ORIGINAL ARTICLE

Effect of different resistance-training regimenson the WNT-signaling pathway

Marcelo Larciprete Leal • Leonardo Lamas • Marcelo Saldanha Aoki •

Carlos Ugrinowitsch • Marcela Sorelli Carneiro Ramos • Valmor Tricoli •

Anselmo Sigari Moriscot

Received: 7 October 2010 / Accepted: 14 February 2011 / Published online: 2 March 2011

� Springer-Verlag 2011

Abstract The purpose of the present study was to eval-

uate the effects of 8 weeks of strength and power training

on the expression of genes related to the canonical WNT

pathway and b-catenin protein levels in physically active

men. Twenty-five subjects (27.4 ± 4.6 years) were bal-

anced based on their relative maximum strength in the

squat exercise (squat 1RM/body mass) and randomly

assigned to strength training (ST) (n = 10), power training

(PT) (n = 10), and control (C) (n = 5) groups. The ST and

the PT groups performed high and low intensity squats,

respectively, thrice a week, for 8 weeks. Muscle biopsies

from the vastus lateralis muscle were collected before and

after the training period. Relative strength and power

increased similarly in both ST and PT groups (P \ 0.001).

Fiber cross-sectional area also increased similarly in both

ST and PT groups. Gene expression and b-catenin protein

expression levels were assessed by real-time PCR and

Western blot. Certain genes were up-regulated in the ST

group (WNT1: 6.4-fold, P \ 0.0001; SFRP1: 3.3-fold,

P \ 0.0001 and LEF1: 7.3-fold, P \ 0.0001) and also in

the PT group (WNT1: 24.9-fold, P \ 0.0001; SFRP1: 2.7-

fold, P \ 0.0001; LEF1: 34.1-fold, P \ 0.0001 and Cyclin

D1: 7.7-fold, P \ 0.001). In addition, the expression of key

WNT pathway genes was substantially more responsive to

PT than to ST (WNT1: P \ 0.0001; LEF1: P \ 0.0001 and

Cyclin D1: P \ 0.001). Finally, the total b-catenin protein

content increased only in the PT group (P \ 0.05). Our

data indicate that a PT regimen triggers greater responses

in key elements of the WNT pathway.

Keywords Skeletal muscle � Gene expression � Strength �Power

Introduction

Skeletal muscle hypertrophy is a widely recognized adap-

tation to resistance training. This adaptation has been

associated with changes in the gene expression profile and

the rate of protein synthesis (Coffey and Hawley 2007;

Toigo and Boutellier 2006). Accordingly, in the past few

years, much attention has been given to the molecular

mechanisms underlying muscle hypertrophy, such as the

expression and activity of MGF, the Akt/mTOR pathway,

myostatin, and atrogin (Glass 2003, 2005; Welle et al.

2007; Williams 2004). However, the molecular basis of the

adaptations produced by different resistance-training regi-

mens such as power and strength training is still elusive.

Previous studies have reported muscle fiber hypertrophy

after a strength-training protocol (Campos et al. 2002;

Lamas et al. 2010; Staron et al. 1990). However, data

regarding power training regimens are scarce. For instance,

Moss et al. (1997) demonstrated that loads correspondent

to the maximum power training intensity induced muscle

Communicated by Hakan Westerblad.

M. L. Leal and L. Lamas contributed equally to the study.

M. L. Leal � M. S. C. Ramos � A. S. Moriscot (&)

Department of Cell and Developmental Biology,

Institute of Biomedical Sciences, University of Sao Paulo,

Av. Prof. Lineu Prestes, 1524. Butanta,

Sao Paulo, SP 05508-900, Brazil

e-mail: moriscot@usp.br

L. Lamas � C. Ugrinowitsch � V. Tricoli

School of Physical Education and Sport,

University of Sao Paulo, Sao Paulo, SP, Brazil

M. S. Aoki

School of Arts, Sciences and Humanities,

University of Sao Paulo, Sao Paulo, SP, Brazil

123

Eur J Appl Physiol (2011) 111:2535–2545

DOI 10.1007/s00421-011-1874-7

hypertrophy. Recently, our research group (Lamas et al.

2010) demonstrated that both strength-training (ST) and

power-training (PT) regimens successfully induced tran-

scription of genes related to the mTOR pathway. None-

theless, the array of pathways modulated by mechanical

stimuli is largely unknown in humans, and the identifica-

tion and characterization of such pathways are important to

provide a better understanding of the molecular mecha-

nisms related to the specific outcomes of different resis-

tance-training regimens. In this context, the wingless-type

MMTV integration site family (WNT) has recently been

shown to be involved in adaptations to mechanical over-

load. For instance, this pathway was activated during

skeletal muscle hypertrophy induced by an ablation pro-

tocol, which overloaded the plantaris muscle in mice

(Armstrong and Esser 2005).

Canonical WNT signaling is transduced through Friz-

zled receptors and the LRP5/LRP6 co-receptor to the

b-catenin cascade (Bhanot et al. 1996; Pinson et al. 2000).

b-catenin is a multifunctional protein that can act as a

co-factor modulating transcription in the nucleus (Logan and

Nusse 2004; Novak and Dedhar 1999; Shapiro 1997). In

the absence of WNT signaling, b-catenin is phosphorylated

and rapidly targeted for proteosomal degradation (Li et al.

1999; Amit et al. 2002; Gao et al. 2002); however, in the

presence of canonical WNT signaling, Disheveled (DVL)

is phosphorylated, leading to the inhibition of glycogen

synthase kinase 3b (GSK3 b) and the disintegration of the

multiprotein complex that includes GSK3 b, axin, ade-

nomatous polyposis coli (APC) and casein kinase 1 (CK1).

The latter event inhibits the degradation of b-catenin,

allowing its cytoplasmic accumulation and subsequent

nuclear translocation. Once in the nucleus b-catenin forms

a complex with transcription factors of the T-cell specific

transcription factor/lymphoid enhancer-binding factor

(TCF/LEF) family and thereby induces transcription of

WNT target genes, such as c-Myc and Cyclin D1 (Logan

and Nusse 2004; Shtutman et al. 1999). Although c-Myc

and Cyclin D1 are thought to function as cell cycle regu-

lators, recent evidence suggests that these proteins can also

regulate cell size (Hesketh and Whitelaw 1992; Montagne

2000; Piedra et al. 2002).

