Delivered by Ingenta toRice University Fondren Library

IP 176142389Wed 01 Aug 2012 061037

RESEARCH

ARTIC

LE

Copyright copy 2012 American Scientific PublishersAll rights reservedPrinted in the United States of America

Journal ofBiomedical Nanotechnology

Vol 8 567ndash574 2012

Efficient siRNA Delivery System Using CarboxilatedSingle-Wall Carbon Nanotubes in Cancer Treatment

Ioana Berindan Neagoe12lowast Cornelia Braicu1 Cristian Matea3 Constantin Bele3 Graur Florin45Katona Gabriel6 Chedea Veronica7 and Alexandru Irimie48lowast

1Department of Functional Genomics and Experimental Pathology Cancer Institute ldquoIon Chiricutardquo Cluj-Napoca 400015 Romania2Department of Immunology University of Medicine and Pharmacy ldquoIuliu Hatieganurdquo Cluj-Napoca 400023 Romania

3Department of Chemistry and Biochemistry University of Agricultural Sciences and Veterinary Medicine Cluj-Napoca 400372 Romania4Department of Surgical Oncology University of Medicine and Pharmacy ldquoI Hatieganurdquo Cluj-Napoca 400023 Romania

5Surgical Clinic III Cluj-Napoca Cluj 400162 Romania6Faculty of Chemistry and Chemical Engineering Babes-Bolyai University Cluj-Napoca 400028 Romania

7Department of Life Science and Biotechnology Shimane University 1060 Nishikawatsu Matsue Shimane 690-8504 Japan8Department of Surgery ldquoIon Chiricutardquo Cancer Institute Cluj-Napoca 400015 Romania

Several functionalized carbon nanotubes have been designed and tested for the purpose of nucleicacid delivery In this study the capacity of SWNTC-COOH for siRNA deliverey were investigateddelivery in parallel with an efficient commercial system Hep2G cells were reverse-transfected with50 nM siRNA (p53 siRNA TNF-siRNA VEGFsiRNA) using the siPORTtrade NeoFX (Ambion) trans-fection agent in paralel with SWNTC-COOH functionalised with siRNA The highest level of geneinhibition was observed in the cases treated with p53 siRNA gene in the case of transfection withsiPort the NeoFX value was 338 while in the case of SWNTC-COOH as delivery system for p53siRNA was 375 The gene silencing capacity for VEGF was 537 respectively for TNF- 567for siPORT NeoFX delivery systems versus 477 (VEGF) and 465 (TNF- for SWNTC-COOHdelivery system SWNTC-COOH we have been showed to have to be an efficient carrier systemThe results from the inhibition of gene expresion for both transfection systems were confirmed atprotein level Overall the lowest mRNA expression was confirmed at protein level especially in thecase of p53 siRNA and TNF- siRNA transfection Less efficient reduction protein expressions wereobserved in the case of VEGF siRNA for both transfection systems at 24 h only at 48 h therewas a statistically significant reduction of VEGF protein expression SWCNT-COOH determined anefficient delivery of siRNA SWNTC-COOH combined with suitable tumor markers like p53 siRNATNF siRNA or VEGF siRNA can be used for the efficient delivery of siRNA

Keywords siRNA Delivery Carbon Nanotubes Hep2G Cell Line

1 BACKGROUND

Small interfering RNA (siRNA) sometimes known asshort interfering RNA or silencing RNA is a class ofdouble-stranded RNA molecules 20ndash25 nucleotides inlength that play a variety of roles in biology1 Thetherapeutic use of siRNA is a developing trend inbiomedicine It has been combined with nanotechnol-ogy for the treatment of several diseases with promisingresults1 However one of the key problems concerning thedevelopment of siRNA target theraphy is its delivery tospecific cell or tissue types2 Until now different deliv-ery systems have been tested Depending of their struc-ture they can be defined as viral vectors (eg adenoviral

lowastAuthors to whom correspondence should be addressed

lentiviral retroviral herpes virus simplex RNA viruses)and non-viral vector systems3 Viral vectors are one of themajor vehicles used by scientists in gene therapy to gettheir sequences expressed in the proper host Non-viralmethods present certain advantages over viral methodsthey are safer to prepare and the risks of pathogenic andimmunologic complications are diminished Nonviral vec-tors are the future of gene transfer due to the limitations ofviral vectors such as pathogenicity expense of productionand systemic instability4

Non-viral vector systems include a variety of smallmolecules lipids peptides and proteins that have beenexamined as delivery vehicles for nucleic acids5 Car-bon nanomaterials like nanotubes or fullerenes are alsoused as carriers for siRNA Modifications to the carbon

J Biomed Nanotechnol 2012 Vol 8 No 4 1550-703320128567008 doi101166jbn20121411 567

Delivered by Ingenta toRice University Fondren Library

IP 176142389Wed 01 Aug 2012 061037

RESEARCH

ARTIC

LE

Efficient siRNA Delivery System Using Carboxilated Single-Wall Carbon Nanotubes in Cancer Treatment Neagoe et al

surface of nanotubes for higher solubility have beenshown to reduce their toxicity Carbon nanotubes (CNTs)exhibit many unique intrinsic physical and chemical prop-erties and have been intensively explored for biologi-cal and biomedical applications in the past few years6

Depending on the number of graphene layers from whicha single nanotube is composed CNTs are classified assingle-walled carbon nanotubes (SWNTs) doublendashwalledcarbon nanotubes (DWNTs) or multi-walled carbon nano-tubes (MWNTs)6 CNTs have significant biological poten-tial and can effectively shuttle various bio-molecules intocells ndash including drugs peptides proteins plasmid DNAand siRNA In the case of CNTs the internalisation hasinsignificant toxicity as was observed in previous studiesas well as low immunogenicity to the cells7ndash10

To date however the potential of designing creat-ing and applying CNTs for the delivery of nucleic acidsor drugs has only been investigated in a limited num-ber of studies11 Several functionalized CNTs have beendesigned and tested for the purpose of nucleic aciddelivery12ndash14 Phospholipid-coated CNTs functionalizedwith amineterminated polyethylene glycol (PL-PEG2000-NH2) ammonium-functionalized CNTs15 dendron-CNT12

carboxylated-NTC14 were reported to be efficient insiRNA delivery with low cytotoxicity and were shown tobe efficient in siRNA and DNA delivery in human celllines or primary cells This study evaluates the potentialof RNAi using two transfection systems that interfere withthe expression of specific genes that are overexpressed incancer p53 TNF- (tumour necrosis factor alpha) andVEGF (vascular endothelial growth factor) were identifiedas new potential therapeutic target for cancer treatmentAbnormalities of p53 are considered a predisposition fac-tor for carcinogenesis16 The p53 gene therapy in cancerhas been intensively investigated The vascular endothelialgrowth factor (VEGF) plays a critical role in the patho-logic angiogenesis during the development of cancer Theknockdown of VEGF and its receptor using RNAi haspreviously shown the ability to inhibit tumor cell pro-liferation and subsequently result in apoptosis17 Successhas been reported in biological therapies especially inpatients resistant to conventional treatment by a specificlevel reduction of tumor necrosis factor- (TNF-18

The carboxylation of CNT (SWNTC-COOH) wasachieved using the procedure presented by Iancu et al7

with minor changes19 In this study SWNTC-COOH werefunctionalized with three different validated siRNA forp53 VEGF and TNF- The silencing activity and thecellular toxicity of siRNA complexes based on SWNTC-COOH were compared with those on the regularly usedlipid transfection agent siPort NeoFX (Ambion) Further-more it was observed that SWNTC-COOH is a highefficient non-cytotoxic system for siRNA delivery To com-pare the delivery efficiency was used as in vitro modelHep2G cell line For the evaluation of cytotoxicity we

used the MTT test while for the inhibition of gene expres-sion we performed RT-PCT with particular primers andUPL probes specific for each gene The gene expressiondata were validated at protein level

2 MATERIALS AND METHODS

21 Materials

The single-wall carbon nanotubes (gt90 carbon puritysim08 nm diameter) were purchased from Sigma-AldrichChemical Co (St Louis MO USA) and used without fur-ther purification All other chemicals were purchased fromMerck (Darmstadt Germany) We used Silencerreg FAMtrade-Labeled Negative Control 1 siRNA from Ambion to eval-uate the uptake capacity of both transfection systems Thep53 siRNA (Santa Cruz sc-29435) consists of pools ofthree to five target-specific 19-25 nt siRNAs designedto knock down gene expression and the VEGF siRNA(AM16804 ID4638) and TNF- (AM16804 ID4021)contain pre-designed siRNA framgments HPLC purifiedFor the siRNA transfection we used siPORT NeoFXTransfection Agent (Ambion)

22 Carboxylation of SWNTC

The CNT carboxylation was achieved using the procedurepresented by Iancu et al7 with minor changes 80 mg ofCNTrsquos were dispersed in a 80 mL 31 (vv) sulphonitricmixture using a sonic tip for 4times 10 s Afterwards themixture was refluxed for 30 min at 120 C The oxidizedCNTrsquos were washed three times with deionized water andcentrifuged at 5000 RPM for 20 min in order to removeexcess acid in the supernatant Further on the CNTrsquoswere filtered through a 02 m polycarbonate filter (What-man) until the elution reached a neutral pH The concen-tration of the solution obtained was determined using aUV-Vis-NIR spectroscopy (JASCO V530 Gross-UmstadtGermany)719

23 Cell Culture

HepG2 are adherent epithelial-like cells growed as mono-layers and in small aggregates HepG2 cells were cul-tivated in the recommended RPMI1640 10 fetal calfserum 2 mM glutamine 100 Uml penicillin 01 mgmlstreptomycin solution (all from Sigma Germany) andwere maintained in 5 CO2-humified air at 37 C

24 Cell Viability

The cell viability was evaluated by MTT viability assayin a 96-well plate Cell survival was determined for trans-fected cells and transfection systems too After discharg-ing the culture medium the cells were incubated (5 CO237 C) for 1 h with 100 lwell MTT and then washed

568 J Biomed Nanotechnol 8 567ndash574 2012

Delivered by Ingenta toRice University Fondren Library

IP 176142389Wed 01 Aug 2012 061037

RESEARCH

ARTIC

LE

Neagoe et al Efficient siRNA Delivery System Using Carboxilated Single-Wall Carbon Nanotubes in Cancer Treatment

with phosphate buffered saline (Sigma Germany) The for-mazan salt produced by the mitochondria of the living cellswas dissolved in 150 igravelwell dimethyl sulfoxide (DMSO)and the absorption was measured at 492 nm with TecanSunrisetrade Absorbance Reader The mean optical density of3 wells was taken in consideration for each control andtreated sample

25 HepG2 Cell Transfection

The transfections were performed using the Silencerreg

siRNA Transfection II Kit (Ambion USA) containingsiPORT Amine tranfection agent Reverse transfection(or neofection) was applied for siPORT NeoFX throughwhich the cells were transfected as they were adhering to aplate after trypsinization 5 l siPORT NeoFX transfectionagent were mixed in Opti-MEM (Gibco-Invitrogen UK)to a total volume of 100 ml then incubated for 10 min-utes at room temperature The siRNA was then diluted ina 100 ml OPTI-MEM medium to achieve a final concen-tration in cell culture medium of 50 nM Then we mixedthe diluted siRNA and the diluted siPORT NeoFX Trans-fection Agent the mixture was incubated for 10 min atroom temperature and dispensed into a culture plate thecells were incubated until further assays A stable aqueoussolution of SWNTC (aprox length 200 nm) was preparedwith highly pure SWNTC-COOH disolved in RN-ase DN-ase free water The solution was sonicated for 3 h thencentrifuged 10 L of 5 10 mM siRNA per target genewere added in 50 l of SWNTC-COOH aqueous solutionsonicated for 30 min then added to cell medium The levelof SWNTC-COOH in the cell medium was 0025 mgmland the final concentration for siRNA was 50 nM

26 Determination of Gene Expression

261 Total RNA Isolation

Total RNA was isolated with TriReagent (Sigma-Aldrich)and analyzed for quantity and quality with ND-1000 andAgilent Lab-on-a-chip Bioanalyzer 2100 (Agilent Technol-ogy) All the RNAs presented a RIN between 75 and 10

262 cDNA Synthesis

cDNA Synthesis Kit (Roche Diagnosis Germany) wasused for cDNA synthesis in this study Dilutions were donefor each sample so as to obtain a final concentration of1000 ng11 ul in each tube (the initial concentration forcDNA synthesis was the same in each tube)

263 qRT-PCR

The LightCycler TaqMan Master kit was used for RT-PCR analyses according to the protocol provided by

the manufacturer using LightCycler 480 Detector Sys-tem (Roche) A template cDNA (110 diluted) wasadded to the TaqMan Universal Master Mix with specificprimers and probe for each gene -actin CCAACCGCGAAGATGACCAGAGGCGTACAGGGATAG VEGF(vascular endothelial growth factor) CCACTTCgTgAT-gATTCgCmTACCTCCACCATgCCAAgT TNF- (tumornecrosis factor-alpha) CagCCTCTTCTCCTTCCTgAT-GCCAGAgggCTGATTAAgAgAThe primers and UPL probes (Roche) used in the qRTndash

PCR evaluation were specific to every gene For all thegenes we used 1 M of both primers and 02 M fromUPL (Universal Probe Library) Changes in the expres-sion of target genes were measured as relative to the meancritical threshold (Ct) values of 18S housekeeping geneThe mRNA levels were analyzed using the Ct methodbased on fold-change calculations with normalization forall of the genes

27 p53 Immunofluorescence Staining

For siRNA treatments subconfluent proliferating cellswere transfected with 50 nM of siRNA using the siPORTNeoFX Transfection Agent and SWNTC-COOH At 24 hafter the transfection the cells were fixed with 4 PFA(paraformaldehyde) for 8 min and washed with PBS Thefixed cells were permeabilized blocked with 10 goatserum and incubated with anti-p53 monoclonal antibod-ies (Santa Cruz Biotechnology) After the washing thecells were incubated with anti-mouse IgG secondary anti-bodies labelled with FITC (Molecular Probes) The pres-ence of the p53 protein was examined under a fluorescentmicroscope

28 TNF- and VEGF Protein Expression

The ELISA immunoassay analysis was performed accord-ing to the manufactured protocol (TNF- and VEGF Qan-tikine kit RampD Systems) The ELISA immunoassay forTNF- and VEGF was performed after 24 and 48 hoursof treatment

3 RESULTS

31 Carbon Nanotube Chemical Characterisation

The Thermo-Gravimetric Analysis (TGA) of pristine andoxidized NTC (SWNTC-COOH) was performed in orderto confirm the purity of the carboxylated carbon nano-tubes (Fig 1(A)) The FTIR (Fourier transform infrared)spectrum shown in Figure 1(B) confirms the succesfuloxidation of the SWNTC By comparing the two spec-tra red one for SWNTC-COOH and black for SWNTCwe observed that the characteristic bands of oxygen con-taining groups at 3420 cmminus1 corresponding to the strech-ing vibration of OndashH and water are visible in the case

