

corrinoid-dependent metabolism in Dehalococcoides mccartyi. Applied and

environmental microbiology 2012, 78 (21), 7745-7752.

12. Mok, K. C.; Taga, M. E., Growth inhibition of Sporomusa ovata by incorporation of

benzimidazole bases into cobamides. Journal of bacteriology 2013, 195 (9), 1902-

1911.

13. Stupperich, E., Eisinger, H.-J. & Kräutler, B. Identification of phenolyl cobamide from

the homoacetogenic bacterium Sporomusa ovata. The FEBS Journal 1989, 186

(3), 657-661.

14. Villemur, R.; Lanthier, M.; Beaudet, R.; Lépine, F., The Desulfitobacterium genus.

FEMS microbiology reviews 2006, 30 (5), 706-733.

15. Ding, C.; Zhao, S.; He, J., A Desulfitobacterium sp. strain PR reductively dechlorinates

both 1, 1, 1‐trichloroethane and chloroform. Environmental microbiology 2014, 16

(11), 3387-3397.

16. Suyama, A.; Yamashita, M.; Yoshino, S.; Furukawa, K., Molecular characterization of

the PceA reductive dehalogenase of Desulfitobacterium sp. strain Y51. Journal of

Bacteriology 2002, 184 (13), 3419-3425.

17. Reinhold, A.; Westermann, M.; Seifert, J.; von Bergen, M.; Schubert, T.; Diekert, G.,

Impact of vitamin B12 on formation of the tetrachloroethene reductive

240

dehalogenase in Desulfitobacterium hafniense strain Y51. Applied and

environmental microbiology 2012, 78 (22), 8025-8032.

18. Nonaka, H.; Keresztes, G.; Shinoda, Y.; Ikenaga, Y.; Abe, M.; Naito, K.; Inatomi, K.;

Furukawa, K.; Inui, M.; Yukawa, H., Complete genome sequence of the

dehalorespiring bacterium Desulfitobacterium hafniense Y51 and comparison with

Dehalococcoides ethenogenes 195. Journal of bacteriology 2006, 188 (6), 2262-

2274.

19. Crofts, T. S.; Seth, E. C.; Hazra, A. B.; Taga, M. E., Cobamide structure depends on

both lower ligand availability and CobT substrate specificity. Chemistry & biology

2013, 20 (10), 1265-1274.

20. Yan, J.; Im, J.; Yang, Y.; Löffler, F. E., Guided cobalamin biosynthesis supports

Dehalococcoides mccartyi reductive dechlorination activity. Phil. Trans. R. Soc. B

2013, 368 (1616), 20120320.

21. Keller, S.; Ruetz, M.; Kunze, C.; Kräutler, B.; Diekert, G.; Schubert, T., Exogenous 5,

6‐dimethylbenzimidazole caused production of a non‐functional tetrachloroethene

reductive dehalogenase in Sulfurospirillum multivorans. Environmental

microbiology 2014, 16 (11), 3361-3369.

22. Guimarães, D. H.; Weber, A.; Klaiber, I.; Vogler, B.; Renz, P., Guanylcobamide and

hypoxanthylcobamide-corrinoids formed by Desulfovibrio vulgaris. Archives of

microbiology 1994, 162 (4), 272-276.

23. Stasyuk, O. A.; Szatyłowicz, H.; Krygowski, T. M., Effect of the H-bonding on

aromaticity of purine tautomers. The Journal of organic chemistry 2012, 77 (8),

4035-4045.

24. Moffatt, B.A.; Ashihara, H., Purine and pyrimidine nucleotide synthesis and

metabolism. The Arabidopsis Book 2002, e0018.

25. Kublik, A.; Deobald, D.; Hartwig, S.; Schiffmann, C. L.; Andrades, A.; Bergen, M.;

Sawers, R. G.; Adrian, L., Identification of a multi‐protein reductive dehalogenase

complex in Dehalococcoides mccartyi strain CBDB1 suggests a protein‐dependent

241

respiratory electron transport chain obviating quinone involvement. Environmental

microbiology 2016, 18 (9), 3044-3056.

