CHOLESTEROL METABOLISM AS A TARGET IN CASTRATION ...

CHOLESTEROL METABOLISM AS A TARGET IN CASTRATION-RESISTANT PROSTATE

CANCER

by

JACOB GORDON

B.Sc. (Hons), Dalhousie University, 2012

A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE

DEGREE OF

DOCTOR OF PHILOSOPHY

in

THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES

(Pharmaceutical Sciences)

THE UNIVERSITY OF BRITISH COLUMBIA

(Vancouver)

July 2018

© Jacob Gordon, 2018

ii

The following individuals certify that they have read, and recommend to the Faculty of Graduate and

Postdoctoral Studies for acceptance, the dissertation entitled:

Cholesterol Metabolism as a target in castration-resistant prostate cancer

submitted by Jacob Gordon in partial fulfilment of the requirements for

the degree of Doctor of Philosophy

in Pharmaceutical Sciences

Examining Committee:

Michael Cox, Pharmaceutical Sciences

Co-supervisor

Kishor Wasan, Pharmaceutical Sciences

Co-supervisor

Emma Guns, Experimental Medicine

Supervisory Committee Member

Vince Duronio, Experimental Medicine

University Examiner

William Wei-Guo Jia, Experimental Medicine

University Examiner

Additional Supervisory Committee Members:

Urs Hafeli, Pharmaceutical Sciences


Abby Collier, Pharmaceutical Sciences


iii

ABSTRACT

Despite clinical benefits of existing prostate cancer treatments, patients continue to develop

therapeutic resistance. Persistence of androgen receptor pathway activity is attributed to several

mechanisms associated with resistance, including intratumoral androgen receptor agonist synthesis from

the precursor cholesterol. Cholesterol has been correlated to poor outcomes in patients and clinically the

use of cholesterol synthesis inhibitors, statins, improves prostate cancer survival. The expression of the

high-density lipoprotein-cholesterol receptor, scavenger receptor B1 (SR-B1), is elevated in castration-

resistant prostate cancer models and has been linked to poor survival of patients. The overarching

hypothesis of this thesis is that cholesterol modulation, through either synthesis or uptake inhibition, will

impact essential signaling processes impeding the proliferation of prostate cancer. Clinically statin use

was found to improve the overall survival of metastatic castration-resistant prostate cancer patients

receiving the androgen synthesis inhibitor abiraterone. In vivo experiments demonstrated the ability of

statins to impede post-castration biochemical recurrence and reduce tumor growth and androgen receptor

agonist synthesis in LNCaP-derived xenograft tumors. SR-B1 was found to be overexpressed in clinical

samples from both local and metastatic prostate cancer. Antagonism of SR-B1 in steroid responsive C4-2

cells decreased cholesterol uptake and growth and induced cell cycle arrest. Initially attributed to an

observed decrease in de novo steroid synthesis and androgen receptor activity, the inability of exogenous

steroid to restore cellular proliferation or androgen receptor activity indicated steroid independent cellular

arrest. As such, cellular stress and nutrient deprivation responses were assessed and SR-B1 antagonism

was found to induce both autophagy and endoplasmic reticulum stress markers. Given the steroid-

independent manner of SR-B1 antagonism mediated cellular arrest, the effects of SR-B1 antagonism on

androgen independent PC-3 cells was assessed and found to result in robust cellular death in vitro and

decreased growth of xenograft tumors. These findings demonstrate that the reduction of cellular

cholesterol availability can impede prostate cancer proliferation through both decreased steroid-synthesis

and steroid-independent mechanisms providing a potential therapeutic target for the treatment of prostate

cancer.

