Co-expression of S. Typhi GroEL and IL-22 gene augments immune responses against Salmonella...

ORIGINAL ARTICLE

Co-expression of S. Typhi GroEL and IL-22 geneaugments immune responses against Salmonellainfection

Gurpreet Kaur, Chitradevi STS, Charu Nimker, Mrinalini Singh, Deepika Saraswat, Shweta Saxena andAnju Bansal

Recombinant DNA vaccines represent a novel method for generating in situ expression of vaccine antigens. Intramuscular

injections of naked DNA are able to elicit potent humoral and cellular immune responses but still numerous factors limit the

immunogenicity of DNA vaccines. Co-expression of cytokines with antigen encoding genes in DNA vectors can improve the

immune responses and modify Th1/Th2 balance. In this study, the immunomodulatory effect of Interleukin 22 (IL-22) as an

adjuvant was studied by DNA vaccination with S. Typhi Heat shock protein 60 (HSP60/GroEL) in mice. Further, DNA construct

of IL-22 gene fused with GroEL was developed and immunization studies were carried out in mice. DNA vaccination with GroEL

alone stimulated humoral and cell-mediated immune responses. Co-immunization (IL-22þGroEL) further resulted in increase

in T-cell proliferative responses, antibody titres (IgG, IgG1, IgG2a) and secretion of IFNc (Th1), IL-1b and Th2 (IL-4, IL-6)

cytokines. Co-expression (IL-22-GroEL DNA) also promoted antibody titres and cytokine levels were significantly higher as

compared to co-immunized group. A reduction in bacterial load in spleen, liver and intestine was seen in all the immunized

groups as compared to control, with least organ burden in fusion DNA construct group (co-expression). Improved protective

efficacy (90%) against lethal challenge by Salmonella was observed with IL-22-GroEL co-expressing DNA vector as compared

with plasmid encoding GroEL only (50–60%) or co-immunization group (75–80%). This study thus shows that co-expression of

IL-22 and GroEL genes enhances the immune responses and protective efficacy, circumventing the need of any adjuvant.

Immunology and Cell Biology (2013) 91, 642–651; doi:10.1038/icb.2013.61; published online 22 October 2013

Keywords: DNA vaccines; GroEL; IL-22; immunity; fusion DNA vaccine

Heat Shock Proteins (HSPs) are a highly conserved family of proteins,first recognized by their upregulated expression in response toelevated temperature.1 These proteins undertake crucial functions inmaintaining cell homeostasis and are essential for life since they act aschaperons which include correct folding of nascent polypeptidechains and dissolution of aggregated protein complexes2 andmediate a range of cytoprotective and housekeeping functions.HSPs serve as a sort of link between innate and adaptive immuneresponses.3 Pathogen-derived HSPs serve as important antigens indefense against numerous infectious agents.4–6

Infectious diseases like typhoid remain a major cause ofconcern worldwide. The preventive measures against salmonellosisand typhoid fever are not adequate and not easy to manage withthe emergence of new multidrug-resistant strains. Vaccines pre-sently in use have limitations and numerous adverse effects.7–9

Therefore, there is a constant need for the development ofimproved, new-generation vaccines that are safe, inexpensive andstable at room temperature. HSPs are potent immunodominantantigens eliciting both humoral and cellular immune responses.

Protection has also been reported by intramuscular injectionsof naked plasmid DNA encoding HSPs against a number ofpathogens.10–13

DNA-based vaccination is a relatively new technology. Due tosimplicity and stability of DNA vaccines, they are relatively costeffective and inherently safe. They have been shown to be an effectiveapproach to induce both antigen-specific cellular and humoralimmunity. In DNA vaccines, gene(s) encoding for antigenic proteinsof a pathogen are inserted into the plasmid under the control ofeukaryotic promoters so that synthesis of these proteins inside thehost cells followed by antigen presentation results in the inductionof an immune response.14 While DNA vaccines have been a greatsuccess in small animal studies, their immunogenicity in largeranimals, non-human primates and humans has been less efficient.15

Different approaches have been employed to modulate theimmunogenicity and efficacy of DNA vaccines,16 the mostpromising of which seems to be the co-delivery of plasmid-basedgenetic adjuvants, viz. cytokines, chemokines, and co-stimulatorymolecules. Raz et al.17 showed for the first time that direct

Division of Experimental Biology, Defence Institute of Physiology and Allied Sciences, Defence Research and Development Organization, Timarpur, Delhi, IndiaCorrespondence: Dr A Bansal, Divison of Experimental Biology, Defence Institute of Physiology and Allied Sciences, Lucknow Road, Timarpur, Delhi 110054, India.E-mail: [email protected]

Received 12 May 2013; revised 11 September 2013; accepted 11 September 2013; published online 22 October 2013

Immunology and Cell Biology (2013) 91, 642–651& 2013 Australasian Society for Immunology Inc. All rights reserved 0818-9641/13

www.nature.com/icb

http://dx.doi.org/10.1038/icb.2013.61

mailto:[email protected]

http://www.nature.com/icb

intramuscular injection of a cytokine-expressing plasmid resulted inthe production of biologically active cytokine in vivo.17 Since then,many studies have proved that co-administration of cytokine genes asplasmid vectors with antigen-expressing plasmid enhances theimmunogenicity of DNA vaccines.18–22 Also, fusion constructs ofantigen and cytokine genes can modify the immune response andameliorate the therapeutic and protective effects of vaccination byDNA plasmid encoding only antigen.23,24

Interleukin 22 (IL-22), discovered in the year 2000 by Renauldet al.25 has a crucial role in modulating local inflammation in certainorgans. It also contributes to the maintenance of mucosal barrierintegrity and generation of a protective inflammatory responseagainst bacterial pathogens.26 It induces antimicrobial proteins andacts as a limiting factor for bacterial replication, playing an importantrole in systemic bacterial infections. Several studies have shown theanti-inflammatory and protective role of IL-22 against variousinfections.26–31 Hepatoprotective effects of IL-22 were shown inT-cell-mediated hepatitis via gene delivery.32 We have earlierreported significant protection (80–90%) using recombinant proteinGroEL (Hsp60), DnaK (Hsp70) of S. Typhi along with adjuvant(CFA) as candidate vaccine molecules against lethal challenge byS. Typhi as well as S. Typhimurium in mice.33–35 Currently, licensedvaccine adjuvants are not sufficiently effective for the induction ofefficient and appropriate immune responses and are unsuitable forhuman use because of certain side effects. Co-delivery of molecularadjuvants (such as cytokines) with DNA vaccine constructs haveshown to modulate the magnitude or direction of vaccine-inducedimmune responses (humoral or cellular) in animal models, thuscircumventing the need of commercial adjuvants, overcoming theharmful effects of adjuvants. Therefore, it was hypothesized that IL-22might be used as an adjuvant to improve the immunogenicity ofGroEL DNA.

Taking this into consideration, we studied the efficacy of IL-22 in aDNA vaccination vector co-administered or co-expressed with GroELof S. Typhi to modulate the immune responses and protection againstlethal infection of Salmonella in mice.

RESULTS

Development of recombinant DNA constructsGroEL (1.6 Kb) and IL-22 (540 bps) were successfully amplified bypolymerase chain reaction (PCR) from genomic DNA of S. Typhi andcDNA of mouse splenocytes, respectively. Both the genes wereindividually cloned in pVAX1 vector and confirmed by doubledigestion. The two genes IL-22 and GroEL were further fused intopVAX1 vector (3.0 Kb) at NheI and XhoI sites to construct fusionDNA plasmid (Figure 1). The recombinant construct was confirmedby colony PCR and further confirmed by double digestion to get a2.1 Kb fragment (1.6 Kb GroEL and 540 bps IL-22) on 1% agarose gel(Figure 2a).

In vitro translation/transcription reactionTo confirm whether recombinant constructs (pVAX-IL-22, pVAX-GroEL and pVAX-IL-22-GroEL) will be transcribed and translatedwhen injected in vivo, we carried out in vitro translation assay usingrabbit reticulocyte system (TNT quick coupled transcription/transla-tion kit, Promega, Madison, WI, USA). Briefly, control and recombi-nant plasmids were incubated separately with TNT translational mixand methionine for 30–90 min. 20mg protein was run on SDS–PAGEand the expression of recombinant proteins translated by recombi-nant DNA constructs was developed by western blot using Chemi-luminescence on an X-ray film. As revealed by Figure 2b, there wassubstantial expression of protein in samples containing recombinantplasmids while no protein was detected in samples containing controlplasmid (pVAX1). Luciferase (60 KDa) was used as a positive control.

