A

AToaC©

K

1

abvian(

MT

0d

Vaccine 25 (2007) 6018–6027

Cross-priming of long lived protective CD8+ T cells againstTrypanosoma cruzi infection: Importance of a

TLR9 agonist and CD4+ T cells

Bruna C.G. de Alencar a,b, Adriano F.S. Araujo a,b, Marcus L.O. Penido c,Ricardo T. Gazzinelli c, Mauricio M. Rodrigues a,b,∗

a Centro Interdisciplinar de Terapia Genica (CINTERGEN), Universidade Federal de Sao Paulo, Escola Paulista de Medicina, Brazilb Departmento de Microbiologia, Imunologia e Parasitologia, Universidade Federal de Sao Paulo, Escola Paulista de Medicina, Brazil

c Departamento de Bioquımica e Imunologia, Instituto de Ciencias Biologicas,Universidade Federal de Minas Gerais e Centro de Pesquisas Rene Rachou, FIOCRUZ, Avenida Augusto de Lima 1715,

Barro Preto, 30190-002 Belo Horizonte, Minas Gerais, Brazil

Received 26 February 2007; received in revised form 9 April 2007; accepted 13 May 2007Available online 4 June 2007

bstract

We recently described that vaccination of mice with a gluthatione S transferase fusion protein representing amino acids 261–500 of themastigote Surface Protein-2 efficiently cross-primed protective CD8+ T cells against a lethal challenge with the human protozoan parasiterypanosoma cruzi. In this study, we initially established that this protective immunity was long lived. Subsequently, we studied the importance

+ +

f TLR9 agonist CpG ODN 1826, TLR4 and CD4 T cells for the generation of these protective CD8 T cells. We found that: (i) the TLR9gonist CpG ODN 1826 improved the efficiency of protective immunity; (ii) TLR4 is not relevant for priming of specific CD8+ T cells; (iii)D4+ T cells are critical for priming of memory/protective CD8+ T cells.2007 Elsevier Ltd. All rights reserved.

lcplcwo

eywords: Vaccination; Trypanosoma cruzi; Amastigotes; CpG ODN

. Introduction

MHC class Ia-restricted CD8+ T cells are important medi-tors of adaptive immune response against infections causedy intracellular microorganisms (reviewed in Ref. [1]). Iniew of the importance of these cells for host survival follow-ng viral, bacterial or parasite challenge, it has become largelyccepted that they should be considered in the design of a

ew generation of vaccines against intracellular pathogensreviewed in Ref. [2]).

∗ Corresponding author at: CINTERGEN, UNIFESP, Escola Paulista deedicina, Rua Mirassol 207, Sao Paulo 04044-010, SP, Brazil.

el.: +55 11 5571 1095; fax: +55 11 5571 1095.E-mail address: mrodrigues@ecb.epm.br (M.M. Rodrigues).

tpia[

tC

264-410X/$ – see front matter © 2007 Elsevier Ltd. All rights reserved.oi:10.1016/j.vaccine.2007.05.022

Infection of humans or mice with the digenetic intracel-ular protozoan parasite Trypanosoma cruzi induces MHClass Ia-restricted CD8+ T cells specific for immunodominantarasite epitopes [3,4]. Since the seminal publication by Tar-eton et al. [5] showing that MHC class I-restricted cells wereritical for acquired immunity against experimental infectionith T. cruzi, a number of reports confirmed the importancef CD8+ T cells for host resistance following challenge withhis parasite ([3,6,7] and reviewed in Refs. [8,9]). The anti-arasitic mechanisms mediated by these cells are multiple,ncluding cytokine secretion, and possibly direct cytotoxicitygainst infected target cells ([3,10,11] and reviewed in Refs.

8,9]).

Vaccination studies against experimental T. cruzi infec-ion extended these observations by providing evidence thatD8+ T cells are particularly relevant for the development of

B.C.G. de Alencar et al. / Vaccin

F2

ppmTiw

nrPwtanotmt

ilCg

2

2

mosdaiPbclCP

2s

sF[bGrTth54Ecrat

wnnptGGt9PtPAEtHpTP

2

ptco(Os(

ig. 1. Schematic representation of the Amastigote Surface Protein-2 (ASP-) of Trypanosoma cruzi and the recombinant proteins used in this study.

rotective immunity in mice immunized with recombinantlasmid DNA, proteins and viruses [12–17]. These experi-ents have given rise to the concept that a long-lived CD8+

-cell mediated immune response might be a key elementn the development of an effective vaccine against infectionith this human protozoan parasite (reviewed in Refs. [8,9]).Following this rationale, we recently described that vacci-

ation with a gluthatione S transferase (GST) fusion proteinepresenting amino acids 261–500 of the Amastigote Surfacerotein-2 (GST-P4–P7, Fig. 1), coupled to alum and admixedith the TLR 9 agonist CpG ODN 1826, provided strong pro-

ective immunity to a highly susceptible mouse strain againstlethal challenge with T. cruzi [15]. This protective immu-ity was mediated by CD8+ T cells as the in vivo depletionf these cells prior to challenge completely reversed protec-ion [15]. The epitope recognized by these CD8+ T cells was

apped to the peptide TEWETGQI (amino acids 320-327 ofhe Amastigote Surface Protein-2).

Based on these observations, this study was designed tonvestigate first whether this protective immunity was long-ived. Subsequently, we assessed whether the TLR9 agonistpG ODN 1826, TLR4 and CD4+ T cells influenced theeneration of these protective CD8+ T cells.

. Materials and methods

.1. Mice and parasites

Female 5- to 8-week-old A/Sn, C3H/HeJ and C3H/HePASice were purchased from University of Sao Paulo. Parasites

f the Y strain of T. cruzi were used in this study [18]. Blood-tream trypomastigotes were obtained from mice infected 7ays earlier. The concentration of parasites was estimatednd adjusted to 1250 ml−1. Each mouse was inoculatedntraperitoneally (i.p.) with 0.2 ml (250 trypomastigotes).arasite development was monitored by counting the num-er of bloodstream trypomastigotes in 5 �l of fresh blood

ollected from the tail vein [19]. Mouse survival was fol-owed daily. This study has been approved by the Ethicalommittee for Animal Care of the Federal University of Saoaulo.

