Epidemiology and molecular phylogeny of Babesia sp in LittlePenguins Eudyptula minor in AustraliaRalph Eric Thijl Vanstreels a Eric J Woehler b Valeria Ruoppolo ac Peter Vertigan dNicholas Carlile e David Priddel e Annett Finger f Peter Dann g Kimberly Vinette Herrin hPaul Thompson h Francisco C Ferreira Junior i Eacuterika M Braga i Renata Hurtado jSabrina Epiphanio k Joseacute Luiz Catatildeo-Dias a

a Laboratory of Wildlife Comparative Pathology (LAPCOM) Department of Pathology School of Veterinary Medicine and Animal Science University of SatildeoPaulo Brazilb Institute for Marine and Antarctic Studies (IMAS) University of Tasmania Australiac International Fund for Animal Welfare USAd Birdlife Tasmania Australiae New South Wales Office of Environment and Heritage Australiaf Ecology and Environmental Management Group College of Engineering and Science Victoria University Australiag Research Department Phillip Island Nature Parks Australiah Taronga Conservation Society Australia Mosman Australiai Department of Parasitology Institute of Biological Sciences Federal University of Minas Gerais Brazilj Department of Preventive Veterinary Medicine and Animal Health School of Veterinary Medicine and Animal Science University of Satildeo Paulo Brazilk Department of Clinical and Toxicological Analyses Faculty of Pharmaceutical Sciences University of Satildeo Paulo Brazil

A R T I C L E I N F O

Article historyReceived 22 January 2015Revised 11 March 2015Accepted 13 March 2015

KeywordsBlood parasiteHealthPiroplasmidaSeabirdSphenisciformesTick-borne pathogen

A B S T R A C T

Blood parasites are potential threats to the health of penguins and to their conservation and manage-ment Little penguins Eudyptula minor are native to Australia and New Zealand and are susceptible topiroplasmids (Babesia) hemosporidians (Haemoproteus Leucocytozoon Plasmodium) and kinetoplastids(Trypanosoma) We studied a total of 263 wild little penguins at 20 sites along the Australian southeast-ern coast in addition to 16 captive-bred little penguins Babesia sp was identified in seven wild littlepenguins with positive individuals recorded in New South Wales Victoria and Tasmania True preva-lence was estimated between 34 and 45 Only round forms of the parasite were observed and genesequencing confirmed the identity of the parasite and demonstrated it is closely related to Babesia poeleafrom boobies (Sula spp) and B uriae from murres (Uria aalge) None of the Babesia-positive penguins pre-sented signs of disease confirming earlier suggestions that chronic infections by these parasites are notsubstantially problematic to otherwise healthy little penguins We searched also for kinetoplastids anddespite targeted sampling of little penguins near the location where Trypanosoma eudyptulae was orig-inally reported this parasite was not detected

copy 2015 The Authors Published by Elsevier Ltd on behalf of Australian Society for Parasitology This isan open access article under the CC BY-NC-SA license (httpcreativecommonsorglicensesby-nc-sa

40)

1 Introduction

Little Penguins Eudyptula minor are the smallest extant pen-guins and breed from Fremantle in Western Australia across thesouthern Australian coastline to central New South Wales (NSW)in Tasmania and in New Zealand (including the Chatham Islands)

(Marchant and Higgins 1990) Although the species has been con-sidered to be of ldquoLeast Concernrdquo in recent conservation statusassessments (eg Birdlife International 2012) significant de-creases have occurred in several breeding colonies in Australia inrecent decades (Bool et al 2007 Stevenson and Woehler 2007)The reasons for these decreases are numerous and while the roleof disease per se has not been investigated or implicated to datedisease could potentially contribute to population decreases nowor in the future

Blood parasites are potential threats to the health of penguinsand therefore to their conservation and management (Jones andShellam 1999 Levin et al 2009) Known penguin blood parasitescomprise Babesia peircei (Earleacute et al 1993) Borrelia sp (Yabsley et al

Corresponding author Departamento de Patologia Faculdade de MedicinaVeterinaacuteria e Zootecnia Universidade de Satildeo Paulo Av Prof Orlando Marques dePaiva 87 Cidade Universitaacuteria Satildeo Paulo SP 05508-000 Brazil Tel +55 11 999173082 fax +55 11 3091 1434

E-mail address ralph_vanstreelsyahoocombr (RET Vanstreels)

httpdxdoiorg101016jijppaw2015030022213-2244copy 2015 The Authors Published by Elsevier Ltd on behalf of Australian Society for Parasitology This is an open access article under the CC BY-NC-SA license(httpcreativecommonsorglicensesby-nc-sa40)

International Journal for Parasitology Parasites and Wildlife 4 (2015) 198ndash205

Contents lists available at ScienceDirect

International Journal for ParasitologyParasites and Wildlife

journal homepage wwwelseviercom locate i jppaw

2011) Haemoproteus sp (Levin et al 2009) Leucocytozoon tawaki(Fallis et al 1976) Plasmodium spp (Fantham and Porter 1944)Trypanosoma eudyptulae (Jones and Woehler 1989) and nema-tode microfilariae (Merkel et al 2007)

There are relatively few reports of blood parasites in little pen-guins in the wild or in captivity Plasmodium relictum has beenreported to cause mortality in captive little penguins in NorthAmerica (Griner and Sheridan 1967) and North Island New Zealand(NZ) (Varney and Gibson 2006 Harvey and Alley 2008) and hasalso been detected in wild little penguins at South Island NZ (vanRensburg 2010) Antibodies against Plasmodium sp or antigeni-cally similar organisms were also demonstrated in wild littlepenguins at Codfish Island NZ (Graczyk et al 1995a) and in captivelittle penguins at South Island NZ (Graczyk et al 1995b) The orig-inal and only report of Trypanosoma eudyptulae was made by Jonesand Woehler (1989) who described this parasite based on bloodsmears collected from wild little penguins at Marion Bay Tasma-nia Babesia sp has been reported to infect little penguins in NSW(Cunningham et al 1993) and it has been assumed to be the samespecies that infects African penguins (Spheniscus demersus) B peircei(Peirce 2000) Cannell et al (2013) identified DNA from Haemo-proteus sp in deceased wild little penguins at Penguin IslandWestern Australia however because intra-hepatocytic meronts wereobserved it is unclear if co-infection with Leucocytozoon sp oc-curred Although L tawaki has not yet been detected in wild littlepenguins Allison et al (1978) demonstrated that the infection candevelop under experimental conditions of forced exposure to simulidflies in South Island NZ