BGH pA

XhoI

Restriction by BamHI + XhoI

Ligation GroEL

BamHI

T7NheI

IL22

Kanamycin

pUC ori

pVAX-IL223.54 Kb

T7 NheI

Kanamycin

pUC ori

pVAX-GroEL4.6 Kb

BamHI

XhoI

GroEL

BGH pA

BGH pA

T7NheI

IL22

Kanamycin

pUC ori

pVAX-IL22-GroEL5.14Kb

BamHI

XhoI

GroEL

Linearised pVax-IL22

Figure 1 Schematic representation of development of fusion DNA construct (IL-22-GroEL).

DNA vaccine with coexpression of GroEL and IL22 geneG Kaur et al

643

Immunology and Cell Biology

Antibody responses induced by the DNA vaccine constructsTo study the antigen-specific antibody responses, four groups of micewere then immunized with plasmid pVAX1 (Group 1 control),recombinant pVAX-GroEL (Group 2), Co-immunized withpVAX-IL-22 and pVAX-GroEL (Group 3) and fusion plasmidpVAX-IL-22-GroEL (Group 4), respectively. Antibody titers weredetermined at 1, 4 and 5 weeks after first immunization, by measuringtotal IgG in sera collected from control and immunized animals.Immunization with DNA vaccine constructs elicited a strong humoralimmune response. Antibody responses were observed after the 1st and2nd week (data not shown) of first immunization and increased till

the end of 5th week. Maximum antibody titre was observed 5 weeksafter 1st immunization (one week after last immunization). None ofthe control animals immunized with pVAX only showed antibodyresponse. Although pVAX-GroEL also produced significant antibodytitres, the maximum amount of antibody titres were seen in the fusiongroup (Figure 3a). Co-immunization with IL-22 and GroEL alsoproduced significant IgG antibody titres but were less as compared tothe fusion group. For antibody isotyping, sera from immunizedanimals were reacted with anti-mouse IgG1 and IgG2a. Resultsrevealed significant high IgG1 and IgG2a levels in all the threeimmunized groups, maximum being in the fusion group implying

3.0Kb2.0Kb

M

2.1 Kb fusiongene

pVAX1

1 54321

Figure 2 Expression of recombinant DNA constructs (a) Restriction dugestion of pVAX1-IL-22-GroEL plasmid with NheIþ Xho1. lane M: 1 Kb Marker,

lane1: 2.1Kb IL-22þHSP60 fragment and 3.0 Kb fragment of pVAX1 seen on gel (b) In vitro Transcription/Translation of recombinant DNA constructs.

lane1: pVAX1-IL-22-GroEL(85 Kda), lane 2: pVAX-GroEL(60 Kda), lane 3: pVAX-IL-22 (25 Kda), lane 4: Luciferase (þ ve control) (60 Kda), lane 5: pVAX

plasmid (-ve control).

0

0.5

1

1.5

2

2.5

3

1 5 10 50 100 200

IgG

(O.D

450

nm)

Reciprocal Serum Dilutions (X103)

ControlGroELGroEL+IL22Fusion

0

0.2

0.4

0.6

0.8

1

1.2

1.4

1.6

1.8

1 5 10 50 200

IgG

1 (O

.D 4

50nm

)


GroELGroEL+IL22Fusion

0

0.2

0.4

0.6

0.8

1

1.2

1 5 10 50 200

IgG

2a (O

.D 4

50nm

)


GroELGroEL+IL22Fusion

Figure 3 Immunoglobulin response (IgG) and antibody isotyping (IgG1, IgG2a) after immunization with recombinant DNA constructs in mice.Groups of mice

were immunized on day 0 with GroEL/IL-22þGroEL/ IL-22-GroEL purified DNA plasmids followed by two booster doses on 7th and 28th day. Control

animals were injected with pVAX1 plasmid. 1 week after the last immunization, blood was drawn and antibody titres measured in the serum of control and

immunized animals by ELISA using (a) goat anti-mouse IgG-HRP conjugate, (b) rabbit anti-mouse IgG1-HRP (c) rabbit anti-mouse IgG2a-HRP conjugate.

Results are expressed as optical density at 450 nm obtained with serial dilutions of serum. Data are represented as mean±s.d. of six mice per group of

three independent experiments. Titers of IgG1 and IgG2a in control group are not shown in figure as they were negligible.


644


induction of both Th1 and Th2 type immune responses, (Figures 3band c) which is an absolute requirement for bacterial infections likeSalmonella. There were negligible titres of IgG1 and IgG2a in thecontrol group; therefore, it has not been shown in the figures.

Proliferative T cell responsesFor determination of cellular responses, lymphocyte proliferation wasstudied in response to in vitro stimulation with rGroEL in splenocytesisolated from mice 1 week after last immunization. All the immunizedgroups showed significantly higher proliferation (Po0.001) ascompared to control even in the absence of any exogenous stimula-tion. In vitro stimulation of lymphocytes resulted in further increasein proliferation in all the immunized groups as compared to controlwith maximum increase in fusion DNA group (Figure 4a).

NO levels for immune protectionNitric oxide (NO), an important immunoregulatory molecule, isoften associated with innate defence mechanisms in activated cells ofinnate immunity like macrophages and cells of epithelial origin.Antimicrobial properties of NO include the capacity to confine thegrowth of viruses, bacteria, fungi and protozoa. Upregulation of NOis important for protection against Salmonella infection. Therefore,we measured the nitrite levels in macrophages isolated from immu-nized and control animals by Griess assay. The results showed thatthere was a considerable increase in the NO level in macrophagesfrom animals immunized with recombinant DNA constructs ascompared to control (Po0.001) but the production was significantlyhigher in the co-immunized and fusion group (Figure 4b).

Enhanced cytokine levelsTo determine the effect of immunization of mice with recombinantDNA vaccine on cytokine levels, we estimated the cytokines IL-4, IL-6,IFNg and IL-1b in supernatants of splenocytes isolated from thecontrol and immunized groups. A marked increase in both Th1(IFNg) and Th2 (IL-4, IL-6) cytokines was observed in culturesupernatant from all the immunized groups, (Figures 5a-d) whichwas further boosted by in vitro stimulation with rGroEL protein.Though the levels of IL-4 were low, there was appreciable differencebetween the various groups. Fusion DNA immunized group showedmaximum level of interleukins production followed by co-immunizedgroup which was higher than GroEL group.

Challenge studies for protective efficacyTo examine whether the enhanced immunogenicity elicited by fusionor co-delivery of IL-22 and GroEL DNA would lead to improvedprotection against Salmonella infection, challenge studies were carriedout in immunized and unimmunized control groups. Two weeks afterthe last immunization, one set of mice (n¼ 10 per group) waschallenged with 1� 107 cells of pathogenic S. Typhi intra-peritoneally.A lethal dose of pathogenic strains was established beforehand byserial dilutions and colony counting. All the control mice died within4–5 days post infection of S. Typhi while 60% protection wasobserved in GroEL DNA immunized group, 80% protection in co-immunized group and 90% protection was detected in the fusionDNA group (Figure 6a). Similarly, another set of mice was challengedwith 1� 104 cells of S. Typhimurium. The control mice died within 4days of infection, while in GroEL DNA immunized group 50%animals survived the lethal infection, 75% survived in co-immunizedgroup and 85% in the fusion DNA immunized group (Figure 6b).