iv

LAY SUMMARY

Prostate cancer is managed by therapies that block the production of androgen sex hormones, or

inhibit activation of the androgen receptor. Resistance to these therapies is inevitable due to several

adaptations, including the tumor acquiring the ability to produce its own androgens. In addition to the

production of androgens, cholesterol is essential for numerous cellular functions needed to maintain

metabolism for rapid tumor growth. The research described in this thesis demonstrates that antagonizing

the cancers ability to obtain cholesterol impedes tumor growth and the production of essential androgens,

while clinically cholesterol lowering drugs improve outcomes of patients with advanced stage prostate

cancer. Lastly a key protein for the import of cholesterol into the cell, scavenger receptor B1 is identified

as a novel therapeutic target in advanced prostate cancer. Highly expressed in prostate cancer, the

inhibition of scavenger receptor B1 reduces cancer growth through the reduction of androgens and other

mechanisms. In summary, the findings of this thesis highlight the potential of targeting cholesterol

metabolism as an approach to prostate cancer treatment.

v

PREFACE

This thesis was conducted at the University of British Columbia (UBC) and Vancouver Prostate

Centre (VPC) with support from clinicians and researchers at the British Columbia Cancer Agency

(BCCA). Contributions of collaborators are acknowledged below.

Chapter 2: The work assessing clinical outcomes of prostate cancer patients at the British

Columbia Cancer Agency has become a component of a multi-institutional international study recently

accepted for publication in the peer-reviewed journal Oncotarget. The British Columbia portion of the

study was carried out under the supervision of Dr. Bernhard J. Eigl (BCCA). Database construction was

performed by Dr. Jenn Locke (VPC) and myself. Univariate statistical analysis was performed by me and

multivariate statistical modelling was performed by Dr. Gregory Pond (McMaster University). Data

interpretation described herein is my own while interpretations found in the multi-institutional study were

collaborative among listed authors. All clinical work was carried out in accordance with human ethics

protocol: H13-01851 CRPC Retrospective Hormonal Agents Database.

The in vivo experiments described in the latter half of the chapter have been published and peer-

reviewed in the journal Prostate Cancer and Prostatic Diseases in the year 2016. All experiments were

designed and conducted by myself under the supervision of Dr. Kishor M. Wasan and Dr. Michael E.

Cox. General assistance was provided by Mr. Ankur Midha and Dr. Yubin Guo, while LC-MS assistance

was provided by Mr. Andras Szeitz and Mr. Hans Adomat under the supervision of Dr. Tara Klassen and

Dr. Emma S. Guns respectively. All animal experiments in this chapter were carried out in accordance

with UBC animal ethics protocol: UBC ACC A12-0211.

Publications:

Gordon JA, et al. (2018) Statin use and survival in patients with metastatic castration-resistant

prostate cancer treated with abiraterone or enzalutamide after docetaxel failure: the international

retrospective observational STABEN study. Oncotarget. (Accepted)

Gordon JA, et al. (2016) Oral simvastatin administration delays castration-resistant progression

and reduces intratumoral steroidogenesis of LNCaP prostate cancer xenografts. Prostate Cancer

and Prostatic Diseases. 19(1);21-27

vi

Chapter 3: The experiments assessing the therapeutic potential of targeting SR-B1 are currently

undergoing peer-review for publication. All experiments described in this chapter were designed and

conducted by myself under the supervision of Dr. Kishor M. Wasan and Dr. Michael E. Cox unless

otherwise stated. Immunohistochemical staining was conducted courtesy of Dr. Colm Morrissey and

scored by Dr. Gang Wang and Dr. Fatemah Derakshan. Access to the Shanghai Cohort mRNA expression

database was provided courtesy of Dr. Collin Collins and access to the Fred Hutchinson Rapid Autopsy

mRNA expression database courtesy of Dr. Colm Morrissey. Fluorescent imaging was conducted with the

assistance of Mr. Jonathan Frew.

Publications:

Gordon JA, et al. Targeting scavenger receptor B1 in castration-resistant prostate cancer. (2018,

Submitted)

Chapter 4: The work assessing BLT-1 use in vivo will in part be published alongside findings

from Chapter 3 currently undergoing peer-review for publication. All experiments were designed and

conducted by myself with assistance from Dr. Emma S. Guns under the supervision of Dr. Kishor M.