J Biomed Nanotechnol 8 567ndash574 2012 569

Delivered by Ingenta toRice University Fondren Library

IP 176142389Wed 01 Aug 2012 061037

RESEARCH

ARTIC

LE

Efficient siRNA Delivery System Using Carboxilated Single-Wall Carbon Nanotubes in Cancer Treatment Neagoe et al

(A) (B)

(C)

(D)

Fig 1 (A) TGA of pristine and oxidized NTC (SWNTC-COOH) (B) FTIR spectrum of pristine and oxidized CNTs (C) UV-vis spectrum andelectron microscopy (D) of SWNTC-COOH and SWNTC-COOH-siRNA

of SWNTC-COOH Moreover in the case of SWNTC-COOH the spectrum bands corresponding to the strechingvibration of carbonyl and carboxyl C O are visible at1580 and 1380 cmminus1 UV-vis measurements clearly con-firmed the functionalization and the attachment process ofsiRNA on the surface of SWNTC The electron micro-scope shows the accumulation of siRNA on the nanotubessurface (Fig 1(D)) The arrow indicates the binding ofsiRNA with SWNTC-COOH

32 siRNA Uptake by HepG Cells

Prior studies have described the penetration of function-alized nanotubes with siRNA into several cell types

Fig 2 Representative fluorescent images (400times) of cellular uptake of Silencerreg FAMtrade-Labeled Negative Control 1 siRNA complexed with siPortNeoFX and SWNTC-COOH at 24 hours after reverse transfection By comparing with control group (free siRNA) we observe a high transfectionefficiency for both transfection systems

however their siRNA internalisation using sWNTC-COOH in HepG2 cell line has not been tested Thustransfection efficiency was assessed by fluorescencemicroscopy using 50 nM FAM-labeled negative controlsiRNA (Figs 2(A and B)) The FAM-labelled negativecontrol siRNA complexes with SWNTC-COOH couldenter the HepG cell easily the siRNA uptake being similarto those by transfection with siPORT NeoFX

33 MTT Cytotoxicity Test

Each target specific gene has characteristics such as theaccessibility of the corresponding target sequences to theRNAi machinery appear to have a significant influence on

570 J Biomed Nanotechnol 8 567ndash574 2012

Delivered by Ingenta toRice University Fondren Library

IP 176142389Wed 01 Aug 2012 061037

RESEARCH

ARTIC

LE

Neagoe et al Efficient siRNA Delivery System Using Carboxilated Single-Wall Carbon Nanotubes in Cancer Treatment

the knockdown observed making certain targets easy ordifficult to knock down using siRNA Thus for the presentstudy we have chosen three target genes that are difficultto use for silencing especially in the case of VEGF andp53 (unpublished data) The present results are based onpreliminary optimization transfection conditions for bothtransfection systems in order to achieve the highest genesilencing with minimal cytotoxicityThe cytotoxicity was evaluated by a MTT-derived

non radioactive viability assay Transfected Hep2G cellsshowed no morphological differences compared tocontrol-untransfected cells All data concerning the eval-uation of the toxic effect of transfection systems (siPortNeoFX versus SWNTC-COOH) as well as the results con-cerning the effect of gene silencing on cell proliferation arepresented below in Figure 3 As the figure shows there ispresented no difference regardless if the cells were treatedwith siPORT NeoFX or SWNTC-COOH by comparingwith control group In conclusion no apparent change incellular viability was observed in the hepatocyte cell lineat a dose of 000125 gml SWNTC-COOH used as adelivery system for different siRNA All in all these datapresent strong evidence that CNTs can enter the cells withminimal side effectsThese results showed that the viability of the transfected

cells was clearly not affected by the transfection agentsThey also confirm a high efficiency of the siRNA trans-fection and good cell viability associated with both thein vitro delivery systems tested The relatively reducedviablility in the case of transfection with siRNA may bedue to the activation of the apoptotic processes asociatedto the gene silencing and not to a cytotoxic effect

34 RT-PCR and Results Analysis

The siRNA-induced gene silencing in mammalian cells isa very promising as a tool used to regulate the expres-sion of specific genes To develop a more efficient method

Fig 3 Cell proliferation as measured by the MTT assay after 24 hoursof incubation for different transfection systems

for delivering siRNA to the cells we have tested a newsystem by using carboxylated functionalyzed SWNTCwith three different siRNA in parallel and a highly effi-cient lipidic system available on the market the siPORTtrade

NeoFXtrade Transfection Agent The siRNA that was deliv-ered into the cell cytoplasm induced a post-transcriptionalgene silencing that can be quantified as a validated assess-ing of mRNA The gene expression was analyzed 24 hourspost transfection for both systemsThe knock-down effect on the gene expression was eval-

uated by RT-PCR and presented as a relatively similar geneexpression for all the experimental variants as we can seein Figure 4 An efficient silencing was obtained with theall three siRNA tests The relative gene expression levelwas determined to be 338ndash567 of the control cellsThe highest level of gene inhibition was observed in p53siRNA gene therapy cases In the case of p53 siRNA trans-fections with siPort NeoFX relative gene expression levelwas 338 meanwhile in the case of SWNTC-COOHdelivery system was 375The gene silencing for VEGFsiRNA transfection was

537 and respectively for TNF-siRNA transfection567 by using siPORT NeoFX as delivery systems Rel-atively similar results for gene expression were observedin the case of SWNTC-COOH delivery system forVEGF siRNA being 477 and for TNF-siRNA 465SWNTC-COOH we have been showed an efficient reduc-tion of the level of gene expression

35 p53 TNF- and VEGF Protein Expression

The quantification of TNF- and VEGF from cell cul-ture medium was done using ELISA assay and p53 pro-tein expression was performed using an imunofluorescencemethod The quantification of p53 TNF- and VEGFprotein expression was performed in order to identify apotential correlation of mRNA levels and posttranslationalprotein expression (Fig 5)The immunoflourescence staining confirmed the

RT-PCR data for p53 The ELISA data concerning thesecretion of TNF- and VEGF in cell culture medium

Fig 4 Relative gene expression level evaluation using RT-PCR after24 hours of incubation for different transfection systems (siPort NeoFXsiRNA versus SWNTC-COOH delivered siRNA)

J Biomed Nanotechnol 8 567ndash574 2012 571

Delivered by Ingenta toRice University Fondren Library

IP 176142389Wed 01 Aug 2012 061037

RESEARCH

ARTIC

LE

Efficient siRNA Delivery System Using Carboxilated Single-Wall Carbon Nanotubes in Cancer Treatment Neagoe et al

(a)

(b) (c)

Fig 5 Protein silencing evaluation using immunofluorescent staining for p53 at 24 hours after the treatment (A) and ELISA technique for TNF-and VEGF after 24 and 48 hours of incubation for different transfection systems (siPort NeoFX siRNA versus SWNTC-COOH delivered siRNA)

were in agreement with those obtained at mRNA levelOverall the lowest mRNA expression was confirmedat protein level especially in the case of p53 siRNAand TNF- siRNA transfection Less efficient reductionprotein expressions were observed in the case of VEGFsiRNA for both transfection systems at 24 h only at 48 hthere was a statistically significant reduction of VEGFprotein expression The highest level of protein expressioninhibition was observed in the case of siRNA transfectionwith SWNTC-COOH Elevated levels of TNF- wereobserved in groups treated with siPORT neoFX and at thetransfection of VEGF with siPORT NeoFX

4 DISCUSSION

The silencing of gene expression by siRNAs is rapidlybecoming a powerful tool in the genetic analysis of mam-malian cells However the rapid degradation of siRNA andthe limited duration of its action call for an efficient deliv-ery technology There are some future directions concern-ing ARNi therapy focused on high transfection efficiencyhigh capacity gene silencing low toxicity of the transfec-tion system and new assays in evaluating the efficiencyof the transfection21 An efficient delivery systems guaran-tees cell penetration prolonged intracellular gene silenc-ing and prevents the siRNA degradation18 In our case

the transfection with SWNTC-COOH fulfils these require-ments Carboxylated nanotubes have some advantages ascompared to other delivery systems One of them is thefact that they are thin and long and cover a large areafor siRNA binding Due to the nano-needle stucture theyare able to facilitate the internalization into the cytoplasmvia an endocytosis-independent pathway13 or through anendocitosis-dependent mechamism2021 The formation ofthe complex of siRNA with SWNTC-COOH is demon-strated by the results obtained at the level of gene expres-sion and protein for each target siRNA In a similar studyit was proved the efficencyof SWNTC-COOH for siRNAdelivery through conjugation of siRNA with positivelycharged SWNTC-COOH14

Restoring the tumour suppressor genes is the mostintuitive application of gene therapy in different cancertypes2223 Several approaches have been used for cancertreatment via the p53 pathway restoring the tumour sup-pression function from inactivation rescuing the mutatedp53 gene from instability or delivering the therapeuticexogenous p53 including p53 siRNA Another importantstudy24 was focused on a mutant adenovirus that doesnot express E1B a protein that binds and inactivates p53Thus this mutant virus could replicate and lyse p53-deficient human tumor cells but not cells with functional

572 J Biomed Nanotechnol 8 567ndash574 2012

Delivered by Ingenta toRice University Fondren Library

IP 176142389Wed 01 Aug 2012 061037

RESEARCH

ARTIC

LE

Neagoe et al Efficient siRNA Delivery System Using Carboxilated Single-Wall Carbon Nanotubes in Cancer Treatment

p53 Furthermore siRNA has been used to suppress theexpression of mutated p53 and restore the function of thewild-type geneTNF- was chosen as a primary target cytokine because

of its central role in mediating the inflammation Althoughthe mechanism of TNF- induced the activation of NF-Band mitogen activated pathways (MAPK) is well under-stood Despite of that the mechanism of TNF-mediatedapoptosis remains unclear TNF- inhibition may providesome new insights on mediated apoptosis by silencing thecandidate mediators of apoptosis or angiogenesis signal-ing The central hypothesis in many diseases includingcancer is that the downregulation of TNF- can resultin lower levels of other pro-inflammatory markers whichcan help to restore the delicate balance between pro- andanti-inflammatory18 The analysis of RT-PCR on showeddecreased levels TNF- in the case of treatment withsiRNA with both transfection systems (siPORT NeoFXrespectively SWNTC-COOH) There was an increasedlevel of TNF- at gene and proteine level in the case ofsiPORT NeoFX transfection agent while in the case ofSWNTC the values were relatively similar with the onesin the control groupThe increase in mRNA transcript and protein in the case

of TNF- in the case of transfection with of p53 siRNAand VEGFsiRNA with siPORTNeoFX can potentially beascribed to an unspecific immune response elicited by thetransfection agent andor inactive siRNA sequence itselfDue to the fact that the siRNA sequence was in an unmod-ified state it could most likely elicit an immune responseTo avoid such an off-target effect the modified and non-immune modulating siRNA should be included in futurestudies18 A decrease in the VEGF mRNA expression wasseen in both transfection systems the increased levelsmay be due to the complex interaction of pro-and anti-inflammatory cytokines causing compensatory reactionstriggered by the siPORT NeoFX transfection reagentThe ELISA results showed a small delay in VEGF pro-

tein silencing as evidenced by the slightly decreased pro-tein expression at 48 hours The delayed response alsoreflects the specificity of siRNA encoding for VEGF asimmune reaction for other markers needs time to occurThe inhibition of angiogenesis involves multiple path-ways other than VEGF transcription2526 At 24 hours afterVEGF siRNA treatment the VEGF expression could pro-tect cells from apoptosis27 but later at 48 hours VEGFprotein levels decreased at 43 in the case of trans-fection with siPORT NeoFX and 338 in the case ofSWNTC-COOH delivery system This phenomenon mightbe caused by the interaction of other growth factorsincluding TNF- which could induce conversion of VEGFcell signaling The coordination of both proapoptotic andprosurvival signals allows a fine modulation of opposingcell functions required for angiogenesis More importantlythe VEGF may convert the antiapoptotic to proapoptotic

activity2628 and as a result this finding could have arelevant pharmacological implication as the MTT datashows The initial lack of balance between the moleculesinvolved in both angiogenesis and tumor survival may acti-vate other alternative mechanisms and restore the tumorangiogenic profile28 This process is modulated by TNFwhose increased level is not only involved in the inflam-matory response but may also be a proangiogenic factorThe SWCNT-COOH has been physically linked to the

siRNA followed by the delivery of the complex into can-cer cells in order to knock down targeted genes Theresults were similar or even more efficient than classi-cally delivery lipidic systems The mRNA and proteinanalysis suggests that only the targeted gene is affectedby the corresponding siRNA Current results indicate thatSWNTC-COOH nanostructures can be used for siRNAsdelivery results confirmed by a priviosly recent study byBartholomeusz et al29

The formation of SWCNT-COOH-siRNA complexesrequires only simple ultrasonic agitation and does notinvolve chemical reactions However before they can beused in biomedical applications the hydrophobic carbonnanotubes must be converted into a stable suspension inan aqueous solution

5 CONCLUSIONS

Gene silencing with SWNTC-COOH offers an alternativestrategy for the lipidic transfection systems-based cancertherapy The data indicate that SWNTC-COOH is a robustnanostructure and exhibits minimal toxicityThis study proves the prospectives of using SWCNT-

COOH solubilized by siRNA as a therapeutic agent incancer treatment but still remains to be validated byin vivo studies In future studies two siRNA targets willbe incorporated to maximize and further improve the effi-ciency of siRNA gene therapy in a dual treatment Studiesshould also focus on developing new biodegradable nano-structures that mimic the nanotube needle structure forsiRNA delivery

References and Notes

1 D Castanotto and J Rossi The promises and pitfalls of RNA-interference-based therapeutics Nature 457 426 (2009)

2 T Niidome and L Huang Gene Therapy Progress and ProspectsNonviral vectors Gene Therapy 9 1647 (2002)

3 I Berindan Neagoe O Balacescu C Burz C Braicu L BalacescuO Tudoran V Cristea and A Irimie p53 gene therapy using RNAinterference Journal of BUON S51 (2009)

4 J Kaminski M Huber J Summers and M Ward Design of anonviral vector for site-selective efficient integration into the humangenome The FASEB Journal 16 1242 (2002)

5 T Chu K Twu A Ellington and M Levy Aptamer mediatedsiRNA delivery Nucleic Acids Res 34 e73 (2006)

6 Z Liu S Tabakman K Welsher and H Dai Carbon nanotubes inBiology and Medicine In vitro and in vivo Detection Imaging andDrug Delivery Nano Res 2 85 (2009)

J Biomed Nanotechnol 8 567ndash574 2012 573

Delivered by Ingenta toRice University Fondren Library

IP 176142389Wed 01 Aug 2012 061037

RESEARCH

ARTIC

LE

Efficient siRNA Delivery System Using Carboxilated Single-Wall Carbon Nanotubes in Cancer Treatment Neagoe et al

surface of nanotubes for higher solubility have beenshown to reduce their toxicity Carbon nanotubes (CNTs)exhibit many unique intrinsic physical and chemical prop-erties and have been intensively explored for biologi-cal and biomedical applications in the past few years6