Organ burden studiesThe capability of immunized mice to clear the infection was exploredby determining the viable bacterial count in tissues (spleen, liver andintestine) isolated from immunized, infected and control mice killed30 days and 3 days, respectively, after challenge with S. Typhi. andS. Typhimurium. Immunization with GroEL-DNA led to a significantreduction in bacterial load as compared to the control group(Po0.01). However, co-immunization with GroEL-DNA and IL-22-DNA led to a further decrease in bacterial load as compared to GroELalone (Po0.01). The level of protection achieved with fusion DNA

0

0.2

0.4

0.6

0.8

1

1.2

1.4

1.6

1.8

2

Control GroEL GroEL+ IL22 Fusion

Lym

phoc

yte

Prol

ifera

tion

(O.D

570

nm)

UninducedInduced

0

10

20

30

40

50

60

Control GroEL GroEL+IL22 Fusion

NO

(�M

)

24 hrs48 hrs

*

* *a

ab

abc

*

*b

*bd

a

ac

ace

Figure 4 Lymphocyte proliferation and nitric oxide production following

immunization in mice by recombinant DNA constructs. Groups of mice

(n¼6) were immunized with pVAX1(control), pVAX-GroEL, pVaxIL-

22þpVaxGroEL and pVAX-IL-22-GroEL plasmids on 0,7, 28 days. One

week after the last immunization, mice were killed and splenocytes were

isolated for lymphocyte proliferation studies, and macrophages were isolated

for nitric oxide estimation. (a) Splenocytes from each group

(1�106 cells ml�1 per mouse) were seeded in 96-well tissue culture plates

and rGroEL (5mg per well) was added to each well to stimulate lymphocyte

proliferation. Splenocytes isolated from un-immunized control were also

stimulated with ConA separately (5mg ml�1) which was taken as positive

control. The plates were incubated for 72 h at 37 1C with 5% CO2. MTT

Assay was done to determine cell proliferation and absorbance measured at570nm. Po0.001. * vs control UI, a vs control induced, b vs GroEL

Induced, c vs GroELþ IL-22 Induced. (b) Peritoneal macrophages isolated

from control and immunized animals were cultured in 96-well plates for 24

and 48h. The supernatants were collected and amount of NO was

measured. Data are represented as mean±s.d. Po0.001, *vs control

(24h), a vs control (48h), b vs GroEL (24 h), c vs GroEL (48 h), d vs.

GroELþ IL-22 (24 h), e vs GroELþ IL-22 (48 h). The experiment has been

repeated three times.


645


encoding plasmid was highest as seen by maximum decrease in organburden in the tissues. As also evident from Table 1, GroEL-IL-22(fusion), co-immunization and GroEL DNA alone led to 1.93–2.24,

1.24–1.59, 0.42–0.84 log level of protection, respectively. As similarprotection was observed against both S. Typhi. and S. Typhimurium,only data of S. Typhimurium infection has been shown in Table 1.

DISCUSSION

Immune responses generated by DNA vaccines were first made knownby Wolff and his colleagues (1990)36 that showed that naked DNA(plasmids) injected into muscle tissue could be taken up by cells at theadministration site resulting in the production of proteins notnormally made by host cells and was able to generate humoral andCTL responses. It was soon realized that this approach could beutilized for both gene therapy as well as vaccine applications and thusthe field of DNA vaccines was born. Since then, many studies havebeen published showing the development of DNA vaccines against anumber of diseases.36–40 An important advantage of this novelvaccination method is that the protein synthesized in vivo can enterboth MHC class I and class II antigen processing pathways to activatea specific T-cell subpopulation. Other advantages of DNA vaccineover conventional vaccines include no risk of infection as they are notlikely to have any residual virulence associated with live attenuatedstrains, induction of long-lived immune response, stability at low andhigh temperatures, easy preparation and low cost.41–43 DirectIntramuscular injection of plasmid DNA encoding HSP60 ofC. pseudotuberculosis has been reported to produce immuneresponses in mice.44 Despite their multiple advantages, there arecertain limitations of plasmid DNA vaccines. Studies have revealedthat antibody levels achieved using DNA vaccines are lower thanconventional vaccines.41,45 Challenge studies have shown 50%protection after 10 days, when mice immunized with plasmid DNAcontaining gene coding mouse virulence gene A (MviA) werechallenged with S. Typhimurium.46

Different strategies are being employed to enhance and modulatethe immune responses induced by DNA vaccines. Co-delivery ofplasmid based genetic adjuvants/ cytokine expressing plasmids has sofar been the best approach.47 We have earlier reported the ability ofrecombinant HSP60 and HSP70 of S. Typhi in inducing an immune

0200400600800

1000120014001600

Control GroEL GroEL+IL22 FusionIF

N�

(pg/

ml)

*

**ab

abc

a

0100200300400500600700800900

1000


IL-1

� (p

g/m

l)

*

*

*ab

abc

50100150200250300350400450


IL-6

(pg/

ml)

*

*

*ab

abc

0

20

40

60

80

100

120


IL-4

(pg/

ml)

*

**ab

abc

a

UninducedInduced

Figure 5 Cytokines estimation following immunization in mice by recombinant DNA constructs. The splenocytes isolated from each group were cultured and

2�106 cells ml�1 from each mouse were added to 24-well plates, stimulated with rGroEL and incubated for 72 h at 37 1C and 5% CO2. Supernatant was

collected and analysed for the presence of (a) IFNg (b) IL-1b (c) IL-6, (d) IL-4 using ELISA kits. Levels of IL-1b were measured in supernatant of peritoneal

macrophages isolated from control and immunized animals and absorbance read at 450nm. Data is mean concentration (pg ml�1)±s.d. and is

representative of three independent experiments. Statistical analysis was done between control and different immunized groups by one way-analysis of

variance. Po0.01 * vs control UI, a vs control induced, b vs GroEL Induced, c vs GroELþ IL-22 Induced.

0 5 10 15 20 25 300

50

100

150 ControlGroELGroEL+IL22Fusion

Days

Perc

ent s

urvi

val

0 5 10 15 20 25 300

50

100

150

GroELControl

GroEL+IL22Fusion

Days

Perc

ent s

urvi

val

p<0.0001

p<0.0001

Figure 6 Protective efficacy of recombinant DNA plasmids against lethal

challenge of Salmonella in mice. Groups of mice (n¼10 per group) were

immunized with different plasmid constructs. Fifteen days after last

immunization, mice were challenged with (a) 1�107 CFU of

S. Typhi (b) 1�104 CFU of S. Typhimurium intra-peritoneally. Animals

were observed for morbidity and mortality for 30 days and protection for

each group has been represented as Kaplan–Meier survival curves. The

experiment was repeated twice.


646


response in mice.33–35 They were also shown to protect 70% miceagainst lethal challenge of S. Typhi in the absence of adjuvant and80–90% with adjuvant CFA. Most widely-used adjuvants in vaccinesare unsuitable for human use because of their toxicity and side effects.Therefore, co-administration/co-expression of cytokine genes andantigen may represent a novel strategy to enhance immunizationand specifically modify the balance of Th1/Th2-driven cellular andhumoral immune responses. Several studies have shown therapeuticefficacy of different cytokines in combination with bacterial/viralantigens.48–54 IFNg co-immunized along with Yersinia HSP60 DNAhas been shown to effectively increase immune response and decreasethe bacterial splenic load.23

Cytokines play an important role in the development of effectorT-cell subsets and in determining the direction and magnitude of theimmune response generated against pathogens. IL-22, a Th-17 T-cell-associated cytokine is expressed by cells of the innate and adaptiveimmune responses in many mouse models. It induces a variety ofproliferative, anti-apoptotic and anti-microbial effects,55,56 thusplaying an important role in host defense against infectiouspathogens, tissue repair and preventing damages of the mucosalepithelial tissue in the respiratory and digestive systems.Hepatoprotective effects of IL-22 have been shown by plasmidDNA-based delivery of IL-22 in murine liver against injury inducedby ConA, CCl4 and Fas-agonist Jo-2 mAb.32 More recently,therapeutic efficacy with recombinant IL-22 has been shown againstacute pancreatitis in rats.57

On the basis of these observations, the immunomodulatory effectof IL-22 expressing plasmid was studied by co-delivery andco-expression with GroEL DNA of S. Typhi in mice. Both the geneswere fused in the pVAX1vector to develop fusion DNA construct. Tothe best of our knowledge this is the first study on the combinedtherapeutic effects of DNA vaccine co-expressing GroEL along withIL-22 as an adjuvant against Salmonella infections.