In a study by Armstrong and Esser (2005), it was

observed that key components of the WNT pathway were

up-regulated in overloaded plantaris muscles, i.e., the

ligand receptor frizzled 1, DVL1, b-catenin, LEF1 and the

target gene Cyclin D1. In addition, Steelman et al. (2006)

showed modulation of specific WNT-related genes in

myostatin knockout mice. Since it is well known that such

animals exhibit marked muscle growth, this study also

supports the hypothesis that WNT pathway activation may

be associated with skeletal muscle hypertrophy (Steelman

et al. 2006).

Meanwhile, other studies have shown that endogenous

inhibitors such as b-catenin-interacting protein (ICAT)

(Tago et al. 2000) and secreted frizzled-related proteins

(SFRP) (Kawano and Kypta 2003) may reduce activity in

the WNT pathway. Therefore, a better understanding of

WNT signaling requires a proper investigation of its

endogenous inhibitors, since these may blunt the muscle

hypertrophy response.

Although some data are available on WNT modulation in

animal models, it is still unclear whether WNT pathway

components are regulated following different resistance-

training regimens in humans. In addition, it has not been

established whether ST and PT regimens can differentially

modulate WNT genes in humans. Since different resistance-

training regimens may promote specific adaptations, we

hypothesized that gene and protein expression related to

WNT signaling might be differentially modulated by the ST

and PT regimens. Therefore, we decided to investigate the

effects of different resistance-training regimens (ST or PT for

8 weeks) on the gene and protein expression of the canonical

WNT pathway components in physically active men.

Methods

Experimental design

This study featured a 3 9 2 repeated measures design, with

the groups strength training (ST), power training (PT) and

control (C), and time (pre- and post-test) as factors. Sub-

jects performed, both in the pre- and post-tests, a 1 repe-

tition maximum (RM) squat exercise, after which a muscle

biopsy was taken. Figure 1 gives a pictorial view of the

study design. This study was conducted according to the

Declaration of Helsinki and was approved by the research

ethics committee from the Institute of Biomedical Sci-

ences, University of Sao Paulo, Brazil. Participants were

informed about the procedures and risks before giving

written consent.

Subjects

For structural/functional analysis and gene expression

determination, twenty physically active male subjects with at

least 2 years of experience in strength training were assigned

to either an ST group (n = 10) (height 177.6 ± 4.1 cm,

body mass 74.4 ± 7.6 kg, and age 22.3 ± 3.6 years), or a

PT group (n = 10) (178.1 ± 6.5 cm, 76.4 ± 9.1 kg, and

24.7 ± 4.3 years). It was a requirement that they had not

participated in any strength-training program in the last

6 months before joining the present study. Subjects in

training groups were classified in quartiles according to their

relative strength in the squat exercise (1RM/body mass).

2536 Eur J Appl Physiol (2011) 111:2535–2545

123

Then, subjects from each quartile were randomly assigned to

groups to ensure similar initial conditions between groups.

An independent t test revealed no differences in initial rel-

ative strength values between trained groups (P [ 0.05, data

not shown). The C group (n = 5) (176.3 ± 3.4 cm,

77.4 ± 7.2 kg, and 27.1 ± 4.3 years) was composed of

healthy sedentary males. For Western blot analysis, we

evaluated 10 subjects either in ST group (n = 5) or PT group

(n = 5).

One repetition maximum test and power production

during the high velocity squat

The 1 repetition maximum (1RM) and the high velocity

squat (HVS) were performed on a Smith machine (Naka-

gym�, Sao Paulo, Brazil). Body position and foot place-

ment were determined with measuring tapes fixed on both

the bar and on the ground. In addition, an adjustable-height

wooden seat was placed behind the subjects to keep the bar

displacement and knee flexion angle constant on each squat

repetition. Subjects’ settings on the Smith machine were

recorded to guarantee the same positioning across testing

sessions. The 1RM squat test was performed according to

standard procedures described by Brown and Weir (2001).

Subjects ran for 5 min on a treadmill at 9 km.h-1, followed

by lower limb light stretching exercises and two light squat

warm-up sets. Individuals performed five repetitions with

50% of the estimated 1RM in the first set, followed by a set

of three repetitions with 70% of the estimated 1RM. A

3 min interval was allowed between sets. After the second

warm-up set, subjects rested for 3 min. Then, they were

given up to five trials to achieve the 1RM load (e.g.

maximum weight that could be lifted once with the proper

technique), with a 3 min interval between attempts. Max-

imum strength values were normalized for body weight for

further analysis.

To assess lower limb power, the mechanical power

produced during the HVS was determined from changes in

the Smith machine bar position through six repetitions.

Before the actual assessment, subjects underwent two

familiarization sessions in which they were considered

acquitted with the test if intra- and inter-day variation was

lower than 3%. Vertical displacement of the bar was col-

lected at a frequency of 50 Hz and a finite differentiation

technique was used to estimate bar velocity and accelera-

tion. Next, bar force and power were calculated using

standard procedures (Bosco et al. 1995). Subjects per-

formed two sets of six repetitions with 26.5 kg as warm-up

with a 1 min rest interval. Then they executed two addi-

tional sets of six repetitions at 50% of the squat 1RM, as

fast as possible, with a 3 min rest interval. The highest

relative mean concentric power obtained in a single repe-

tition of the HVS was considered for data analysis.

Training regimens

The ST group trained with intensities between 10RM and

4RM, while the PT group trained with intensities varying

from 30 to 60% of 1RM. Both groups were instructed to

perform each repetition as fast as possible, and trained with

a similar number of sets per week. However, training

intensities and external movement velocity were different

between them. Training intensities progressed through the

8-week period following a periodized model and were

about 40% higher in the ST group compared with the PT

group (Table 1). Load adjustments were performed every

4 weeks for both the ST and PT groups. The ST exercise

load was based on the maximum load that could be sup-

ported to complete the desired number of repetitions, while

the PT exercise load was based on a percentage of the squat

1RM. The differences in the method for determining the

training load between groups were due to two factors:

(a) the maximum number of repetitions performed at a

specific percentage of the 1RM load (e.g., 70% of the

1RM) has a very high variability between individuals.