Depending on the number of graphene layers from whicha single nanotube is composed CNTs are classified assingle-walled carbon nanotubes (SWNTs) doublendashwalledcarbon nanotubes (DWNTs) or multi-walled carbon nano-tubes (MWNTs)6 CNTs have significant biological poten-tial and can effectively shuttle various bio-molecules intocells ndash including drugs peptides proteins plasmid DNAand siRNA In the case of CNTs the internalisation hasinsignificant toxicity as was observed in previous studiesas well as low immunogenicity to the cells7ndash10

To date however the potential of designing creat-ing and applying CNTs for the delivery of nucleic acidsor drugs has only been investigated in a limited num-ber of studies11 Several functionalized CNTs have beendesigned and tested for the purpose of nucleic aciddelivery12ndash14 Phospholipid-coated CNTs functionalizedwith amineterminated polyethylene glycol (PL-PEG2000-NH2) ammonium-functionalized CNTs15 dendron-CNT12

carboxylated-NTC14 were reported to be efficient insiRNA delivery with low cytotoxicity and were shown tobe efficient in siRNA and DNA delivery in human celllines or primary cells This study evaluates the potentialof RNAi using two transfection systems that interfere withthe expression of specific genes that are overexpressed incancer p53 TNF- (tumour necrosis factor alpha) andVEGF (vascular endothelial growth factor) were identifiedas new potential therapeutic target for cancer treatmentAbnormalities of p53 are considered a predisposition fac-tor for carcinogenesis16 The p53 gene therapy in cancerhas been intensively investigated The vascular endothelialgrowth factor (VEGF) plays a critical role in the patho-logic angiogenesis during the development of cancer Theknockdown of VEGF and its receptor using RNAi haspreviously shown the ability to inhibit tumor cell pro-liferation and subsequently result in apoptosis17 Successhas been reported in biological therapies especially inpatients resistant to conventional treatment by a specificlevel reduction of tumor necrosis factor- (TNF-18

The carboxylation of CNT (SWNTC-COOH) wasachieved using the procedure presented by Iancu et al7

with minor changes19 In this study SWNTC-COOH werefunctionalized with three different validated siRNA forp53 VEGF and TNF- The silencing activity and thecellular toxicity of siRNA complexes based on SWNTC-COOH were compared with those on the regularly usedlipid transfection agent siPort NeoFX (Ambion) Further-more it was observed that SWNTC-COOH is a highefficient non-cytotoxic system for siRNA delivery To com-pare the delivery efficiency was used as in vitro modelHep2G cell line For the evaluation of cytotoxicity we

used the MTT test while for the inhibition of gene expres-sion we performed RT-PCT with particular primers andUPL probes specific for each gene The gene expressiondata were validated at protein level

2 MATERIALS AND METHODS

21 Materials

The single-wall carbon nanotubes (gt90 carbon puritysim08 nm diameter) were purchased from Sigma-AldrichChemical Co (St Louis MO USA) and used without fur-ther purification All other chemicals were purchased fromMerck (Darmstadt Germany) We used Silencerreg FAMtrade-Labeled Negative Control 1 siRNA from Ambion to eval-uate the uptake capacity of both transfection systems Thep53 siRNA (Santa Cruz sc-29435) consists of pools ofthree to five target-specific 19-25 nt siRNAs designedto knock down gene expression and the VEGF siRNA(AM16804 ID4638) and TNF- (AM16804 ID4021)contain pre-designed siRNA framgments HPLC purifiedFor the siRNA transfection we used siPORT NeoFXTransfection Agent (Ambion)

22 Carboxylation of SWNTC

The CNT carboxylation was achieved using the procedurepresented by Iancu et al7 with minor changes 80 mg ofCNTrsquos were dispersed in a 80 mL 31 (vv) sulphonitricmixture using a sonic tip for 4times 10 s Afterwards themixture was refluxed for 30 min at 120 C The oxidizedCNTrsquos were washed three times with deionized water andcentrifuged at 5000 RPM for 20 min in order to removeexcess acid in the supernatant Further on the CNTrsquoswere filtered through a 02 m polycarbonate filter (What-man) until the elution reached a neutral pH The concen-tration of the solution obtained was determined using aUV-Vis-NIR spectroscopy (JASCO V530 Gross-UmstadtGermany)719

23 Cell Culture

HepG2 are adherent epithelial-like cells growed as mono-layers and in small aggregates HepG2 cells were cul-tivated in the recommended RPMI1640 10 fetal calfserum 2 mM glutamine 100 Uml penicillin 01 mgmlstreptomycin solution (all from Sigma Germany) andwere maintained in 5 CO2-humified air at 37 C

24 Cell Viability

The cell viability was evaluated by MTT viability assayin a 96-well plate Cell survival was determined for trans-fected cells and transfection systems too After discharg-ing the culture medium the cells were incubated (5 CO237 C) for 1 h with 100 lwell MTT and then washed

568 J Biomed Nanotechnol 8 567ndash574 2012

Delivered by Ingenta toRice University Fondren Library

IP 176142389Wed 01 Aug 2012 061037

RESEARCH

ARTIC

LE

Neagoe et al Efficient siRNA Delivery System Using Carboxilated Single-Wall Carbon Nanotubes in Cancer Treatment

with phosphate buffered saline (Sigma Germany) The for-mazan salt produced by the mitochondria of the living cellswas dissolved in 150 igravelwell dimethyl sulfoxide (DMSO)and the absorption was measured at 492 nm with TecanSunrisetrade Absorbance Reader The mean optical density of3 wells was taken in consideration for each control andtreated sample

25 HepG2 Cell Transfection

The transfections were performed using the Silencerreg

siRNA Transfection II Kit (Ambion USA) containingsiPORT Amine tranfection agent Reverse transfection(or neofection) was applied for siPORT NeoFX throughwhich the cells were transfected as they were adhering to aplate after trypsinization 5 l siPORT NeoFX transfectionagent were mixed in Opti-MEM (Gibco-Invitrogen UK)to a total volume of 100 ml then incubated for 10 min-utes at room temperature The siRNA was then diluted ina 100 ml OPTI-MEM medium to achieve a final concen-tration in cell culture medium of 50 nM Then we mixedthe diluted siRNA and the diluted siPORT NeoFX Trans-fection Agent the mixture was incubated for 10 min atroom temperature and dispensed into a culture plate thecells were incubated until further assays A stable aqueoussolution of SWNTC (aprox length 200 nm) was preparedwith highly pure SWNTC-COOH disolved in RN-ase DN-ase free water The solution was sonicated for 3 h thencentrifuged 10 L of 5 10 mM siRNA per target genewere added in 50 l of SWNTC-COOH aqueous solutionsonicated for 30 min then added to cell medium The levelof SWNTC-COOH in the cell medium was 0025 mgmland the final concentration for siRNA was 50 nM

26 Determination of Gene Expression

261 Total RNA Isolation

Total RNA was isolated with TriReagent (Sigma-Aldrich)and analyzed for quantity and quality with ND-1000 andAgilent Lab-on-a-chip Bioanalyzer 2100 (Agilent Technol-ogy) All the RNAs presented a RIN between 75 and 10

262 cDNA Synthesis

cDNA Synthesis Kit (Roche Diagnosis Germany) wasused for cDNA synthesis in this study Dilutions were donefor each sample so as to obtain a final concentration of1000 ng11 ul in each tube (the initial concentration forcDNA synthesis was the same in each tube)

263 qRT-PCR

The LightCycler TaqMan Master kit was used for RT-PCR analyses according to the protocol provided by

the manufacturer using LightCycler 480 Detector Sys-tem (Roche) A template cDNA (110 diluted) wasadded to the TaqMan Universal Master Mix with specificprimers and probe for each gene -actin CCAACCGCGAAGATGACCAGAGGCGTACAGGGATAG VEGF(vascular endothelial growth factor) CCACTTCgTgAT-gATTCgCmTACCTCCACCATgCCAAgT TNF- (tumornecrosis factor-alpha) CagCCTCTTCTCCTTCCTgAT-GCCAGAgggCTGATTAAgAgAThe primers and UPL probes (Roche) used in the qRTndash

PCR evaluation were specific to every gene For all thegenes we used 1 M of both primers and 02 M fromUPL (Universal Probe Library) Changes in the expres-sion of target genes were measured as relative to the meancritical threshold (Ct) values of 18S housekeeping geneThe mRNA levels were analyzed using the Ct methodbased on fold-change calculations with normalization forall of the genes

27 p53 Immunofluorescence Staining

For siRNA treatments subconfluent proliferating cellswere transfected with 50 nM of siRNA using the siPORTNeoFX Transfection Agent and SWNTC-COOH At 24 hafter the transfection the cells were fixed with 4 PFA(paraformaldehyde) for 8 min and washed with PBS Thefixed cells were permeabilized blocked with 10 goatserum and incubated with anti-p53 monoclonal antibod-ies (Santa Cruz Biotechnology) After the washing thecells were incubated with anti-mouse IgG secondary anti-bodies labelled with FITC (Molecular Probes) The pres-ence of the p53 protein was examined under a fluorescentmicroscope

28 TNF- and VEGF Protein Expression

The ELISA immunoassay analysis was performed accord-ing to the manufactured protocol (TNF- and VEGF Qan-tikine kit RampD Systems) The ELISA immunoassay forTNF- and VEGF was performed after 24 and 48 hoursof treatment

3 RESULTS

31 Carbon Nanotube Chemical Characterisation

The Thermo-Gravimetric Analysis (TGA) of pristine andoxidized NTC (SWNTC-COOH) was performed in orderto confirm the purity of the carboxylated carbon nano-tubes (Fig 1(A)) The FTIR (Fourier transform infrared)spectrum shown in Figure 1(B) confirms the succesfuloxidation of the SWNTC By comparing the two spec-tra red one for SWNTC-COOH and black for SWNTCwe observed that the characteristic bands of oxygen con-taining groups at 3420 cmminus1 corresponding to the strech-ing vibration of OndashH and water are visible in the case

J Biomed Nanotechnol 8 567ndash574 2012 569

Delivered by Ingenta toRice University Fondren Library

IP 176142389Wed 01 Aug 2012 061037

RESEARCH

ARTIC

LE

Efficient siRNA Delivery System Using Carboxilated Single-Wall Carbon Nanotubes in Cancer Treatment Neagoe et al

(A) (B)

(C)

(D)

Fig 1 (A) TGA of pristine and oxidized NTC (SWNTC-COOH) (B) FTIR spectrum of pristine and oxidized CNTs (C) UV-vis spectrum andelectron microscopy (D) of SWNTC-COOH and SWNTC-COOH-siRNA

of SWNTC-COOH Moreover in the case of SWNTC-COOH the spectrum bands corresponding to the strechingvibration of carbonyl and carboxyl C O are visible at1580 and 1380 cmminus1 UV-vis measurements clearly con-firmed the functionalization and the attachment process ofsiRNA on the surface of SWNTC The electron micro-scope shows the accumulation of siRNA on the nanotubessurface (Fig 1(D)) The arrow indicates the binding ofsiRNA with SWNTC-COOH

32 siRNA Uptake by HepG Cells

Prior studies have described the penetration of function-alized nanotubes with siRNA into several cell types

Fig 2 Representative fluorescent images (400times) of cellular uptake of Silencerreg FAMtrade-Labeled Negative Control 1 siRNA complexed with siPortNeoFX and SWNTC-COOH at 24 hours after reverse transfection By comparing with control group (free siRNA) we observe a high transfectionefficiency for both transfection systems

however their siRNA internalisation using sWNTC-COOH in HepG2 cell line has not been tested Thustransfection efficiency was assessed by fluorescencemicroscopy using 50 nM FAM-labeled negative controlsiRNA (Figs 2(A and B)) The FAM-labelled negativecontrol siRNA complexes with SWNTC-COOH couldenter the HepG cell easily the siRNA uptake being similarto those by transfection with siPORT NeoFX

33 MTT Cytotoxicity Test

Each target specific gene has characteristics such as theaccessibility of the corresponding target sequences to theRNAi machinery appear to have a significant influence on

570 J Biomed Nanotechnol 8 567ndash574 2012

Delivered by Ingenta toRice University Fondren Library

IP 176142389Wed 01 Aug 2012 061037

RESEARCH

ARTIC

LE

Neagoe et al Efficient siRNA Delivery System Using Carboxilated Single-Wall Carbon Nanotubes in Cancer Treatment

the knockdown observed making certain targets easy ordifficult to knock down using siRNA Thus for the presentstudy we have chosen three target genes that are difficultto use for silencing especially in the case of VEGF andp53 (unpublished data) The present results are based onpreliminary optimization transfection conditions for bothtransfection systems in order to achieve the highest genesilencing with minimal cytotoxicityThe cytotoxicity was evaluated by a MTT-derived

non radioactive viability assay Transfected Hep2G cellsshowed no morphological differences compared tocontrol-untransfected cells All data concerning the eval-uation of the toxic effect of transfection systems (siPortNeoFX versus SWNTC-COOH) as well as the results con-cerning the effect of gene silencing on cell proliferation arepresented below in Figure 3 As the figure shows there ispresented no difference regardless if the cells were treatedwith siPORT NeoFX or SWNTC-COOH by comparingwith control group In conclusion no apparent change incellular viability was observed in the hepatocyte cell lineat a dose of 000125 gml SWNTC-COOH used as adelivery system for different siRNA All in all these datapresent strong evidence that CNTs can enter the cells withminimal side effectsThese results showed that the viability of the transfected

cells was clearly not affected by the transfection agentsThey also confirm a high efficiency of the siRNA trans-fection and good cell viability associated with both thein vitro delivery systems tested The relatively reducedviablility in the case of transfection with siRNA may bedue to the activation of the apoptotic processes asociatedto the gene silencing and not to a cytotoxic effect

34 RT-PCR and Results Analysis

The siRNA-induced gene silencing in mammalian cells isa very promising as a tool used to regulate the expres-sion of specific genes To develop a more efficient method

Fig 3 Cell proliferation as measured by the MTT assay after 24 hoursof incubation for different transfection systems

for delivering siRNA to the cells we have tested a newsystem by using carboxylated functionalyzed SWNTCwith three different siRNA in parallel and a highly effi-cient lipidic system available on the market the siPORTtrade

NeoFXtrade Transfection Agent The siRNA that was deliv-ered into the cell cytoplasm induced a post-transcriptionalgene silencing that can be quantified as a validated assess-ing of mRNA The gene expression was analyzed 24 hourspost transfection for both systemsThe knock-down effect on the gene expression was eval-

uated by RT-PCR and presented as a relatively similar geneexpression for all the experimental variants as we can seein Figure 4 An efficient silencing was obtained with theall three siRNA tests The relative gene expression levelwas determined to be 338ndash567 of the control cellsThe highest level of gene inhibition was observed in p53siRNA gene therapy cases In the case of p53 siRNA trans-fections with siPort NeoFX relative gene expression levelwas 338 meanwhile in the case of SWNTC-COOHdelivery system was 375The gene silencing for VEGFsiRNA transfection was

537 and respectively for TNF-siRNA transfection567 by using siPORT NeoFX as delivery systems Rel-atively similar results for gene expression were observedin the case of SWNTC-COOH delivery system forVEGF siRNA being 477 and for TNF-siRNA 465SWNTC-COOH we have been showed an efficient reduc-tion of the level of gene expression