In the present study, immunization with the DNA constructsinduced humoral responses as evident by increase in the total IgGantibody titres as compared to control (Figure 3). However, max-imum increase in IgG levels was seen in the fusion DNA group andthe co-immunized group as compared to GroEL DNA alone. Anti-body isotyping revealed increase in both IgG1 and IgG2a antibodytitres in all the three immunized groups, indicating the induction ofmixed immune response. The fusion DNA immunized group showedmaximum increase in both subtypes followed by the co-immuniza-tion group. Interestingly, the higher levels of IgG1 than IgG2a indicatepredominance of Th2 type immune response in all the groups. But

the ratio of IgG1/IgG2a was found to be maximum in GroEL DNAimmunized animals (1.74) followed by GroELþ IL-22 (1.23) andfusion GroEL-IL-22 DNA (1.23) pointing towards the polarization ofimmune response towards Th1 by co-immunization or fusion withIL-22. Studies carried out by other researchers with plasmid DNAexpressing a secretory form of the influenza hemagglutinin hadshown induction of Th2 immune response when DNA was deliveredintramuscularly, and a Th1 response when gene gun was used fordelivery.58 Similar results were reported by Rothel et al.,59 that showedthat immunization with a host-protective antigen (45 W) from thesheep parasite Taenia ovis intramuscularly enhanced antibodyresponses in animals, predominantly of IgG1 subclass.59

Immunity to intracellular parasite like S. Typhi is complex and onlyantigen-specific antibody response is not considered to be completelyprotective. It is important that both the arms of immunity areeffectively generated by vaccination.60 T cells play an important roleagainst Salmonella infection by expression of protective cytokines.Therefore, in the present study the potential of vaccine molecules toinduce cellular immune responses was evaluated by measuringT- lymphocyte proliferation and cytokine levels in splenocytes. Datashown in Figure 4a suggests that immunization with GroELDNA alone induced a strong lymphocyte proliferation response ascompared to empty vector control. This response was furtherenhanced by co-administration with IL-22 DNA or co-expression ofIL-22-GroEL-DNA.

To correlate IgG isotypes with cytokine profile, cell-mediatedimmune responses were also measured by estimating concentrationsof various cytokines in culture supernatants of splenocytes. Both Th1(IFNg) and Th2 (IL-4, IL-6) cytokines were increased significantly inall the immunized groups as compared to un-immunized control,increase being more pronounced in co-immunized and fusionconstruct group. This shows the induction of mixed (Th0) immuneresponse as evident by antibody isotyping also, thus stimulating boththe arms of immunity. Th0 represents a heterogenous population ofpartially-differentiated effector cells consisting of multiple subsetswhich secrete different combinations of both Th1 and Th2 cyto-kines.61 CD4þ Th1 cytokines such as IFN-g provide protectiveimmunity against intracellular pathogens, elicit macrophageactivation, delayed type hypersensitivity reactions and induce potentmicrobicidal activity. They promote CD8þ T cell responses and Bcell class-switching to IgG2a.62,63 Levels of IL-1b in macrophages alsoincreased significantly in fusion and co-immunized group ascompared to GroEL DNA group (Po0.01). The protective actionof IL-1b during infection is mediated by rapid recruitment of

Table 1 Organ bacterial load of immunized animals after lethal challenge with 1�104 CFU of S. Typhimurium

Experimental Groups Intestine Spleen Liver

Mean log10 CFU±s.d. Log10 unit of protection Mean log10 CFU±s.d. Log10 unit of protection Mean log10 CFU±s.d. Log10 unit of protection

Control 8.023±0.003 — 8.19±0.01 — 8.08±0.006 —

GroEL 7.59±0.02a 0.428 7.34±0.03a 0.847 7.56±0.04a 0.514

GroELþ IL-22 6.77±0.059ab 1.24 6.6±0.07ab 1.59 6.49±0.09ab 1.59

Fusion 6.09±0.32abc 1.93 5.94±0.2abc 2.24 5.94±0.27abc 2.13

30 days after challenge, bacterial load in spleen, liver and intestine of immunized animals was determined and results are expressed as log10 units. Control mice were killed three days afterchallenge. The level of protection was determined by subtracting the mean of log10 CFU value obtained from each experimental group from the mean log10 CFU value of control group. Datarepresents mean log10 CFU±s.d. Statistical significance was determined by one-way analysis of variance between control and different immunized groups. (As similar protection was observedagainst both S. Typhi and S. Typhimurium; therefore, only data of S. Typhimurium infection has been shown).aPo0.01 vs control.bPo0.01 vs GroEL.cPo0.01 vs GroELþ IL-22.


647


neutrophils to inflammatory sites, activation of the endothelialadhesion molecules, induction of cytokines and chemokines andthe stimulation of adaptive immunity as Th17 response. In contrast,CD4þ Th2 cytokines such as IL-4 activates B cell proliferationsupporting antibody responses, promotes B cell class switching toneutralizing antibodies such as IgG1 and also regulates the magnitudeof Th1 cytokine responses.64 IL-6 is involved in the differentiation andproliferation of T and B cells and acts in conjunction with otherproinflammatory cytokines to initiate the early inflammatoryresponse during infection. The two types of responses (CD4þ Th1and Th2) induced by the recombinant constructs in this study arecrucial for vaccine required to induce both cell-mediated andantibody responses for protection against infection by Salmonella.

During the last two decades, NO has been regarded as animmunoregulatory and antimicrobial molecule, which is importantfor innate host defence against various infections. It has beenproposed recently that antibacterial immunity driven by IL-22 mayfunction via activation of iNOS.65,66 iNOS has been associated withimmunoactivation seen at host/environmental interfaces duringinfections. In S. Typhimurium infection, lack of iNOS wasassociated with higher mortality.67 IL-22 has also been shown toincrease iNOS in human epithelial cells in vitro.68,69 Therefore, wemeasured NO in cell culture supernatants of mouse macrophagesusing Greiss assay. We found that in vivo administration of GroELsignificantly increased NO production in macrophages of mice from24 to 48 h. Co-expression/Co-immunization further enhanced the NOto significant levels in macrophages of immunized animals. Theproduction of NO by stimulated rodent cells is an importantcomponent of anti-microbial activity of these cells,70 and thecoordinated increase in innate NO levels by co-immunization(GroELþ IL-22 DNA) or fusion DNA (GroEL-IL-22 DNA) inimmunized animals may be a beneficial host defence mechanismagainst microbial infections.

Since, our DNA constructs were able to generate robust immuneresponses, we next studied the protection elicited by our recombinantconstructs against S. Typhi and S. Typhimurium infection in mice.Though murine infection with S. Typhimurium has been widelyaccepted as the best experimental system for determining efficacy oftyphoid vaccines, S. Typhi at higher CFUs has also been reported toinfect animals.71–74 Moreover, S. Typhi is the causative organism oftyphoid in humans. Efficacy of HSP60/70 against infection caused byS. Typhi in mice has been reported by us earlier as well.33–35 So, wehave used a higher CFU of S. Typhi strain to cause infection and testedthe efficacy of our recombinant vaccine against S. Typhimurium too.

Our results showed 85–90% protection in fusion DNA constructgroup, 75–80% protection in co-immunized group while 50–60%protection was seen in GroEL DNA immunized group. 100%mortality was observed in control group within 4–5 days(Figure 6). Overall, the results demonstrated that IL-22 DNAeffectively enhanced the protective efficacy against Salmonella infec-tion. Aujla et al.,27 reported that IL-22 is essential for mucosal hostdefence against Klebsiella pneumonia infection and increased lungepithelial cell proliferation.27 Zheng et al.,26 reported considerablemortality in IL-22 deficient mice during Citrobacter rodentiuminfection.26 Also, it was reported that IL-22 can protect againstsystemic Salmonella enterica infection, independent of IL-17.75,76

We also observed that protective efficacy was more when IL-22DNA was administered along with GroEL DNA, either as co-immunization or when fused with GroEL DNA, the fusion DNAconstruct providing higher protection than that achieved byco-administration of two genes.

Infection by Salmonella results in serious gastroenteritis with thedanger of proceeding towards bacteraemia. 30 days after the miceimmunized with DNA vaccine constructs were challenged with lethaldose of bacteria, bacterial load in spleen, liver and intestine of animalswere determined. The fusion DNA construct resulted in maximumreduction in the bacterial load in all these tissues followed by groupsco-administered with GroELþ IL-22 DNA and GroEL DNA alone.IL-22 helped to reduce dissemination of bacteria and increasedbactericidal activity, both leading to reduced pathogen burden inthe host and ultimately protection from infection.