In this study we conducted a survey for blood parasites in littlepenguins along the coast of southeastern Australia in NSW Victo-ria and Tasmania Our results provide novel molecular andepidemiological information on Babesia sp in little penguins andcontribute with insights into the phylogeny of seabird-infectingBabesia spp

2 Materials and methods

21 Sampling procedures

A total of 263 wild little penguins were sampled from October2012 to March 2013 in 20 study sites in NSW Victoria and Tasma-nia (Table 1 Fig 1) An additional 16 captive-bred little penguin chickswere sampled at Taronga Zoo (Mosman NSW) Wild penguins werecaptured in their burrows during the day or were manually caughtwhile in their colonies at night with the exception of one 2ndash3 week-old chick found dead at Alum Cliffs Tasmania (site 16) Further detailson sampling effort are provided in Supplementary Data S1

Blood samples (between 005 and 3 mL) were collected throughvenepuncture (25 times 07 mm needle 3 mL syringe) of the dorsal meta-tarsal vein or right jugular vein For one deceased penguin chickblood was collected directly from the heart For the 11 penguinsat Haunted Bay (site 14) we also collected additional blood samplesby pinching the anterior flipper muscle (M extensor metacarpi ra-dialis) with a 25 times 07 mm needle then collecting a blood drop witha heparinised capillary tube Sampling procedures were approvedby the relevant Animal Research Ethics Committees (New SouthWales 02102802 Phillip Island Nature Park 32011 University ofTasmania A12394 University of Satildeo Paulo 279012) and authori-ties (New South Wales SL100668 Victoria 10005200 10006148Tasmania FA12284)

22 Morphological analysis of blood parasites

Two thin blood smears were freshly prepared from each sampleair-dried and then fixed with absolute methanol within 6 hours Oneslide was stained with Giemsa and another with Wright-Rosenfeld

(Rosenfeld 1947) One slide (preferably Giemsa-stained) from eachindividual was examined for intracellular and extracellular bloodparasites in 200 fields under 1000times magnification (approx 30minutes per slide field of view area = 0126 mm2) by an experi-enced observer (RET Vanstreels) Based on a sample of 100randomly selected microscope fields (obtained from 10 different in-dividuals 10 fields each) we found that each field contained anaverage 208 plusmn 44 erythrocytes we therefore examined approxi-mately 40000 erythrocytes per individual Additionally blood smearsfrom penguins sampled at Haunted Bay (site 14) were further ex-amined under 500times magnification for 20ndash30 min to increase theprobability of detecting Trypanosoma sp

23 PCR testing and gene sequencing

After blood smears were freshly prepared the remaining volumeof the blood samples collected in Tasmania and Taronga Zoo wastransferred to cryotubes and frozen (ndash20 degC) Frozen blood samplesfrom a few selected individuals were used for PCR testing and genesequencing DNA extraction was conducted using the DNEasy Bloodand Tissue Kit (69506 Qiagen ndash Valencia USA) and was verified and

Table 1Details of the study sites and sample sizes Superscript numbers within brackets cor-respond to the number of individuals with Babesia-positive blood smears

Study sites Geographiccoordinates

N

New South Wales1 - Cabbage Tree Island (Shoal Bay) 32deg41prime1737Prime S

152deg13prime3067Prime E10[2]

2 - Manly Point (Sydney) 33deg48prime3288Prime S151deg16prime5776Prime E

7

3 - Big Island Five Islands (Port Kembla) 34deg29prime2481Prime S150deg55prime3804Prime E

10

4 - Brush Island (Bawley Point) 35deg31prime3966Prime S150deg24prime5480Prime E

10

5 - ldquoNorthern Isletrdquo Tollgate Islands(Batemans Bay)

35deg44prime5354Prime S150deg15prime3793Prime E

10

6 - Montague Island (Narooma) 36deg15prime0220Prime S150deg13prime3560Prime E

20

Victoria7 - St Kilda (Melbourne) 37deg52prime0182Prime S

144deg58prime2339Prime E16

8 - ldquoSummerland Estaterdquo (Phillip Island) 38deg30prime3870Prime S145deg08prime3174Prime E

12[1]

9 - ldquoSummerland Southwestrdquo (Phillip Island) 38deg30prime5862Prime S145deg07prime4404Prime E

27

Tasmania10 - ldquoDoctorrsquos Rocks Westrdquo (Wynyard) 40deg59prime5076Prime S

145deg46prime0558Prime E18

11 - Lillico Beach (Devonport) 41deg09prime3600Prime S146deg18prime0228Prime E

22

12 - ldquoDarlington Foreshorerdquo (Maria Island) 42deg34prime4146Prime S148deg03prime5616Prime E

7[2]

13 - Fossil Cliffs (Maria Island) 42deg34prime2160Prime S148deg04prime4548Prime E

22

14 - Haunted Bay (Maria Island) 42deg43prime0714Prime S148deg04prime0840Prime E

11

15 - Red Chapel Beach (Hobart) 42deg54prime2958Prime S147deg20prime4470Prime E

4

16 - Alum Cliffs (Taroona) 42deg57prime3504Prime S147deg20prime3114Prime E

5

17 - Lucas Point (Tinderbox) 43deg02prime0990Prime S147deg20prime1824Prime E

2

18 - Stinking Bay (Tasman Peninsula) 43deg07prime3066Prime S147deg52prime4374Prime E