Wasan and Dr. Michael E. Cox. General animal support was provided by Ms. Mei Chin and LC-MS

support and expertise provided by Mr. Hans Adomat. All animal experiments in this chapter were carried

out in accordance with UBC animal ethics protocol: UBC ACC A16-0072.

Publications:

Gordon JA, et al. Targeting scavenger receptor B1 in castration-resistant prostate cancer. (2018,

Submitted)

vii

TABLE OF CONTENTS

ABSTRACT ................................................................................................................................................ iii

LAY SUMMARY ....................................................................................................................................... iv

PREFACE .................................................................................................................................................... v

TABLE OF CONTENTS ......................................................................................................................... vii

LIST OF TABLES ...................................................................................................................................... x

LIST OF FIGURES ................................................................................................................................... xi

LIST OF ABBREVIATIONS .................................................................................................................. xii

ACKNOWLEDGEMENTS .................................................................................................................... xvi

DEDICATION......................................................................................................................................... xvii

CHAPTER 1: INTRODUCTION .............................................................................................................. 1

1.1 Prostate cancer epidemiology .......................................................................................................... 1

1.2 Structure and development of the prostate .................................................................................... 2

1.3 Androgen receptor ............................................................................................................................ 2

1.4 Androgens and steroid hormones.................................................................................................... 3

1.5 Prostate cancer development ........................................................................................................... 5

1.6 Diagnosis, Gleason grading and staging of prostate cancer.......................................................... 6

1.7 Local therapies for prostate cancer................................................................................................. 8

1.8 Androgen deprivation therapy ........................................................................................................ 9

1.9 CRPC and mechanisms of progression ......................................................................................... 10

1.10 Other androgen receptor pathway targeted treatments ........................................................... 12

1.11 Chemotherapeutic approaches to CRPC treatment .................................................................. 16

1.12 Immunotherapies and other systemic treatments for CRPC ................................................... 17

1.13 Cholesterol structure and distribution ....................................................................................... 18

1.14 Cellular cholesterol metabolism .................................................................................................. 19

1.15 Scavenger Receptor B1 ................................................................................................................ 21

1.16 Lipoproteins and cholesterol transport ...................................................................................... 23

1.17 Cholesterol and prostate cancer .................................................................................................. 24

1.18 Research rationale ........................................................................................................................ 27

1.19 Hypothesis ..................................................................................................................................... 27

CHAPTER 2: THE IMPACT OF STATIN USE ON DE NOVO STEROIDOGENESIS AND

CLINICAL OUTCOMES OF CRPC PATIENTS RECEIVING ABIRATERONE .......................... 29

2.1 Specific aim and rationale .............................................................................................................. 29

2.2 Methods ........................................................................................................................................... 29 2.2.1 Analysis of abiraterone patients at the British Columbia Cancer Agency ................................ 29

2.2.2 LNCaP xenografts ..................................................................................................................... 30

2.2.3 Simvastatin and simvastatin hydroxy acid LC-MS ................................................................... 31

2.2.5 Alanine transaminase assay ....................................................................................................... 33

2.2.6 Cholesterol LC-MS ................................................................................................................... 33

2.2.7 Steroid LC-MS .......................................................................................................................... 34

2.2.8 Quantitative PCR....................................................................................................................... 34

2.3 Results .............................................................................................................................................. 35 2.3.1 Statin use improves the overall survival and PSA declines of men receiving abiraterone for

locally advanced or metastatic CRPC ................................................................................................ 35

2.3.2 Oral administration of simvastatin resulted in clinically relevant serum concentrations and

reduced serum cholesterol .................................................................................................................. 43

viii

2.3.3 Simvastatin administration does not result in overt toxicity ..................................................... 44

2.3.4 Simvastatin administration reduces tumor volume ................................................................... 44