In conclusion, application of a cytokine gene by co-administrationor fusion with an antigen DNA vaccine can influence the differentia-tion of Th cell response and can enhance the immune response andmay thus provide a strategy to improve the efficacy of candidate DNAvaccine. Fusion DNA construct of IL-22 gene with GroEL of S. Typhiwas able to generate immune responses in mice by increasing T cellproliferative responses and humoral antibody responses. Antibodyisotyping revealed increase in the levels of both IgG1 and IgG2a. Also,our recombinant constructs were able to provide significant protec-tion to animals against lethal challenge of S. Typhi andS. Typhimurium. The study thus underscores the potential of DNAvaccines in conjunction with appropriate cytokine gene as adjuvant,thereby providing a better and effective treatment for bacterialinfections like Salmonella.

Since HSPs are conserved across different life forms, the study canform a basis for the treatment of other enteric infections like Klebsiellaand E. coli and develop better therapeutics with cytokine genes (asfusion constructs or co-immunization) as an improved alternativestrategy in vaccine development.

METHODS

Bacterial strains, vectors and reagentsS. Typhi MTCC 733 was used for isolation of genomic DNA and was procured

from Institute of Microbial Technology, Chandigarh, India. E. coli strain DH5a(Invitrogen, Carlsbad, CA, USA) was used as host for cloning experiments and

for the propagation of plasmids. Pathogenic strains of S. Typhi and

S. Typhimurium were clinically isolated at All India Institute of Medical

Sciences, New Delhi, India. pVAX1 (Invitrogen) was used as DNA vaccine

vector. All the enzymes used in present study were from MBI Fermentas

(Hanover, MD, USA), while all chemicals and kits, unless otherwise stated,

were purchased from Sigma-Aldrich (St Louis, MO, USA). All the kits were

used as recommended by the manufacturer’s instructions.

MiceFour to six-week-old female Balb/c mice were maintained under specific

pathogen-free conditions in the Central Animal House Facility of the Institute

and fed autoclaved food and water ad libitium. Mice were handled and

disposed off according to the guidelines of the Institute’s Ethical Committee.

Bacterial cultivation and DNA purificationThe bacterial strains were grown in Luria Bertani (Difco, Sparks, MD, USA)

medium at 37 1C. All the recombinant constructs with pVAX1 plasmid were

supplemented with 50mg ml�1 kanamycin and grown at 37 1C with shaking

until bacterial growth reached an optical density of 0.5–0.6 at 600 nm.

Genomic and plasmid DNA were isolated by gene elute genomic DNA

isolation kit and gene-elute plasmid DNA isolation kit (Sigma-Aldrich),

respectively, as per the manufacturer’s instructions. For large scale isolation

of highly purified plasmid DNA for immunization, Endofree Plasmid Maxi kit

(Qiagen, Hilden, Germany) was used.

Development of recombinant DNA plasmidsAll the recombinant genes were cloned into the DNA Vaccine vector pVAX1.

pVAX1 is a 3.0 Kb vector designed for use in the development of DNA


648


vaccines. The small size of pVAX1 and the variety of unique cloning sites

simplify sub-cloning of even very large DNA fragments.

Development of recombinant pVAX-IL-22 constructcDNA of IL-22 was derived by reverse transcription of RNA isolated from

mouse splenocytes stimulated by 5mg ml�1 ConA for 24 h in culture medium.

cDNA was used as a template for PCR amplification using gene-specific

primers as shown below:

IL-22: forward, 50-AA GCTAGCGAGCTCACCATGGCTGTCCTGCAGAAA

TCTATG-30,reverse, 50- AA GAATTCTCAGGATCCGACGCAAGCATTTCTCAGAGAC-30.The mIL-22 forward primer was designed to have NheI at 50end and reverse

primer had EcoRI and BamHI sites at 50 end. The PCR product (540 bps) was

amplified and cloned between the Nhe1 and EcoRI sites of pVAX1 to generate

pVAX-IL-22 construct.

Development of recombinant pVAX-GroEL constructGenomic DNA was isolated from S. Typhi MTCC 733 strain according to the

manufacturer’s instructions (Genomic DNA isolation kit, Sigma). The

upstream primer for GroEL (HSP60) gene contained BglII at 50end and the

downstream primer contained Xho1 restriction site at 50end as shown below:

GroEL: forward, 50-GGAGATCTACCATGGCAGCTAAAGACGTAAAATT

CG-30,reverse, 50-AA CTCGAGTTACATGCCGCCCATACCACC-30

GroEL (1.6 Kb fragment) was PCR amplified from genomic DNA, purified

and cloned into BamHI and XhoI sites of pVAX1 (BglII overhang is compatible

with BamHI overhang) to generate pVAX-GroEL construct.

Development of fusion DNA construct (pVAX-IL-22-GroEL)pVAX-IL-22 construct (as stated above) was restricted with BamHI and XhoI

restriction enzymes and purified by gel elution (Sigma gen elute Gel extraction

kit). pVAX1-GroEL construct was restricted with Bam HI and XhoI and GroEL

fragment was purified by gel elution. It was cloned into linearised pVAX-IL-22

construct at Bam HI and XhoI sites to generate the fusion construct pVAX1-

IL-22-GroEL having Nhe1 at 50 end and Xho1 at 30 end (2.1 Kb fusion gene).

Transformation and screening of recombinantsThe recombinant plasmid constructs (pVAX-IL-22, pVAX-GroEL, pVAX-IL-

22-GroEL) were transformed into E. coli DH5a by CaCl2 method.77 The

transformants with correct insert were identified by colony PCR, plasmid

isolation and restriction digestion followed by DNA sequencing. Pure Plasmid

DNA was purified from transformed E. coli DH5a by Endofree Plasmid Maxi

Kit according to the manufacturer’s instructions. The DNA was run on agarose

gel to check purity and reconstituted in sterile PBS at a concentration of

1 mg ml�1 for immunization in animals and stored at �70 1C till further use.

DNA concentration and purity were determined by absorbance at 260 and

280 nm.

In Vitro transcription/translation reactionIn vitro translation of recombinant genes was carried out using TNT quick

coupled transcription/translation kit (Promega). It is a convenient single

tubed, coupled transcription/translation reaction for eukaryotic in vitro

translation. It combines RNA polymerase, nucleotides, salts and recombinant

Ribonuclease inhibitor (RNasin) with the reticulocyte lysate solution to form a

single TNT quick master mix. 40ml of this master mix was incubated with

0.2–2.0mg of individual recombinant plasmid constructs, 1 mM Methionine

and 1–2ml of Biotin-Lysyl-tRNA. The reaction tubes were incubated at 30 1C

for 60 to 90 min. Luciferase encoding plasmid was used as a positive control.

After the reaction was over, 1–2ml of sample was loaded on SDS–PAGE. The

proteins were transferred to nitrocellulose membrane by Semi-dry transblot

apparatus (Biorad, Hercules, CA, USA), and the membrane was incubated

with Streptavidin-HRP conjugate before developing the bands on X-ray film

(Kodak, Rochester, NY, USA) by Chemiluminescent Substrate (Transcend

Chemiluminescent Translation Detection System, Promega) in the dark.

Expression, isolation and purification of recombinant GroELS. Typhi GroEL gene was cloned in pQE-30 expression vector and expressed in

E. coli BL21 cells. Recombinant GroEL protein was induced with 0.5 mM IPTG

and purified using Ni-NTA agarose resin (Qiagen) under denaturing condi-

tions as already reported.34

Immunization of miceFour to six-week-old female BALB/c mice were randomly divided into four

groups (n¼ 6): Group 1: control group immunized by plasmid pVAX1, Group

2: immunized with recombinant pVAX-GroEL(50mg per animal), Group 3:

co-Immunized with pVAX-IL-22 (25mg) and pVAX-GroEL (25mg) and

Group 4: immunized with fusion plasmid pVAX-IL-22-GroEL(50mg). The

animals were immunized intramuscularly and subsequent booster doses were

given on the 7th and 28th day.