Therefore, determining the maximum weight to perform a

Fig. 1 Time line of the study design

Eur J Appl Physiol (2011) 111:2535–2545 2537

123

specific number of repetitions increases the precision of the

ST training load; and (b) maximum power is usually gen-

erated with exercise loads between 30 and 60% of the squat

1RM for physically active individuals.

Muscle biopsy sampling

Unilateral pre- and post-test muscle samples were taken

from the midportion of the vastus lateralis muscle of the

right leg using the percutaneous biopsy technique with

suction. Immediately after the procedure, the muscle

sample was removed from the needle and frozen in liquid

nitrogen. The pre-test biopsy was done 48 h after the squat

1RM pre-test and 4 days before the start of the training

period. The post-test biopsy was taken through an incision

adjacent to the pre-test site 48 h after the last training

session. It should be mentioned that the muscle samples

from PT and ST groups in the pre- and post-test conditions

were also used as a source of tissue in a previous study

(Lamas et al. 2010).

Measurement of fiber cross-sectional area

Images of fiber sections were captured on a computer with

the imaging software MetaMorph version 6.1 (Universal

Imaging Corp.�, USA). The cross-sectional area of all

muscle fibers was determined using computerized pla-

nimetry, in the 4.3 pH image (Image PRO Plus�, Media

Cybernetics�, USA). A range of 100–261 and 109–306

fibers were assessed per subject in the pre- and post-test

muscle samples, respectively.

Reverse transcription

Total cellular RNA was isolated from pre- and post-test

muscle samples using the TRIzol reagent (Invitrogen�,

Carlsbad, CA, USA). Total RNA (1 lg) was typically used

in a reaction containing oligo DT (0.5 lg/ll), 10 mM of

each dNTP, 5 9 first-strand buffer, 0.1 M dithiothreitol

and 200 U reverse transcriptase (SuperScript II, Invitro-

gen�, Carlsbad, CA, USA). Reverse transcription was

performed at 70�C for 10 min followed by 42�C for 60 min

and 95�C for 10 min.

Primer design

Primer sets were designed using Primer Express Software

(Applied Biosystems�, Foster City, CA, USA). The

sequences of primers for each gene are shown in Table 2.

Real-time polymerase chain reaction (PCR)

All samples were analyzed in duplicate, and the emitted

fluorescence was quantified with an ABI Prism 7300

sequence detector (Applied Biosystems�, Foster City, CA,

USA) based on current methodology (Bustin 2002).

Table 1 Training regimens for strength-training and power-training groups

Monday Wednesday Friday

Training protocol—strength training group

Week 1 4 9 10 4 9 10 4 9 10

Week 2 2 9 10; 3 9 8 3 9 8; 2 9 6 2 9 10; 3 9 8

Week 3 3 9 8; 3 9 6 3 9 8; 3 9 6 3 9 8; 3 9 6

Week 4 2 9 10; 2 9 8; 2 9 6 2 9 10; 2 9 8; 2 9 6 2 9 10; 2 9 8; 2 9 6

Week 5 1 9 8; 3 9 6; 3 9 4 3 9 6; 4 9 4 4 9 6; 3 9 4

Week 6 3 9 6; 3 9 4 4 9 6; 4 9 4 4 9 6; 4 9 4

Week 7 3 9 6; 3 9 4 3 9 6; 3 9 4 3 9 6; 3 9 4

Week 8 2 9 6; 2 9 4 2 9 6; 2 9 4 2 9 6; 2 9 4

Training protocol—power training group

Week 1 4 9 8 (30%) 4 9 8 (30%) 4 9 8 (30%)

Week 2 2 9 8 (30%); 3 9 8 (40%) 3 9 8 (40%); 2 9 6 (50%) 2 9 8 (30%); 3 9 8 (40%)

Week 3 3 9 8 (40%); 3 9 6 (50%) 3 9 8 (40%); 3 9 6 (50%) 3 9 8 (40%); 3 9 6 (50%)

Week 4 2 9 8 (30%); 2 9 8 (40%); 2 9 6 (50%) 2 9 8 (30%); 2 9 8 (40%); 2 9 6 (50%) 2 9 8 (30%); 2 9 8 (40%); 2 9 6 (50%)

Week 5 2 9 8 (30%); 3 9 8 (40%); 2 9 6 (50%) 3 9 8 (40%); 4 9 6 (60%) 3 9 8 (30%); 2 9 6 (50%); 2 9 6 (60%)

Week 6 3 9 8 (30%); 3 9 6 (60%) 4 9 8 (40%); 4 9 6 (50%) 4 9 8 (30%); 4 9 6 (60%)

Week 7 3 9 8 (40%); 3 9 6 (60%) 2 9 8 (40%); 4 9 6 (60%) 2 9 8 (40%); 4 9 6 (60%)

Week 8 2 9 8 (40%); 2 9 6 (50%) 2 9 8 (40%); 2 9 6 (50%) 2 9 8 (40%); 2 9 6 (50%)

2 9 10 number 2 represents the number of sets, while number 10 describes the number of repetitions. Percentage within parentheses indicates the

training load (1RM %)

2538 Eur J Appl Physiol (2011) 111:2535–2545

123

Analyses of amplification plots were performed using

Applied Biosystems sequence detection software, and the

results were expressed using the comparative cycle

threshold (CT) method described in the manufacturer’s user

bulletin no. 2 (Applied Biosystems�, Foster City, CA,

USA).

The CT represents the PCR cycle at which an increase in

reporter gene fluorescence above a baseline signal can first

be detected. The DCT values were calculated for every

sample for each gene of interest as follows: (CT Target-CT

Endogenous control). Ribosomal protein large P0 (RPLP0) was

used as the endogenous control gene. This gene has been

previously used as an endogenous control in exercising

humans (Sorensen et al. 2009; Leger et al. 2006) and we

have consistently found that its expression does not vary

after either ST or PT regimens (CT means ± SD for pre-

and post-test conditions were 20.15 ± 1.02 and

20.19 ± 0.74 respectively, data not shown).