2.3.5 Simvastatin treatment suppresses intratumoral androgen accumulation and alters androgen

receptor activity .................................................................................................................................. 47

2.3.6 Simvastatin treatment alters cholesterol metabolism ................................................................ 48

2.4 Discussion ........................................................................................................................................ 51

CHAPTER 3: SR-B1 A NOVEL TARGET FOR PROSTATE CANCER TREATMENT

THROUGH ANDROGEN RECEPTOR PATHWAY-DEPENDENT AND –INDEPENDENT

MECHANISMS......................................................................................................................................... 58


3.2 Methods ........................................................................................................................................... 58 3.2.1 Immunohistochemical and mRNA expression analysis of clinical samples ............................. 58

3.2.2 Prostate cancer cell lines ........................................................................................................... 59

3.2.3 Antibodies ................................................................................................................................. 59

3.2.4 RNA-interference transfection protocol .................................................................................... 60

3.2.5 BLT-1 treatment protocol .......................................................................................................... 60

3.2.6 HDL-cholesterol uptake assay................................................................................................... 60

3.2.7 Quantitative PCR....................................................................................................................... 61

3.2.8 IncuCyte Zoom cellular growth assay ....................................................................................... 62

3.2.9 Live/Dead cytotoxicity assay .................................................................................................... 62

3.2.10 Cell cycle analysis ................................................................................................................... 63

3.2.11 Western blotting ...................................................................................................................... 63

3.2.12 Fluorescent microscopy ........................................................................................................... 64

3.2.13 Steroid analysis by LC-MS ..................................................................................................... 64

3.2.14 PSA secretion quantification ................................................................................................... 65

3.2.15 Statistical analyses ................................................................................................................... 65

3.3 Results .............................................................................................................................................. 65 3.3.1 SR-B1 is highly expressed in primary, metastatic and neuroendocrine prostate cancer ........... 65

3.3.2 SR-B1 antagonism alters cholesterol metabolism of castration-resistant C4-2 cells ................ 69

3.3.3 SR-B1 antagonism inhibits cellular proliferation of C4-2 cells ................................................ 70

3.3.4 SR-B1 antagonism can induce sub G0 and G0 – G1 cell cycle accumulation ............................ 73

3.3.5 SR-B1 antagonism reduces cellular androgen accumulation and AR activity in steroidogenic

C4-2 cells ........................................................................................................................................... 73

3.3.6 SR-B1 knockdown phenotype is not rescued by exogenous steroid ......................................... 75

3.3.7 SR-B1 antagonism induces cell stress and autophagy pathways .............................................. 77

3.3.8 SR-B1 antagonism reduces cholesterol uptake and induces robust cell death in androgen

independent PC-3 cells ....................................................................................................................... 80

3.3.9 SR-B1 co-targeting can amplify the effects of singular agents ................................................. 83

3.4 Discussion ........................................................................................................................................ 85

CHAPTER 4: EVALUATION OF BLT-1 AS AN IN VIVO INHIBITOR OF SR-B1 ....................... 92


4.2 Methods ........................................................................................................................................... 92 4.2.1 Microsomal assay ...................................................................................................................... 92

4.2.2 Pharmacokinetic and toxicity analysis ...................................................................................... 92

4.2.3 BLT-1 analysis by LC-MS ........................................................................................................ 93

4.2.4 Xenograft experiments .............................................................................................................. 94

4.3 Results .............................................................................................................................................. 95 4.3.1 BLT-1 is rapidly metabolized by mouse liver microsomes ....................................................... 95

4.3.2 Oral administration of BLT-1 results in relevant serum concentrations ................................... 96

4.3.3 50 mg/kg BLT-1 induces overt toxicity in C4-2 tumor bearing mice ....................................... 97

ix

4.3.4 BLT-1 administration reduces PC-3 tumor growth ................................................................. 100

4.4 Discussion ...................................................................................................................................... 102