26. Dobbek, H.; Svetlitchnyi, V.; Gremer, L.; Huber, R.; Meyer, O., Crystal structure of a

carbon monoxide dehydrogenase reveals a [Ni-4Fe-5S] cluster. Science 2001,

293 (5533), 1281-1285.

27. Iverson, T. M.; Luna-Chavez, C.; Cecchini, G.; Rees, D. C., Structure of the

Escherichia coli fumarate reductase respiratory complex. Science 1999, 284

(5422), 1961-1966.

28. Rosemeyer, H., The chemodiversity of purine as a constituent of natural products.

Chemistry & biodiversity 2004, 1 (3), 361-401.

29. Löfgren, N.; Lüning, B., On the structure of nebularine. Acta Chemica Scandinavica

1953, 7, 225.

30. Nakamura, G., Studies on antibiotic actinomycetes. III. on Streptomyces producing 9-

β-D-ribofuranosylpurine. Journal of Antibiotics 1961, 14 (2), 94–97.

31. Cooper, R.; Horan, A.C.; Gunnarsson, I.; Patel, M.; Truumees, I., Nebularine from a

novel Microbispora sp. Journal of Industrial Microbiology & Biotechnology 1986, 1

(4), 275–276.

32. Gordon, M. P.; Brown, G. B., A study of the metabolism of purine riboside. Journal of

Biological Chemistry 1956, 220 (2), 927-937.

33. Brown, E. G.; Konuk, M., Plant cytotoxicity of nebularine (purine riboside).

Phytochemistry 1994, 37 (6), 1589-1592.

34. el Kouni, M.H., Messier, N.J. & Cha, S. Treatment of schistosomiasis by purine

nucleoside analogues in combination with nucleoside transport inhibitors.

Biochem. Pharmacol. 1987, 36, 3815–3821.

35. Brown, E.G. & Konuk, M. Biosynthesis of nebularine (purine 9-β-Dribofuranoside)

involves enzymic release of hydroxylamine from adenosine. Phytochemistry 1995,

38, 61–71.

242

36. Ralevic, V.; Burnstock, G., Receptors for purines and pyrimidines. Pharmacological

reviews 1998, 50 (3), 413-492.

37. Burnstock, G., Purinergic signaling and disorders of the central nervous system.

Nature reviews Drug discovery 2008, 7 (7), 575-590.

38. Di Virgilio, F.; Adinolfi, E., Extracellular purines, purinergic receptors and tumor

growth. Oncogene 2017, 36 (3), 293-303.

39. Miles, Z. D.; McCarty, R. M.; Molnar, G.; Bandarian, V., Discovery of epoxyqueuosine

(oQ) reductase reveals parallels between halorespiration and tRNA modification.

Proceedings of the National Academy of Sciences 2011, 108 (18), 7368-7372.

40. Parks, J. M.; Johs, A.; Podar, M.; Bridou, R.; Hurt, R. A.; Smith, S. D.; Tomanicek, S.

J.; Qian, Y.; Brown, S. D.; Brandt, C. C., The genetic basis for bacterial mercury

methylation. Science 2013, 339 (6125), 1332-1335.

41. Randaccio, L.; Geremia, S.; Demitri, N.; Wuerges, J., Vitamin B12: unique

metalorganic compounds and the most complex vitamins. Molecules 2010, 15 (5),

3228-3259.

42. Schneider, Z.; Stroinski, A., Comprehensive B12: chemistry, biochemistry, nutrition,

ecology, medicine. Walter de Gruyter: 1987.

43. Degnan, P. H.; Taga, M. E.; Goodman, A. L., Vitamin B12 as a modulator of gut

microbial ecology. Cell metabolism 2014, 20 (5), 769-778.

44. Suyama, A.; Iwakiri, R.; Kai, K.; Tokunaga, T.; Sera, N.; Furukawa, K., Isolation and

characterization of Desulfitobacterium sp. strain Y51 capable of efficient

dehalogenation of tetrachloroethene and polychloroethanes. Bioscience,

biotechnology, and biochemistry 2001, 65 (7), 1474-1481.