1oAd

e 25 (2007) 6018–6027 6019

.2. Plasmid and recombinant proteins based on theequence of the amastigote surface protein (asp-2) gene

Gluthatione S transferase fusion protein (GST) repre-enting amino acids 261–500 of the ASP-2 (GST-P4–P7,ig. 1) was expressed and purified as described earlier15]. The plasmid pGEX-4T-2-TEWETGQI was generatedy ligating the oligonucleotides containing the forward (5′-ATCCACCGAATGGGAAACCGGCCAGATTGG-3) and

everse (5′-AATTCCAATCTGGCCGGTTTCCCATTCGG-G-3′) sequences representing the epitope TEWETGQI and

he BamHI and EcoRI sites. These oligonucleotides wereeated at 90 ◦C for 5 min and kept at 60 ◦C for moremin. This fragment was ligated into the vetor pGEX-T-2 (GE Amershan) previously treated with BamHI andcoRI enzymes. The presence of the oligonucleotides wasonfirmed by sequencing the recombinant plasmid. Theecombinant protein denominated GST-TEWTGQI (Fig. 1)nd GST were expressed and purified according to the pro-ocols provided by the manufacturer.

The recombinant plasmid denominated pHis6-P4–P7as generated by inserting a DNA fragment representingucleotides 781–1500 of clone 9 gene (GenBank accessionumber: AY 186572) into EcoRI and SalI sites of the plasmidHis [20]. The DNA fragment was generated by PCR usinghe forward oligonucleotide (5′-CCG GAA TTC GAT GTTTG ACT GCT GG-3′) or the reverse oligonucleotide (5′-GG TCT AGA TTA CGT ATT GGA CAG GA-3′) designed

o anneal with nucleotides 781–799 or 1483–1500 of clonegene, respectively. PCR were performed using the enzymeLATINUM Pfx DNA Polymerase (Life Technologies) and

he annealing temperature used was 48 ◦C. The amplifiedCR products were cloned into the pMOSBlue vector (GE-mersham), removed by treatment with restriction enzymescoRI and SalI and ligated into the pHIS vector treated with

hese same enzymes. The recombinant protein denominatedis6-P4–P7 represented amino acids 261–500 of ASP-2. Therotein was expressed and purified as described earlier [15].he purity of recombinant proteins was determined by SDS-AGE and was represented by a single band.

.3. Immunization

Each A/Sn mouse received three i.p. doses of 25 �g ofrotein adsorbed to alum (Alhydrogel “85” Superfos Biosec-or, Vedbaek, Denmark) given at 0, 2 and 4 weeks. Efficientoupling of recombinant GST, GST-P4-P7, GST-TEWTGQIr His6-P4–P7 to alum was obtained by mixing 2.5 �l 2%w/v) Al(OH)3 per �g of recombinant protein for 2 h. CpGDN 1826 (TCCATGACGTTCCTGACGTT) was synthe-

ized with a nuclease-resistant phosphorothioate backboneColey Pharmaceutics, Wellesley, MA). When indicated,

0 �g of CpG ODN 1826 was mixed with alum containingr not the recombinant proteins before i.p. immunization of/Sn mice. Two weeks or 5 months after the last immunizingose mice were challenged with bloodstream trypomastig-

6 / Vaccin

oir

2

ddH1grttR3mog5(paU(

Aao1pwcC

TPog2a6(fiaa17pfsPaa

2

pIiord9

2

bmbwapibs

2

wAsoAuTt

3

hGplmGawtmw

020 B.C.G. de Alencar et al.

tes. Results of parasitemia are representative of two or morendependent experiments. Results of mortality are pooledesults of two or more experiments.

.4. Immunological assays

The ELISPOT assay was performed essentially asescribed earlier [20]. Briefly, the preparation of plates wasone by coating 96-well nitrocellulose plates MultiscreenA (Millipore) with 60 �l/well of sterile PBS containing0 �g/ml of the anti-mouse IFN-� MAb R4-6A2 (Pharmin-en). After overnight incubation at rt, MAb solution wasemoved by sterile aspiration and the plates were washedhree times with plain RPMI medium under sterile condi-ions. Plates were blocked by incubating wells with 100 �lPMI medium containing 10% (v/v) FBS for at least 2 h at7 ◦C. Responder cells were obtained from spleens of A/Snice. Responder cells were ressuspended to a concentration

f 106 viable cells per ml in RPMI medium (Life Technolo-ies) supplemented with 10 mM HEPES, 2 mM l-glutamine,× 10−5 M 2-mercaptoethanol, 1mM sodium pyruvate, 1%

v/v) nonessential amino acids solution, 1% (v/v) vitamin (allurchased from Life Technologies), 100 U/ml of penicillinnd streptomycin (Sigma), 10% (v/v) FBS (Hyclone, Logan,tah), and 30 U/ml of recombinant human Interleukin-2

kindly provided by Hoffman-LaRoche).Antigen presenting cells were prepared by irradiating

/Sn spleen cells for 7 min. These cells were adjusted toconcentration of 4 × 106 viable cells per ml and incubatedr not with the synthetic peptide at a final concentration of0 �M for 30 min at 37 ◦C. One hundred microliters of sus-ensions containing responders or antigen presenting cellsere pipetted to each well. The plates were incubated in static

ondition for 24 h at 37 ◦C in an atmosphere containing 5%O2.

After incubation, the bulk of cultured cells was flicked off.o remove residual cells, plates were washed 3 times withBS and 3 times with PBS-Tween. Each well received 75 �lf biotinylated anti-mouse IFN-� MAb XMG1.2 (Pharmin-en) diluted in PBS-Tween to a final concentration of�g/ml. Plates were incubated overnight at 4 ◦C. Unboundntibodies were removed by washing the plates at least

times with PBS-Tween. Peroxidase-labeled streptavidinKPL) was added at a 1:800 dilution in PBS-Tween in anal volume of 100 �l/well. Plates were incubated for 1–2 ht rt and then washed three to five times with PBS-Tweennd three times with PBS. Plates were developed by adding00 �l/well of peroxidase substrate (50 mM Tris–HCl at pH.5 containing 1 mg/ml of DAB and 1 �l/ml of 30% hydrogeneroxide solution, both from Sigma). After incubation at rt

or 15 min, the reaction was stopped by discarding the sub-trate solution and rinsing the plates under running tap water.lates were dried at rt and spots were counted with the aid ofstereomicroscope (Nikon). Results of the ELISPOT assay

re representative of two or more independent experiments.

wwoim

e 25 (2007) 6018–6027

.5. In vivo depletion of CD4+ T cells

Ascites fluids containing GK1.5 and 53.6.7 mAbs wereroduced in BALB/c nude mice and the concentration of RatgG was estimated as described [21]. At days 2 and 4 beforemmunization GST-P4–P7 mice were treated i.p. with a dosef 1 mg per day of Rat IgG or anti-CD4. This treatment wasepeated before the second immunizing dose. The efficacy ofepletion of CD4+ spleen cells was commonly higher than8%.