CHAPTER 5: DISCUSSION AND CONCLUSIONS ......................................................................... 107

5.1 Limitations and alternatives ........................................................................................................ 108 5.1.1 Pleiotropic effects of statin therapy ......................................................................................... 108

5.1.2 Alternative mechanisms of cholesterol targeting .................................................................... 109

5.1.3 Pleiotropic effects of SR-B1 antagonism ................................................................................ 109

5.2 Future directions ........................................................................................................................... 110 5.2.1 Statins and PCa........................................................................................................................ 110

5.2.2 SR-B1 and PCa........................................................................................................................ 111

5.3 Conclusions.................................................................................................................................... 117

References ................................................................................................................................................ 120

x

LIST OF TABLES

TABLE 2.1: COMORBIDITY SCORE WEIGHTING OF CHARLSON INDEX. ....................................................... 30 TABLE 2.2: BASELINE CHARACTERISTICS AND OUTCOMES OF BRITISH COLUMBIA ABIRATERONE

PATIENTS ............................................................................................................................................ 36 TABLE 2.3: OUTCOMES BY STATIN STATUS OF ABIRATERONE PATIENTS ................................................... 38 TABLE 2.4: PSA DECLINES OF >30% AND >50% BY STATIN STATUS OF ABIRATERONE PATIENTS ............ 38 TABLE 2.5: PROGNOSTIC FACTORS FOR OVERALL SURVIVAL DETERMINED BY MULTIVARIATE COX

REGRESSION ANALYSES FOR BRITISH COLUMBIA ABIRATERONE PATIENTS ...................................... 40 TABLE 2.6: PROGNOSTIC FACTORS FOR PSA RESPONSE (50% DECLINE FROM BASELINE) DETERMINED BY

MULTIVARIATE LOGISTIC REGRESSION ANALYSES FOR BRITISH COLUMBIA ABIRATERONE PATIENTS

............................................................................................................................................................ 41 TABLE 2.7: BREAKDOWN OF CHARLSON INDEX SCORING BY STATIN STATUS ........................................... 42 TABLE 2.8: BASELINE CHARACTERISTIC COMPARISON OF ABIRATERONE PATIENTS BY STATIN STATUS ... 42 TABLE 3.1: ANTIBODY SPECIFICATIONS FOR PRIMARY ANTIBODIES USED IN WESTERN BLOTTING ........... 59 TABLE 4.1 ASSESSMENT OF COMMON SERUM TOXICITY MARKERS FOLLOWING REPEATED BLT-1 DOSING

IN MICE ............................................................................................................................................... 99

xi

LIST OF FIGURES

FIGURE 1.1: PATHWAY OF TESTOSTERONE AND DHT SYNTHESIS ................................................................ 4 FIGURE 1.2: MECHANISMS OF CELLULAR CHOLESTEROL AND ANDROGEN METABOLISM IN CRPC ........... 13 FIGURE 2.1: STATIN USE PROLONGS SURVIVAL OF CRPC PATIENTS ON ABIRATERONE ............................. 38 FIGURE 2.2: ORAL SIMVASTATIN ADMINISTRATION RESULTS IN EFFICACIOUS AND CLINICALLY RELEVANT

SERUM CONCENTRATIONS IN THE ABSENCE OF TOXICITY .................................................................. 45 FIGURE 2.3: SIMVASTATIN SUPPRESSES POST-CASTRATION LNCAP XENOGRAFT GROWTH ...................... 46 FIGURE 2.4: SIMVASTATIN SUPPRESSES PSA PROGRESSION IN CASTRATED LNCAP XENOGRAFT MICE ... 47 FIGURE 2.5: SIMVASTATIN DOES NOT ALTER ANDROGEN PRECURSOR ACCUMULATION IN CASTRATED

LNCAP XENOGRAFT BEARING MICE .................................................................................................. 49 FIGURE 2.6: SIMVASTATIN SUPPRESSES INTRATUMORAL AND SERUM STEROID ACCUMULATION IN