10

19 - Maignon Bay (Tasman Peninsula) 43deg11prime5725Prime S147deg51prime2334Prime E

13

20 - The Neck (Bruny Island) 43deg16prime1266Prime S147deg20prime5430Prime E

27[2]

Ex-situ (New South Wales)21 - Taronga Zoo (Mosman) 33deg50prime3488Prime S

151deg14prime3089Prime E16

199RET Vanstreels et alInternational Journal for Parasitology Parasites and Wildlife 4 (2015) 198ndash205

quantified through UV spectrophotometry (Nanodrop 2000 ThermoFisher Scientific ndash Waltham USA)

To test for Haemoproteus and Plasmodium we used a nested PCRtargeting the cytochrome b mitochondrial gene (Hellgren et al 2004)The first reaction used 75 ng of sample DNA 12 μmol of each primer(HaemNFI and HaemNR3) and the following temperature profile94 degC for 3 min 20 cycles (94 degC for 30 sec 50 degC for 50 sec 72 degCfor 45 sec) 72 degC for 10 min The second reaction used 1 μL of thefirst reaction product 12 μmol of each primer (HaemF and HaemR2)and the following temperature profile 94 degC for 3 min 35 cycles(94 degC for 30 sec 50 degC for 50 sec 72 degC for 45 sec) 72 degC for 10 min

To test for Babesia we used two nested PCR targeting the 18SrRNA gene (Medlin et al 1988 Gubbels et al 1999 Yabsley et al2006) The first reaction used 5 μL of sample DNA 20 μmol of eachprimer (Bab51 and BabB) and the following temperature profile94 degC for 1 min 30 cycles (94 degC for 1 min 48 degC for 1 min 72 degC for2 min) 72 degC for 5 min The second reaction used 1 μL of the firstreaction product 20 μmol of each primer (Bab51v2 and Bab31)and the following temperature profile 94 degC for 1 min 30 cycles(94 degC for 1 min 52 degC for 1 min 72 degC for 2 min) 72 degC for 5 minThe alternative second reaction used 1 μL of the first reaction product20 μmol of each primer (BabRLBF and BabRLBR) and the follow-ing temperature profile 94 degC for 1 min 30 cycles (94 degC for 1 min50 degC for 1 min 72 degC for 2 min) 72 degC for 5 min

Table 2 provides the sequences of the primers employed All re-actions were conducted with 125 μL GoTaq Green Master Mix(M7122 Promega ndash Madison USA) and a total well volume of 25 μLThe following samples were used as controls blood from a chickenexperimentally infected with Plasmodium gallinaceum blood froma tropical screech owl (Megascops choliba) naturally infected withHaemoproteus syrnii blood from a brown booby (Sula leucogaster)naturally infected with B poelea and blood from chicken raised inarthropod-free environments Gel electrophoresis was conductedto visualise amplification products using 1 agarose gel SYBR Safe(Invitrogen S33102 Life Technologies ndash Carlsbad USA) and a high-resolution imaging system (Gel Doc EZ System 170ndash8270 Bio-Radndash Hercules USA)

PCR amplification products of positive samples were purified withPolyethylene Glycol 8000 Bi-directional sequencing with dye-terminator fluorescent labelling (Applied Biosystems 4337455 LifeTechnologies ndash Carlsbad USA) was performed using primers Bab51v2and Bab31 and an automated sequencer (Applied Biosystems ABIPrism 3100 Life Technologies ndash Carlsbad USA) Forward and re-versed chromatograms were edited and consensus sequences weredeposited in GenBank (KP144322 and KP144323)

24 Phylogenetic analysis

Phylogenetic relationships of the Babesia lineages identified inthis study were inferred using published sequences for which specieswas identified based on morphological evidence (Criado et al 2006Lack et al 2012) in addition to avian-infecting Babesia lineages frompublished studies (Criado et al 2006 Jefferies et al 2008 Yabsleyet al 2009 Quillfeldt et al 2013 Martiacutenez et al 2014) Se-quences were aligned using ClustalW (Thompson et al 1997) asimplemented in MEGA 522 (Tamura et al 2011) A maximum like-lihood phylogenetic tree for the parasite sequences was producedusing MEGA 522 with the GTR + Gamma model of nucleotide evo-lution with 1000 bootstrap replications

Fig 1 Geographic distribution of sampling locations southeast Australia Site details are given in Table 1 The geographic distribution of little penguins (black area) is shownin the top right map (adapted from Marchant and Higgins 1990)

Table 2Sequence of the primers employed ldquoIrdquo stands for inosine a universal base

Primer name Sequence (5primendash3prime)

HaemNFI CATATATTAAGAGAAITATGGAGHaemNR3 ATAGAAAGATAAGAAATACCATTCHaemF ATGGTGCTTTCGATATATGCATGHaemR2 GCATTATCTGGATGTGATAATGGTBab51 CCTGGTTGATCCTGCCAGTAGTBabB CCCGGGATCCAAGCTTGATCCTTCTGCAGGTTCACCTACBab51v2 CATATGCTTGTCTTAAABab31 CTCCTTCCTTTAAGTGATAAGBabRLBF GTAGTGACAAGAAATAACAATABabRLBR TCTTCGATCCCCTAACTTTC

200 RET Vanstreels et alInternational Journal for Parasitology Parasites and Wildlife 4 (2015) 198ndash205

25 True prevalence estimate

True prevalence of blood parasites was estimated from bloodsmear examination using an adapted Rosan and Gladen proce-dure (Reiczigel et al 2010) Test sensitivity (Se) of blood smearexamination for Plasmodium sp is estimated between 68 and 81(Richard et al 2002 Valkiunas et al 2008) and we therefore usedvalues of 60 (worst-case) and 80 (best-case) to estimate true prev-alence Test specificity was fixed at 100 to produce the mostconservative estimates and confidence level was fixed at 95