45. Yan, J.; Ritalahti, K. M.; Wagner, D. D.; Löffler, F. E., Unexpected specificity of

interspecies cobamide transfer from Geobacter spp. to organohalide-respiring

Dehalococcoides mccartyi strains. Applied and environmental microbiology 2012,

78 (18), 6630-6636.

243

46. Holliger, C.; Hahn, D.; Harmsen, H.; Ludwig, W.; Schumacher, W.; Tindall, B.;

Vazquez, F.; Weiss, N.; Zehnder, A. J., Dehalobacter restrictus gen. nov. and sp.

nov., a strictly anaerobic bacterium that reductively dechlorinates tetra-and

trichloroethene in an anaerobic respiration. Archives of Microbiology 1998, 169 (4),

313-321.

47. Hazra, A. B.; Han, A. W.; Mehta, A. P.; Mok, K. C.; Osadchiy, V.; Begley, T. P.; Taga,

M. E., Anaerobic biosynthesis of the lower ligand of vitamin B12. Proceedings of

the National Academy of Sciences 2015, 112 (34), 10792-10797.

48. Wang, P.-H.; Tang, S.; Nemr, K.; Flick, R.; Yan, J.; Mahadevan, R.; Yakunin, A. F.;

Löffler, F. E.; Edwards, E. A., Refined experimental annotation reveals conserved

corrinoid autotrophy in chloroform-respiring Dehalobacter isolates. The ISME

journal 2017, 11 (3), 626-640.

49. Tang, S.; Chan, W. W.; Fletcher, K. E.; Seifert, J.; Liang, X.; Löffler, F. E.; Edwards,

E. A.; Adrian, L., Functional characterization of reductive dehalogenases by using

blue native polyacrylamide gel electrophoresis. Applied and environmental

microbiology 2013, 79 (3), 974-981.

50. Bradford, M. M., A rapid and sensitive method for the quantitation of microgram

quantities of protein utilizing the principle of protein-dye binding. Analytical

biochemistry 1976, 72 (1-2), 248-254.

51. Keller, A.; Nesvizhskii, A. I.; Kolker, E.; Aebersold, R., Empirical statistical model to

estimate the accuracy of peptide identifications made by MS/MS and database

search. Analytical chemistry 2002, 74 (20), 5383-5392.

52. Nesvizhskii, A. I.; Keller, A.; Kolker, E.; Aebersold, R., A statistical model for identifying

proteins by tandem mass spectrometry. Analytical chemistry 2003, 75 (17), 4646-

4658.

53. Ritalahti, K. M.; Amos, B. K.; Sung, Y.; Wu, Q.; Koenigsberg, S. S.; Löffler, F. E.,

Quantitative PCR targeting 16S rRNA and reductive dehalogenase genes

simultaneously monitors multiple Dehalococcoides strains. Applied and

environmental microbiology 2006, 72 (4), 2765-2774.

244

54. Patiny, L.; Borel, A., ChemCalc: A Building Block for Tomorrow’s Chemical

Infrastructure. Journal of Chemical Information and Modeling 2013, 53 (5), 1223-

1228.

55. Sievers, F.; Wilm, A.; Dineen, D.; Gibson, T. J.; Karplus, K.; Li, W.; Lopez, R.;

McWilliam, H.; Remmert, M.; Söding, J.; Thompson, J. D.; Higgins, D. G., Fast,

scalable generation of high-quality protein multiple sequence alignments using

Clustal Omega. Molecular Systems Biology 2011, 7, 539-539.

56. Kearse, M.; Moir, R.; Wilson, A.; Stones-Havas, S.; Cheung, M.; Sturrock, S.; Buxton,

S.; Cooper, A.; Markowitz, S.; Duran, C.; Thierer, T.; Ashton, B.; Meintjes, P.;

Drummond, A., Geneious Basic: An integrated and extendable desktop software

platform for the organization and analysis of sequence data. Bioinformatics 2012,

28 (12), 1647-1649.