.6. Peptide synthesis

The peptide TEWETGQI (AA 320-327) was preparedy standard N�[9-fluorenylmethyloxycarbonyl] on a PSSM8ultispecific peptide synthesizer (Shimadzu, Kyoto, Japan)

y solid-phase synthesis with a scale of 30 �mol. Peptideas purified by HPLC in a Shimadzu system. Peptides were

nalyzed in a C18 Vydac column (10 mm × 250 mm, 5 (marticle diameter). Different peptide batches were obtainedn a range of 80–90% purity. Their identities were confirmedy Q-TOF MicroTM equipped with an electrospray ionizationource (Micromass, UK).

.7. Statistical analysis

The values of peak parasitemia of each individual mouseere log transformed before being compared by one-wayNOVA followed by Tukey HSD tests available at the

ite http://faculty.vassar.edu/lowry/VassarStats.html. Valuesf ELISPOT assay were also compared by the One Waynova followed by Tukey HSD tests. The LogRank test wassed to compare the mouse survival rate after challenge with. cruzi. The differences were considered significant whenhe P value was <0.05.

. Results

In our previous study we showed that immunization ofighly susceptible A/Sn mice with the recombinant proteinST-P4–P7 coupled to alum admixed with CpG ODN 1826rovided a high degree of protective immunity against aethal challenge with T. cruzi. This protective immunity was

ediated by CD8+ T cells specific for the epitope TEWET-QI located within AA 320 and 327 of ASP-2 (Ref. [15]

nd Fig. 1). To determine whether this protective immunityas long-lived, mice vaccinated with GST-P4–P7 coupled

o alum admixed with CpG ODN 1826 were challenged 5onths after the last immunization dose. Following infectionith bloodstream trypomastigotes, a significant reductionas observed in the peak parasitemia in vaccinated mice

hen compared to animals immunized with the adjuvantsnly (Fig. 2A and B, P < 0.01). Most relevant was the fact thatmmunization with GST-P4–P7 dramatically reduced mouse

ortality after challenge. While 100% of the control mice

B.C.G. de Alencar et al. / Vaccin

Fig. 2. Trypomastigote-induced parasitemia and mortality in A/Sn miceimmunized with recombinant protein GST-P4–P7 and challenged 5 monthsafter the last immunizing dose. Groups of 6 mice were immunized asdescribed below. Five months after the last immunizing dose, mice werechallenged i.p. with 250 bloodstream trypomastigotes. The parasitemia foreach individual mouse is represented. (A) Group I: alum admixed with 10 �gof CpG ODN 1826 i.p. at 0, 2 and 4 weeks. (B) Group II: 25 �g of recombi-nant GST-P4–P7 coupled to alum admixed with 10 �g of CpG ODN 1826i.p. at 0, 2 and 4 weeks. A significant reduction in the peak parasitemia of ani-mals from mice immunized with GST-P4–P7 was observed when comparedto control mice (P < 0.01). (C) The graph shows the Kaplan–Meier curvesfor survival of 11–12 mice per group. Mice immunized with GST-P4–P7had a significant improvement in survival (P < 0.0001).

iwiwnw

iTFfOPaoatF

gstFl

1ciFn

otpphCTtnw1Cemi(cp

wsiowa

e 25 (2007) 6018–6027 6021

njected with adjuvant died, 91.66% of the mice immunizedith GST-P4–P7 survived infection (P < 0.01). Protective

mmunity obtained following immunization with GST-P4–P7as specific as mice immunized with several other recombi-ant proteins were not protected against a lethal challengeith T. cruzi (see Ref. [15] and also experiments below).Based on the result described above, subsequent exper-

ments were designed to further understand the role of theLR9 agonist in the generation of this protective immunity.or this purpose, we immunized A/Sn mice according to theollowing protocols: (#I) alum; (#II) alum admixed with CpGDN 1826; (#III) GST-P4–P7 coupled to alum; (#IV) GST-4–P7 coupled to alum admixed with CpG ODN 1826. Afterchallenge with bloodstream trypomastigotes of T. cruzi, webserved a significant reduction in the peak parasitemia ofnimals from mouse groups #III and #IV when comparedo control mice of groups #I and #II (P < 0.05, in all cases,ig. 3A–D).

Mouse mortality was also recorded for the different mouseroups after challenge with T. cruzi. Comparisons of miceurvival indicated that groups #III and #IV survived longerhan controls from groups #I and #II (P < 0.001 in all cases,ig. 3E). Survival of mice from group #IV was significantly

onger than animals from group #III (P < 0.01).We then evaluated whether the presence of CpG ODN

826 improved the priming of these IFN-� secreting cells spe-ific for the epitope TEWETGQI in the spleen of A/Sn micemmunized with GST-P4–P7 adsorbed to alum. As shown inig. 3F, the presence of CpG ODN 1826 indeed increased theumber of peptide-specific IFN-� secreting cells.

The fact that recombinant proteins purified from E. coliften have traces of LPS led us to question whether con-aminant LPS could eventually influence the priming ofeptide-specific IFN-� secreting cells and eventually therotective immunity against T. cruzi infection. To test thisypothesis, we took advantage of the existence of H-2K

3H/HeJ mice. This mouse strain has a mutation in theLR4 open reading frame and does not express a func-

ional receptor. Due to the lack of TLR4, these animals doot respond to LPS. We found that following immunizationith GST-P4–P7 coupled to alum admixed with CpG ODN826, the immune response of the C3H/HeJ (TLR4−/−) or3H/HePAS (TLR4+/+) mice was not significantly differ-nt (Fig. 4A). We also determined that, similarly to A/Snice, the presence of CpG ODN 1826 improved the prim-

ng of peptide-specific IFN-� producing cells in TLR4−/−C3H/HeJ) mice (Fig. 4B). From these experiments we con-luded that TLR4 does not participate in the priming of IFN-�roducing cells specific for the epitope TEWETGQI.