35 p53 TNF- and VEGF Protein Expression

The quantification of TNF- and VEGF from cell cul-ture medium was done using ELISA assay and p53 pro-tein expression was performed using an imunofluorescencemethod The quantification of p53 TNF- and VEGFprotein expression was performed in order to identify apotential correlation of mRNA levels and posttranslationalprotein expression (Fig 5)The immunoflourescence staining confirmed the

RT-PCR data for p53 The ELISA data concerning thesecretion of TNF- and VEGF in cell culture medium

Fig 4 Relative gene expression level evaluation using RT-PCR after24 hours of incubation for different transfection systems (siPort NeoFXsiRNA versus SWNTC-COOH delivered siRNA)

J Biomed Nanotechnol 8 567ndash574 2012 571

Delivered by Ingenta toRice University Fondren Library

IP 176142389Wed 01 Aug 2012 061037

RESEARCH

ARTIC

LE

Efficient siRNA Delivery System Using Carboxilated Single-Wall Carbon Nanotubes in Cancer Treatment Neagoe et al

(a)

(b) (c)

Fig 5 Protein silencing evaluation using immunofluorescent staining for p53 at 24 hours after the treatment (A) and ELISA technique for TNF-and VEGF after 24 and 48 hours of incubation for different transfection systems (siPort NeoFX siRNA versus SWNTC-COOH delivered siRNA)

were in agreement with those obtained at mRNA levelOverall the lowest mRNA expression was confirmedat protein level especially in the case of p53 siRNAand TNF- siRNA transfection Less efficient reductionprotein expressions were observed in the case of VEGFsiRNA for both transfection systems at 24 h only at 48 hthere was a statistically significant reduction of VEGFprotein expression The highest level of protein expressioninhibition was observed in the case of siRNA transfectionwith SWNTC-COOH Elevated levels of TNF- wereobserved in groups treated with siPORT neoFX and at thetransfection of VEGF with siPORT NeoFX

4 DISCUSSION

The silencing of gene expression by siRNAs is rapidlybecoming a powerful tool in the genetic analysis of mam-malian cells However the rapid degradation of siRNA andthe limited duration of its action call for an efficient deliv-ery technology There are some future directions concern-ing ARNi therapy focused on high transfection efficiencyhigh capacity gene silencing low toxicity of the transfec-tion system and new assays in evaluating the efficiencyof the transfection21 An efficient delivery systems guaran-tees cell penetration prolonged intracellular gene silenc-ing and prevents the siRNA degradation18 In our case

the transfection with SWNTC-COOH fulfils these require-ments Carboxylated nanotubes have some advantages ascompared to other delivery systems One of them is thefact that they are thin and long and cover a large areafor siRNA binding Due to the nano-needle stucture theyare able to facilitate the internalization into the cytoplasmvia an endocytosis-independent pathway13 or through anendocitosis-dependent mechamism2021 The formation ofthe complex of siRNA with SWNTC-COOH is demon-strated by the results obtained at the level of gene expres-sion and protein for each target siRNA In a similar studyit was proved the efficencyof SWNTC-COOH for siRNAdelivery through conjugation of siRNA with positivelycharged SWNTC-COOH14

Restoring the tumour suppressor genes is the mostintuitive application of gene therapy in different cancertypes2223 Several approaches have been used for cancertreatment via the p53 pathway restoring the tumour sup-pression function from inactivation rescuing the mutatedp53 gene from instability or delivering the therapeuticexogenous p53 including p53 siRNA Another importantstudy24 was focused on a mutant adenovirus that doesnot express E1B a protein that binds and inactivates p53Thus this mutant virus could replicate and lyse p53-deficient human tumor cells but not cells with functional

572 J Biomed Nanotechnol 8 567ndash574 2012

Delivered by Ingenta toRice University Fondren Library

IP 176142389Wed 01 Aug 2012 061037

RESEARCH

ARTIC

LE

Neagoe et al Efficient siRNA Delivery System Using Carboxilated Single-Wall Carbon Nanotubes in Cancer Treatment

p53 Furthermore siRNA has been used to suppress theexpression of mutated p53 and restore the function of thewild-type geneTNF- was chosen as a primary target cytokine because

of its central role in mediating the inflammation Althoughthe mechanism of TNF- induced the activation of NF-Band mitogen activated pathways (MAPK) is well under-stood Despite of that the mechanism of TNF-mediatedapoptosis remains unclear TNF- inhibition may providesome new insights on mediated apoptosis by silencing thecandidate mediators of apoptosis or angiogenesis signal-ing The central hypothesis in many diseases includingcancer is that the downregulation of TNF- can resultin lower levels of other pro-inflammatory markers whichcan help to restore the delicate balance between pro- andanti-inflammatory18 The analysis of RT-PCR on showeddecreased levels TNF- in the case of treatment withsiRNA with both transfection systems (siPORT NeoFXrespectively SWNTC-COOH) There was an increasedlevel of TNF- at gene and proteine level in the case ofsiPORT NeoFX transfection agent while in the case ofSWNTC the values were relatively similar with the onesin the control groupThe increase in mRNA transcript and protein in the case

of TNF- in the case of transfection with of p53 siRNAand VEGFsiRNA with siPORTNeoFX can potentially beascribed to an unspecific immune response elicited by thetransfection agent andor inactive siRNA sequence itselfDue to the fact that the siRNA sequence was in an unmod-ified state it could most likely elicit an immune responseTo avoid such an off-target effect the modified and non-immune modulating siRNA should be included in futurestudies18 A decrease in the VEGF mRNA expression wasseen in both transfection systems the increased levelsmay be due to the complex interaction of pro-and anti-inflammatory cytokines causing compensatory reactionstriggered by the siPORT NeoFX transfection reagentThe ELISA results showed a small delay in VEGF pro-

tein silencing as evidenced by the slightly decreased pro-tein expression at 48 hours The delayed response alsoreflects the specificity of siRNA encoding for VEGF asimmune reaction for other markers needs time to occurThe inhibition of angiogenesis involves multiple path-ways other than VEGF transcription2526 At 24 hours afterVEGF siRNA treatment the VEGF expression could pro-tect cells from apoptosis27 but later at 48 hours VEGFprotein levels decreased at 43 in the case of trans-fection with siPORT NeoFX and 338 in the case ofSWNTC-COOH delivery system This phenomenon mightbe caused by the interaction of other growth factorsincluding TNF- which could induce conversion of VEGFcell signaling The coordination of both proapoptotic andprosurvival signals allows a fine modulation of opposingcell functions required for angiogenesis More importantlythe VEGF may convert the antiapoptotic to proapoptotic

activity2628 and as a result this finding could have arelevant pharmacological implication as the MTT datashows The initial lack of balance between the moleculesinvolved in both angiogenesis and tumor survival may acti-vate other alternative mechanisms and restore the tumorangiogenic profile28 This process is modulated by TNFwhose increased level is not only involved in the inflam-matory response but may also be a proangiogenic factorThe SWCNT-COOH has been physically linked to the

siRNA followed by the delivery of the complex into can-cer cells in order to knock down targeted genes Theresults were similar or even more efficient than classi-cally delivery lipidic systems The mRNA and proteinanalysis suggests that only the targeted gene is affectedby the corresponding siRNA Current results indicate thatSWNTC-COOH nanostructures can be used for siRNAsdelivery results confirmed by a priviosly recent study byBartholomeusz et al29

The formation of SWCNT-COOH-siRNA complexesrequires only simple ultrasonic agitation and does notinvolve chemical reactions However before they can beused in biomedical applications the hydrophobic carbonnanotubes must be converted into a stable suspension inan aqueous solution

5 CONCLUSIONS

Gene silencing with SWNTC-COOH offers an alternativestrategy for the lipidic transfection systems-based cancertherapy The data indicate that SWNTC-COOH is a robustnanostructure and exhibits minimal toxicityThis study proves the prospectives of using SWCNT-

COOH solubilized by siRNA as a therapeutic agent incancer treatment but still remains to be validated byin vivo studies In future studies two siRNA targets willbe incorporated to maximize and further improve the effi-ciency of siRNA gene therapy in a dual treatment Studiesshould also focus on developing new biodegradable nano-structures that mimic the nanotube needle structure forsiRNA delivery

References and Notes

1 D Castanotto and J Rossi The promises and pitfalls of RNA-interference-based therapeutics Nature 457 426 (2009)

2 T Niidome and L Huang Gene Therapy Progress and ProspectsNonviral vectors Gene Therapy 9 1647 (2002)

3 I Berindan Neagoe O Balacescu C Burz C Braicu L BalacescuO Tudoran V Cristea and A Irimie p53 gene therapy using RNAinterference Journal of BUON S51 (2009)

4 J Kaminski M Huber J Summers and M Ward Design of anonviral vector for site-selective efficient integration into the humangenome The FASEB Journal 16 1242 (2002)

5 T Chu K Twu A Ellington and M Levy Aptamer mediatedsiRNA delivery Nucleic Acids Res 34 e73 (2006)

6 Z Liu S Tabakman K Welsher and H Dai Carbon nanotubes inBiology and Medicine In vitro and in vivo Detection Imaging andDrug Delivery Nano Res 2 85 (2009)

J Biomed Nanotechnol 8 567ndash574 2012 573

Delivered by Ingenta toRice University Fondren Library

IP 176142389Wed 01 Aug 2012 061037

RESEARCH

ARTIC

LE

Neagoe et al Efficient siRNA Delivery System Using Carboxilated Single-Wall Carbon Nanotubes in Cancer Treatment

with phosphate buffered saline (Sigma Germany) The for-mazan salt produced by the mitochondria of the living cellswas dissolved in 150 igravelwell dimethyl sulfoxide (DMSO)and the absorption was measured at 492 nm with TecanSunrisetrade Absorbance Reader The mean optical density of3 wells was taken in consideration for each control andtreated sample

25 HepG2 Cell Transfection

The transfections were performed using the Silencerreg

siRNA Transfection II Kit (Ambion USA) containingsiPORT Amine tranfection agent Reverse transfection(or neofection) was applied for siPORT NeoFX throughwhich the cells were transfected as they were adhering to aplate after trypsinization 5 l siPORT NeoFX transfectionagent were mixed in Opti-MEM (Gibco-Invitrogen UK)to a total volume of 100 ml then incubated for 10 min-utes at room temperature The siRNA was then diluted ina 100 ml OPTI-MEM medium to achieve a final concen-tration in cell culture medium of 50 nM Then we mixedthe diluted siRNA and the diluted siPORT NeoFX Trans-fection Agent the mixture was incubated for 10 min atroom temperature and dispensed into a culture plate thecells were incubated until further assays A stable aqueoussolution of SWNTC (aprox length 200 nm) was preparedwith highly pure SWNTC-COOH disolved in RN-ase DN-ase free water The solution was sonicated for 3 h thencentrifuged 10 L of 5 10 mM siRNA per target genewere added in 50 l of SWNTC-COOH aqueous solutionsonicated for 30 min then added to cell medium The levelof SWNTC-COOH in the cell medium was 0025 mgmland the final concentration for siRNA was 50 nM

26 Determination of Gene Expression

261 Total RNA Isolation

Total RNA was isolated with TriReagent (Sigma-Aldrich)and analyzed for quantity and quality with ND-1000 andAgilent Lab-on-a-chip Bioanalyzer 2100 (Agilent Technol-ogy) All the RNAs presented a RIN between 75 and 10

262 cDNA Synthesis

cDNA Synthesis Kit (Roche Diagnosis Germany) wasused for cDNA synthesis in this study Dilutions were donefor each sample so as to obtain a final concentration of1000 ng11 ul in each tube (the initial concentration forcDNA synthesis was the same in each tube)

263 qRT-PCR

The LightCycler TaqMan Master kit was used for RT-PCR analyses according to the protocol provided by

the manufacturer using LightCycler 480 Detector Sys-tem (Roche) A template cDNA (110 diluted) wasadded to the TaqMan Universal Master Mix with specificprimers and probe for each gene -actin CCAACCGCGAAGATGACCAGAGGCGTACAGGGATAG VEGF(vascular endothelial growth factor) CCACTTCgTgAT-gATTCgCmTACCTCCACCATgCCAAgT TNF- (tumornecrosis factor-alpha) CagCCTCTTCTCCTTCCTgAT-GCCAGAgggCTGATTAAgAgAThe primers and UPL probes (Roche) used in the qRTndash

PCR evaluation were specific to every gene For all thegenes we used 1 M of both primers and 02 M fromUPL (Universal Probe Library) Changes in the expres-sion of target genes were measured as relative to the meancritical threshold (Ct) values of 18S housekeeping geneThe mRNA levels were analyzed using the Ct methodbased on fold-change calculations with normalization forall of the genes

27 p53 Immunofluorescence Staining

For siRNA treatments subconfluent proliferating cellswere transfected with 50 nM of siRNA using the siPORTNeoFX Transfection Agent and SWNTC-COOH At 24 hafter the transfection the cells were fixed with 4 PFA(paraformaldehyde) for 8 min and washed with PBS Thefixed cells were permeabilized blocked with 10 goatserum and incubated with anti-p53 monoclonal antibod-ies (Santa Cruz Biotechnology) After the washing thecells were incubated with anti-mouse IgG secondary anti-bodies labelled with FITC (Molecular Probes) The pres-ence of the p53 protein was examined under a fluorescentmicroscope

28 TNF- and VEGF Protein Expression

The ELISA immunoassay analysis was performed accord-ing to the manufactured protocol (TNF- and VEGF Qan-tikine kit RampD Systems) The ELISA immunoassay forTNF- and VEGF was performed after 24 and 48 hoursof treatment

3 RESULTS

31 Carbon Nanotube Chemical Characterisation

The Thermo-Gravimetric Analysis (TGA) of pristine andoxidized NTC (SWNTC-COOH) was performed in orderto confirm the purity of the carboxylated carbon nano-tubes (Fig 1(A)) The FTIR (Fourier transform infrared)spectrum shown in Figure 1(B) confirms the succesfuloxidation of the SWNTC By comparing the two spec-tra red one for SWNTC-COOH and black for SWNTCwe observed that the characteristic bands of oxygen con-taining groups at 3420 cmminus1 corresponding to the strech-ing vibration of OndashH and water are visible in the case

J Biomed Nanotechnol 8 567ndash574 2012 569

Delivered by Ingenta toRice University Fondren Library

IP 176142389Wed 01 Aug 2012 061037

RESEARCH

ARTIC

LE

Efficient siRNA Delivery System Using Carboxilated Single-Wall Carbon Nanotubes in Cancer Treatment Neagoe et al

(A) (B)

(C)

(D)

Fig 1 (A) TGA of pristine and oxidized NTC (SWNTC-COOH) (B) FTIR spectrum of pristine and oxidized CNTs (C) UV-vis spectrum andelectron microscopy (D) of SWNTC-COOH and SWNTC-COOH-siRNA

of SWNTC-COOH Moreover in the case of SWNTC-COOH the spectrum bands corresponding to the strechingvibration of carbonyl and carboxyl C O are visible at1580 and 1380 cmminus1 UV-vis measurements clearly con-firmed the functionalization and the attachment process ofsiRNA on the surface of SWNTC The electron micro-scope shows the accumulation of siRNA on the nanotubessurface (Fig 1(D)) The arrow indicates the binding ofsiRNA with SWNTC-COOH