3 Results

Round intracytoplasmatic parasites were observed in the eryth-rocytes of seven wild little penguin blood smears (Fig 2) Theseparasites were most compatible with round forms of piroplasmids(Babesia sp) but early stages of haemosporidians (Haemoproteussp Plasmodium sp Leucocytozoon sp) could not be discarded onthe basis of morphology No other parasite forms were observedin any of the blood smears and no blood parasites were detectedin the blood smears of the captive-bred penguins sampled in thisstudy

Molecular testing was applied to two blood smear-positivesamples and demonstrated that both were positive in the nestedPCR targeting the 18S rRNA gene of piroplasmids and were nega-tive to mitochondrial cytochrome b gene of haemosporidians (seeFig 3) The identity of the parasite was conclusively establishedthrough the sequencing of the 18S rRNA gene amplicons which dem-onstrated high phylogenetic similarity with published sequencesfrom Babesia spp particularly with seabird-infecting lineages (Fig 4Table 3)

Additionally it should be noted that the Haemoproteus-positivecontrol also yielded amplification products for the nested PCR tar-geting the 18S rRNA gene these products were only slightly lighterthan those for Babesia-positive samples (lane ldquodrdquo in Fig 3) Se-quencing of these amplicons however revealed high identity (gt98)with published 18S rRNA sequences from Strigiformes (owls ndash datanot shown) indicating that this was a false positive result due tounintentional amplification of host DNA

Apparent prevalence based on blood smears was 27 (7263)True prevalence is estimated to have been between 34 (best-case diagnostic performance) and 45 (worst-case diagnostic

performance) Table 4 provides estimates for each study site and stateseparately

We did not maintain records on the presence of ectoparasitesor haematophagous insects in NSW or Victoria however in Tas-mania we observed soft ticks (Argasidae) hard ticks (Ixodidae) fleas(Siphonaptera) lice (Austrogoniodes sp) mosquitoes (Culicidae) andblack flies (Simuliidae) (RET Vanstreels pers obs)

4 Discussion

Five species of Babesia are known to infect seabirds B bennetti(host Caspian gull Larus cachinnans) (Criado et al 2006) B peircei

Fig 2 Babesia sp in the blood smear of a little penguin Individual details TAS-124 male adult moulting sampled at ldquoDarlington Foreshorerdquo (Maria Island Tasmania)in 21022013 Genbank ascension number KP144323 Giemsa stain

a b c d e f a b c d e f

100

600

1500

primers targeting HaemoproteusPlasmodium

primers targeting Babesia

Fig 3 Agarose gel electrophoresis of amplification products obtained through nestedPCR tests targeting the 18S rRNA gene of Babesia (primers Bab51BabB followed byRLBFRLBR) or the mitochondrial cytochrome b gene of HaemoproteusPlasmodium(primers HaemNFIHaemNR3 followed by HaemFHaemR2) The following samplesare represented (a) captive-born little penguin chick negative blood smear (b) adultwild little penguin negative blood smear (c) Babesia-infected adult wild little penguinas confirmed through blood smear (d) Haemoproteus-infected adult tropical screechowl as confirmed through blood smear (e) Plasmodium-inoculated chicken raisedin arthropod-free environment (f) blood parasite-free chicken raised in arthropod-free environment

Table 3Estimates of evolutionary distance ( expected base substitutions per site) of 18SrRNA gene sequences of avian-infecting Babesia spp

Morphospecies (Genbanknumber) Host

2 3 4 5 6 7 8

1 Babesia kiwiensis(EF551335) Apteryxmantelli

171 913 913 915 828 889 889

2 Babesia sp (JX984667)Turdus falklandii

833 833 835 803 822 822

3 Babesia poelea(DQ200887) Sulaleucogaster

000 042 854 042 042

4 Babesia sp (KC754965)Sula leucogaster

042 854 042 042

5 Babesia uriae (FJ717705)Uria aalge

876 084 084

6 Babesia bennetti(DQ402155) Laruscachinnans

842 842

7 Babesia sp (KP144322)Eudyptula minor

000

8 Babesia sp (KP144323)Eudyptula minor

201RET Vanstreels et alInternational Journal for Parasitology Parasites and Wildlife 4 (2015) 198ndash205

(African penguin) (Earleacute et al 1993) B poelea (boobies Sula spp)(Work and Rameyer 1997) B uriae (common murre Uria aalge)(Yabsley et al 2009) and B ugwidiensis (cormorants Phalacrocoraxspp) (Peirce and Parsons 2012) B peircei and B poelea share re-markable morphological similarity both with the distinctive featureof concentrating the chromatin in the distal half of the merozo-ites which led Peirce (2000) to suggest that these taxa may in factbe synonymous The later-described B uriae (Yabsley et al 2009)also shares this morphological characteristic

In this study the lack of schizonts in blood smears has pre-cluded morphospecies identification as the round forms we observedare common to all avian-infecting Babesia spp (Peirce 2000) Thishas been a recurring characteristic of Babesia infections in little pen-guins (Cunningham et al 1993 van Rensburg 2010) and has madeit impossible to determine whether little penguins are infected byB peircei or by a distinct and presumably novel species Unfortu-nately there are no 18S rRNA gene sequences from B peircei to whichours could be compared Future studies will hopefully allow for this

comparison but it is our opinion that the parasite found in littlepenguins in this study is most likely B peircei as proposed by Peirce(2000)

Our phylogenetic analysis indicates that B poelea B uriae andBabesia sp from little penguins form a neat phylogenetic clusterwith high bootstrap value (98) and low evolutionary distance (lt084expected base substitutions per site) It is unclear however whether(a) B poelea B peircei and B uriae are distinct species and their mor-phological and genetic similarities do not reflect the true reproductiveisolation that exists or (b) the three parasites correspond to a singlespecies that can be transmitted among different taxonomic ordersof seabirds