Determination of antibody titres by ELISAAll the control and experimental animals were bled 1, 4 and 5 weeks after the

first immunization by the retro orbital vein. Serum was separated from blood

and antigen-specific ELISAs were done to determine antibody responses in the

serum samples. Briefly, 96-well microtitre plates (Grenier, Frickenhausen,

Germany) were coated with 100ml of recombinant purified GroEL

(10mg ml�1) per well in coating buffer (0.1 m carbonate buffer, pH 9.5) and

incubated at 4 1C overnight. Plates were washed three times with PBS

containing 0.05% Tween-20 and blocked with 100ml of blocking buffer, 5%

BSA in PBS containing 0.05% Tween-20 for 2 h at 37 1C. Plates were again

washed three times with wash buffer and incubated with serial dilutions of sera

samples for 2 h at 37 1C. After washing again, plates were incubated with HRP-

conjugated goat antimouse IgG antibody (1:2000, Santacruz, CA, USA) for 1 h.

For detection of antibody isotypes, antimouse IgG1 and IgG2a were used

(1:2000 dilution in PBS containing 0.05% Tween-20). Plates were then

developed with 100ml of TMBþ H2O2 substrate (BD Biosciences, San Diego,

CA, USA) for 20–30 min in dark. Reaction was stopped with 50ml of 2N

H2SO4. Plates were read at 450 nm in a microplate reader (Molecular devices,

Sunnyvale, CA, USA).

Lymphocyte proliferationSeven days after the last immunization, animals were killed in each group to

study lymphocyte proliferation. Sterile spleen cell suspensions were prepared

for in vitro culture. Splenocytes from each group (1� 106 cells ml�1 per

mouse) were seeded in 96-well tissue culture plates in RPMI-1640 media, and

the recombinant protein (5mg per well rGroEL) was added to each well to

stimulate lymphocyte proliferation. Splenocytes isolated from un-immunized

control group (group 1) were also stimulated with ConA separately

(5mg ml�1), which was taken as positive control. The plates were incubated

for 72 h at 37 1C with 5% CO2. MTT Assay was done to determine cell

proliferation. Briefly, 20ml of MTT (5 mg ml�1) was added in each well and

further incubated for 4 h. After incubation, plates were centrifuged for 10 min

at 2000 g in a microplate centrifuge, and supernatant was removed without

disturbing the pellet and replaced with 200ml of dimethylsulfoxide (DMSO)

and incubated for 10–15 min at 37 1C until formazan crystals dissolved. The

optical density value of each well was measured using a microplate reader at

570 nm wavelength.

Cytokines estimationThe splenocytes, as isolated above, were cultured in RPMI-1640 medium

supplemented with 10% Fetal bovine serum, ampicillin (0.1 g l�1), strepto-

mycin (0.1 g l�1), sodium bicarbonate (10.4 g l�1) and L-glutamine (0.3 g l�1).

2� 106 cells ml�1 from each group of mice were added to 24-well plates,

stimulated with rGroEL, as described above, and incubated for 72 h at 37 1C

and 5% CO2. Supernatant was collected and analysed for the presence of IL-4,

IL-6, IFNg using ELISA kits (BD Biosciences).

Levels of IL-1b were measured in supernatant of peritoneal macrophages

isolated from control and immunized animals.78 Briefly, 3 days before killing,

the animals were injected with 4% thioglycolate intra-peritoneally to induce

peritoneal macrophages. The animals were killed and 5 ml of cold PBS was

flushed into the peritoneal cavity and gently aspirated and collected in a


649


centrifuge tube. The fluid containing peritoneal macrophages was centrifuged

at 2000 r.p.m. for 10 min and pellet suspended in RPMI medium. The

macrophages were counted and 1� 106 cells ml�1 were cultured in 96-well

plates, stimulated with rGroEL, as described above, and incubated for 72 h at

37 1C and 5% CO2. Supernatant was collected and analysed for the presence of

IL-1b according to manufacturer’s instructions (BD Biosciences) and

absorbance read at 450 nm.

Measurement of NONO plays an important role in host defence against various microbes. In the

immune system, NO has been shown to be a product of activated macrophages

with tumoricidal and antimicrobial activity. For NO estimation, peritoneal

macrophages were isolated from control and immunized mice, as mentioned

above, and 1� 106 cells ml�1 cells were cultured in 96-well tissue culture plates

at 37 1C with 5% CO2 for 24–48 h. Cell-free supernatants were recovered and

nitrite estimation was done using Griess assay. Briefly, Griess reagent was

prepared by mixing equal volumes of Solution A-NED Solution (0.1% N-1-

napthylethylenediamine dihydrochloride) in water and solution B-1% sulfani-

lamide in 5% phosphoric acid, prepared fresh. 100ml of supernatant was mixed

with 100ml of Griess reagent and incubated for 10–15 min in the dark. The

absorbance was measured at 540 nm using a microplate reader and nitrite

concentrations were calculated using a calibration curve with sodium nitrite

standards.

Challenge studiesAnother two sets of mice were divided into four groups each (n¼ 10 per

group). Control mice (group 1) were injected with vehicle (pVAX1) and

experimental animals (groups 2, 3, 4) were immunized with respective

recombinant plasmids on 0, 7th and 28th day, as described above. After 15

days of the last immunization, one set of animals was challenged with a lethal

dose of S. Typhi (1� 107 CFU per mice) and another set with S. Typhimurium

(1� 104 CFU per mice) intra-peritoneally. All the mice were observed for

morbidity and mortality for 30 days. The experiment was repeated twice.

Organ burden studiesMice from immunized groups that remained alive for 30 days after challenge

were killed. During standardization of Salmonella dose for challenge, that dose

was selected at which the unimmunized control mice died within 4–5 days. As

the control mice could remain alive for only 4–5 days; therefore, for organ

burden study, additional groups of control mice (n¼ 6) were killed after 3 days

of challenge with S. Typhi and S. Typhimurium, respectively. Spleen, liver and

intestine were removed aseptically and homogenized in 5 ml ice-cold PBS with

0.5% Tween 80. 10-fold serial dilutions of homogenates were plated on agar

plates followed by incubation at 37 1C for 16–18 h. Colonies on each plate were

counted and expressed as log10 CFU for different tissues. Level of protection

was expressed as log10 units and calculated by subtracting mean log10 CFU

value of the experimental group from the mean of log10 CFU of control group.

Statistical analysisData are represented as mean±SD. The data were analysed using one-way

analysis of variance with post-hoc bonferroni analysis using standard statistical

software package of social science (SPSS 16.0, Chicago, IL, USA) and Po0.05

was considered as statistically significant. Data of challenge studies are

expressed as Kaplan–Meier survival curves and analysed by log rank test. All

the experiments were repeated on three different occasions. Challenge studies

were repeated twice.

CONFLICT OF INTERESTThe authors declare no conflict of interest.

ACKNOWLEDGEMENTSWe thank Bhagwat Singh of Experimental Animal Facility for his valuable

support and technical assistance with animal experiments. The help rendered by

Professor S Swaminathan, ICGEB, New Delhi, India in designing the primers is

gratefully acknowledged. The work was supported by grants from Council of

Scientific and Industrial Research, New Delhi, India and Defence Research and

Development Organisation, Ministry of Defence, Government of India.

Ms.Gurpreet Kaur was a recipient of senior research fellowship from CSIR.

1 Ritossa F. A new puffing pattern induced by temperature shock and dnp in drosophila.Experientia 1962; 18: 571–573.

2 Smith DF, Whitesell L, Katsanis E. Molecular chaperones: biology and prospects forpharmacological intervention. Pharmacol Rev 1998; 50: 493–514.

3 Srivastava P. Roles of heat-shock proteins in innate and adaptive immunity. Nat RevImmunol 2002; 2: 185–194.

4 Kaufmann SHE. Heat shock proteins and the immune response. Immunol Today 1990;11: 129–136.

5 Zugel U, Kaufmann SHE. Role of heat shock proteins in protection from andpathogenesis of infectious diseases. Clin Microbiol Rev 1999; 12: 19–39.

6 Kaufmann SHE, Schoel B. Heat shock proteins as antigens in immunity againstinfection and self. In: Morimoto RI, Tissieres A and Georgopoulos C (eds), The Biologyof Heat Shock Proteins and Molecular Chaperones. Cold Spring Harbor, MonographArchive, New York, 1994, pp 495–531.

7 Cadoz M. Potential and limitations of polysaccharide vaccines in infancy. Vaccine1998; 16: 1391–1395.

8 Garmory HS, Brown KA, Titball RW. Salmonella vaccines for use in humans: presentand future perspectives. FEMS Microbiol Rev 2002; 26: 339–353.