CASTRATED LNCAP XENOGRAFT BEARING MICE .............................................................................. 50 FIGURE 2.7: SIMVASTATIN ADMINISTRATION ALTERS CHOLESTEROL METABOLISM IN THE ABSENCE OF

CHANGES TO AR EXPRESSION ............................................................................................................ 51 FIGURE 3.1: SR-B1 EXPRESSION IS INCREASED IN LOCAL AND METASTATIC PROSTATE CANCER .............. 67 FIGURE 3.2 SR-B1 EXPRESSION IS INCREASED IN PROSTATE CANCER ........................................................ 68 FIGURE 3.3 SR-B1 EXPRESSION IS INCREASED IN NEPC ............................................................................ 69 FIGURE 3.4 SR-B1 ANTAGONISM INHIBITS CHOLESTEROL UPTAKE AND INDUCES HMGCR EXPRESSION . 70 FIGURE 3.5 SR-B1 ANTAGONISM INHIBITS C4-2 CELL GROWTH ................................................................ 71 FIGURE 3.6 SR-B1 ANTAGONISM INDUCES CELL CYCLE ARREST AND DEATH ............................................ 72 FIGURE 3.7 SR-B1 ANTAGONISM REDUCES CELLULAR ANDROGEN ACCUMULATION AND AR ACTIVITY .. 75 FIGURE 3.8 ARRESTED SRBI KNOCKDOWN PHENOTYPE IS NOT RESCUED BY EXOGENOUS STEROID ......... 77 FIGURE 3.9 SR-B1 ANTAGONISM INDUCES CELL STRESS AND AUTOPHAGY PATHWAYS ............................ 78 FIGURE 3.10 COMPARISON OF PROTEIN QUANTIFICATION ASSAYS ............................................................ 80 FIGURE 3.11 SR-B1 ANTAGONISM INHIBITS CHOLESTEROL IN PC-3 CELLS ............................................... 81 FIGURE 3.12 SR-B1 ANTAGONISM INHIBITS CELL GROWTH IN PC-3 CELLS ............................................... 82 FIGURE 3.13 SR-B1 ANTAGONISM INDUCES ROBUST CELL CYCLE ARREST AND DEATH IN PC-3 CELLS .... 83 FIGURE 3.14 SR-B1 CO-TARGETING CAN AMPLIFY THE EFFECTS OF SINGULAR AGENTS ........................... 84 FIGURE 4.1 BLT-1 IS RAPIDLY METABOLIZED BY LIVER MICROSOMES ...................................................... 96 FIGURE 4.2 BLT-1 REDUCES SURVIVAL OF C4-2 XENOGRAFTS .................................................................. 97 FIGURE 4.3 BLT-1 REDUCES PC-3 XENOGRAFT TUMOR GROWTH ............................................................ 101