32 siRNA Uptake by HepG Cells

Prior studies have described the penetration of function-alized nanotubes with siRNA into several cell types

Fig 2 Representative fluorescent images (400times) of cellular uptake of Silencerreg FAMtrade-Labeled Negative Control 1 siRNA complexed with siPortNeoFX and SWNTC-COOH at 24 hours after reverse transfection By comparing with control group (free siRNA) we observe a high transfectionefficiency for both transfection systems

however their siRNA internalisation using sWNTC-COOH in HepG2 cell line has not been tested Thustransfection efficiency was assessed by fluorescencemicroscopy using 50 nM FAM-labeled negative controlsiRNA (Figs 2(A and B)) The FAM-labelled negativecontrol siRNA complexes with SWNTC-COOH couldenter the HepG cell easily the siRNA uptake being similarto those by transfection with siPORT NeoFX

33 MTT Cytotoxicity Test

Each target specific gene has characteristics such as theaccessibility of the corresponding target sequences to theRNAi machinery appear to have a significant influence on

570 J Biomed Nanotechnol 8 567ndash574 2012

Delivered by Ingenta toRice University Fondren Library

IP 176142389Wed 01 Aug 2012 061037

RESEARCH

ARTIC

LE

Neagoe et al Efficient siRNA Delivery System Using Carboxilated Single-Wall Carbon Nanotubes in Cancer Treatment

the knockdown observed making certain targets easy ordifficult to knock down using siRNA Thus for the presentstudy we have chosen three target genes that are difficultto use for silencing especially in the case of VEGF andp53 (unpublished data) The present results are based onpreliminary optimization transfection conditions for bothtransfection systems in order to achieve the highest genesilencing with minimal cytotoxicityThe cytotoxicity was evaluated by a MTT-derived

non radioactive viability assay Transfected Hep2G cellsshowed no morphological differences compared tocontrol-untransfected cells All data concerning the eval-uation of the toxic effect of transfection systems (siPortNeoFX versus SWNTC-COOH) as well as the results con-cerning the effect of gene silencing on cell proliferation arepresented below in Figure 3 As the figure shows there ispresented no difference regardless if the cells were treatedwith siPORT NeoFX or SWNTC-COOH by comparingwith control group In conclusion no apparent change incellular viability was observed in the hepatocyte cell lineat a dose of 000125 gml SWNTC-COOH used as adelivery system for different siRNA All in all these datapresent strong evidence that CNTs can enter the cells withminimal side effectsThese results showed that the viability of the transfected

cells was clearly not affected by the transfection agentsThey also confirm a high efficiency of the siRNA trans-fection and good cell viability associated with both thein vitro delivery systems tested The relatively reducedviablility in the case of transfection with siRNA may bedue to the activation of the apoptotic processes asociatedto the gene silencing and not to a cytotoxic effect

34 RT-PCR and Results Analysis

The siRNA-induced gene silencing in mammalian cells isa very promising as a tool used to regulate the expres-sion of specific genes To develop a more efficient method

Fig 3 Cell proliferation as measured by the MTT assay after 24 hoursof incubation for different transfection systems

for delivering siRNA to the cells we have tested a newsystem by using carboxylated functionalyzed SWNTCwith three different siRNA in parallel and a highly effi-cient lipidic system available on the market the siPORTtrade

NeoFXtrade Transfection Agent The siRNA that was deliv-ered into the cell cytoplasm induced a post-transcriptionalgene silencing that can be quantified as a validated assess-ing of mRNA The gene expression was analyzed 24 hourspost transfection for both systemsThe knock-down effect on the gene expression was eval-

uated by RT-PCR and presented as a relatively similar geneexpression for all the experimental variants as we can seein Figure 4 An efficient silencing was obtained with theall three siRNA tests The relative gene expression levelwas determined to be 338ndash567 of the control cellsThe highest level of gene inhibition was observed in p53siRNA gene therapy cases In the case of p53 siRNA trans-fections with siPort NeoFX relative gene expression levelwas 338 meanwhile in the case of SWNTC-COOHdelivery system was 375The gene silencing for VEGFsiRNA transfection was

537 and respectively for TNF-siRNA transfection567 by using siPORT NeoFX as delivery systems Rel-atively similar results for gene expression were observedin the case of SWNTC-COOH delivery system forVEGF siRNA being 477 and for TNF-siRNA 465SWNTC-COOH we have been showed an efficient reduc-tion of the level of gene expression

35 p53 TNF- and VEGF Protein Expression

The quantification of TNF- and VEGF from cell cul-ture medium was done using ELISA assay and p53 pro-tein expression was performed using an imunofluorescencemethod The quantification of p53 TNF- and VEGFprotein expression was performed in order to identify apotential correlation of mRNA levels and posttranslationalprotein expression (Fig 5)The immunoflourescence staining confirmed the

RT-PCR data for p53 The ELISA data concerning thesecretion of TNF- and VEGF in cell culture medium

Fig 4 Relative gene expression level evaluation using RT-PCR after24 hours of incubation for different transfection systems (siPort NeoFXsiRNA versus SWNTC-COOH delivered siRNA)

J Biomed Nanotechnol 8 567ndash574 2012 571

Delivered by Ingenta toRice University Fondren Library

IP 176142389Wed 01 Aug 2012 061037

RESEARCH

ARTIC

LE

Efficient siRNA Delivery System Using Carboxilated Single-Wall Carbon Nanotubes in Cancer Treatment Neagoe et al

(a)

(b) (c)

Fig 5 Protein silencing evaluation using immunofluorescent staining for p53 at 24 hours after the treatment (A) and ELISA technique for TNF-and VEGF after 24 and 48 hours of incubation for different transfection systems (siPort NeoFX siRNA versus SWNTC-COOH delivered siRNA)

were in agreement with those obtained at mRNA levelOverall the lowest mRNA expression was confirmedat protein level especially in the case of p53 siRNAand TNF- siRNA transfection Less efficient reductionprotein expressions were observed in the case of VEGFsiRNA for both transfection systems at 24 h only at 48 hthere was a statistically significant reduction of VEGFprotein expression The highest level of protein expressioninhibition was observed in the case of siRNA transfectionwith SWNTC-COOH Elevated levels of TNF- wereobserved in groups treated with siPORT neoFX and at thetransfection of VEGF with siPORT NeoFX

4 DISCUSSION

The silencing of gene expression by siRNAs is rapidlybecoming a powerful tool in the genetic analysis of mam-malian cells However the rapid degradation of siRNA andthe limited duration of its action call for an efficient deliv-ery technology There are some future directions concern-ing ARNi therapy focused on high transfection efficiencyhigh capacity gene silencing low toxicity of the transfec-tion system and new assays in evaluating the efficiencyof the transfection21 An efficient delivery systems guaran-tees cell penetration prolonged intracellular gene silenc-ing and prevents the siRNA degradation18 In our case

the transfection with SWNTC-COOH fulfils these require-ments Carboxylated nanotubes have some advantages ascompared to other delivery systems One of them is thefact that they are thin and long and cover a large areafor siRNA binding Due to the nano-needle stucture theyare able to facilitate the internalization into the cytoplasmvia an endocytosis-independent pathway13 or through anendocitosis-dependent mechamism2021 The formation ofthe complex of siRNA with SWNTC-COOH is demon-strated by the results obtained at the level of gene expres-sion and protein for each target siRNA In a similar studyit was proved the efficencyof SWNTC-COOH for siRNAdelivery through conjugation of siRNA with positivelycharged SWNTC-COOH14

Restoring the tumour suppressor genes is the mostintuitive application of gene therapy in different cancertypes2223 Several approaches have been used for cancertreatment via the p53 pathway restoring the tumour sup-pression function from inactivation rescuing the mutatedp53 gene from instability or delivering the therapeuticexogenous p53 including p53 siRNA Another importantstudy24 was focused on a mutant adenovirus that doesnot express E1B a protein that binds and inactivates p53Thus this mutant virus could replicate and lyse p53-deficient human tumor cells but not cells with functional

572 J Biomed Nanotechnol 8 567ndash574 2012

Delivered by Ingenta toRice University Fondren Library

IP 176142389Wed 01 Aug 2012 061037

RESEARCH

ARTIC

LE

Neagoe et al Efficient siRNA Delivery System Using Carboxilated Single-Wall Carbon Nanotubes in Cancer Treatment

p53 Furthermore siRNA has been used to suppress theexpression of mutated p53 and restore the function of thewild-type geneTNF- was chosen as a primary target cytokine because

of its central role in mediating the inflammation Althoughthe mechanism of TNF- induced the activation of NF-Band mitogen activated pathways (MAPK) is well under-stood Despite of that the mechanism of TNF-mediatedapoptosis remains unclear TNF- inhibition may providesome new insights on mediated apoptosis by silencing thecandidate mediators of apoptosis or angiogenesis signal-ing The central hypothesis in many diseases includingcancer is that the downregulation of TNF- can resultin lower levels of other pro-inflammatory markers whichcan help to restore the delicate balance between pro- andanti-inflammatory18 The analysis of RT-PCR on showeddecreased levels TNF- in the case of treatment withsiRNA with both transfection systems (siPORT NeoFXrespectively SWNTC-COOH) There was an increasedlevel of TNF- at gene and proteine level in the case ofsiPORT NeoFX transfection agent while in the case ofSWNTC the values were relatively similar with the onesin the control groupThe increase in mRNA transcript and protein in the case

of TNF- in the case of transfection with of p53 siRNAand VEGFsiRNA with siPORTNeoFX can potentially beascribed to an unspecific immune response elicited by thetransfection agent andor inactive siRNA sequence itselfDue to the fact that the siRNA sequence was in an unmod-ified state it could most likely elicit an immune responseTo avoid such an off-target effect the modified and non-immune modulating siRNA should be included in futurestudies18 A decrease in the VEGF mRNA expression wasseen in both transfection systems the increased levelsmay be due to the complex interaction of pro-and anti-inflammatory cytokines causing compensatory reactionstriggered by the siPORT NeoFX transfection reagentThe ELISA results showed a small delay in VEGF pro-

tein silencing as evidenced by the slightly decreased pro-tein expression at 48 hours The delayed response alsoreflects the specificity of siRNA encoding for VEGF asimmune reaction for other markers needs time to occurThe inhibition of angiogenesis involves multiple path-ways other than VEGF transcription2526 At 24 hours afterVEGF siRNA treatment the VEGF expression could pro-tect cells from apoptosis27 but later at 48 hours VEGFprotein levels decreased at 43 in the case of trans-fection with siPORT NeoFX and 338 in the case ofSWNTC-COOH delivery system This phenomenon mightbe caused by the interaction of other growth factorsincluding TNF- which could induce conversion of VEGFcell signaling The coordination of both proapoptotic andprosurvival signals allows a fine modulation of opposingcell functions required for angiogenesis More importantlythe VEGF may convert the antiapoptotic to proapoptotic

activity2628 and as a result this finding could have arelevant pharmacological implication as the MTT datashows The initial lack of balance between the moleculesinvolved in both angiogenesis and tumor survival may acti-vate other alternative mechanisms and restore the tumorangiogenic profile28 This process is modulated by TNFwhose increased level is not only involved in the inflam-matory response but may also be a proangiogenic factorThe SWCNT-COOH has been physically linked to the

siRNA followed by the delivery of the complex into can-cer cells in order to knock down targeted genes Theresults were similar or even more efficient than classi-cally delivery lipidic systems The mRNA and proteinanalysis suggests that only the targeted gene is affectedby the corresponding siRNA Current results indicate thatSWNTC-COOH nanostructures can be used for siRNAsdelivery results confirmed by a priviosly recent study byBartholomeusz et al29

The formation of SWCNT-COOH-siRNA complexesrequires only simple ultrasonic agitation and does notinvolve chemical reactions However before they can beused in biomedical applications the hydrophobic carbonnanotubes must be converted into a stable suspension inan aqueous solution

5 CONCLUSIONS

Gene silencing with SWNTC-COOH offers an alternativestrategy for the lipidic transfection systems-based cancertherapy The data indicate that SWNTC-COOH is a robustnanostructure and exhibits minimal toxicityThis study proves the prospectives of using SWCNT-

COOH solubilized by siRNA as a therapeutic agent incancer treatment but still remains to be validated byin vivo studies In future studies two siRNA targets willbe incorporated to maximize and further improve the effi-ciency of siRNA gene therapy in a dual treatment Studiesshould also focus on developing new biodegradable nano-structures that mimic the nanotube needle structure forsiRNA delivery

References and Notes

1 D Castanotto and J Rossi The promises and pitfalls of RNA-interference-based therapeutics Nature 457 426 (2009)

2 T Niidome and L Huang Gene Therapy Progress and ProspectsNonviral vectors Gene Therapy 9 1647 (2002)

3 I Berindan Neagoe O Balacescu C Burz C Braicu L BalacescuO Tudoran V Cristea and A Irimie p53 gene therapy using RNAinterference Journal of BUON S51 (2009)

4 J Kaminski M Huber J Summers and M Ward Design of anonviral vector for site-selective efficient integration into the humangenome The FASEB Journal 16 1242 (2002)

5 T Chu K Twu A Ellington and M Levy Aptamer mediatedsiRNA delivery Nucleic Acids Res 34 e73 (2006)

6 Z Liu S Tabakman K Welsher and H Dai Carbon nanotubes inBiology and Medicine In vitro and in vivo Detection Imaging andDrug Delivery Nano Res 2 85 (2009)

J Biomed Nanotechnol 8 567ndash574 2012 573

Delivered by Ingenta toRice University Fondren Library

IP 176142389Wed 01 Aug 2012 061037

RESEARCH

ARTIC

LE

Efficient siRNA Delivery System Using Carboxilated Single-Wall Carbon Nanotubes in Cancer Treatment Neagoe et al

(A) (B)

(C)

(D)

Fig 1 (A) TGA of pristine and oxidized NTC (SWNTC-COOH) (B) FTIR spectrum of pristine and oxidized CNTs (C) UV-vis spectrum andelectron microscopy (D) of SWNTC-COOH and SWNTC-COOH-siRNA

of SWNTC-COOH Moreover in the case of SWNTC-COOH the spectrum bands corresponding to the strechingvibration of carbonyl and carboxyl C O are visible at1580 and 1380 cmminus1 UV-vis measurements clearly con-firmed the functionalization and the attachment process ofsiRNA on the surface of SWNTC The electron micro-scope shows the accumulation of siRNA on the nanotubessurface (Fig 1(D)) The arrow indicates the binding ofsiRNA with SWNTC-COOH

32 siRNA Uptake by HepG Cells

Prior studies have described the penetration of function-alized nanotubes with siRNA into several cell types