The hypothesis that B poelea B peircei and B uriae are distinctspecies is strengthened by the fact that most Babesia spp are host-specific at the family or subfamily level (Peirce 2000) AdditionallyYabsley et al (2009) argue that the relatively small genetic differ-ence between B uriae and B poelea is sufficient to indicate areproductive isolation between these parasites Alternatively thehypothesis that B poelea and B uriae are in fact synonymous toB peircei is made plausible by the fact that opportunities for cross-infection of Babesia among different taxonomic orders of seabirdsare perhaps more common than initially assumed There are nu-merous locations in the world where sympatric species nest in closeproximity and can be parasitised by the same species of Ixodidaeand Argasidae ticks (Dietrich et al 2011) Thus it is reasonable thatthese ticks could be vectors for the transmission of Babesia amongdifferent species of seabirds as has been shown to occur forspirochaetes (Olseacuten et al 1995) In this case the subtle morpho-logical differences observed among B poelea B peircei and B uriae

Babesia divergens (U16370) Bos taurus Babesia capreoli (GQ304526) Capreolus capreolus Babesia odocoilei (AY339761) Rangifer tarandus

Babesia lotori (DQ028958) Procyon lotor Babesia gibsoni (AF175301) Canis familiaris Babesia canis (L19079) Canis familiaris

Babesia kiwiensis (EF551335) Apteryx mantelli (Northland New Zealand) Babesia sp (JX984667) Turdus falklandii (Robinson Crusoe Island Chile) Babesia caballi (EU642512) Equus ferus caballus

Babesia major (GU194290) Bos taurus Babesia crassa (AY260176) Ovis aries Babesia bigemina (HQ840959) Bubalus bubalis

Babesia orientalis (AY596279) Bubalus bubalis Babesia bovis (DQ402155) Bos taurus

Babesia bennetti (DQ402155) Larus cachinnans (Benidorm Island Spain) Babesia ovis (DQ287954) Capra aegagrus hircus

Babesia felis (AY452701) Felis catus Babesia leo (AF244911) Panthera leo Babesia rodhaini (AB049999) Rattus rattus

Babesia microti (JQ609304) Homo sapiens Babesia conradae (AF158702) Canis familiaris Babesia duncani (AY027816) Homo sapiens

Babesia sp (KP144322) Eudyptula minor (Maria Island Australia) Babesia sp (KP144323) Eudyptula minor (Maria Island Australia) Babesia uriae (FJ717705) Uria aalge (California USA)

Babesia poelea (DQ200887) Sula leucogaster (Johnston Atoll) Babesia sp (KC754965) Sula leucogaster (Fernando de Noronha Brazil)

Babesia bicornis (AF419313) Diceros bicornis Cytauxzoon felis (L19080) Felis catus

Babesia equi (AY150063) Equus ferus caballus Theilleria buffeli (Z15106) Bos taurus

Plasmodium falciparum (M19172) Homo sapiens

6588

99

100

98

63

98

74

91

30

55

7

7 76

99

69

100

100

65

50

98

70

60

85

56

01

Fig 4 Maximum likelihood phylogenetic tree of the 18S rRNA gene of the studied Babesia lineages Lineages identified in this study are emphasized in red and other avian-infecting lineages are emphasized in blue For each lineage the following information is provided morphospecies (Genbank ascension number) host species For avian-infecting lineages the geographic location is also provided Branch lengths are drawn proportionally to evolutionary distance (scale bar is shown) For interpretation of thereferences to colour in this figure legend the reader is referred to the web version of this article

Table 4True prevalence estimates under different scenarios of test sensitivity

Apparent prevalence Estimated true prevalence

Best-case(SE = 80)

Worst-case(SE = 60)

New South Wales 30 (2 67) 38 50Victoria 18 (1 55) 23 30Tasmania 28 (4 141) 35 47Total 27 (7 263) 34 45

202 RET Vanstreels et alInternational Journal for Parasitology Parasites and Wildlife 4 (2015) 198ndash205

could reflect host-specific variations as has been demonstrated inother avian blood parasites (eg Laird and Van Riper 1981)

Regardless it is clear that these parasites share a close phylo-genetic relationship and numerous phenotypic characteristics Incontrast the phylogenetic relationship between B ugwidiensis andother avian-infecting Babesia remains unknown The hosts ofB ugwidiensis and B peircei are sympatric in South Africa and shareectoparasites (Dietrich et al 2011) however the morphology ofthese parasites is clearly distinct ( Peirce and Parsons 2012) On theother hand B bennetti belongs to a phylogenetic group that is clearlydistinct from that of B poelea B uriae and Babesia sp from little pen-guins being more closely related to the Babesia spp identified indomestic mammals (see Fig 4)

Cunningham et al (1993) were first to document the occur-rence of Babesia-like parasites in little penguins at Bowen (apparentprevalence = 2126 = 16) and Lion islands (8168 = 48) (NSWAustralia) The protozoan nature of these parasites was demon-strated through electron microscopy but because only round formswere observed the identity of the parasites could not be conclu-sively demonstrated Likewise van Rensburg (2010) observed roundintracytoplasmatic inclusions compatible with Babesia sp in theblood smears of little penguins at Tiritiri Matangi Island(979 = 114) (Hauraki Gulf NZ) but also could not conclusivelyidentify the parasite Other studies examining blood smears orhistopathology of wild little penguins did not find evidence ofBabesia sp infection in Western Australia (Jones and Shellam 1999Cannell et al 2013) Victoria (Obendorf and McColl 1980 Mortimerand Lill 2007) Tasmania (Jones and Woehler 1989 Jones andShellam 1999) NSW (Mykytowycz and Hesterman 1957) or NewZealand (Laird 1950 Crockett and Kearns 1975 Allison et al1978)

In this study we confirm the occurrence of Babesia sp in wildlittle penguins in NSW and extend the known distribution of theseparasites to Victoria and Tasmania The parasite was identified in27 of the blood smears examined from wild little penguinshowever it must be considered that blood smear examination isas any other diagnostic test imperfect (Garamszegi 2011) Con-sidering the information available on the performance of blood smearexamination for the detection of other avian blood parasites (Richardet al 2002 Valkiunas et al 2008) we estimate that true preva-lence was between 34 and 45 We suggest that if each Australianstate is examined separately for Babesia in little penguins the trueprevalence is estimated between 23 and 50 (Table 4) based oncurrent evidence