The subsequent question we approached during this workas whether it was possible to elicit protective immunity

olely by immunization with a recombinant protein contain-

ng the CD8 T-cell epitope TEWETGQI in the absence ofther parasite derived amino acid sequences. To this end,e generated a recombinant fusion protein containing GST

nd the epitope TEWETGQI (Fig. 1). This protein denomi-

6022 B.C.G. de Alencar et al. / Vaccine 25 (2007) 6018–6027

Fig. 3. Trypomastigote-induced parasitemia in A/Sn mice immunized withthe recombinant protein GST-P4–P7 coupled to alum in the presence orabsence of CpG ODN 1826. Groups of 6 mice were immunized i.p. at 0, 2and 4 weeks with 25 �g of GST-P4–P7 adsorbed to alum admixed or notwith 10 �g of CpG ODN 1826, or adjuvant alone. Two weeks after the lastdose, mice were challenged i.p. with 250 bloodstream trypomastigotes. Theparasitemia for each individual mouse is represented. (A) Group #I, alum; (B)group #II, alum admixed with CpG ODN 1826; (C) group #III, GST-P4–P7coupled to alum; (D) group #IV, GST-P4–P7 coupled to alum admixed withCpG ODN 1826. The peak parasitemia of animals from mouse groups #Iand #II were higher than mice of groups #III and #IV (P < 0.05, in all cases).(E) The graph shows the Kaplan–Meier curves for survival of 6–13 mice pergroup. Mice immunized with GST-P4–P7 (mouse groups #III and #IV) hada significant improvement in survival when compared to mice immunizedwith adjuvant only (P < 0.001 in all cases). Survival of animals immunizedwith GST-P4–P7 coupled to alum admixed with CpG ODN 1826 (mousegroup #IV) was significantly longer than mice from group #III (P < 0.01). (F)Groups of three mice were immunized i.p. at 0 and 2 weeks with GST-P4–P7or GST. Each mouse received i.p. 25 �g of recombinant protein adsorbedto alum admixed or not with 10 �g of CpG ODN 1826. One week after thelast dose, ELISPOT assay was performed to detect IFN-� producing cellsspecific for TEWETGQI. Results represent the mean of spot forming cells(SFC) ± S.D. of three mice per group. Asterisk denotes significantly fewerSFC (P < 0.01).

Fig. 4. Groups of three C3H/HePAS or C3H/HeJ mice were immunized i.p.at 0 and 2 weeks with GST-P4–P7 or GST. Each mouse received i.p. 25 �gof recombinant protein adsorbed to alum admixed or not with 10 �g of CpGODN 1826. One week after the last dose, ELISPOT assay was performed todmf

nCcsitBcclHd

etect IFN-� producing cells specific for TEWETGQI. Results represent theean of SFC ± S.D. of three mice per group. Asterisk denotes significantly

ewer SFC (P < 0.01).

ated GST-TEWETGQI was coupled to alum, admixed withpG ODN 1826 and used to vaccinate A/Sn mice. After ahallenge with bloodstream trypomastigotes of T. cruzi, noignificant reduction was observed in the peak parasitemian mice vaccinated with GST-TEWETGQI when comparedo control mice immunized with GST (P > 0.05, Fig. 5A and). Mortality in the two mouse groups after challenge with T.ruzi was only slightly different. Statistical comparisons indi-ated that mice immunized with GST-TEWETGQI survived

onger than mice which had received GST only (P = 0.003).owever, 100% of the GST-TEWETGQI immunized miceied following infection (Fig. 5E).

B.C.G. de Alencar et al. / Vaccin

Fig. 5. Trypomastigote-induced parasitemia and mortality in mice immu-nized with GST-TEWETGQI. Groups of 5 mice were immunized asdescribed in the legend of Fig. 2. Two weeks after the last immunizingdose, mice were challenged i.p. with 250 bloodstream trypomastigotes. Theparasitemia for each individual mouse is represented. (A) alum admixedwith CpG ODN 1826; (B) GST-TEWETGQI coupled to alum admixedwith CpG ODN 1826; (C) GST-P4–P7 coupled to alum admixed withCpG ODN 1826; (D) His6-P4–P7 coupled to alum admixed with CpGODN 1826. No significant reduction in the peak parasitemia of mice vac-cinated with GST-TEWETGQI was observed when compared to controlmice immunized with GST (P > 0.05). Peak parasitemia of mice vaccinatedwith GST-P4–P7 or His6-P4–P7 were lower than animals injected with GSTor GST-TEWETGQI (P < 0.01, in all cases). No difference was observedwhen we compared the peak parasitemia of animals vaccinated with GST-P4–P7 or His6-P4–P7 (P > 0.05). (E) The graph shows the Kaplan-Meiercurves for survival of 15 to 16 mice per group. Mice immunized with GST-TEWETGQI survived longer than mice which received GST (=0.003). Thesurvival of mice vaccinated with GST-P4–P7 or His6-P4–P7 was longer thananimals which received GST or GST-TEWETGQI (P < 0.0001, in all cases).The survival curves of mice immunized with His6-P4–P7 or GST-P4–P7were not statistically different (=0.0975). (F) Groups of three mice wereimmunized i.p. at 0 and 2 weeks with GST-P4–P7 or GST-TEWETGQI orGST. Each mouse received i.p. 25 �g of recombinant protein adsorbed toalum admixed with 10 �g of CpG ODN 1826. One week after the last dose,ELISPOT assay was performed to detect IFN-� producing cells specific forTEWETGQI. Results represent the mean of spot forming cells (SFC) ± S.D.of three mice per group.