9 Hessel L, Debois H, Fletcher M, Dumas R. Experience with Salmonella Typhi Vicapsular polysaccharide vaccine. Eur J Clin Microbiol Infect Dis 1999; 18: 609–620.

10 Coutanceau E, Legras P, Marsollier L, Reysset G, Cole ST, Demangel C. Immunogeni-city of Mycobacterium ulcerans Hsp65 and protective efficacy of a Mycobacteriumleprae Hsp65-based DNA vaccine against buruli ulcer. Microbes and Infect 2006; 8:2075–2081.

11 Noll A, Bucheler N, Bohn E, Schirmbeck R, Reimann J, Autenrieth IB. DNAimmunization confers systemic, but not mucosal, protection against enteroinvasivebacteria. Eur J Immunol 1999; 29: 986–996.

12 Ribeiro AM, Bocca AL, Amaral AC, Faccioli LH, Galetti FCS, Zarate-Blades CR et al.DNA-hsp65 vaccination induces protection in mice against paracoccidioides brasi-liensis infection. Vaccine 2009; 27: 606–613.

13 Santos-Junior RR, Sartori A, De Franco M, Filho OG, Coelho-Castelo AA, Bonato VLet al. Immunomodulation and protection induced by DNA-hsp65 vaccination in ananimal model of arthritis. Hum Gene Ther 2005; 16: 1338–1345.

14 Davis HL. Plasmid DNA expression systems for the purpose of immunization. Curr OpinBiotechnol 1997; 8: 635–646.

15 Egan MA, Israel ZR. The use of cytokines and chemokines as genetic adjuvants forplasmid DNA vaccines. Clin Appl Immunol Rev 2002; 2: 255–287.

16 Garmory HS, Brown KA, Titball RW. DNA vaccines: improving expression of antigens.Genet Vaccines Ther 2003; 1: 2.

17 Raz E, Watanabe A, Baird SM, Eisenberg RA, Parr TB, Lotz M et al. Systemicimmunological effects of cytokine genes injected into skeletal muscle. Proc Natl AcadSci USA 1993; 90: 4523–4527.

18 Irvine KR, Rao JB, Rosenberg SA, Restifo NP. Cytokine enhancement of DNAimmunization leads to effective treatment of established pulmonary metastases.J Immunol 1996; 156: 238–245.

19 Li Q, Zhu Y, Chu J, Wang Y, Xu Y, Hou Q et al. Protective immunity against Bordetellapertussis by a recombinant DNA vaccine and the effect of coinjection with agranulocyte-macrophage colony stimulating factor gene. Microbiol Immunol 2006;50: 929–936.

20 Triccas JA, Sun L, Palendira U, Britton WJ. Comparative affects of plasmid-encodedinterleukin 12 and interleukin 18 on the protective efficacy of DNA vaccination againstMycobacterium tuberculosis. Immunol Cell Biol 2002; 80: 346–350.

21 Xiang Z, Ertl HC. Manipulation of the immune response to a plasmid-encoded viralantigen by coinoculation with plasmids expressing cytokines. Immunity 1995;2: 129–135.

22 Xin KQ, Hamajima K, Sasaki S, Honsho A, Tsuji T, Ishii N et al. Intranasaladministration of human immunodeficiency virus type-1 (HIV-1) DNA vaccine withinterleukin-2 expression plasmid enhances cell-mediated immunity against HIV-1.Immunology 1998; 94: 438–444.

23 Hornef MW, Noll A, Schirmbeck R, Reimann J, Autenrieth IB. DNA vaccination usingcoexpression of cytokine genes with a bacterial gene encoding a 60-kda heat shockprotein. Med Microbiol Immunol 2000; 189: 97–104.

24 Maecker HT, Umetsu DT, DeKruyff RH, Levy S. DNA vaccination with cytokine fusionconstructs biases the immune response to ovalbumin. Vaccine 1997; 15: 1687–1696.

25 Dumoutier L, Louahed J, Renauld JC. Cloning and characterization of IL-10-related Tcell-derived inducible factor (IL-TIF), a novel cytokine structurally related to IL-10 andinducible by IL-9. J Immunol 2000; 164: 1814–1819.

26 Zheng Y, Valdez PA, Danilenko DM, Hu Y, Sa SM, Gong Q et al. Interleukin-22 mediatesearly host defense against attaching and effacing bacterial pathogens. Nat Med 2008;14: 282–289.

27 Aujla SJ, Chan YR, Zheng M, Fei M, Askew DJ, Pociask DA et al. IL-22 mediatesmucosal host defense against gram-negative bacterial pneumonia. Nat Med 2008; 14:275–281.

28 Liang SC, Nickerson-Nutter C, Pittman DD, Carrier Y, Goodwin DG, Shields KM et al.IL-22 induces an acute-phase response. J Immunol 2010; 185: 5531–5538.


650


29 Ren X, Hu B, Colletti LM. IL-22 is involved in liver regeneration after hepatectomy. AmJ Physiol Gastrointest Liver Physiol 2010; 298: G74–G80.

30 Schulz SM, Kohler G, Schutze N, Knauer J, Straubinger RK, Chackerian AA et al.Protective immunity to systemic infection with attenuated salmonella enterica serovarenteritidis in the absence of IL-12 is associated with IL-23-dependent IL-22, but notIL-17. J Immunol 2008; 181: 7891–7901.

31 El-Shemi AG, Basalamah MA, Kensara OA, Ashshi AM. Interleukin-22 therapyattenuates the development of acute pancreatitis in rats. Clin Med Res 2011; 3:82–88.

32 Pan H, Hong F, Radaeva S, Gao B. Hydrodynamic gene delivery of interleukin-22protects the mouse liver from concanavalin A-, carbon tetrachloride-, and Fas ligand-induced injury via activation of Stat3. Cell Mol Immunol 2004; 1: 43–49.

33 Bansal A, Paliwal PK, Sagi SS, Sairam M. Effect of adjuvants on immune response andprotective immunity elicited by recombinant hsp60 (GroEL) of Salmonella typhiagainst S. Typhi infection. Mol Cell Biochem 2010; 337: 213–221.

34 Paliwal PK, Bansal A, Sagi SS, Mustoori S, Govindaswamy I. Cloning, expression andcharacterization of heat shock protein 60 (GroEL) of Salmonella enterica serovar typhiand its role in protective immunity against lethal Salmonella infection in mice. ClinImmunol 2008; 126: 89–96.

35 Paliwal PK, Bansal A, Sagi SS, Sairam M. Intraperitoneal immunization of recombinanthsp70 (Dnak) of Salmonella typhi induces a predominant Th2 response and protectiveimmunity in mice against lethal Salmonella infection. Vaccine 2011; 29: 6532–6539.

36 Borrego B, Fernandez-Pacheco P, Ganges L, Domenech N, Fernandez-Borges N,Sobrino F et al. DNA vaccines expressing B and T cell epitopes can protect mice fromfmdv infection in the absence of specific humoral responses. Vaccine 2006; 24:3889–3899.

37 Huygen K, Content J, Denis O, Montgomery DL, Yawman AM, Deck RR et al.Immunogenicity and protective efficacy of a tuberculosis DNA vaccine. Nat Med1996; 2: 893–898.

38 Michel ML, Davis HL, Schleef M, Mancini M, Tiollais P, Whalen RG. DNA-mediatedimmunization to the hepatitis b surface antigen in mice: aspects of the humoralresponse mimic hepatitis b viral infection in humans. Proc Natl Acad Sci USA 1995;92: 5307–5311.

39 Sedegah M, Hedstrom R, Hobart P, Hoffman SL. Protection against malaria byimmunization with plasmid DNA encoding circumsporozoite protein. Proc Natl AcadSci USA 1994; 91: 9866–9870.

40 Xiang ZQ, Spitalnik S, Tran M, Wunner WH, Cheng J, Ertl HC. Vaccination with aplasmid vector carrying the rabies virus glycoprotein gene induces protective immunityagainst rabies virus. Virology 1994; 199: 132–140.

41 Montgomery DL, Ulmer JB, Donnelly JJ, Liu MA. DNA vaccines. Pharmacol Ther 1997;74: 195–205.

42 Gurunathan S, Klinman DM, Seder RA. DNA vaccines: immunology, application, andoptimization. Annu Rev Immunol 2000; 18: 927–974.