Blood smear examination is considered to be the standard methodto detect blood parasites due to its high specificity its value for mor-phological characterisation and its ability to detect mixed infectionswhile requiring no a priori decisions on the parasitic species for whichsearches are to be conducted Alternatively PCR has been shownto provide a higher sensitivity particularly for chronic infections(Richard et al 2002 Valkiunas et al 2008) Our results demon-strate that the nested PCR targeting the 18S rRNA gene is adequatefor the detection of Babesia sp in little penguins and may there-fore become a viable tool for future studies on the epidemiologyof penguin-infecting Babesia However because we observed thatthe avian hostrsquos DNA may occasionally be co-amplified and lead tofalse positive results it is imperative that positive results ob-tained by this method are confirmed through sequencing of theamplicons

The clinical relevance of Babesia in penguins is not clear Brossyet al (1999) considered that B peircei ldquodoes not cause overt clin-ical symptoms except under stress or in association with otherdebilitating diseasesrdquo in African penguins Cunningham et al (1993)did not find evident signs of illness in Babesia-positive little penguinsexcept for mild regenerative anaemia Similarly co-infection byB peircei was observed in 50 of the African penguins infected

with Relapsing Fever Borrelia at a rehabilitation centre in SouthAfrica and yet these co-infections are not accompanied by signif-icant signs of disease (Yabsley et al 2011) None of the Babesia-positive penguins in this study presented any obvious sign ofdisease supporting earlier proposals that this is not a substantial-ly pathogenic parasite to otherwise healthy little penguins It isworth considering however that the fact that we only observedround forms with no schizonts in the blood smears (as didCunningham et al 1993) suggests these were chronic infectionswhen asexual multiplication is low and most circulating life stagesare latent progametocytes it is possible that the acute stage ofthe infection could result in more prominent health implicationsfor the host

The little penguin colony at Marion Bay from which Jones andWoehler (1989) described T eudyptulae was destroyed during a firein 1994 and the site has not been recolonised since (Stevenson andWoehler 2007 EJ Woehler unpubl data) We intentionally di-rected considerable sampling effort on the extant breeding coloniesclose to Marion Bay (see Fig 1) but did not detect T eudyptulae inthese colonies in this study This is surprising considering the rel-atively high prevalence (173) with which the parasite was foundin that study and could indicate that (a) the parasite eluded de-tection in this study (b) the parasite occurred in lower prevalenceat the locations and time at which we conducted our sampling com-pared with the 1989 study andor (c) the parasite disappeared alongwith its host population at Marion Bay (which we consider highlyunlikely)

Jones and Woehler (1989) obtained blood samples by superfi-cially scraping the skin near the brachial vein on the flipper withrazorblades (EJ Woehler pers obs) therefore obtaining capillaryblood In this study we used venipuncture of large vessels (jugularor metatarsal) obtaining peripheral blood This difference in sam-pling may be relevant as it has been shown that mammal-infectingtrypanosomes tend to concentrate in capillaries rather than largerblood vessels (Hornby and Bailey 1931 Banks 1978) It is pres-ently unclear whether avian-infecting trypanosomes behave similarly(Holmstad et al 2003) We produced smears from capillary bloodsamples obtained by pinching the flipper muscle from little pen-guins at Haunted Bay We found no parasites in those smearshowever the sample size may have been too small (n = 11) we there-fore encourage future studies to employ blood sampling methodsthat yield capillary blood Furthermore because the Trypanosomaparasitemia is often very low the development of PCR tests that allowfor the detection of T eudyptulae could be of great benefit to futurestudies on the epidemiology of this parasite

It is possible that little penguin colonies permanently or inter-mittently fail to provide adequate environmental conditions suitablefor the proliferation of arthropod vectors andor the presence of otheravian species that could act as reservoirs of infection Factors suchas interannual prevalence fluctuations age (Merino et al 1996) timeof the day (Cornford et al 1976) and seasonal latency (Valkiunaset al 2004) may affect both the occurrence of Trypanosoma spp orthe probability of their detection Arthropod vectors of T eudyptulaeremain unknown but could include mites (Acari) mosquitoes (Cu-licidae) and blood-sucking flies (Hippoboscidae Simuliidae)(Molyneux 1977)

In conclusion it is unclear whether Babesia sp poses a signifi-cant concern to the conservation of little penguins Future studiesinvestigating the health effects of this parasite and its epidemio-logical dynamics would help in understanding this parasite Thequestion still remains on whether this parasite corresponds to Babesiapeircei from African penguins or if it is a distinct species and futurestudies in the African species may assist in clarifying this The failureto detect T eudyptulae in southeastern Tasmania is puzzling and forthe moment this continues to be the most enigmatic blood para-site of penguins

203RET Vanstreels et alInternational Journal for Parasitology Parasites and Wildlife 4 (2015) 198ndash205

Acknowledgements

We are thankful to Natalie Bool Andre Chiaradia John CoombesAlena Hrasky Jason Jones Peter Lingard Perviz Marker Ken MathersMichael Peirce Leanne Renwick Caitlin Vertigan Cecilia Villan-ueva John Warren and Paula Wasiak for their valuable contributionsMark Hindell and Stewart Nicol (University of Tasmania) providedmaterials and laboratory facilities This study was conducted throughthe financial support of CAPES ndash Coordenaccedilatildeo de Aperfeiccediloamentode Pessoal de Niacutevel Superior (BEX 1250512-9) Fundaccedilatildeo de Amparoagrave Pesquisa do Estado de Satildeo Paulo (FAPESP 200910695-0 200953956-9 201051801-5) and National Institute of Science andTechnology Genetic and Health Information of the Brazilian Live-stock (INCT-IGSPB) and logistical support of BirdLife Tasmania theUniversity of Tasmania the New South Wales Office of Environ-ment and Heritage and Phillip Island Nature Parks