xii

LIST OF ABBREVIATIONS

Abbreviation Definition

4E-BP1/2 eIF-4E Binding Proteins

ABCA1 ATP-Binding Cassette Transporter A1

ABCG1 ATP-Binding Cassette Transporter G1

ACAT Acyl-CoA Cholesterol Acyltransferase

ACTH Adrenocorticotropin Hormone

ADT Androgen Deprivation Therapy

AKT Protein Kinase B

ALB Albumin

ALP Alkaline Phosphatase

ALT Alanine Transaminase

AMPK AMP-Activated Protein Kinase

AMY Amylase

ApoB Apolipoprotein B

AR Androgen Receptor

ARE Androgen Response Element

Atg12 Autophagy-related Protein 12

AUC Area Under Curve

BCR Biochemical Recurrence

BiP Binding Immunoglobulin Protein

BLT-1 Block Lipid Transport-1

BSA Bovine Serum Albumin

BUN Blood Urea Nitrogen

C/EBP Ccaat-Enhancer-Binding Proteins

CA Calcium

CaMKK-β Calmodulin-Dependent Protein Kinase Kinase 2

CAN Acetonitrile

CK Creatine Kinase

CLint-app Apparent Intrinsic Clearance

Clu Clusterin

Cmax Max Concentration

CRE Creatinine

CRPC Castration-Resistant Prostate Cancer

CTLA4 Cytotoxic T Lymphocyte-associated Antigen 4

DBD DNA Binding Domain

DHEA Dehydroepiandrosterone

DHEAS Dehydroepiandrosterone Sulfate

DHT Dihydrotestosterone

DiI 1,1′-dioctadecyl-3,3,3′,3′-tetramethylindocarbocyanine perchlorate

DMSO Dimethyl Sulfoxide

DRE Digital Rectal Exam

EBRT External Beam Radiation Therapy

xiii

EGFR Epidermal Growth Factor Receptor

eIF2α Eukaryotic Initiation Factor 2

eNOS Endothelial Nitric Oxide Synthase

ER Endoplasmic Reticulum

ETS E26 Transcription Specific

FACS Fluorescence Activated Cell Sorting

FGF Fibroblast Growth Factor

FPKM Fragments per Kilobase of Transcript per Million Mapped Reads

FSC Forward Scatter

FSH Follicle Stimulating Hormone

GLOB Globulin

GLU Glucose

GSK3 Glycogen Synthase Kinase 3

HDL High Density Lipoprotein

HIF1α Hypoxia-inducible Factor 1-alpha

HMGCR HMG-CoA Reductase

HSD Hydroxysteroid Dehydrogenase

IDL Intermediate Density Lipoprotein

IGF Insulin-like Growth Factor

IGFR Insulin-like Growth Factor 1 Receptor

IHC Immunohistochemical

INSIG Insulin Induced Gene 1

IRE1α Inositol-Requiring Enzyme 1 Alpha

IS Internal Standard

JNK C-Jun N-terminal Kinase

K+ Potassium

LBD Ligand Binding Domain

LC-MS Liquid Chromatography-Mass Spectrometry

LDL Low Density Lipoprotein

LDLr Low Density Lipoprotein Receptor

LH Luteinizing Hormone

LHRH Luteinizing Hormone-Releasing Hormone

LKB1 Liver Kinase B1

LXR Liver X Receptor

MDR1 P-glycoprotein

MTBE Methyl Tert-Butyl Ether

mTOR Mammalian Target of Rapamycin

Na+ Sodium

NAFLD Non-Alcoholic Fatty Acid Liver Disease

NC Negative Control RNAi duplex

NCCN National Comprehensive Cancer Network

NEPC Neuroendocrine Prostate Cancer

NF-kB Nuclear Factor Kappa-light-chain-enhancer of Activated B Cells

xiv

NO Nitric Oxide

NPC1 Niemann-Pick C1

NPC2 Niemann-Pick C2

NT Non-treated

NTD N-Terminal Domain

PAP Prostatic Acid Phosphatase

PBS Phosphate-Buffered Saline

PCa Prostate Cancer

PHOS Phosphorus

PI Propidium Iodide

PI3K Phosphoinositide 3-kinase

pRB Retinoblastoma protein

PSA Prostate Specific Antigen

PTEN Phosphatase and Tensin Homolog

RFU Corrected Florescence

RIPA Radioimmunoprecipitation Assay

S1P Site 1 Protease

S2P Site 2 Prostease

S6K1 S6 Kinase 1

SC Shanghai Cohort

SCAP SREBP Cleavage-activating Protein

SDS-PAGE SDS-Polyacrylamide Gel Electrophoresis

SF-1 Steroidogenic Factor-1

SHH Sonic Hedgehog

Sp1P Sphingosine-1-Phosphate

SQLE Squalene Monooxygenase

SR-B1 Scavenger Receptor B1

SRB1-KD Scavenger Receptor B1 Knock Down

SREBP Sterol Regulatory Element Binding Protein

SSC Side Scatter

StAR Steroidogenic Acute Regulatory Protein

TBIL Total Bilirubin

TBS-T Tris-buffered Saline, 0.1% Tween 20