Fig 2 Representative fluorescent images (400times) of cellular uptake of Silencerreg FAMtrade-Labeled Negative Control 1 siRNA complexed with siPortNeoFX and SWNTC-COOH at 24 hours after reverse transfection By comparing with control group (free siRNA) we observe a high transfectionefficiency for both transfection systems

however their siRNA internalisation using sWNTC-COOH in HepG2 cell line has not been tested Thustransfection efficiency was assessed by fluorescencemicroscopy using 50 nM FAM-labeled negative controlsiRNA (Figs 2(A and B)) The FAM-labelled negativecontrol siRNA complexes with SWNTC-COOH couldenter the HepG cell easily the siRNA uptake being similarto those by transfection with siPORT NeoFX

33 MTT Cytotoxicity Test

Each target specific gene has characteristics such as theaccessibility of the corresponding target sequences to theRNAi machinery appear to have a significant influence on

570 J Biomed Nanotechnol 8 567ndash574 2012

Delivered by Ingenta toRice University Fondren Library

IP 176142389Wed 01 Aug 2012 061037

RESEARCH

ARTIC

LE

Neagoe et al Efficient siRNA Delivery System Using Carboxilated Single-Wall Carbon Nanotubes in Cancer Treatment

the knockdown observed making certain targets easy ordifficult to knock down using siRNA Thus for the presentstudy we have chosen three target genes that are difficultto use for silencing especially in the case of VEGF andp53 (unpublished data) The present results are based onpreliminary optimization transfection conditions for bothtransfection systems in order to achieve the highest genesilencing with minimal cytotoxicityThe cytotoxicity was evaluated by a MTT-derived

non radioactive viability assay Transfected Hep2G cellsshowed no morphological differences compared tocontrol-untransfected cells All data concerning the eval-uation of the toxic effect of transfection systems (siPortNeoFX versus SWNTC-COOH) as well as the results con-cerning the effect of gene silencing on cell proliferation arepresented below in Figure 3 As the figure shows there ispresented no difference regardless if the cells were treatedwith siPORT NeoFX or SWNTC-COOH by comparingwith control group In conclusion no apparent change incellular viability was observed in the hepatocyte cell lineat a dose of 000125 gml SWNTC-COOH used as adelivery system for different siRNA All in all these datapresent strong evidence that CNTs can enter the cells withminimal side effectsThese results showed that the viability of the transfected

cells was clearly not affected by the transfection agentsThey also confirm a high efficiency of the siRNA trans-fection and good cell viability associated with both thein vitro delivery systems tested The relatively reducedviablility in the case of transfection with siRNA may bedue to the activation of the apoptotic processes asociatedto the gene silencing and not to a cytotoxic effect

34 RT-PCR and Results Analysis

The siRNA-induced gene silencing in mammalian cells isa very promising as a tool used to regulate the expres-sion of specific genes To develop a more efficient method

Fig 3 Cell proliferation as measured by the MTT assay after 24 hoursof incubation for different transfection systems

for delivering siRNA to the cells we have tested a newsystem by using carboxylated functionalyzed SWNTCwith three different siRNA in parallel and a highly effi-cient lipidic system available on the market the siPORTtrade

NeoFXtrade Transfection Agent The siRNA that was deliv-ered into the cell cytoplasm induced a post-transcriptionalgene silencing that can be quantified as a validated assess-ing of mRNA The gene expression was analyzed 24 hourspost transfection for both systemsThe knock-down effect on the gene expression was eval-

uated by RT-PCR and presented as a relatively similar geneexpression for all the experimental variants as we can seein Figure 4 An efficient silencing was obtained with theall three siRNA tests The relative gene expression levelwas determined to be 338ndash567 of the control cellsThe highest level of gene inhibition was observed in p53siRNA gene therapy cases In the case of p53 siRNA trans-fections with siPort NeoFX relative gene expression levelwas 338 meanwhile in the case of SWNTC-COOHdelivery system was 375The gene silencing for VEGFsiRNA transfection was

537 and respectively for TNF-siRNA transfection567 by using siPORT NeoFX as delivery systems Rel-atively similar results for gene expression were observedin the case of SWNTC-COOH delivery system forVEGF siRNA being 477 and for TNF-siRNA 465SWNTC-COOH we have been showed an efficient reduc-tion of the level of gene expression

35 p53 TNF- and VEGF Protein Expression

The quantification of TNF- and VEGF from cell cul-ture medium was done using ELISA assay and p53 pro-tein expression was performed using an imunofluorescencemethod The quantification of p53 TNF- and VEGFprotein expression was performed in order to identify apotential correlation of mRNA levels and posttranslationalprotein expression (Fig 5)The immunoflourescence staining confirmed the

RT-PCR data for p53 The ELISA data concerning thesecretion of TNF- and VEGF in cell culture medium

Fig 4 Relative gene expression level evaluation using RT-PCR after24 hours of incubation for different transfection systems (siPort NeoFXsiRNA versus SWNTC-COOH delivered siRNA)

J Biomed Nanotechnol 8 567ndash574 2012 571

Delivered by Ingenta toRice University Fondren Library

IP 176142389Wed 01 Aug 2012 061037

RESEARCH

ARTIC

LE

Efficient siRNA Delivery System Using Carboxilated Single-Wall Carbon Nanotubes in Cancer Treatment Neagoe et al

(a)

(b) (c)

Fig 5 Protein silencing evaluation using immunofluorescent staining for p53 at 24 hours after the treatment (A) and ELISA technique for TNF-and VEGF after 24 and 48 hours of incubation for different transfection systems (siPort NeoFX siRNA versus SWNTC-COOH delivered siRNA)

were in agreement with those obtained at mRNA levelOverall the lowest mRNA expression was confirmedat protein level especially in the case of p53 siRNAand TNF- siRNA transfection Less efficient reductionprotein expressions were observed in the case of VEGFsiRNA for both transfection systems at 24 h only at 48 hthere was a statistically significant reduction of VEGFprotein expression The highest level of protein expressioninhibition was observed in the case of siRNA transfectionwith SWNTC-COOH Elevated levels of TNF- wereobserved in groups treated with siPORT neoFX and at thetransfection of VEGF with siPORT NeoFX

4 DISCUSSION

The silencing of gene expression by siRNAs is rapidlybecoming a powerful tool in the genetic analysis of mam-malian cells However the rapid degradation of siRNA andthe limited duration of its action call for an efficient deliv-ery technology There are some future directions concern-ing ARNi therapy focused on high transfection efficiencyhigh capacity gene silencing low toxicity of the transfec-tion system and new assays in evaluating the efficiencyof the transfection21 An efficient delivery systems guaran-tees cell penetration prolonged intracellular gene silenc-ing and prevents the siRNA degradation18 In our case

the transfection with SWNTC-COOH fulfils these require-ments Carboxylated nanotubes have some advantages ascompared to other delivery systems One of them is thefact that they are thin and long and cover a large areafor siRNA binding Due to the nano-needle stucture theyare able to facilitate the internalization into the cytoplasmvia an endocytosis-independent pathway13 or through anendocitosis-dependent mechamism2021 The formation ofthe complex of siRNA with SWNTC-COOH is demon-strated by the results obtained at the level of gene expres-sion and protein for each target siRNA In a similar studyit was proved the efficencyof SWNTC-COOH for siRNAdelivery through conjugation of siRNA with positivelycharged SWNTC-COOH14

Restoring the tumour suppressor genes is the mostintuitive application of gene therapy in different cancertypes2223 Several approaches have been used for cancertreatment via the p53 pathway restoring the tumour sup-pression function from inactivation rescuing the mutatedp53 gene from instability or delivering the therapeuticexogenous p53 including p53 siRNA Another importantstudy24 was focused on a mutant adenovirus that doesnot express E1B a protein that binds and inactivates p53Thus this mutant virus could replicate and lyse p53-deficient human tumor cells but not cells with functional

572 J Biomed Nanotechnol 8 567ndash574 2012

Delivered by Ingenta toRice University Fondren Library

IP 176142389Wed 01 Aug 2012 061037

RESEARCH

ARTIC

LE

Neagoe et al Efficient siRNA Delivery System Using Carboxilated Single-Wall Carbon Nanotubes in Cancer Treatment

p53 Furthermore siRNA has been used to suppress theexpression of mutated p53 and restore the function of thewild-type geneTNF- was chosen as a primary target cytokine because

of its central role in mediating the inflammation Althoughthe mechanism of TNF- induced the activation of NF-Band mitogen activated pathways (MAPK) is well under-stood Despite of that the mechanism of TNF-mediatedapoptosis remains unclear TNF- inhibition may providesome new insights on mediated apoptosis by silencing thecandidate mediators of apoptosis or angiogenesis signal-ing The central hypothesis in many diseases includingcancer is that the downregulation of TNF- can resultin lower levels of other pro-inflammatory markers whichcan help to restore the delicate balance between pro- andanti-inflammatory18 The analysis of RT-PCR on showeddecreased levels TNF- in the case of treatment withsiRNA with both transfection systems (siPORT NeoFXrespectively SWNTC-COOH) There was an increasedlevel of TNF- at gene and proteine level in the case ofsiPORT NeoFX transfection agent while in the case ofSWNTC the values were relatively similar with the onesin the control groupThe increase in mRNA transcript and protein in the case

of TNF- in the case of transfection with of p53 siRNAand VEGFsiRNA with siPORTNeoFX can potentially beascribed to an unspecific immune response elicited by thetransfection agent andor inactive siRNA sequence itselfDue to the fact that the siRNA sequence was in an unmod-ified state it could most likely elicit an immune responseTo avoid such an off-target effect the modified and non-immune modulating siRNA should be included in futurestudies18 A decrease in the VEGF mRNA expression wasseen in both transfection systems the increased levelsmay be due to the complex interaction of pro-and anti-inflammatory cytokines causing compensatory reactionstriggered by the siPORT NeoFX transfection reagentThe ELISA results showed a small delay in VEGF pro-

tein silencing as evidenced by the slightly decreased pro-tein expression at 48 hours The delayed response alsoreflects the specificity of siRNA encoding for VEGF asimmune reaction for other markers needs time to occurThe inhibition of angiogenesis involves multiple path-ways other than VEGF transcription2526 At 24 hours afterVEGF siRNA treatment the VEGF expression could pro-tect cells from apoptosis27 but later at 48 hours VEGFprotein levels decreased at 43 in the case of trans-fection with siPORT NeoFX and 338 in the case ofSWNTC-COOH delivery system This phenomenon mightbe caused by the interaction of other growth factorsincluding TNF- which could induce conversion of VEGFcell signaling The coordination of both proapoptotic andprosurvival signals allows a fine modulation of opposingcell functions required for angiogenesis More importantlythe VEGF may convert the antiapoptotic to proapoptotic

activity2628 and as a result this finding could have arelevant pharmacological implication as the MTT datashows The initial lack of balance between the moleculesinvolved in both angiogenesis and tumor survival may acti-vate other alternative mechanisms and restore the tumorangiogenic profile28 This process is modulated by TNFwhose increased level is not only involved in the inflam-matory response but may also be a proangiogenic factorThe SWCNT-COOH has been physically linked to the

siRNA followed by the delivery of the complex into can-cer cells in order to knock down targeted genes Theresults were similar or even more efficient than classi-cally delivery lipidic systems The mRNA and proteinanalysis suggests that only the targeted gene is affectedby the corresponding siRNA Current results indicate thatSWNTC-COOH nanostructures can be used for siRNAsdelivery results confirmed by a priviosly recent study byBartholomeusz et al29

The formation of SWCNT-COOH-siRNA complexesrequires only simple ultrasonic agitation and does notinvolve chemical reactions However before they can beused in biomedical applications the hydrophobic carbonnanotubes must be converted into a stable suspension inan aqueous solution

5 CONCLUSIONS

Gene silencing with SWNTC-COOH offers an alternativestrategy for the lipidic transfection systems-based cancertherapy The data indicate that SWNTC-COOH is a robustnanostructure and exhibits minimal toxicityThis study proves the prospectives of using SWCNT-

COOH solubilized by siRNA as a therapeutic agent incancer treatment but still remains to be validated byin vivo studies In future studies two siRNA targets willbe incorporated to maximize and further improve the effi-ciency of siRNA gene therapy in a dual treatment Studiesshould also focus on developing new biodegradable nano-structures that mimic the nanotube needle structure forsiRNA delivery

References and Notes

1 D Castanotto and J Rossi The promises and pitfalls of RNA-interference-based therapeutics Nature 457 426 (2009)

2 T Niidome and L Huang Gene Therapy Progress and ProspectsNonviral vectors Gene Therapy 9 1647 (2002)

3 I Berindan Neagoe O Balacescu C Burz C Braicu L BalacescuO Tudoran V Cristea and A Irimie p53 gene therapy using RNAinterference Journal of BUON S51 (2009)

4 J Kaminski M Huber J Summers and M Ward Design of anonviral vector for site-selective efficient integration into the humangenome The FASEB Journal 16 1242 (2002)

5 T Chu K Twu A Ellington and M Levy Aptamer mediatedsiRNA delivery Nucleic Acids Res 34 e73 (2006)

6 Z Liu S Tabakman K Welsher and H Dai Carbon nanotubes inBiology and Medicine In vitro and in vivo Detection Imaging andDrug Delivery Nano Res 2 85 (2009)

J Biomed Nanotechnol 8 567ndash574 2012 573

Delivered by Ingenta toRice University Fondren Library

IP 176142389Wed 01 Aug 2012 061037

RESEARCH

ARTIC

LE

Neagoe et al Efficient siRNA Delivery System Using Carboxilated Single-Wall Carbon Nanotubes in Cancer Treatment

the knockdown observed making certain targets easy ordifficult to knock down using siRNA Thus for the presentstudy we have chosen three target genes that are difficultto use for silencing especially in the case of VEGF andp53 (unpublished data) The present results are based onpreliminary optimization transfection conditions for bothtransfection systems in order to achieve the highest genesilencing with minimal cytotoxicityThe cytotoxicity was evaluated by a MTT-derived

non radioactive viability assay Transfected Hep2G cellsshowed no morphological differences compared tocontrol-untransfected cells All data concerning the eval-uation of the toxic effect of transfection systems (siPortNeoFX versus SWNTC-COOH) as well as the results con-cerning the effect of gene silencing on cell proliferation arepresented below in Figure 3 As the figure shows there ispresented no difference regardless if the cells were treatedwith siPORT NeoFX or SWNTC-COOH by comparingwith control group In conclusion no apparent change incellular viability was observed in the hepatocyte cell lineat a dose of 000125 gml SWNTC-COOH used as adelivery system for different siRNA All in all these datapresent strong evidence that CNTs can enter the cells withminimal side effectsThese results showed that the viability of the transfected

cells was clearly not affected by the transfection agentsThey also confirm a high efficiency of the siRNA trans-fection and good cell viability associated with both thein vitro delivery systems tested The relatively reducedviablility in the case of transfection with siRNA may bedue to the activation of the apoptotic processes asociatedto the gene silencing and not to a cytotoxic effect

34 RT-PCR and Results Analysis

The siRNA-induced gene silencing in mammalian cells isa very promising as a tool used to regulate the expres-sion of specific genes To develop a more efficient method

Fig 3 Cell proliferation as measured by the MTT assay after 24 hoursof incubation for different transfection systems

for delivering siRNA to the cells we have tested a newsystem by using carboxylated functionalyzed SWNTCwith three different siRNA in parallel and a highly effi-cient lipidic system available on the market the siPORTtrade