Conflict of interest

The authors declared that there is no conflict of interest

Appendix Supplementary material

Supplementary data to this article can be found online atdoi101016jijppaw201503002

References

Allison FR Desser SS Whitten LK 1978 Further observations on the life cycleand vectors of the haemosporidian Leucocytozoon tawaki and its transmissionto the Fiordland crested penguin New Zeal J Zool 5 371ndash374

Banks KL 1978 Binding of Trypanosoma congolense to the walls of small bloodvessels J Protozool 25 241ndash245

Birdlife International 2012 Eudyptula minor IUCN 2012 IUCN Red List of ThreatenedSpecies Version 20122 httpwwwiucnredlistorg Accessed March 2013

Bool NM Page B Goldsworthy SD 2007 What is causing the decline of littlepenguins (Eudyptula minor) on Granite Island South Australia Report to theSouth Australian Department for Environment and Heritage WildlifeConservation Fund and the Nature Foundation SA

Brossy JJ Ploumls AL Blackbeard JM Kline A 1999 Diseases acquired by captivepenguins what happens when they are released into the wild Mar Ornithol27 185ndash186

Cannell BL Krasnec KV Campbell K Jones HI Miller RD Stephens N 2013The pathology and pathogenicity of a novel Haemoproteus spp infection in wildLittle Penguins (Eudyptula minor) Vet Parasitol 197 74ndash84

Cornford EM Freeman BJ MacInnis AJ 1976 Physiological relationships andcircadian periodicities in rodent trypanosomes Trans R Soc Trop Med Hyg70 238ndash243

Criado A Martinez J Buling A Barba JC Merino S Jefferies R et al 2006 Newdata on epizootiology and genetics of piroplasms based on sequences of smallribosomal subunit and cytochrome b genes Vet Parasitol 142 238ndash247

Crockett DE Kearns MP 1975 Northern little blue penguin mortality in NorthlandNotornis 22 69ndash72

Cunningham M Gibbs P Rogers T Spielman D Walraven E 1993 Ecology andhealth of the little penguin Eudyptula minor near Sydney A report prepared forthe Sydney Water board Edited by the Taronga Zoo

Dietrich M Goacutemez-Diacuteaz E McCoy KD 2011 Worldwide distribution and diversityof seabird ticks implications for the ecology and epidemiology of tick-bornepathogens Vector Borne Zoonotic Dis 11 453ndash470

Earleacute RA Huchzermeyer FW Bennett GF Brossy JJ 1993 Babesia peircei spnov from the Jackass Penguin S Afr J Zool 28 88ndash90

Fallis AM Bisset SA Allison FR 1976 Leucocytozoon tawaki n sp (EucoccidaLeucocytozoidae) from the penguin Eudyptes pachyrhynchus and preliminaryobservations on its development in Austrosimulium spp New Zeal J Zool 311ndash16

Fantham HB Porter A 1944 On a Plasmodium (Plasmodium relictum varspheniscidae n var) observed in four species of Penguins Proc Zool Soc Lond114 279ndash292

Garamszegi LZ 2011 The sensitivity of microscopy and PCR-based detectionmethods affecting estimates of prevalence of blood parasites in birds J Parasitol96 1197ndash1203

Graczyk TK Cockrem JF Cranfield MR Darby JT Moore P 1995a Avian malariaseroprevalence in wild New Zealand penguins Parasite 2 401ndash405

Graczyk TK Cranfield MR Brossy JJ Cockrem JF Jouventin P Seddon PJ 1995bDetection of avian malaria infections in wild and captive penguins J Helm SocWash 62 135ndash141

Griner LA Sheridan BW 1967 Malaria (Plasmodium relictum) in penguins at theSan Diego Zoo Am J Vet Clin Path 1 7ndash17

Gubbels JM de Vos AP van der Weide M Viseras J Schouls LM 1999Simultaneous detection of bovine Theileria and Babesia species by reverse lineblot hybridization J Clin Microbiol 37 1782ndash1789

Harvey C Alley MR 2008 Current veterinary laboratory surveillance of avianhaemoparasitic diseases in New Zealand Kokako 15 15ndash19

Hellgren O Waldenstroumlm J Bensch S 2004 A new PCR assay for simultaneousstudies of Leucocytozoon Plasmodium and Haemoproteus from avian blood JParasitol 90 797ndash802

Holmstad PR Anwar A Lezhova T Skorping A 2003 Standard samplingtechniques underestimate prevalence of avian hematozoa in Willow Ptarmigan(Lagopus lagopus) J Wildl Dis 39 354ndash358

Hornby HE Bailey HW 1931 Diurnal variation in the concentration of Trypanosomacongolense in the blood-vessels of the Oxrsquos ear Trans R Soc Trop Med Hyg 5557ndash564

Jefferies R Down J McInnes L Ryan U Robertson H Jakob-Hoff R et al 2008Molecular characterization of Babesia kiwiensis from the Brown Kiwi (Apteryxmantelli) J Parasitol 94 557ndash560

Jones HI Shellam GR 1999 The occurrence of blood-inhabiting protozoa in captiveand free-living penguins Polar Biol 21 5ndash10

Jones HI Woehler EJ 1989 A new species of blood trypanosome from LittlePenguins (Eudyptula minor) in Tasmania J Protozool 36 389ndash390

Lack JB Reichard MV Van Den Bussche RA 2012 Phylogeny and evolution ofthe Piroplasmida as inferred from 18S rRNA sequences Int J Parasitol 42353ndash363

Laird M 1950 Some blood parasites of New Zealand birds Zoological PublicationsVictoria University College of Wellington 5 pp 1ndash20

Laird M Van Riper C 1981 Questionable reports of Plasmodium from birds inHawaii with the recognition of P relictum ssp capistranoae (Russel 1932) as theavian malaria parasite there In Canning EU (Ed) Parasitological topics apresentation volume to PCC Garnham FRS on the occasion of his 80th birthday1981 Allen Press Lawrence pp 159ndash165