The relative changes in the expression levels of each

specific gene were calculated by subtracting the DCT of the

pre-test condition (used as the calibrator) from the corre-

sponding DCTs of the two experimental groups. The values

and ranges given were determined as follows: 2�DDCT with

DDCT ± SD = (CT Target-CT Endogenous control)Post-test-

(CT Target-CT Endogenous control)Pre-test, with the SD being the

standard deviation of the mean DDCT value (user bulletin

no. 2, Applied Biosystems�, Foster City, CA, USA).

Expression values are shown as mean plus standard devi-

ation of fold differences relative to the pre-test condition,

which was arbitrarily set to 1.

Protein expression

Total protein from vastus lateralis muscle was obtained

using 30 mg of tissue to 1 ml of digestion buffer (KCl

90 mM, Hepes 10 mM, MgCl2? 3 mM, EDTA 5 mM,

glycerol 1%, DTT 1 mM, SDS 0.04%). Protein concentra-

tion was determined by the Bradford method. Twenty lg of

total protein was subjected to electrophoresis in 5% stacking

and 15% resolving polyacrylamide-SDS gels, and the sep-

arated proteins were transferred to a nitrocellulose mem-

brane (Bio-Rad Laboratories�, Hercules, CA, USA). The

membrane was stained with Ponceau solution to demon-

strate that the protein concentration was similar among

lanes. The membrane was then washed with TBST (Tris

50 mM, NaCl 150 mM, pH 7.5 and Tween-20, 2%) for

10 min at room temperature, after which it was incubated

overnight at 4�C with rabbit polyclonal antibodies against

b-catenin (SC-7,199, 1:700; Santa Cruz Biotechnology

Inc.�, CA, USA) in TBST. After washing, the membrane

was incubated with a secondary anti-rabbit IgG conjugated

with peroxidase (Jackson Immuno Research Laboratories�,

PA, USA; 1:10,000 dilution in TBST) for 1 h at room

temperature. Following further washing with TBST the

membrane was incubated with ECL detection reagent

(Amersham Biosciences�, Little Chalfont, Buckinghamshire,

UK), which produced a chemiluminescent signal that was

detected by exposure to X-ray film. The protein bands were

quantified by densitometry and expressed as percentages.

Statistical analysis

A standard descriptive statistical analysis (average and

standard deviation) was followed by the Shapiro–Wilk and

Levene tests to confirm data normality and variance

homogeneity, respectively. A mixed model was produced

for each dependent variable, with groups and time as fixed

factors, and subjects as a random factor (Ugrinowitsch

et al. 2004) to test for differences in mRNA and b-catenin

protein expression. Whenever a significant F value was

Table 2 Primer sequences used for real-time PCR

Genes Forward (50-30) Reverse (50-30)

WNT1 CAACCGAGGCTGTCGAGAAA AGGATTCGATGGAACCTTCTGA

Frizzled 1 CCTCCACGGTCACCTTCAAC TTTGGCATTGGTTATCTCACTCA

SFRP1 ACGGTGTGTCCTCCCTGTGA GCAAACTCGCTGGCACAGA

DVL1 CACACGGTCAACAAGATCACCTT GGCGAGATTGCTGCAGAGAT

b-catenin AGCTGATTTGATGGAGTTGGACAT GTAAGACTGTTGCTGCCAGTGACTA

ICAT AGCACCTGTTTGCCTGAAGT CTGGCTGTCAGGTTTGATCC

LEF1 TCCAGCTCCTGATATCCCTACTTT CTGACCTTGCCAGCCAAGAG

c-Myc ACTTACAACACCCGAGCAAG CGAGTCGTAGTCGAGGTCAT

Cyclin D1 TCGTGGCCTCTAAGATGAAGGA AGGTTCCACTTGAGCTTGTTCAC

RPLP0 CGACCTGGAAGTCCAACTAC ATCTGCTGCATCTGCTTG

Genbank Accession codes for WNT1, frizzled 1, SFRP1, DVL1, b-catenin, ICAT, LEF1, c-Myc, Cyclin D1 and RPLP0 genes are NM_005430,

NM_003505, NM_003012, NM_182779, NM_001904, NM_020248, NM_016269, NM_002467, NM_053056 (RPLP0 NM_001002 transcript

variant 1, NM_053275 transcript variant 2), respectively

Eur J Appl Physiol (2011) 111:2535–2545 2539

123

obtained, a post-hoc test with a Tukey adjustment was

performed for multiple comparison purposes. The signifi-

cance level was set at P \ 0.05.

Results

Relative strength, relative concentric power, and fiber

cross-sectional area after ST and PT regimens

Progressive resistance training resulted in significant

increases in relative strength and relative mean concentric

power from the pre- to the post-test condition (P \ 0.001,

main time effect) in both trained groups (ST, 24 and 7%;

PT, 14 and 11%, respectively). However, there were no

significant differences between trained groups in the

post-test condition, for both relative strength and mean

concentric power (P [ 0.05; Fig. 2a, b). Muscle fiber

cross-sectional area also increased significantly in both

trained groups in the post-test (P \ 0.05) as compared to

the pre-test condition (Fig. 2c), although with no signif-

icant differences between groups in the last assessment

(P \ 0.05).

Gene expression after ST and PT regimens

Several genes encoding proteins involved in the canonical

WNT-signaling pathway were analyzed. Figures 3, 4 and 5

show the fold changes in mRNA levels of the selected

WNT pathway-related genes, normalized for RPLP0 and

relative to pre-test levels for the ST, PT, and C groups.

Firstly, we highlight gene expression profiles related to

ligand-receptor coupling and endogenous inhibition of

WNT receptor binding. The results showed that, in the

trained groups, mRNA levels for the ligand WNT1

increased 6.4-fold (P \ 0.0001) in the ST group and 24.9-

fold (P \ 0.0001) in the PT group (Fig. 3a). Although

mRNA levels for the frizzled 1 receptor were not signifi-

cantly different from pre- to post-test in both ST and PT

groups (i.e., interaction effect; P [ 0.05), a main time

effect was observed (P \ 0.01, Fig. 3b). Meanwhile,

mRNA levels for the WNT ligand pathway inhibitor

SFRP1 increased 3.3-fold (P \ 0.0001) in the ST group

and 2.7-fold (P \ 0.0001) in the PT group (Fig. 3c). In the

control group, expression levels of these genes were not

significantly altered (Fig. 3a, b and c).