NeoFXtrade Transfection Agent The siRNA that was deliv-ered into the cell cytoplasm induced a post-transcriptionalgene silencing that can be quantified as a validated assess-ing of mRNA The gene expression was analyzed 24 hourspost transfection for both systemsThe knock-down effect on the gene expression was eval-

uated by RT-PCR and presented as a relatively similar geneexpression for all the experimental variants as we can seein Figure 4 An efficient silencing was obtained with theall three siRNA tests The relative gene expression levelwas determined to be 338ndash567 of the control cellsThe highest level of gene inhibition was observed in p53siRNA gene therapy cases In the case of p53 siRNA trans-fections with siPort NeoFX relative gene expression levelwas 338 meanwhile in the case of SWNTC-COOHdelivery system was 375The gene silencing for VEGFsiRNA transfection was

537 and respectively for TNF-siRNA transfection567 by using siPORT NeoFX as delivery systems Rel-atively similar results for gene expression were observedin the case of SWNTC-COOH delivery system forVEGF siRNA being 477 and for TNF-siRNA 465SWNTC-COOH we have been showed an efficient reduc-tion of the level of gene expression

35 p53 TNF- and VEGF Protein Expression

The quantification of TNF- and VEGF from cell cul-ture medium was done using ELISA assay and p53 pro-tein expression was performed using an imunofluorescencemethod The quantification of p53 TNF- and VEGFprotein expression was performed in order to identify apotential correlation of mRNA levels and posttranslationalprotein expression (Fig 5)The immunoflourescence staining confirmed the

RT-PCR data for p53 The ELISA data concerning thesecretion of TNF- and VEGF in cell culture medium

Fig 4 Relative gene expression level evaluation using RT-PCR after24 hours of incubation for different transfection systems (siPort NeoFXsiRNA versus SWNTC-COOH delivered siRNA)

J Biomed Nanotechnol 8 567ndash574 2012 571

Delivered by Ingenta toRice University Fondren Library

IP 176142389Wed 01 Aug 2012 061037

RESEARCH

ARTIC

LE

Efficient siRNA Delivery System Using Carboxilated Single-Wall Carbon Nanotubes in Cancer Treatment Neagoe et al

(a)

(b) (c)

Fig 5 Protein silencing evaluation using immunofluorescent staining for p53 at 24 hours after the treatment (A) and ELISA technique for TNF-and VEGF after 24 and 48 hours of incubation for different transfection systems (siPort NeoFX siRNA versus SWNTC-COOH delivered siRNA)

were in agreement with those obtained at mRNA levelOverall the lowest mRNA expression was confirmedat protein level especially in the case of p53 siRNAand TNF- siRNA transfection Less efficient reductionprotein expressions were observed in the case of VEGFsiRNA for both transfection systems at 24 h only at 48 hthere was a statistically significant reduction of VEGFprotein expression The highest level of protein expressioninhibition was observed in the case of siRNA transfectionwith SWNTC-COOH Elevated levels of TNF- wereobserved in groups treated with siPORT neoFX and at thetransfection of VEGF with siPORT NeoFX

4 DISCUSSION

The silencing of gene expression by siRNAs is rapidlybecoming a powerful tool in the genetic analysis of mam-malian cells However the rapid degradation of siRNA andthe limited duration of its action call for an efficient deliv-ery technology There are some future directions concern-ing ARNi therapy focused on high transfection efficiencyhigh capacity gene silencing low toxicity of the transfec-tion system and new assays in evaluating the efficiencyof the transfection21 An efficient delivery systems guaran-tees cell penetration prolonged intracellular gene silenc-ing and prevents the siRNA degradation18 In our case

the transfection with SWNTC-COOH fulfils these require-ments Carboxylated nanotubes have some advantages ascompared to other delivery systems One of them is thefact that they are thin and long and cover a large areafor siRNA binding Due to the nano-needle stucture theyare able to facilitate the internalization into the cytoplasmvia an endocytosis-independent pathway13 or through anendocitosis-dependent mechamism2021 The formation ofthe complex of siRNA with SWNTC-COOH is demon-strated by the results obtained at the level of gene expres-sion and protein for each target siRNA In a similar studyit was proved the efficencyof SWNTC-COOH for siRNAdelivery through conjugation of siRNA with positivelycharged SWNTC-COOH14

Restoring the tumour suppressor genes is the mostintuitive application of gene therapy in different cancertypes2223 Several approaches have been used for cancertreatment via the p53 pathway restoring the tumour sup-pression function from inactivation rescuing the mutatedp53 gene from instability or delivering the therapeuticexogenous p53 including p53 siRNA Another importantstudy24 was focused on a mutant adenovirus that doesnot express E1B a protein that binds and inactivates p53Thus this mutant virus could replicate and lyse p53-deficient human tumor cells but not cells with functional

572 J Biomed Nanotechnol 8 567ndash574 2012

Delivered by Ingenta toRice University Fondren Library

IP 176142389Wed 01 Aug 2012 061037

RESEARCH

ARTIC

LE

Neagoe et al Efficient siRNA Delivery System Using Carboxilated Single-Wall Carbon Nanotubes in Cancer Treatment

p53 Furthermore siRNA has been used to suppress theexpression of mutated p53 and restore the function of thewild-type geneTNF- was chosen as a primary target cytokine because

of its central role in mediating the inflammation Althoughthe mechanism of TNF- induced the activation of NF-Band mitogen activated pathways (MAPK) is well under-stood Despite of that the mechanism of TNF-mediatedapoptosis remains unclear TNF- inhibition may providesome new insights on mediated apoptosis by silencing thecandidate mediators of apoptosis or angiogenesis signal-ing The central hypothesis in many diseases includingcancer is that the downregulation of TNF- can resultin lower levels of other pro-inflammatory markers whichcan help to restore the delicate balance between pro- andanti-inflammatory18 The analysis of RT-PCR on showeddecreased levels TNF- in the case of treatment withsiRNA with both transfection systems (siPORT NeoFXrespectively SWNTC-COOH) There was an increasedlevel of TNF- at gene and proteine level in the case ofsiPORT NeoFX transfection agent while in the case ofSWNTC the values were relatively similar with the onesin the control groupThe increase in mRNA transcript and protein in the case

of TNF- in the case of transfection with of p53 siRNAand VEGFsiRNA with siPORTNeoFX can potentially beascribed to an unspecific immune response elicited by thetransfection agent andor inactive siRNA sequence itselfDue to the fact that the siRNA sequence was in an unmod-ified state it could most likely elicit an immune responseTo avoid such an off-target effect the modified and non-immune modulating siRNA should be included in futurestudies18 A decrease in the VEGF mRNA expression wasseen in both transfection systems the increased levelsmay be due to the complex interaction of pro-and anti-inflammatory cytokines causing compensatory reactionstriggered by the siPORT NeoFX transfection reagentThe ELISA results showed a small delay in VEGF pro-

tein silencing as evidenced by the slightly decreased pro-tein expression at 48 hours The delayed response alsoreflects the specificity of siRNA encoding for VEGF asimmune reaction for other markers needs time to occurThe inhibition of angiogenesis involves multiple path-ways other than VEGF transcription2526 At 24 hours afterVEGF siRNA treatment the VEGF expression could pro-tect cells from apoptosis27 but later at 48 hours VEGFprotein levels decreased at 43 in the case of trans-fection with siPORT NeoFX and 338 in the case ofSWNTC-COOH delivery system This phenomenon mightbe caused by the interaction of other growth factorsincluding TNF- which could induce conversion of VEGFcell signaling The coordination of both proapoptotic andprosurvival signals allows a fine modulation of opposingcell functions required for angiogenesis More importantlythe VEGF may convert the antiapoptotic to proapoptotic

activity2628 and as a result this finding could have arelevant pharmacological implication as the MTT datashows The initial lack of balance between the moleculesinvolved in both angiogenesis and tumor survival may acti-vate other alternative mechanisms and restore the tumorangiogenic profile28 This process is modulated by TNFwhose increased level is not only involved in the inflam-matory response but may also be a proangiogenic factorThe SWCNT-COOH has been physically linked to the

siRNA followed by the delivery of the complex into can-cer cells in order to knock down targeted genes Theresults were similar or even more efficient than classi-cally delivery lipidic systems The mRNA and proteinanalysis suggests that only the targeted gene is affectedby the corresponding siRNA Current results indicate thatSWNTC-COOH nanostructures can be used for siRNAsdelivery results confirmed by a priviosly recent study byBartholomeusz et al29

The formation of SWCNT-COOH-siRNA complexesrequires only simple ultrasonic agitation and does notinvolve chemical reactions However before they can beused in biomedical applications the hydrophobic carbonnanotubes must be converted into a stable suspension inan aqueous solution

5 CONCLUSIONS

Gene silencing with SWNTC-COOH offers an alternativestrategy for the lipidic transfection systems-based cancertherapy The data indicate that SWNTC-COOH is a robustnanostructure and exhibits minimal toxicityThis study proves the prospectives of using SWCNT-

COOH solubilized by siRNA as a therapeutic agent incancer treatment but still remains to be validated byin vivo studies In future studies two siRNA targets willbe incorporated to maximize and further improve the effi-ciency of siRNA gene therapy in a dual treatment Studiesshould also focus on developing new biodegradable nano-structures that mimic the nanotube needle structure forsiRNA delivery

References and Notes

1 D Castanotto and J Rossi The promises and pitfalls of RNA-interference-based therapeutics Nature 457 426 (2009)

2 T Niidome and L Huang Gene Therapy Progress and ProspectsNonviral vectors Gene Therapy 9 1647 (2002)

3 I Berindan Neagoe O Balacescu C Burz C Braicu L BalacescuO Tudoran V Cristea and A Irimie p53 gene therapy using RNAinterference Journal of BUON S51 (2009)

4 J Kaminski M Huber J Summers and M Ward Design of anonviral vector for site-selective efficient integration into the humangenome The FASEB Journal 16 1242 (2002)

5 T Chu K Twu A Ellington and M Levy Aptamer mediatedsiRNA delivery Nucleic Acids Res 34 e73 (2006)

6 Z Liu S Tabakman K Welsher and H Dai Carbon nanotubes inBiology and Medicine In vitro and in vivo Detection Imaging andDrug Delivery Nano Res 2 85 (2009)

J Biomed Nanotechnol 8 567ndash574 2012 573

Delivered by Ingenta toRice University Fondren Library

IP 176142389Wed 01 Aug 2012 061037

RESEARCH

ARTIC

LE

Efficient siRNA Delivery System Using Carboxilated Single-Wall Carbon Nanotubes in Cancer Treatment Neagoe et al

(a)

(b) (c)

Fig 5 Protein silencing evaluation using immunofluorescent staining for p53 at 24 hours after the treatment (A) and ELISA technique for TNF-and VEGF after 24 and 48 hours of incubation for different transfection systems (siPort NeoFX siRNA versus SWNTC-COOH delivered siRNA)

were in agreement with those obtained at mRNA levelOverall the lowest mRNA expression was confirmedat protein level especially in the case of p53 siRNAand TNF- siRNA transfection Less efficient reductionprotein expressions were observed in the case of VEGFsiRNA for both transfection systems at 24 h only at 48 hthere was a statistically significant reduction of VEGFprotein expression The highest level of protein expressioninhibition was observed in the case of siRNA transfectionwith SWNTC-COOH Elevated levels of TNF- wereobserved in groups treated with siPORT neoFX and at thetransfection of VEGF with siPORT NeoFX

4 DISCUSSION

The silencing of gene expression by siRNAs is rapidlybecoming a powerful tool in the genetic analysis of mam-malian cells However the rapid degradation of siRNA andthe limited duration of its action call for an efficient deliv-ery technology There are some future directions concern-ing ARNi therapy focused on high transfection efficiencyhigh capacity gene silencing low toxicity of the transfec-tion system and new assays in evaluating the efficiencyof the transfection21 An efficient delivery systems guaran-tees cell penetration prolonged intracellular gene silenc-ing and prevents the siRNA degradation18 In our case

the transfection with SWNTC-COOH fulfils these require-ments Carboxylated nanotubes have some advantages ascompared to other delivery systems One of them is thefact that they are thin and long and cover a large areafor siRNA binding Due to the nano-needle stucture theyare able to facilitate the internalization into the cytoplasmvia an endocytosis-independent pathway13 or through anendocitosis-dependent mechamism2021 The formation ofthe complex of siRNA with SWNTC-COOH is demon-strated by the results obtained at the level of gene expres-sion and protein for each target siRNA In a similar studyit was proved the efficencyof SWNTC-COOH for siRNAdelivery through conjugation of siRNA with positivelycharged SWNTC-COOH14

Restoring the tumour suppressor genes is the mostintuitive application of gene therapy in different cancertypes2223 Several approaches have been used for cancertreatment via the p53 pathway restoring the tumour sup-pression function from inactivation rescuing the mutatedp53 gene from instability or delivering the therapeuticexogenous p53 including p53 siRNA Another importantstudy24 was focused on a mutant adenovirus that doesnot express E1B a protein that binds and inactivates p53Thus this mutant virus could replicate and lyse p53-deficient human tumor cells but not cells with functional

572 J Biomed Nanotechnol 8 567ndash574 2012

Delivered by Ingenta toRice University Fondren Library

IP 176142389Wed 01 Aug 2012 061037

RESEARCH

ARTIC

LE

Neagoe et al Efficient siRNA Delivery System Using Carboxilated Single-Wall Carbon Nanotubes in Cancer Treatment

p53 Furthermore siRNA has been used to suppress theexpression of mutated p53 and restore the function of thewild-type geneTNF- was chosen as a primary target cytokine because

of its central role in mediating the inflammation Althoughthe mechanism of TNF- induced the activation of NF-Band mitogen activated pathways (MAPK) is well under-stood Despite of that the mechanism of TNF-mediatedapoptosis remains unclear TNF- inhibition may providesome new insights on mediated apoptosis by silencing thecandidate mediators of apoptosis or angiogenesis signal-ing The central hypothesis in many diseases includingcancer is that the downregulation of TNF- can resultin lower levels of other pro-inflammatory markers whichcan help to restore the delicate balance between pro- andanti-inflammatory18 The analysis of RT-PCR on showeddecreased levels TNF- in the case of treatment withsiRNA with both transfection systems (siPORT NeoFXrespectively SWNTC-COOH) There was an increasedlevel of TNF- at gene and proteine level in the case ofsiPORT NeoFX transfection agent while in the case ofSWNTC the values were relatively similar with the onesin the control groupThe increase in mRNA transcript and protein in the case

of TNF- in the case of transfection with of p53 siRNAand VEGFsiRNA with siPORTNeoFX can potentially beascribed to an unspecific immune response elicited by thetransfection agent andor inactive siRNA sequence itselfDue to the fact that the siRNA sequence was in an unmod-ified state it could most likely elicit an immune responseTo avoid such an off-target effect the modified and non-immune modulating siRNA should be included in futurestudies18 A decrease in the VEGF mRNA expression wasseen in both transfection systems the increased levelsmay be due to the complex interaction of pro-and anti-inflammatory cytokines causing compensatory reactionstriggered by the siPORT NeoFX transfection reagentThe ELISA results showed a small delay in VEGF pro-

tein silencing as evidenced by the slightly decreased pro-tein expression at 48 hours The delayed response alsoreflects the specificity of siRNA encoding for VEGF asimmune reaction for other markers needs time to occurThe inhibition of angiogenesis involves multiple path-ways other than VEGF transcription2526 At 24 hours afterVEGF siRNA treatment the VEGF expression could pro-tect cells from apoptosis27 but later at 48 hours VEGFprotein levels decreased at 43 in the case of trans-fection with siPORT NeoFX and 338 in the case ofSWNTC-COOH delivery system This phenomenon mightbe caused by the interaction of other growth factorsincluding TNF- which could induce conversion of VEGFcell signaling The coordination of both proapoptotic andprosurvival signals allows a fine modulation of opposingcell functions required for angiogenesis More importantlythe VEGF may convert the antiapoptotic to proapoptotic

activity2628 and as a result this finding could have arelevant pharmacological implication as the MTT datashows The initial lack of balance between the moleculesinvolved in both angiogenesis and tumor survival may acti-vate other alternative mechanisms and restore the tumorangiogenic profile28 This process is modulated by TNFwhose increased level is not only involved in the inflam-matory response but may also be a proangiogenic factorThe SWCNT-COOH has been physically linked to the

siRNA followed by the delivery of the complex into can-cer cells in order to knock down targeted genes Theresults were similar or even more efficient than classi-cally delivery lipidic systems The mRNA and proteinanalysis suggests that only the targeted gene is affectedby the corresponding siRNA Current results indicate thatSWNTC-COOH nanostructures can be used for siRNAsdelivery results confirmed by a priviosly recent study byBartholomeusz et al29