TpHtdiGnGnpPGwind

GfbtopTtn

amcEiOfLnCssmiGpc[

sCadaasi

e 25 (2007) 6018–6027 6023

The immunogenicity of the recombinant protein GST-EWETGQI was compared to two other recombinantroteins, the conventional GST-P4–P7 and a newly producedis6-P4–P7. This last recombinant protein does not contain

he GST protein, therefore the putative CD4 epitopes areerived from the parasite antigen ASP-2 (Fig. 1). As shownn Fig. 5C and D, following challenge, mice vaccinated withST-P4–P7 or His6-P4–P7 presented a peak parasitemia sig-ificantly lower than that of animals injected with GST orST-TEWETGQI (P < 0.01, in all cases). No statistically sig-ificant difference was observed when comparing the peakarasitemia of animals vaccinated with GST-P4–P7 or His6-4–P7 (P > 0.05). Also the survival of mice vaccinated withST-P4–P7 or His6-P4–P7 was longer than that of animalshich had received GST or GST-TEWETGQI (P < 0.0001,

n all cases, Fig. 5E). The survival curves of mice immu-ized with His6-P4–P7 or GST-P4–P7 were not statisticallyifferent (=0.0975).

Subsequently, we determined whether immunization withST-TEWETGQI could elicit IFN-� secreting cells specific

or the peptide TEWETGQI. To our surprise, similar num-ers of peptide-specific IFN-� secreting cells were detected inhe spleen of A/Sn mice immunized with GST-TEWETGQIr GST-P4–P7 (Fig. 5F). These results indicated that theresence of IFN-� secreting cells specific for the epitopeEWETGQI detected by ELISPOT failed to correlate with

he limited protective immunity observed following immu-ization with the recombinant protein GST-TEWETGQI.

This unexpected finding raised the possibility that thebsence of CD4+ T cell epitopes present in the GST-P4–P7ight not be important in the expansion of IFN-� secreting

ells specific for the epitope TEWETGQI as detected by theLISPOT. Instead, these CD4+ T cells might be important

n the priming of specific memory/protective CD8+ T cells.ur hypothesis was based on recent observations obtained

rom experimental models of infections with influenza virus,isteria monocitogenes or Herpes simplex virus I and immu-ization with synthetic peptides. These studies reported thatD4+ T cells can be critically important in the generation of

pecific memory CD8+ T cells [22–26]. To evaluate this pos-ibility, we used an assay that we had recently developed toeasure the expansion of specific memory cells. This assay

s based on our published observation that immunization withST-P4–P7 coupled to alum admixed with CpG ODN 1826rimed memory peptide-specific IFN-� secreting cells thatan expand vigorously following a challenge with T. cruzi3].

As shown in Fig. 6A (white bars), immunization with aingle dose of GST-P4–P7 coupled to alum admixed withpG ODN 1826 generated an immune response that peakedt one week (185 ± 32.5 SFC per 106 spleen cells) andeclined in the subsequent 2 and 4 weeks (30.83 ± 12.3

nd 20.83 ± 20.21, respectively), as measured by ELISPOTssay. Thirteen days after challenge, the number of peptide-pecific IFN-� secreting cells in these immunized micencreased several times, to 1,150 ± 210, 1,510 ± 282.96 or

6024 B.C.G. de Alencar et al. / Vaccin

Fig. 6. Groups of three mice were immunized i.p. once with GST-P4–P7or GST. Each mouse received i.p. 25 �g of recombinant protein adsorbedto alum admixed with 10 �g of CpG ODN 1826. One, 2 or 4 weeks later,ELISPOT assay was performed to detect IFN-� producing cells specificfor TEWETGQI (open bars). Alternatively, mice were challenged with 250bloodstream trypomastigotes of T. cruzi. Thirteen days later, ELISPOT assaywas performed to detect IFN-� producing cells specific for TEWETGQI(hatched bars). Results represent the mean of SFC ± S.D. of three mice pergroup. Groups of three mice were immunized i.p. twice at 0 and 2 weeks withGST-P4–P7, GST-TEWETGQI or GST. Each mouse received i.p. 25 �g ofrecombinant protein adsorbed to alum admixed with 10 �g of CpG ODN1826. One week later, ELISPOT assay was performed to detect IFN-� pro-ducing cells specific for TEWETGQI (open bars). Alternatively, mice werechallenged with 250 bloodstream trypomastigotes of T. cruzi. Thirteen dayslater, ELISPOT assay was performed to detect IFN-� producing cells spe-cific for TEWETGQI (hatched bars). Treatment with anti-CD4 antibodieswSS

8wsmtcT

Fdn

(ocwTwltfItTtr�rsTosw(

paTAsoatIc

4

vCrti[nTt[stTb

Initially, we determined that protective immunity gen-

as performed as described in Section 2. Results represent the mean ofFC ± S.D. of three mice per group. Asterisks denote significantly fewerFC (P < 0.01).

70 ± 390.74, respectively (hatched bars). This Expansionas dependent on the immunization with GST-P4–P7, as

uch expansion of CD8+ T cells was not found in controlice immunized with GST. Based on these results, we believe

hat this assay reveals the presence of specific memory cellsapable of expanding vigorously following a challenge with. cruzi.

This assay allowed us to ask two related questions.

irstly, we tested whether these memory cells were inducedifferently following the immunization with the recombi-ant proteins GST-P4–P7 (protective) or GST-TEWETGQI

eai

e 25 (2007) 6018–6027

non-protective). Secondly, we asked whether the primingf these memory cells was in fact dependent on CD4+ Tells. To approach the first question, we immunized miceith the recombinant proteins GST-P4–P7 (protective), GST-EWETGQI (non-protective) and GST (control). These miceere either challenged or not with T. cruzi. Thirteen days

ater, we estimated the number of peptide-specific T cells inhe spleen of the different mouse groups. As shown in Fig. 6B,ollowing T. cruzi infection, the number of peptide-specificFN-� producing cells in the spleen of mice immunized withhe recombinant proteins GST-P4–P7 (protective) or GST-EWETGQI (non-protective) expanded significantly more

han in mice immunized with GST (control). However, mostelevant was the fact that the number of peptide-specific IFN-producing cells in the spleen of mice immunized with the

ecombinant protein GST-P4–P7 was 3096 ± 1172, a figureeveral times higher than for mice immunized with GST-EWETGQI (1066.67 ± 676.56). It is important to pointut that mice immunized, but not challenged, presented aimilar number of peptide-specific IFN-� producing cellshether they had received GST-P4–P7 or GST-TEWETGQI

121.33 ± 20.50 and 140 ± 122.17, respectively).To determine the importance of CD4+ T cells during the

riming of memory CD8+ T cells, we treated A/Sn withnti-CD4 antibodies before immunization with GST-P4–P7.hese mice were subsequently challenged or not with T. cruzi.s shown in Fig. 6B, following infection, very few peptide-

pecific IFN-� producing cells were detected in the spleenf the vaccinated mice that had been treated with anti-CD4ntibodies (253.20 ± 192). This figure represents a reduc-ion of more than 10 times in the number of peptide-specificFN-� producing cells when compared to immunized andhallenged mice not treated with anti-CD4 antibodies.