Subsequently, we analyzed downstream genes of the

WNT pathway (b-catenin, LEF1 and Cyclin D1). Although

b-catenin mRNA levels were not significantly different

from the pre-test condition in both ST and PT groups, a

main time effect was observed (P \ 0.001, Fig. 4a). The

mRNA levels of the transcription factor LEF1 increased

7.3-fold (P \ 0.0001) in the ST group and 34.1-fold

(P \ 0.0001) in the PT group (Fig. 4b). Interestingly, only

PT induced an increase (7.7-fold; P \ 0.001) in Cyclin D1

gene expression (Fig. 4c). In the control group, expression

levels of these genes were not significantly altered (Fig. 4a,

b and c).

Lastly, we grouped together genes whose expression

was not significantly altered by either training regimen.

These included DVL1, ICAT and c-Myc genes (Fig. 5a, b

and c, respectively).

Fig. 2 Relative maximum strength (a), relative concentric power

(b) and fiber cross-sectional area (c) for strength-training (ST,

n = 10, black bars) and power-training (PT, n = 10, gray bars)

groups in the pre- and post-test conditions (mean ± SD). Main time

effect, post-test greater than pre-test *P \ 0.01

2540 Eur J Appl Physiol (2011) 111:2535–2545

123

b-catenin protein expression

After 8 weeks of training, the total protein expression of

b-catenin was quantified in the ST and PT groups. No

significant changes in b-catenin protein expression levels

were observed in the ST group; however, these levels were

significantly increased after training in the PT group

(P \ 0.05, Fig. 6).

Fig. 3 Gene expression in strength training (ST, n = 10, black bars),

power training (PT, n = 10, gray bars) and control (C, n = 5, whitebars) groups pre- and post-8-week training period (mean ± SD). The

genes analyzed are represented on the y axis. These were WNT1 (a),

Frizzled 1 (b) and secreted frizzled-related protein 1 (SFRP1) (c),

respectively. aPost-test greater than pre-test P \ 0.0001. bPost-test

greater than control group at post-test P \ 0.0001. cPower post-test

greater than strength post-test P \ 0.0001. dMain time effect, post-

test greater than pre-test P \ 0.01

Fig. 4 Gene expression in strength training (ST, n = 10, black bars),power training (PT, n = 10, gray bars) and control (C, n = 5, white bars)

groups pre- and post-8-week training period (mean ± SD). The genes

analyzed are represented on the y axis. These were b-catenin (a), LEF1

(b) and Cyclin D1 (c), respectively. aPost-test greater than pre-test

P \ 0.0001. bPost-test greater than control group at post-test P \ 0.0001.cPower post-test greater than strength post-test P \ 0.0001. dMain time

effect, post-test greater than pre-test P \ 0.001. ePost-test greater than

pre-test P \ 0.001. fPost-test greater than control group at post-test

P \ 0.01. gPower post-test greater than strength post-test P \ 0.001

Eur J Appl Physiol (2011) 111:2535–2545 2541

123

Discussion

The main finding of the present study was that key genes

related to the canonical WNT pathway were up-regulated

after 8 weeks of ST and PT regimens. In addition, it should

be highlighted that the PT regimen was a much more potent

stimulus to elevate the expression of WNT pathway genes

and b-catenin protein levels, compared to the ST regimen.

These results corroborate our initial hypothesis that distinct

resistance-training regimens preferentially modulate gene

and protein expression of WNT pathway components.

We employed these different training regimens with the

aim of determining their effect on the gene expression

profile of the WNT pathway, which has been recently

associated with a hypertrophic response in skeletal muscle

in animal models. The WNT-signaling pathway was ini-

tially associated with colon cancer and embryonic devel-

opment (Moon et al. 1997; Peifer and Polakis 2000) and it

has been extensively demonstrated that abnormal activa-

tion of this pathway can lead to the development of

numerous types of tumors, including colorectal cancer

(Morin et al. 1997). In addition, canonical WNT target

genes such as c-Myc and Cyclin D1 have been associated

with activation of the cell cycle (Hesketh and Whitelaw

1992; Montagne 2000; Piedra et al. 2002). These genes

were also identified as potential modulators of cardiac

hypertrophy; for example, in the heart, c-Myc expression

has been found to increase quickly (*3 h) after a hyper-

trophic stimulus imposed by pressure overload (Izumo

et al. 1988). Similarly, another study, which also used the

cardiac pressure overload model, showed that knock down

of Cyclin D2 expression attenuates the hypertrophic

response (Angelis et al. 2008). Thus, it is now clear that

these WNT target genes are strongly modulated in the

cardiac hypertrophic model. Nevertheless, the role of WNT

signaling in skeletal muscle is still unclear, especially in

humans. In fact, to the best of our knowledge, this is the

first study to describe the effects of resistance-training

programs on the WNT pathway in humans.

Fig. 5 Gene expression in strength training (ST, n = 10, black bars),

power training (PT, n = 10, gray bars) and control (C, n = 5, whitebars) groups pre- and post-8-week training period (mean ± SD). The

genes analyzed are represented on the y axis. These were DVL1 (a),

ICAT (b) and c-Myc (c), respectively. There were no differences

between training conditions and regimens

Fig. 6 Effects of strength training (ST, n = 5, black bars) and power

training (PT, n = 5, gray bars) on total b-catenin protein expression

after an 8-week training period. A representative Western blot is

shown and bars represent the means ± SD of densitometric analysis

of b-catenin/alpha-actinin ratio in pre- and post-test conditions

expressed as arbitrary units. Power post-test greater than power pre-

test; *P \ 0.05. Power post-test greater than strength post-test;�P \ 0.05

2542 Eur J Appl Physiol (2011) 111:2535–2545

123

In the present study, we detected a more marked acti-

vation of WNT gene expression by the PT regimen when

compared to the ST regimen, which is likely to have

resulted from their distinct mechanical characteristics. For

instance, PT is performed using light loads and high

movement velocities, while the ST regimen involves using

high loads, which consequently lead to a greater time under

tension and lower movement velocity. Although it is well

accepted that these differences would eventually lead to

specific outcomes, we did not observe differences between

groups in performance indices (i.e., strength and power)

and muscle fiber cross-sectional area in the post-test con-

dition. Furthermore, resistance-training guidelines suggest

that heavy resistance training, as in our ST regimen, would

produce greater muscle fiber hypertrophy and molecular/

cellular modulation than the PT regimen (Fry 2004; Rata-

mess et al. 2009). On the other hand, emerging data indi-

cate that divergent resistance-training approaches can elicit

similar anabolic responses (Burd et al. 2010). These

investigators showed that similar changes occur in acute

protein synthesis response, despite large discrepancies in

training regimens.