57. Datsenko, K. A.; Wanner, B. L., One-step inactivation of chromosomal genes in

Escherichia coli K-12 using PCR products. Proceedings of the National Academy

of Sciences 2000, 97 (12), 6640-6645.

58. Huang, L.; Khusnutdinova, A.; Nocek, B.; Brown, G.; Xu, X.; Cui, H.; Petit, P.; Flick,

R.; Zallot, R.; Balmant, K.; Ziemak, M. J.; Shanklin, J.; de Crécy-Lagard, V.; Fiehn,

O.; Gregory Iii, J. F.; Joachimiak, A.; Savchenko, A.; Yakunin, A. F.; Hanson, A.

D., A family of metal-dependent phosphatases implicated in metabolite damage-

control. Nature Chemical Biology 2016, 12, 621.

59. Hazra, Amrita B.; Tran, Jennifer L. A.; Crofts, Terence S.; Taga, Michiko E., Analysis

of Substrate Specificity in CobT Homologs Reveals Widespread Preference for

DMB, the Lower Axial Ligand of Vitamin B12. Chemistry & Biology 2013, 20 (10),

1275-1285.

245

CONCLUSION

246

While spearheading the development of our neuroscience collaborations at the

University of Tennessee-Knoxville, I was able to advance the field of small molecule

detection and identification. These projects stretched the boundaries of our analytical

technologies and bolstered our current understanding of the true capabilities of high-

resolution mass spectrometry. Through our analyses, we established that a vast amount

of information can be gained from sub-milligram quantities of brain tissue or even from

dilute, small volume dialysate samples. Additionally, we have identified standard

statistical protocols for proper pre-processing normalization procedures and the

identification of significant metabolites through multiple statistical analyses. Through

literature research, we have tentatively interpreted the observed metabolic changes for

identified small molecules that will be studied in detail during future experimental

endeavors. Lastly, several unidentified features were ambiguously classified, and

represent the unique advantage of using an untargeted approach.

The analysis of stress-related changes to global metabolism provides the field of

behavioral psychology with a novel toolset to promote the research of new small molecule

targets. In the future, the results of our analyses may well lead to a therapeutic lead

discovery compound that could treat, or even prevent post-traumatic stress related

symptoms. This mental health condition is known to affect our war veterans, but it

stretches far beyond the military as ~10% of the population exhibits symptoms related to

PTSD. Unique to our study, future researchers can refer to our unidentified spectral

features list to determine if a compound of interest was detected in our study. This aspect

demonstrates the dynamic nature of untargeted metabolomics because even after the

research has been published, new discoveries could always be related back to our initial

discovery-based experiment.

The identification of thousands of small molecules from a 15-microliter sample of

dialysate represents the unparalleled qualities of a high-resolution mass spectrometer.

By detecting the global metabolism during various states of consciousness, we have

provided sleep researchers with comparable tools that will facilitate the expansion of

current neurochemical analyses within the field. It is foreseeable that future experiments

will be conducted based on our results. This is a simple prediction to make because the

247

function and regulation of the sleep-wake cycle is still generally unknown. The analysis

of native (underivatized) small molecules from dialysate of the extracellular matrix

reduces sample convolution and increases sample throughput. Although the true

understanding of neuronal function will forever be a complicated maze, this progression

of research brings us closer to full comprehension.

After analyzing thousands of known and unknown metabolites, the ability to

successfully characterize a novel compound was refreshing. The successful

characterization of purinyl-cobamide is a significant advancement within the fields of

microbiology and structure elucidation. In future studies of novel cobamides, we have

provided a strategy for the characterization of future cobamide species. This will be

essential for the continued research involving bioremediation. Microbial cultures are the

ideal biological system for the characterization of novel compounds. We can grow them

in large quantities with minimal biosafety regulation and relatively low costs, then following

analyte purification, we are left with a clean sample. The only limiting factor for cell

cultures are growth rates and the amount of analyte produced per cell.