. Discussion

A key question in the development of new or improvedaccines is how to induce protective memory T cells.ross-priming of CD8+ T cells following vaccination with

ecombinant proteins may represent an interesting strategyo achieve this goal. This type of immunization can be usedndependently or in protocols of heterologous prime-boosting27–32]. In the studies performed so far using recombi-ant proteins for cross- priming of protective CD8+ T cells,LR agonists were used as part of these vaccine formula-

ions. Among them, TLR9 agonists are of particular interest27–32]. Based on the relevance of this subject, the aim of ourtudy was to investigate certain aspects that could be impor-ant during the cross-priming of long-lived protective CD8+

cells following immunization with a recombinant proteinased on the T. cruzi antigen ASP-2.

rated by immunization with GST-P4–P7 coupled to alumdmixed with CpG ODN 1826 was long-lived, as detectedn mice vaccinated 5 months earlier (Fig. 2). This fact is

/ Vaccin

ioincp5

tt(i(trfEbvHw�crvC[ts

eappiTiCwa

Omaeantp[mplmrp

abitbmriabf

sihetAtInTGtcc(ocin

itovhooT

ipitpvlc

op

B.C.G. de Alencar et al.

mportant because it provides evidences that long-lived mem-ry CD8+ T cells against this human protozoan parasite canndeed be efficiently primed by immunization with recombi-ant proteins. The longevity of the protective immunity wasomparable to that obtained following immunization with theowerful replication-defective recombinant adenovirus type[17].Our second relevant observation was the fact that pro-

ective immunity could be elicited by vaccination withhe recombinant protein GST-P4–P7 coupled to alum onlyFig. 3). This formulation primed splenic IFN-� produc-ng cells specific for the CD8 T cell epitope TEWETGQIFig. 3F). This result was not completely expected as it con-rasts with a previous study showing that immunization withecombinant Hepatitis B antigen coupled to this adjuvantailed to prime specific CD8+ T cells as detected ex vivo byLISPOT assay [33]. The presence of contaminant LPS coulde a possible explanation for it. LPS could act as an adju-ant to prime these peptide-specific IFN-� producing cells.owever, using C3H/HeJ mice that do not respond to LPS,e were easily able to detect ex vivo peptide-specific IFN-producing cells following immunization with GST-P4–P7

oupled to alum (Fig. 4B). Based on this, we believe that theecombinant protein GST-P4–P7 itself may have some adju-ant property. As mentioned above, cross-priming of specificD8+ T cells using antigen coupled to alum is rarely seen

33], therefore the route of antigen processing and presenta-ion in vivo in our model is completely obscure at present andhould be an interesting topic to be studied in the future.

In spite of the fact that GST-P4–P7 coupled to alum couldlicit some degree of immunity, the presence of the TLR9gonist CpG ODN 1826 significantly improved the anti-arasitic effect of vaccination (Fig. 3). This improvement inrotective immunity correlated with an increase in the prim-ng of splenic IFN-� producing cells specific for the CD8-cell epitope TEWETGQI (Fig. 3E). Together, these resultsndicate that efficient cross-priming of long-lived protectiveD8+ T cells can be better achieved following vaccinationith this recombinant protein in the presence of the TLR9

gonist CpG ODN 1826.Although it has been noticed in different models that CpG

DN 1826 improves cross-priming of CD8+ T cells, the exactechanisms mediated by this adjuvant in vivo are unknown

t present. TLR-9 agonists stimulate a number of differ-nt events in dendritic cells (DC) which may be critical forntigen presentation. In vitro studies showed that a TLR9 ago-ist coupled to a soluble antigen (ovalbumin) improves theranslocation of the complex to endosomal–lysosomal com-artment of DCs, a factor that may aid cross-presentation34]. In addition, activation by TLR9 agonists leads toaturation of these cells that express increased levels of trans-

orter associated protein and MHC class I molecules. Higher

evel of transporter associated protein expression may aug-

ent transport of CD8 T-cell epitopes to the endoplasmiceticulum, facilitating the formation of MHC I-peptide com-lexes presented to specific CD8+ T cells [35]. However,

i1ai

e 25 (2007) 6018–6027 6025

recent study suggests that the main mechanism mediatedy CpG ODN in vitro to improve cross-presentation is thencreased MHC I mRNA and surface protein expressionhrough a novel posttranscriptional mechanism involving sta-ilization of MHC I mRNA [36]. Whether these or otherechanisms operate in vivo to improve cross-presentation

emains to be elucidated. In addition to the mechanisms thatmprove antigen presentation by DCs, it has been shown thatTLR9 agonist can mediate cross-priming of CD8+ T cellsy B cells [37]. The participation of B cells may be an additiveactor to improve cross-priming of CD8+ T cells.

In addition to the direct consequences on the antigen pre-enting cells (DCs and/or B cells) TLR9 agonists may alsoncrease CD8+ T cell cross-priming by improving T cellelp. To investigate the role of parasite-derived CD4 T cellpitopes in the protective immunity generated by vaccina-ion with recombinant proteins based on the sequence of theSP-2 of T. cruzi, we generated a new recombinant pro-

ein containing solely the CD8 T cell epitope TEWETGQI.mmunization with GST-TEWETGQI elicited a comparableumber of splenic IFN-� producing cells specific for the CD8-cell epitope TEWETGQI as did the immunization withST-P4–P7 (Fig. 5D). In spite of that, very limited protec-

ive immunity was observed following a challenge with T.ruzi (Fig. 5B and E). In contrast, two recombinant proteinsontaining parasite-derived putative CD4+ T-cell epitopesGST-P4–P7 or His6-P4–P7) provided a significant degreef protective immunity (Fig. 5C–E). These results impli-ate parasite-derived epitopes other than TEWETGQI in thenduction of protective immunity observed following immu-ization with GST-P4–P7 or His6-P4–P7.