Several studies reported muscle fiber hypertrophy after a

strength-training protocol (Campos et al. 2002; Lamas

et al. 2010; Staron et al. 1990). However, data regarding

power training are scarce. For example, Malisoux et al.

(2006) reported an average of 25% hypertrophy across fiber

types using an unloaded power training (i.e., plyometrics

only). Moss et al. (1997) also demonstrated that loads

corresponding to the maximum power training intensity

produced hypertrophy gains of 2.8% (P \ 0.001). There-

fore, it appears that muscle hypertrophy occurs even when

exercising with low loads if movement velocity is high.

Indeed, there are a couple of studies showing that high

movement velocities produce greater muscle hypertrophy

than low movement velocity, when the workload is

equalized between them (Farthing and Chilibeck 2003;

Shepstone et al. 2005). In the present study, muscle fiber

hypertrophy response was also similar between groups.

The cross-sectional area of type I, IIa and IIb fibers

increased by 15, 18 and 41%, respectively, for the ST

group, and by 15 and 19% for type IIa and IIb fibers,

respectively, for the PT group. Type I fibers decreased the

cross-sectional area by 5% after the PT, but this effect

seems to be within the normal measurement variation,

taking into consideration the variability of our control

group data. Although a similar muscle fiber hypertrophy

response was observed, it is possible that specific outcomes

of PT and ST regimens could be achieved after the period

of 8 weeks.

Out of nine genes analyzed, the PT regimen produced

greater increments in three key genes of the WNT pathway

as compared to the ST regimen: those encoding the ligand

WNT (*24- vs. *6-fold), the transcriptional factor LEF-1

(*34- vs. *7-fold) and the WNT pathway target gene

Cyclin D1 (*7.7-fold vs. no significant change under the

ST regimen). Accordingly, b-catenin protein levels were

significantly elevated only in the PT group, although

b-catenin mRNA levels were not significantly different

between groups. Such differences between mRNA and

protein expression levels are extensively observed in the

literature in many biological systems and might indicate

the involvement of post-transcriptional mechanisms, such

as increases in translational efficiency obtained by maxi-

mizing recruitment of elongation initiation factors. How-

ever, such differences also may reflect a gap in time

between mRNA levels and protein content. The elevated

level of b-catenin protein along with increased levels of

LEF-1 (its heterodimerization partner) mRNA reinforces

the effective nuclear targeting induced by PT. Furthermore,

activation of the Cyclin D1 (a major target of b-catenin/

LEF heterodimers) gene in the PT group strongly suggests

a specific biological role for the WNT pathway in skeletal

muscle adaptations to the high mechanical overload.

In our study, we also addressed the genes involved in

repression of the WNT pathway, namely, SFRP and ICAT.

SFRP competes with WNT for binding to the frizzled

receptor (Kawano and Kypta 2003), while ICAT interferes

with the b-catenin/TCF interaction and antagonizes WNT

signaling (Tago et al. 2000). Interestingly, while ICAT

gene expression was not affected by training, we observed

a marked increase in SFRP1 gene expression. Although

one might suggest that the increase in SFRP1 gene

expression would not be expected, it should be emphasized

that activation of the WNT pathway might trigger a cellular

negative feedback loop, ensuring that the system will not

be over-stimulated. Indeed, we detected several LEF-

responsive elements along the SFRP1 gene regulatory

region (data not shown), suggesting that the SFRP1 gene

could be a direct target for the LEF transcriptional factor.

The reason, as well as the physiological relevance, for

the greater responsiveness of the WNT pathway to PT over

ST is currently unknown. The total number of repetitions

and range of motion cannot account for such differences

since these parameters were balanced between groups. On

the other hand, it is possible that muscle action velocity

plays a role in the differential effects of ST and PT regi-

mens. For example, it has been shown that high velocity

eccentric muscle actions result in greater hypertrophy

(Farthing and Chilibeck 2003) than low velocity eccentric

muscle actions, probably due to greater protein remodeling

(Shepstone et al. 2005). It should be emphasized that

eccentric actions constitute a potent mechanical stimulus

since they induce muscle damage (Chapman et al. 2008)

and activate mechanical transduction mechanisms (O’Neil

et al. 2009), which can be associated with protein synthesis

Eur J Appl Physiol (2011) 111:2535–2545 2543

123

and muscle hypertrophy (Morgan and Partridge 2003). In

addition, satellite cells are well known to participate in

skeletal muscle repair; therefore, one can speculate that PT,

due to its high velocity/eccentric component, leads to a

more intense recruitment of satellite cell activity. Accord-

ingly, cyclin D1, the expression of which was markedly

increased only in PT, is involved in progression through the

cell cycle from G1 to S (Alao 2007) and could be involved

in higher satellite cell proliferation in PT. Alternatively, it

is possible that cyclin D1 is actually involved in non-

proliferative events leading to muscle fiber hypertrophy. It

is worth recalling that heart hypertrophy can be elicited by

activation of WNT target genes (Angelis et al. 2008; Izumo

et al. 1988), which is associated with an increase in cyclin

D expression (Angelis et al. 2008). Therefore, it is possible

to imagine cyclin D1 not only as a driver of the cell cycle

but also as a cell mass regulator.

Although this study sheds light into new aspects on

WNT pathway regulation by resistance training, we should

acknowledge important intrinsic limitations in the experi-

mental design, which in a certain extent restrict our precise

understanding on WNT pathway regulation by resistance

training. For example, increased number of biopsies would

greatly strengthen our knowledge upon the kinetics of

WNT-related genes after a single bout (i.e., 6, 12, and

24 h) and also the same procedure after the last bout.