The expansion of metabolomics for pharmacological development and clinical

practices is crucial for the treatment, or prevention of various health related

diseases/disorders. More specifically, the areas of neurological disorders and oncology

could benefit the most from continued development of small molecule analysis. From my

point-of-view, the study of small molecules needs to become a cross-functional ‘omics’

technique that is easily interpreted when combined with genomics, or even proteomics.

The disconnect from systems biology to the real-time snapshot analyses of metabolomics

is an issue that will be resolved over the next decade. Additionally, researchers need to

begin utilizing the true power of mass spectrometry by analyzing complex multicellular

organisms, such as rodents and humans, through flux analysis. Flux studies involve the

labeling of one, or more atoms using a heavy isotope, such as 13-carbon or 15-nitrogen.

These analyses provide a rate of metabolism because you can observe the appearance,

and disappearance of labeled metabolites. This process is commonly used in bacterial

and microbial cultures, and I think would greatly benefit the health research community if

we could begin using 13-carbon labeled glucose in a food or drink supplement to study

248

the rate of metabolism. Who knows, maybe mass spectrometry imaging or even magnetic

resonance could be used to show where the labeled material is being consumed fastest.

This could lead to a non-invasive technique for the identification of tumorous cells. In the

meantime, small molecule researchers need to continue conducting discovery-based

research projects, then use those results to begin performing targeted experiments. This

could include the administration of a small molecule of interest, or even the genetic

engineering of a knockout strain, given that your research is using rodents. These follow-

up studies would lead to the development of a single, or multiple small molecule targets

that could lead to the treatment of disease.

In closing, my research has all been focused on the study of small molecules and

the development of new technologies, or techniques for the identification of novel

compounds. I truly believe that the global biochemical community has only discovered

less than 5% of all biologically active compounds. As instrumentation becomes more

accurate and sensitive, as computers and related software enhances, and our ability to

analyze, comprehend, and learn develops, we can expand our current understanding of

how small molecule fluctuations occur as a response, or cause the response.

249

VITA

Allen Kenneth Bourdon grew up in Massena, NY, a small town in upstate New York

along the St. Lawrence River. Under the care of Raymond J. Bourdon and Cathy E.

Phelix, Allen lettered in three varsity sports; soccer hockey, and baseball, including a

2008 State Championship in hockey during his senior season. A 2008 graduation from

high school included the completion of an Advanced Regents diploma and an

International Bachelorette diploma. In the fall of 2012, Allen received his Bachelor of

Science in Medicinal Chemistry from the State University of New York at Buffalo. During

his time at UB, he worked as an undergraduate research assistant in two separate

laboratories; the organic division of Dr. Andrew Murkin, and the analytical division of Dr.

Luis A. Colon. It was under the supervision of Dr. Colon’s graduate student, Dr. J. Cody

Vinci that Allen accomplished his first authorship (Vinci, J. C. et al., Hidden Properties of

Carbon Dots Revealed After HPLC Fractionation. J. Phys. Chem. Lett 2013, 4 (2), 239-

243.) and propelled him towards a graduate career of his own. But before embracing the

life of a graduate student, Allen wanted a feel for the industrial work place, so in the

summer of 2012 he moved to Boston, MA to work as a chemical technician in the quality

control sector of Doble Engineering. In an attempt to get closer to his twin nephews, Brody

and Landyn Enslow, Allen began focusing on graduate programs in the southeastern

United States. This lead him to the acceptance of a graduate fellowship from the

University of Tennessee, and sequential move to Knoxville, TN in the summer of 2013.

In the spring of 2014, Allen began working with Dr. Shawn R. Campagna, originally

working on organic synthesis. His research quickly transitioned to the use of analytical

technologies, where he spearheaded the establishment of the neuroscience division for

the Biological Small Molecule Mass Spectrometry Core. Following graduate school, Allen

plans to join the research & development sector of a pharmaceutical company with long-

term goals of becoming a principal scientist for early-stage drug development.