The lack of protective immunity observed followingmmunization with GST-TEWETGQI might be explained byhe absence of effector CD4+ T cells. However, in our previ-us study, we described that depletion of CD4+ T cells in miceaccinated with GST-P4–P7 prior to challenge with T. cruziad no impact on protective immunity. In contrast, depletionf CD8+ T cells completely reversed protection [15]. Basedn this, we consider remote the possibility that effector CD4+

cells might play a predominant role in protective immunity.The lack of protective immunity observed following

mmunization with GST-TEWETGQI correlated with a lowerriming of memory peptide-specific T cells detected follow-ng a parasite challenge (Fig. 6B). This result suggested thathe absence of CD4 T-cell epitopes could be important in theriming of memory/protective CD8+ T cells. By depleting inivo CD4+ T cells, we confirmed that this sub-population ofymphocytes was indeed critical in the priming of memoryells (Fig. 6B).

The importance of CD4+ T cells in the priming of mem-ry CD8+ T cells in our system corroborates several recentlyublished studies. Following mouse primary infection with

nfluenza virus, L. monocitogenes or Herpes simplex virus, memory CD8+ T cells failed to develop properly in thebsence of sufficient CD4+ T cell help [22–25]. Whethermmunization with other recombinant proteins and CpG

6 / Vaccin

OowoTcroivn

tfaaceboisu

A

AMo(sF

R

[

[

[

[

[

[

[

[

[

[

[

[

[

[

026 B.C.G. de Alencar et al.

DN 1826 requires appropriate CD4 help to expand mem-ry/protective CD8+ T cells is unknown at present. Also,hen these CD4+ T cells are important in providing help inur system remains to be investigated. For example, CD4+

cells specific for Herpes simplex virus 1 antigen act byonditioning antigen presenting cells early on in the immuneesponse, therefore providing an early help for proliferationf specific CD8+ T cells [25]. Differently, CD4+ T cellsnduced following L. monocitogenes infection improved sur-ival of memory specific CD8+ T cells, maintaining theirumber and function [37].

To sum up, we studied some aspects we considered impor-ant in the generation of long-lived protective CD8+ T cellsollowing immunization with a recombinant protein of ASP-2ntigen. We concluded that a TLR9 agonist and CD4+ T cellsre important in the development of these memory/protectiveells. It is possible that these studies on the immune responselicited by cross-priming following vaccination with recom-inant proteins of ASP-2 may contribute to the developmentf new strategies for the prevention or treatment of T. cruzinfection. However, due to the complex nature of this para-itic disease, we believe that it is too early to anticipate anyse of this or other strategy in humans.

cknowledgments

This work was supported by grants from Fundacao demparo a Pesquisa do Estado de Sao Paulo, CNPq, Theillennium Institute for Vaccine Development and Technol-

gy (CNPq, 420067/2005-1), and FAPEMIG (EDT 24.000)Brazil). AFSA, RTG and MMR were recipients of fellow-hips from CNPq. BCGA is a recipient of a fellowship fromAPESP.

eferences

[1] Wong P, Pamer EG. CD8 T cell responses to infectious pathogens. AnnuRev Immunol 2003;21:29–70.

[2] Robinson HL, Amara RR. T cell vaccines for microbial infections. NatMed 2005;11:S25–32.

[3] Tzelepis F, de Alencar BC, Penido ML, Gazzinelli RT, Persechini PM,Rodrigues MM. Distinct kinetics of effector CD8+ cytotoxic T cellsafter infection with Trypanosoma cruzi in naive or vaccinated mice.Infect Immun 2006;74:2477–82.

[4] Martin DL, Weatherly DB, Laucella SA, Cabinian MA, Crim MT,Sullivan S, et al. CD8+ T-Cell responses to Trypanosoma cruzi arehighly focused on strain-variant trans-sialidase epitopes. PLoS Pathog2006;2(8):e77.

[5] Tarleton RL, Koller BH, Latour A, Postan M. Susceptibility of beta 2-microglobulin-deficient mice to Trypanosoma cruzi infection. Nature1992;356:338–40.

[6] Rottenberg ME, Bakhiet M, Olsson T, Kristensson K, Mak T, Wigzell

H, et al. Differential susceptibilities of mice genomically deleted ofCD4 and CD8 to infections with Trypanosoma cruzi or Trypanosomabrucei. Infect Immun 1993;61:5129–33.

[7] Tarleton RL, Sun J, Zhang L, Postan M, Glimcher L. Trypanosomacruzi infection in MHC-deficient mice: further evidence for the role of

[

[

e 25 (2007) 6018–6027

both class I- and class II-restricted T cells in immune resistance anddisease. Int Immunol 1996;8:13–22.

[8] Rodrigues MM, Boscardin SB, Vasconcelos JR, Hiyane MI, SalayG, Soares IS. Importance of CD8 T cell-mediated immune responseduring intracellular parasitic infections and its implications for thedevelopment of effective vaccines. Ann Acad Bras Cienc 2003;75:443–68.

[9] Martin D, Tarleton R. Generation, specificity, and function of CD8+ Tcells in Trypanosoma cruzi infection. Immunol Rev 2004;201:304–17.

10] Henriques-Pons A, Oliveira GM, Paiva MM, Correa AF, Batista MM,Bisaggio RC, et al. Evidence for a perforin-mediated mechanism con-trolling cardiac inflammation in Trypanosoma cruzi infection. Int J ExpPathol 2002;83:67–79.

11] Muller U, Sobek V, Balkow S, Holscher C, Mullbacher A, MuseteanuC, et al. Concerted action of perforin and granzymes is critical for theelimination of Trypanosoma cruzi from mouse tissues, but preventionof early host death is in addition dependent on the FasL/Fas pathway.Eur J Immunol 2003;33:70–8.

12] Garg N, Tarleton R. Genetic immunization elicits antigen-specificprotective immune responses and decreases disease severity in Try-panosoma cruzi infection. Infect Immun 2002;70:5547–55.

13] Katae M, Miyahira Y, Takeda K, Matsuda H, Yagita H, Okumura K,et al. Coadministration of an interleukin-12 gene and a Trypanosomacruzi gene improves vaccine efficacy. Infect Immun 2002;70:4833–40.

14] Vasconcelos JR, Hiyane MI, Marinho CRF, Claser C, Vieira-MachadoAM, Gazinelli RT, et al. Protective immunity against Trypanosomacruzi infection in a highly susceptible mouse strain following vac-cination with genes encoding the Amastigote Surface Protein-2 andtrans-sialidase. Hum Gene Ther 2004;15:878–86.