Levin II Outlaw DC Vargas FH Parker PG 2009 Plasmodium blood parasitefound in endangered Galaacutepagos penguins (Spheniscus mendiculus) Biol Conserv142 3191ndash3195

Marchant S Higgins PJ 1990 Handbook of Australian New Zealand and AntarcticBirds ndash Volume 1 Ratites to Ducks Oxford University Press Melbourne

Martiacutenez J Vaacutesquez RA Venegas C Merino S 2014 Molecular characterisationof haemoparasites in forest birds from Robinson Crusoe Island is the AustralThrush a potential threat to endemic birds Bird Conserv Int doi101017S0959270914000227

Medlin L Elwood HJ Stickel S Sogin ML 1988 The characterization ofenzymatically amplified eukaryotic 16-like rRNA-coding regions Gene 71491ndash499

Merino S Potti J Moreno J 1996 Maternal effort mediates the prevalence oftrypanosomes in the offspring of a passerine bird Proc Natl Acad Sci USA93 5726ndash5730

Merkel J Jones HI Whiteman NK Gottdenker N Vargas H Travis EK et al2007 Microfilariae in Galaacutepagos Penguins (Spheniscus mendiculus) and FlightlessCormorants (Phalacrocorax harrisi) J Parasitol 93 492ndash503

Molyneux DH 1977 Vector relationships in the trypanosomatidae Adv Parasitol15 1ndash82

Mortimer L Lill A 2007 Activity-related variation in blood parameters associatedwith oxygen transport and chronic stress in little penguins Aust J Zool 55249ndash256

Mykytowycz R Hesterman ER 1957 A note on tick infestation of the fairy penguinEudyptula minor Forster CSIRO Wildl Res 2 165ndash166

Obendorf DL McColl K 1980 Mortality in little penguins (Eudyptula minor) alongthe coast of Victoria Australia J Wildl Dis 16 251ndash259

Olseacuten B Duffy DC Jaenson TGT Gylfe A Bonnedahl J Bergstroumlm S 1995Transhemispheric exchange of Lyme disease spirochetes by seabirds J ClinMicrobiol 33 3270ndash3274

Peirce MA 2000 A taxonomic review of avian piroplasms of the genus BabesiaStarcovici 1893 J Nat Hist 34 317ndash332

Peirce MA Parson NJ 2012 Babesia ugwidiensis a new species of Avian piroplasmfrom Phalacrocoracidae in South Africa Parasite 19 375ndash379

Quillfeldt P Martiacutenez J Bugoni L Mancini PL Merino S 2013 Blood parasitesin noddies and boobies from Brazilian offshore islands ndash differences betweenspecies and influence of nesting habitat Parasitol 141 399ndash410

Reiczigel J Foumlldi J Oacutezsvaacuteri L 2010 Exact confidence limits for prevalence of adisease with an imperfect diagnostic test Epidemiol Infect 138 1674ndash1678

Richard FA Sehgal RNM Jones HI Smith TB 2002 A comparative analysis ofPCR-based detection methods for avian malaria J Parasitol 88 819ndash822

Rosenfeld G 1947 Corante pancrocircmico para hematologia e citologia cliacutenica Novacombinaccedilatildeo dos componentes do May-Grunwald e do Giemsa num soacute corantede emprego raacutepido Mem Inst Butantan 2 329ndash335

Stevenson C Woehler EJ 2007 Population decreases in Little Penguins Eudyptulaminor in southeastern Tasmania Australia over the past 45 years Mar Ornithol35 71ndash76

Tamura K Peterson D Peterson N Stecher G Nei M Kumar S 2011 MEGA5molecular evolutionary genetics analysis using maximum likelihood evolution-ary distance and maximum parsimony methods Mol Biol Evol 28 2731ndash2739

Thompson JD Gibson TJ Plewniak F Jeanmougin F Higgins DG1997 The CLUSTAL_X windows interface flexible strategies for multiple

204 RET Vanstreels et alInternational Journal for Parasitology Parasites and Wildlife 4 (2015) 198ndash205

sequence alignment aided by quality analysis tools Nucleic Acids Res 254876ndash4882

van Rensburg MJ 2010 Parasitism disease and breeding ecology of little bluepenguins (Eudyptula minor) on Tiritiri Matangi Island New Zealand MSc thesisMassey University Auckland 240 pp

Valkiunas G Bairlein F Iezhova TA Dolnik OV 2004 Factors affecting the relapseof Haemoproteus belopolskyi infections and the parasitaemia of Trypanosoma sppin a naturally infected European songbird the blackcap Sylvia atricapilla ParasitolRes 93 218ndash222

Valkiunas G Iezhova TA Krizanauskiene A Palinauskas V Sehgal RNM BenschS 2008 A comparative analysis of microscopy and PCR-based detection methodsfor blood parasites J Parasitol 94 1395ndash1401

Varney K Gibson I 2006 Quarterly review of diagnostic cases ndash October toDecember 2005 Surveillance 33 11ndash16

Work TM Rameyer RA 1997 Description and Epizootiology of Babesia poelean sp in Brown Boobies (Sula leucogaster (Boddaert)) on Sand Island JohnstonAtoll Central Pacific J Parasitol 83 734ndash738

Yabsley MJ Work TM Rameyer RA 2006 Molecular phylogeny of Babesia poeleafrom Brown Boobies (Sula leucogaster) from Johnston Atoll Central Pacific JParasitol 92 423ndash425

Yabsley MJ Greiner E Tseng FS Garner MM Nordhausen RW Ziccardi MHet al 2009 Description of novel Babesia species and associated lesions fromcommon murres (Uria aalge) from California J Parasitol 95 1183ndash1188

Yabsley MJ Parsons NJ Horne EC Shock BC Purdee M 2011 Novel relapsingfever Borrelia detected in African penguins (Spheniscus demersus) admitted totwo rehabilitation centers in South Africa Parasitol Res 110 1125ndash1130

205RET Vanstreels et alInternational Journal for Parasitology Parasites and Wildlife 4 (2015) 198ndash205