Similarly, it would be very interesting to have an additional

biopsy just before the last bout, so it would be possible to

compare the effect of the resistance training, not consid-

ering the effect of the last bout.

Different training regimens would be primarily expected

to promote specific outcomes including maximized

strength gains in ST and increased power output in PT. In a

certain way, our data oppose this assumption since PT and

ST resulted in similar strength and power gains in the

period of 8 weeks. Interestingly, despite the fact that nei-

ther of the training regimens employed is designed to

promote a significant hypertrophic response, both indeed

induced a similar increase in muscle fiber cross-sectional

area. It is not clear at this point why these training regimens

are driving different outcomes in terms of WNT pathway-

related gene/protein expression modulation. Accordingly,

we also do not know the biological relevance of such

cellular alterations. One aspect that might be important is

the fact the subjects used in the present study, although not

engaged in specific strength training in the last 6 months,

are not sedentary, they are in fact physically active. This

might result in an additional period (more than 8 weeks) to

observe functional differences.

In summary, our results clearly demonstrate that resis-

tance-training regimens (ST and PT) activated expression of

components of the WNT-signaling pathway at the gene and

protein levels. Interestingly, the PT regimen induced a much

greater gene expression response and exclusively increased

b-catenin protein expression levels when compared with the

ST regimen, raising the possibility that the former elicits

WNT signaling in a preferential manner. This study provides

insight into the molecular basis of differential training

outcomes of specific regimens. Future studies should investi-

gate the effects of longer periods of different resistance-training

modes on training outcomes and molecular adaptations related

to muscle hypertrophy. In addition, future studies could focus

not only on the gene expression profile but also on measure-

ments of muscle protein expression.

Acknowledgments The authors express their gratitude to Antonio

Garcia Soares for excellent technical assistance. This work was

supported by FAPESP (Fundacao de Amparo a Pesquisa do Estado de

Sao Paulo, Brazil), Grants: 08/58415-3, 07/52288-7, 06/00302-3 and

06/61523-7.

References

Alao JP (2007) The regulation of cyclin D1 degradation: roles in

cancer development and the potential for therapeutic invention.

Mol Cancer 6:24. doi:10.1186/1476-4598-6-24

Amit S, Hatzubai A, Birman Y, Andersen JS, Ben-Shushan E, Mann

M, Ben-Neriah Y, Alkalay I (2002) Axin-mediated cki phos-

phorylation of beta-catenin at ser 45: a molecular switch for the

WNT pathway. Genes Dev 16(9):1066–1076

Angelis E, Garcia A, Chan SS, Schenke-Layland K, Ren S,

Goodfellow SJ, Jordan MC, Roos KP, White RJ, MacLellan

WR (2008) A cyclin D2–Rb pathway regulates cardiac myocyte

size and RNA polymerase iii after biomechanical stress in adult

myocardium. Circ Res 102(10):1222–1229

Armstrong DD, Esser KA (2005) WNT/beta-catenin signaling

activates growth-control genes during overload-induced skeletal

muscle hypertrophy. Am J Physiol 289(4):C853–C859

Bhanot P, Brink M, Samos CH, Hsieh JC, Wang Y, Macke JP,

Andrew D, Nathans J, Nusse R (1996) A new member of the

frizzled family from drosophila functions as a wingless receptor.

Nature 382(6588):225–230

Bosco C, Belli A, Astrua M, Tihanyi J, Pozzo R, Kellis S, Tsarpela O,

Foti C, Manno R, Tranquilli C (1995) A dynamometer for

evaluation of dynamic muscle work. Eur J Appl Physiol

70:379–386

Brown LE, Weir JP (2001) ASEP procedures recommendation I:

accurate assessment of muscular strength and power. JEPonline

4(3):1–21

Burd NA, West DW, Staples AW, Atherton PJ, Baker JM, Moore DR,

Holwerda AM, Parise G, Rennie MJ, Baker SK, Phillips SM

(2010) Low-load high volume resistance exercise stimulates

muscle protein synthesis more than high-load low volume

resistance exercise in young men. PLoS One 5(8):e12033

Bustin SA (2002) Quantification of mRNA using real-time reverse

transcription PCR (RT-PCR): trends and problems. J Mol

Endocrinol 29(1):23–39

Campos GE, Luecke TJ, Wendeln HK, Toma K, Hagerman FC,

Murray TF, Ragg KE, Ratamess NA, Kraemer WJ, Staron RS

(2002) Muscular adaptations in response to three different

resistance-training regimens: specificity of repetition maximum

training zones. Eur J Appl Physiol 88(1–2):50–60

Chapman DW, Newton M, McGuigan M, Nosaka K (2008) Effect of

lengthening contraction velocity on muscle damage of the elbow

flexors. Med Sci Sports Exerc 40(5):926–933

2544 Eur J Appl Physiol (2011) 111:2535–2545

123

Coffey VG, Hawley JA (2007) The molecular bases of training

adaptation. Sports Med 37(9):737–763

Farthing JP, Chilibeck PD (2003) The effects of eccentric and

concentric training at different velocities on muscle hypertrophy.

Eur J Appl Physiol 89(6):578–586

Fry AC (2004) The role of resistance exercise intensity on muscle

fibre adaptations. Sports Med 34(10):663–679

Gao ZH, Seeling JM, Hill V, Yochum A, Virshup DM (2002) Casein

kinase I phosphorylates and destabilizes the beta-catenin degra-

dation complex. PNAS USA 99(3):1182–1187

Glass DJ (2003) Molecular mechanisms modulating muscle mass.

Trends Mol Med 9(8):344–350

Glass DJ (2005) Skeletal muscle hypertrophy and atrophy signaling

pathways. Intl J Biochem Cell Biol 37(10):1974–1984

Hesketh JE, Whitelaw PF (1992) The role of cellular oncogenes in

myogenesis and muscle cell hypertrophy. Intl J Biochem

24(2):193–203

Izumo S, Nadal-Ginard B, Mahdavi V (1988) Protooncogene

induction and reprogramming of cardiac gene expression

produced by pressure overload. PNAS USA 85(2):339–343

Kawano Y, Kypta R (2003) Secreted antagonists of the WNT

signalling pathway. J Cell Sci 116(Pt 13):2627–2634

Lamas L, Aoki MS, Ugrinowitsch C, Campos GE, Regazzini M,

Moriscot AS, Tricoli V (2010) Expression of genes related to

muscle plasticity after strength and power training regimens.