15] Araujo AF, de Alencar BC, Vasconcelos JR, Hiyane MI, Marinho CR,Penido ML, et al. CD8+-T-cell-dependent control of Trypanosoma cruziinfection in a highly susceptible mouse strain after immunization withrecombinant proteins based on amastigote surface protein 2. InfectImmun 2005;73:6017–25.

16] Miyahira Y, Takashima Y, Kobayashi S, Matsumoto Y, Takeuchi T,Ohyanagi-Hara M, et al. Immune responses against a dingle CD8+-T-Cell epitope induced by virus vector vaccination can successfullycontrol Trypanosoma cruzi infection. Infect Immun 2005;73:7356–65.

17] Machado AV, Cardoso JE, Claser C, Rodrigues MM, Gazzinelli RT,Bruna-Romero O. Long-term protective immunity induced againstTrypanosoma cruzi infection after vaccination with recombinant ade-noviruses encoding Amastigote Surface Protein-2 and trans-sialidase.Hum Gene Ther 2006;17:898–908.

18] Silva LHP, Nussenzweig V. Sobre uma cepa de Trypanosoma cruzialtamente virulenta para o camundongo branco. Folia Clin Biol1953;20:191–203.

19] Krettli AU, Brener Z. Protective effects of specific antibodies in Try-panosoma cruzi infections. J Immunol 1976;116:755–60.

20] Boscardin SB, Kinoshita SS, Fujimura AE, Rodrigues MM. Immu-nization with cDNA expressed by amastigotes of Trypanosoma cruzielicits protective immune response against experimental infection.Infect Immun 2003;71:2744–57.

21] Li S, Rodrigues M, Rodriguez D, Rodriguez JR, Esteban M, PaleseP, et al. Priming with recombinant influenza virus followed byadministration of recombinant vaccinia virus induces CD8+ T-cell-mediated protective immunity against malaria. Proc Natl Acad Sci USA1993;90:5214–8.

22] Belz GT, Wodarz D, Diaz G, Nowak MA, Doherty PC. Compromisedinfluenza virus-specific CD8+-T-cell memory in CD4+-T-cell-deficientmice. J Virol 2002;76:12388–93.

23] Sun JC, Bevan MJ. Defective CD8 T cell memory following acuteinfection without CD4 T cell help. Science 2003;300:339–42.

24] Shedlock DJ, Shen H. Requirement for CD4 T cell help in generatingfunctional CD8 T cell memory. Science 2003;300:337–9.

25] Smith CM, Wilson NS, Waithman J, Villadangos JA, Carbone FR,Heath WR, et al. Cognate CD4+ T cell licensing of dendritic cellsin CD8+ T cell immunity. Nat Immunol 2004;5:1143–8.

/ Vaccin

[

[

[

[

[

[

[

[

[

[

[

B.C.G. de Alencar et al.

26] Kumaraguru U, Suvas S, Biswas PS, Azkur AK, Rouse BT. Concomi-tant helper response rescues otherwise low avidity CD8+ memory CTLsto become efficient effectors in vivo. J Immunol 2004;172:3719–24.

27] Heit A, Schmitz F, O’Keeffe M, Staib C, Busch DH, Wagner H,et al. Protective CD8 T cell immunity triggered by CpG-proteinconjugates competes with the efficacy of live vaccines. J Immunol2005;174:4373–80.

28] Wille-Reece U, Wu CY, Flynn BJ, Kedl RM, Seder RA. Immunizationwith HIV-1 Gag protein conjugated to a TLR7/8 agonist results in thegeneration of HIV-1 Gag-specific Th1 and CD8+ T cell responses. JImmunol 2005;174:7676–83.

29] Wille-Reece U, Flynn BJ, Lore K, Koup RA, Kedl RM, Mattapallil JJ,et al. HIV Gag protein conjugated to a Toll-like receptor 7/8 agonistimproves the magnitude and quality of Th1 and CD8+ T cell responsesin nonhuman primates. Proc Natl Acad Sci USA 2005;102:15190–4.

30] Sugauchi F, Wang RY, Qiu Q, Jin B, Alter HJ, Shih JW. Vig-orous hepatitis C virus-specific CD4+ and CD8+ T cell responsesinduced by protein immunization in the presence of Montanide ISA720

plus synthetic oligodeoxynucleotides containing immunostimulatorycytosine-guanine dinucleotide motifs. J Infect Dis 2006;193:563–72.

31] Tritel M, Stoddard AM, Flynn BJ, Darrah PA, Wu CY, Wille U,et al. Prime-boost vaccination with HIV-1 Gag protein and cytosinephosphate guanosine oligodeoxynucleotide, followed by adenovirus,

[

e 25 (2007) 6018–6027 6027

induces sustained and robust humoral and cellular immune responses.J Immunol 2003;171:2538–47.

32] Wille-Reece U, Flynn BJ, Lore K, Koup RA, Miles AP, Saul A, etal. Toll-like receptor agonists influence the magnitude and quality ofmemory T cell responses after prime-boost immunization in nonhumanprimates. J Exp Med 2006;203:1249–58.

33] Hutchings CL, Gilbert SC, Hill AV, Moore AC. Novel protein andpoxvirus-based vaccine combinations for simultaneous induction ofhumoral and cell-mediated immunity. J Immunol 2005;175:599–606.

34] Heit A, Huster KM, Schmitz F, Schiemann M, Busch DH, Wagner H.CpG-DNA aided cross-priming by cross-presenting B cells. J Immunol2004;172:1501–7.

35] Cho HJ, Hayashi T, Datta SK, Takabayashi K, Van Uden JH, Horner A,et al. IFN-�� promotes priming of antigen-specific CD8+ and CD4+ Tlymphocytes by immunostimulatory DNA-based vaccines. J Immunol2002;168:4907–13.

36] Kuchtey J, Chefalo PJ, Gray RC, Ramachandra L, Harding CV.Enhancement of dendritic cell antigen cross-presentation by CpG DNA

involves type I IFN and stabilization of class I MHC mRNA. J Immunol2005;175:2244–51.

37] Sun JC, Williams MA, Bevan MJ. CD4+ T cells are required for themaintenance, not programming, of memory CD8+ T cells after acuteinfection. Nat Immunol 2004;5:927–33.