43 Robinson HL. Nucleic acid vaccines: an overview. Vaccine 1997; 15: 785–787.44 Costa MP, McCulloch JA, Almeida SS, Dorella FA, Fonseca CT, Oliveira DM et al.

Molecular characterization of the Corynebacterium pseudotuberculosis hsp60-hsp10operon, and evaluation of the immune response and protective efficacy induced byhsp60 DNA vaccination in mice. BMC Res Notes 2011; 4: 243.

45 Ulmer JB, Sadoff JC, Liu MA. DNA vaccines. Curr Opin Immunol 1996; 8: 531–536.46 Abdelnoor AM. Plasmid DNA vaccines. Curr Drug Targets Immune Endocr Metabol

Disord 2001; 1: 79–92.47 Scheerlinck J-PY. Genetic adjuvants for DNA vaccines. Vaccine 2001; 19:

2647–2656.48 Gonzalez-Smith A, Vemulapalli R, Andrews E, Onate A. Evaluation of Brucella abortus

DNA vaccine by expression of cu-zn superoxide dismutase antigen fused to IL-2.Immunobiology 2006; 211: 65–74.

49 Singha H, Mallick AI, Jana C, Isore DP, Goswami TK, Srivastava SK et al. Escherio-somes entrapped DNA vaccine co-expressing Cu-Zn superoxide dismutase and IL-18confers protection against brucella abortus. Microbes Infect 2008; 10: 1089–1096.

50 Feng C, Jin J, Zou Q, Chen X, Zhou C, Wu B et al. Interleukin-21 inhibits humoralresponse to HIV DNA vaccine by enhancing Bcl-6 and Pax-5 expression. Viral Immunol2012; 25: 131–140.

51 Naderi M, Saeedi A, Moradi A, Kleshadi M, Zolfaghari MR, Gorji A et al. Interleukin-12as a genetic adjuvant enhances hepatitis c virus NS3 DNA vaccine immunogenicity.Virol Sin 2013; 28: 167–173.

52 Chow YH, Chiang BL, Lee YL, Chi WK, Lin WC, Chen YT et al. Development of Th1 andTh2 populations and the nature of immune responses to hepatitis B virus DNA vaccinescan be modulated by codelivery of various cytokine genes. J Immunol 1998; 160:1320–1329.

53 Kim JJ, Yang JS, VanCott TC, Lee DJ, Manson KH, Wyand MS et al. Modulation ofantigen-specific humoral responses in rhesus macaques by using cytokine cDNAs asDNA vaccine adjuvants. J Virol 2000; 74: 3427–3429.

54 Zhao F, Wang S, Zhang X, Gu W, Yu J, Liu S et al. Protective efficacy of a Treponemapallidum Gpd DNA vaccine vectored by chitosan nanoparticles and fused withinterleukin-2. Can J Microbiol 2012; 58: 117–123.

55 Sonnenberg GF, Fouser LA, Artis D. Border patrol: regulation of immunity, inflammationand tissue homeostasis at barrier surfaces by IL-22. Nat Immunol 2011; 12:383–390.

56 Zenewicz LA, Flavell RA. Recent advances in IL-22 biology. Int Immunol 2011; 23:159–163.

57 El-Shemi AG, Basalamah MA, Kensara OA, Ashshi AM. Interleukin-22 therapyattenuates the development of acute pancreatitis in rats. J Clin Med Res 2011; 3:82–88.

58 Torres CA, Yang K, Mustafa F, Robinson HL. DNA immunization: Effect of secretion ofDNA-expressed hemagglutinins on antibody responses. Vaccine 1999; 18: 805–814.

59 Rothel JS, Waterkeyn JG, Strugnell RA, Wood PR, Seow HF, Vadolas J et al. Nucleicacid vaccination of sheep: use in combination with a conventional adjuvanted vaccineagainst Taenia ovis. Immunol Cell Biol 1997; 75: 41–46.

60 HogenEsch H. Mechanisms of stimulation of the immune response by aluminumadjuvants. Vaccine 2002; 20: S34–S39.

61 D’Elios MM, Benagiano M, Della Bella C, Amedei A. T-cell response to bacterial agents.J Infect Dev Ctries 2011; 5: 640–645.

62 Finkelman FD, Holmes J, Katona IM, Urban JF Jr., Beckmann MP, Park LS et al.Lymphokine control of in vivo immunoglobulin isotype selection. Annu Rev Immunol1990; 8: 303–333.

63 Spellberg B, Edwards JE Jr.. Type 1/Type 2 immunity in infectious diseases. Clin InfectDis 2001; 32: 76–102.

64 O’Garra A, Arai N. The molecular basis of T helper 1 and T helper 2 cell differentiation.Trends Cell Biol 2000; 10: 542–550.

65 Muhl H, Bachmann M, Pfeilschifter J. Inducible NO synthase and antibacterial hostdefence in times of Th17/Th22/T22 immunity. Cell Microbiol 2011; 13: 340–348.

66 van de Veerdonk FL, Gresnigt MS, Kullberg BJ, van der Meer JW, Joosten LA, NeteaMG. Th17 responses and host defense against microorganisms: an overview. BMB Rep2009; 42: 776–787.

67 Mastroeni P, Vazquez-Torres A, Fang FC, Xu Y, Khan S, Hormaeche CE et al.Antimicrobial actions of the nadph phagocyte oxidase and inducible nitric oxidesynthase in experimental Salmonellosis. I. Effects on microbial proliferation and hostsurvival in vivo. J Exp Med 2000; 192: 237–248.

68 Raffatellu M, George MD, Akiyama Y, Hornsby MJ, Nuccio SP, Paixao TA et al.Lipocalin-2 resistance confers an advantage to Salmonella enterica serotype typhimur-ium for growth and survival in the inflamed intestine. Cell Host Microbe 2009; 5:476–486.

69 Ziesche E, Bachmann M, Kleinert H, Pfeilschifter J, Muhl H. The Interleukin-22/Stat3pathway potentiates expression of inducible nitric-oxide synthase in human coloncarcinoma cells. J Biol Chem 2007; 282: 16006–16015.

70 Green SJ, Nacy CA, Meltzer MS. Cytokine-induced synthesis of nitrogen oxides inmacrophages: a protective host response to leishmania and other intracellularpathogens. J Leukoc Biol 1991; 50: 93–103.

71 Edsall G, Gaines S, Landy M, Tigertt W, Sprinz H, Trapani R-J et al. Studies oninfection and immunity in experimental typhoid fever I. Typhoid fever in chimpanzeesorally infected with Salmonella typhosa. J Exp med 1960; 112: 143–166.

72 Spaun J. Studies on the influence of the route of immunization in the active mouseprotection test with intraperitoneal challenge for potency assay of typhoid vaccines.Bull World Health Organ 1964; 31: 793.

73 Esposito VM, Feeley JC, Leeder WD, Pittman M. Immunological response of threemouse strains to typhoid vaccine and vi antigen. J Bacteriol 1969; 99: 8–12.

74 Collins FM, Carter PB. Growth of salmonellae in orally infected germfree mice. InfectImmun 1978; 21: 41–47.

75 Godinez I, Haneda T, Raffatellu M, George MD, Paixao TA, Rolan HG et al. T cells helpto amplify inflammatory responses induced by Salmonella enterica serotype typhimur-ium in the intestinal mucosa. Infect Immun 2008; 76: 2008–2017.

76 Raffatellu M, Santos RL, Verhoeven DE, George MD, Wilson RP, Winter SE et al.Simian immunodeficiency virus-induced mucosal interleukin-17 deficiency promotesSalmonella dissemination from the gut. Nat Med 2008; 14: 421–428.

77 Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA et al. Shortprotocols in molecular biology. John Wiley & Sons, New York, 2002.

78 Zhang X, Goncalves R, Mosser DM. The isolation and characterization of murinemacrophages. Curr Protoc Immunol 2008, Chapter 14: Unit 14.1.


651


Co-expression of S. Typhi GroEL and IL-22 gene augments immune responses against Salmonella...

Documents

Transcript of Co-expression of S. Typhi GroEL and IL-22 gene augments immune responses against Salmonella...