Scand J Med Sci Sports 20(2):216–225

Leger B, Cartoni R, Praz M, Lamon S, Deriaz O, Crettenand A,

Gobelet C, Rohmer P, Konzelmann M, Luthi F, Russell AP

(2006) Akt signalling through GSK-3Beta, mTOR and FOXO1

is involved in human skeletal muscle hypertrophy and atrophy.

J Physiol 576(Pt 3):923–933

Li L, Yuan H, Weaver CD, Mao J, Farr GH 3rd, Sussman DJ, Jonkers

J, Kimelman D, Wu D (1999) Axin and FRAT-1 interact with

DVL and GSK, bridging DVL to GSK in WNT-mediated

regulation of LEF-1. EMBO J 18(15):4233–4240

Logan CY, Nusse R (2004) The WNT signaling pathway in

development and disease. Ann Rev Cell Dev Biol 20:781–810

Malisoux L, Francaux M, Nielens H, Theisen D (2006) Stretch-

shortening cycle exercises: an effective training paradigm to

enhance power output of human single muscle fibers. J Appl

Physiol 100(3):771–779

Montagne J (2000) Genetic and molecular mechanisms of cell size

control. Mol Cell Biol Res Commun 4(4):195–202

Moon RT, Brown JD, Torres M (1997) WNTs modulate cell fate and

behavior during vertebrate development. Trends Genet 13(4):

157–162

Morgan JE, Partridge TA (2003) Muscle satellite cells. Intl J Biochem

Cell Biol 35(8):1151–1156

Morin PJ, Sparks AB, Korinek V, Barker N, Clevers H, Vogelstein B,

Kinzler KW (1997) Activation of Beta-catenin-TCF signaling in

colon cancer by mutations in Beta-catenin or APC. Science

(New York, NY) 275(5307):1787–1790

Moss BM, Refsnes PE, Abildgaard A, Nicolaysen K, Jensen J (1997)

Effects of maximal effort strength training with different loads on

dynamic strength, cross-sectional area, load-power and load-velocity

relationships. Eur J Appl Physiol Occup Physiol 75(3):193–199

Novak A, Dedhar S (1999) Signaling through Beta-catenin and LEF/

TCF. Cell Mol Life Sci 56(5–6):523–537

O’Neil TK, Duffy LR, Frey JW, Hornberger TA (2009) The role of

phosphoinositide 3-kinase and phosphatidic acid in the regula-

tion of mammalian target of rapamycin following eccentric

contractions. J Physiol 587(Pt 14):3691–3701. doi:10.1113/

jphysiol.2009.173609

Peifer M, Polakis P (2000) WNT signaling in oncogenesis and

embryogenesis–a look outside the nucleus. Science (New York,

NY) 287(5458):1606–1609

Piedra ME, Delgado MD, Ros MA, Leon J (2002) C-myc overex-

pression increases cell size and impairs cartilage differentiation

during chick limb development. Cell Growth Differ 13(4):

185–193

Pinson KI, Brennan J, Monkley S, Avery BJ, Skarnes WC (2000) An

LDL-receptor-related protein mediates WNTsignalling in mice.

Nature 407(6803):535–538

Ratamess NA, Alvar BA, Evetoch TK, Housh TJ, Kibler WB,

Kraemer WJ, Triplett NT (2009) American college of sports

medicine position stand. Progression models in resistance

training for healthy adults. Med Sci Sports Exerc 41(3):687–708

Shapiro L (1997) The multi-talented Beta-catenin makes its first

appearance. Structure 5(10):1265–1268

Shepstone TN, Tang JE, Dallaire S, Schuenke MD, Staron RS,

Phillips SM (2005) Short-term high- vs. low-velocity isokinetic

lengthening training results in greater hypertrophy of the elbow

flexors in young men. J Appl Physiol 98(5):1768–1776

Shtutman M, Zhurinsky J, Simcha I, Albanese C, D’Amico M, Pestell

R, Ben-Ze’ev A (1999) The cyclin D1 gene is a target of the

Beta-catenin/LEF-1 pathway. PNAS USA 96(10):5522–5527

Sorensen B, Jones JF, Vernon SD, Rajeevan MS (2009) Transcrip-

tional control of complement activation in an exercise model of

chronic fatigue syndrome. Mol Med 15(1–2):34–42

Staron RS, Malicky ES, Leonardi MJ, Falkel JE, Hagerman FC,

Dudley GA (1990) Muscle hypertrophy and fast fiber type

conversions in heavy resistance-trained women. Eur J Appl

Physiol Occup Physiol 60(1):71–79

Steelman CA, Recknor JC, Nettleton D, Reecy JM (2006) Transcrip-

tional profiling of myostatin-knockout mice implicates WNT

signaling in postnatal skeletal muscle growth and hypertrophy.

Faseb J 20(3):580–582

Tago K, Nakamura T, Nishita M, Hyodo J, Nagai S, Murata Y,

Adachi S, Ohwada S, Morishita Y, Shibuya H, Akiyama T

(2000) Inhibition of WNT signaling by ICAT, a novel beta-

catenin-interacting protein. Genes Dev 14(14):1741–1749

Toigo M, Boutellier U (2006) New fundamental resistance exercise

determinants of molecular and cellular muscle adaptations. Eur J

Appl Physiol 97(6):643–663

Ugrinowitsch C, Fellingham GW, Ricard MD (2004) Limitations of

ordinary least squares models in analyzing repeated measures

data. Med Sci Sports Exerc 36(12):2144–2148

Welle S, Bhatt K, Pinkert CA, Tawil R, Thornton CA (2007) Muscle

growth after postdevelopmental myostatin gene knockout. Am J

Physiol 292(4):E985–E991

Williams (2004) Myostatin mutation associated with gross muscle

hypertrophy in a child. New Eng J Med 351(10):1030–1031

Eur J Appl Physiol (2011) 111:2535–2545 2545

123