The formation of SWCNT-COOH-siRNA complexesrequires only simple ultrasonic agitation and does notinvolve chemical reactions However before they can beused in biomedical applications the hydrophobic carbonnanotubes must be converted into a stable suspension inan aqueous solution

5 CONCLUSIONS

Gene silencing with SWNTC-COOH offers an alternativestrategy for the lipidic transfection systems-based cancertherapy The data indicate that SWNTC-COOH is a robustnanostructure and exhibits minimal toxicityThis study proves the prospectives of using SWCNT-

COOH solubilized by siRNA as a therapeutic agent incancer treatment but still remains to be validated byin vivo studies In future studies two siRNA targets willbe incorporated to maximize and further improve the effi-ciency of siRNA gene therapy in a dual treatment Studiesshould also focus on developing new biodegradable nano-structures that mimic the nanotube needle structure forsiRNA delivery

References and Notes

1 D Castanotto and J Rossi The promises and pitfalls of RNA-interference-based therapeutics Nature 457 426 (2009)

2 T Niidome and L Huang Gene Therapy Progress and ProspectsNonviral vectors Gene Therapy 9 1647 (2002)

3 I Berindan Neagoe O Balacescu C Burz C Braicu L BalacescuO Tudoran V Cristea and A Irimie p53 gene therapy using RNAinterference Journal of BUON S51 (2009)

4 J Kaminski M Huber J Summers and M Ward Design of anonviral vector for site-selective efficient integration into the humangenome The FASEB Journal 16 1242 (2002)

5 T Chu K Twu A Ellington and M Levy Aptamer mediatedsiRNA delivery Nucleic Acids Res 34 e73 (2006)

6 Z Liu S Tabakman K Welsher and H Dai Carbon nanotubes inBiology and Medicine In vitro and in vivo Detection Imaging andDrug Delivery Nano Res 2 85 (2009)

J Biomed Nanotechnol 8 567ndash574 2012 573

Delivered by Ingenta toRice University Fondren Library

IP 176142389Wed 01 Aug 2012 061037

RESEARCH

ARTIC

LE

Neagoe et al Efficient siRNA Delivery System Using Carboxilated Single-Wall Carbon Nanotubes in Cancer Treatment

p53 Furthermore siRNA has been used to suppress theexpression of mutated p53 and restore the function of thewild-type geneTNF- was chosen as a primary target cytokine because

of its central role in mediating the inflammation Althoughthe mechanism of TNF- induced the activation of NF-Band mitogen activated pathways (MAPK) is well under-stood Despite of that the mechanism of TNF-mediatedapoptosis remains unclear TNF- inhibition may providesome new insights on mediated apoptosis by silencing thecandidate mediators of apoptosis or angiogenesis signal-ing The central hypothesis in many diseases includingcancer is that the downregulation of TNF- can resultin lower levels of other pro-inflammatory markers whichcan help to restore the delicate balance between pro- andanti-inflammatory18 The analysis of RT-PCR on showeddecreased levels TNF- in the case of treatment withsiRNA with both transfection systems (siPORT NeoFXrespectively SWNTC-COOH) There was an increasedlevel of TNF- at gene and proteine level in the case ofsiPORT NeoFX transfection agent while in the case ofSWNTC the values were relatively similar with the onesin the control groupThe increase in mRNA transcript and protein in the case

of TNF- in the case of transfection with of p53 siRNAand VEGFsiRNA with siPORTNeoFX can potentially beascribed to an unspecific immune response elicited by thetransfection agent andor inactive siRNA sequence itselfDue to the fact that the siRNA sequence was in an unmod-ified state it could most likely elicit an immune responseTo avoid such an off-target effect the modified and non-immune modulating siRNA should be included in futurestudies18 A decrease in the VEGF mRNA expression wasseen in both transfection systems the increased levelsmay be due to the complex interaction of pro-and anti-inflammatory cytokines causing compensatory reactionstriggered by the siPORT NeoFX transfection reagentThe ELISA results showed a small delay in VEGF pro-

tein silencing as evidenced by the slightly decreased pro-tein expression at 48 hours The delayed response alsoreflects the specificity of siRNA encoding for VEGF asimmune reaction for other markers needs time to occurThe inhibition of angiogenesis involves multiple path-ways other than VEGF transcription2526 At 24 hours afterVEGF siRNA treatment the VEGF expression could pro-tect cells from apoptosis27 but later at 48 hours VEGFprotein levels decreased at 43 in the case of trans-fection with siPORT NeoFX and 338 in the case ofSWNTC-COOH delivery system This phenomenon mightbe caused by the interaction of other growth factorsincluding TNF- which could induce conversion of VEGFcell signaling The coordination of both proapoptotic andprosurvival signals allows a fine modulation of opposingcell functions required for angiogenesis More importantlythe VEGF may convert the antiapoptotic to proapoptotic

activity2628 and as a result this finding could have arelevant pharmacological implication as the MTT datashows The initial lack of balance between the moleculesinvolved in both angiogenesis and tumor survival may acti-vate other alternative mechanisms and restore the tumorangiogenic profile28 This process is modulated by TNFwhose increased level is not only involved in the inflam-matory response but may also be a proangiogenic factorThe SWCNT-COOH has been physically linked to the

siRNA followed by the delivery of the complex into can-cer cells in order to knock down targeted genes Theresults were similar or even more efficient than classi-cally delivery lipidic systems The mRNA and proteinanalysis suggests that only the targeted gene is affectedby the corresponding siRNA Current results indicate thatSWNTC-COOH nanostructures can be used for siRNAsdelivery results confirmed by a priviosly recent study byBartholomeusz et al29

The formation of SWCNT-COOH-siRNA complexesrequires only simple ultrasonic agitation and does notinvolve chemical reactions However before they can beused in biomedical applications the hydrophobic carbonnanotubes must be converted into a stable suspension inan aqueous solution

5 CONCLUSIONS

Gene silencing with SWNTC-COOH offers an alternativestrategy for the lipidic transfection systems-based cancertherapy The data indicate that SWNTC-COOH is a robustnanostructure and exhibits minimal toxicityThis study proves the prospectives of using SWCNT-

COOH solubilized by siRNA as a therapeutic agent incancer treatment but still remains to be validated byin vivo studies In future studies two siRNA targets willbe incorporated to maximize and further improve the effi-ciency of siRNA gene therapy in a dual treatment Studiesshould also focus on developing new biodegradable nano-structures that mimic the nanotube needle structure forsiRNA delivery

References and Notes

1 D Castanotto and J Rossi The promises and pitfalls of RNA-interference-based therapeutics Nature 457 426 (2009)

2 T Niidome and L Huang Gene Therapy Progress and ProspectsNonviral vectors Gene Therapy 9 1647 (2002)

3 I Berindan Neagoe O Balacescu C Burz C Braicu L BalacescuO Tudoran V Cristea and A Irimie p53 gene therapy using RNAinterference Journal of BUON S51 (2009)

4 J Kaminski M Huber J Summers and M Ward Design of anonviral vector for site-selective efficient integration into the humangenome The FASEB Journal 16 1242 (2002)

5 T Chu K Twu A Ellington and M Levy Aptamer mediatedsiRNA delivery Nucleic Acids Res 34 e73 (2006)

6 Z Liu S Tabakman K Welsher and H Dai Carbon nanotubes inBiology and Medicine In vitro and in vivo Detection Imaging andDrug Delivery Nano Res 2 85 (2009)

J Biomed Nanotechnol 8 567ndash574 2012 573

Delivered by Ingenta toRice University Fondren Library

IP 176142389Wed 01 Aug 2012 061037

RESEARCH

ARTIC

LE

Efficient siRNA Delivery System Using Carboxilated Single-Wall Carbon Nanotubes in Cancer Treatment Neagoe et al

7 S Foillard G Zuber and E Doris Polyethylenimine-carbon nano-tube nanohybrids for siRNA-mediated gene silencing at cellularlevel Nanoscale 3 1461 (2011)

8 A K Varkouhi S Foillard T Lammers R M Schiffelers E DorisW E Hennink and G Storm siRNA delivery with functionalizedcarbon nanotubes Int J Pharm 416 419 (2011)

9 G Bartholomeusz P Cherukuri J Kingston L Cognet R LemosT K Leeuw L Gumbiner-Russo R B Weisman and G PowisIn Vivo therapeutic silencing of hypoxia-inducible factor 1 alpha(HIF-1) using single-walled carbon nanotubes noncovalentlycoated with siRNA Nano Res 2 279 (2009)

10 Z Liu K Chen C Davis S Sherlock Q Cao X Chen and H DaiDrug delivery with carbon nanotubes for in vivo cancer treatmentCancer Res 68 6652 (2008)

11 J McCarroll H Baigude C Yang and T M Rana Nanotubesfunctionalized with lipids and natural amino acid dendrimers A newstrategy to create nanomaterials for delivering systemic RNAi Bio-conjug Chem 21 56 (2010)

12 K T Al-Jamal F M Toma A Yilmazer H Ali-Boucetta A NunesM Herrero B Tian A Eddaoudi W T Al-Jamal A BiancoM Prato and K Kostarelo Enhanced cellular internalization andgene silencing with a series of cationic dendron-multiwalled carbonnanotubesiRNA complexes FASEB 24 4354 (2010)

13 A K Varkouhi S Foillard T Lammers R M Schiffelers E DorisW E Hennink and G Storm siRNA delivery with functionalizedcarbon nanotubes Int J Pharm 416 419 (2011)

14 M S Ladeira V A Andrade E R M Gomes C J Aguiar E RMoraes J S Soares E E Silva R G Lacerda L O LadeiraA Jorio P Lima M F Leite R R Resende and S GuatimosimHighly efficient siRNA delivery system into human and murine cellsusing single-wall carbon nanotubes Nanotechnology 21 385101(2010)

15 X Wang J Ren and X Qu Targeted RNA interference of cyclin A2mediated by functionalized single-walled carbon nanotubes inducesproliferation arrest and apoptosis in chronic myelogenous leukemiaK562cells ChemMed 3 940 (2008)

16 Y S Guan Z La L Yang Q He and P Li p53 gene in treatmentof hepatic carcinoma status quo World J Gastroenterol 13 985(2007)

17 J Jung A Solanki K A Memoli K Kamei H Kim M ADrahl L J Williams H R Tseng and K Lee Selective inhibi-tion of human brain tumor cells through multifunctional quantum-dot-based siRNA delivery Angew Chem Int Ed Engl 49 103(2010)

18 C Kriegel Dual TNF-Cyclin D1 gene silencing with an oral poly-meric microparticle system as a novel strategy for the treatment ofInflammatory Bowel Disease Clinical and Translational Gastroen-terology 2 e2 (2011)

19 E Heister V Neves C Tilmaciu K Lipert V S Beltran H MColey S R P Silva and J J McFadden Triple functionalisationof single-walled carbon nanotubes with doxorubicin a monoclonalantibody and a fluorescent marker for targeted cancer therapy Car-bon 47 2152 (2009)

20 M L Becker J A Fagan N D Gallant B J Bauer V Baj-pai E K Hobbie S H Lacerda K B Migler and J P Jacup-ciak Length-dependent uptake of DNA-wrapped single-walled car-bon nanotubes Adv Mater 19 939 (2007)

21 N W S Kam Z A Liu and H J Dai Carbon nanotubes as intra-cellular transporters for proteins and DNA An investigation of theuptake mechanism and pathway Angew Chem Int Ed Engl 45 577(2006)

22 P Guo O Coban N Snead J Trebley S Hoeprich S Guo andY Shu Engineering RNA for targeted siRNA delivery and medicalapplication Adv Drug Deliv Rev 62 650 (2010)

23 D Xu D Falke and R L Juliano p53-dependent cell-killing byselective repression of thymidine kinase and reduced prodrug acti-vation Molecular Pharmacology 64 289 (2003)

24 J R Bischoff D H Kirn A Williams C Heise S Horn M MunaJ A Nye A Sampson-Johannes A Fattaey and F McCormick Anadenovirus mutant that replicates selectively in p53-deficient humantumor cells Science (Wash DC) 274 373 (1996)

25 M Sartippour Z M Shao D Heber P Beatty L Zhang C LiuL Ellis W Liu V L Go and M N Brooks Green tea inhibits vas-cular endothelial growth factor (VEGF) induction in human breastcancer cells J Nutr 132 2307 (2002)

26 G Ferrari G Pintucci G Seghezzi K Hyman A Galloway andP Mignatti VEGF a prosurvival factor acts in concert with TGF-1 to induce endothelial cell apoptosis Proc Natl Acad Sci USA103 17260 (2006)

27 H Leong and P Mathur Green tea catechins inhibit angiogenesisthrough suppression of STAT3 activation Breast Cancer Res Treat117 505 (2009)

28 R J Epstein VEGF signaling inhibitors more pro-apoptotic thananti-angiogenic Cancer Metastasis Rev 26 443 (2007)

29 G Bartholomeusz P Cherukuri J Kingston L Cognet R LemosT K Leeuw L Gumbiner-Russo R B Weisman and G PowisIn vivo therapeutic silencing of hypoxia-inducible factor 1 alpha(HIF-1) using single-walled carbon nanotubes noncovalentlycoated with siRNA Nano Res 2 279 (2009)

Received 11 September 2011 Accepted 15 November 2011

574 J Biomed Nanotechnol 8 567ndash574 2012