TCGA The Cancer Genome Atlas-PRAD

TGFβ Transforming Growth Factor Beta

TNM Tumor-Node-Metastasis

TP Total Protein

TRAF2 TNF Receptor-Associated Factor 2

TRAMP TRansgenic Adenocarcinoma Mouse Prostate

UGE Urogenital Sinus Epithelium

UGM Urogenital Sinus Mesenchyme

UGS Urogenital Sinus

UGT UDP-glucuronosyltransferase

xv

ULDL Ultra Low Density Lipoprotein

ULK1/2 Unc-51 Like Autophagy Activating Kinase

UPR Unfolded Protein Response

UWRA University of Washington Rapid Autopsy

VLDL Very Low Density Lipoprotein

WC Weill Cornell

WGA Wheat Germ Agglutinin

XBP1 X-box Binding Protein 1

xvi

ACKNOWLEDGEMENTS

This thesis would not have been completed without the guidance and support of several

individuals. I would like to thank my supervisors Dr. Kishor Wasan and Dr. Michael Cox for their

continued mentorship from the start of my graduate studies both aiding in my development as an

academic. For Dr. Wasan providing me the opportunity to become a graduate student directly following

my undergraduate degree and introducing me to the world of pharmaceutical sciences and Dr. Cox

graciously accepting me into his laboratory and engaging the role of supervisor with full heart following

the departure of Dr. Wasan from the University of British Columbia. The members of the laboratory who

provided a friendly, supportive and engaging work environment, Dr. Mitali Pandey, Dr. Manju Sharma,

Dr. Yubin Guo, Jonathan Frew and Jake Noble and all of the members of the Vancouver Prostate Centre

and the Faculty of Pharmaceutical Sciences. Further, I would like to thank both the Prostate Cancer

Foundation of British Columbia and Prostate Cancer Canada providing me with financial support to

undertake my studies and the research within this thesis. Lastly, I am continually grateful to Dr. Jon

Campbell, Dr. Moe Wehbe and soon to be doctors Christian Buchwalder and Ankur Midha for their

support and comradery as we collectively went through our graduate studies.

xvii

DEDICATION

This work is dedicated to my loving parents John and Darlene, brothers Sam and Jonah,

partner Irene, grandparents Roy and Doreen, the farm girls Aunt Eileen and Aunt Sharon, the

Brodeur-Eyers and Afonsos and lastly my dearly departed grandparents Donald and Barbara.

Although she will never see the culmination of my years of graduate studies Grammy G’s loving

impact will forever be with me.

1

CHAPTER 1: INTRODUCTION

1.1 Prostate cancer epidemiology

An estimated 206,200 Canadians will have been diagnosed with new cases of cancer in 20171. Of

these new cases 21,300 will be cancers of the prostate accounting for 20.7% of the new cancers in men

and making prostate cancer (PCa) the 4th most diagnosed form of cancer following cancers of the lung,

colorectal region and breast. A vast majority of men diagnosed with the disease are over the age of 50

years (>99.9%) and approximately 85% of patients are diagnosed after the age of 65 years, while a

majority of men aged above 85 years show histological evidence of PCa2. The relative five and ten year

survival rates for prostate cancer are 99% and 96% respectively largely due to the near 100% survival

rates of those diagnosed with local disease3. However, those with distant disease have a relative 5 year

survival rate of only 29%. In total this translates to an expected 4,000 deaths due to prostate cancer in

2017 in Canada.

Both environmental and genetic factors have been deemed to play contributory roles in the risk of

developing PCa. The presence of PCa within the immediate family has been shown to increase the risk of

developing PCa, such that having one first-degree relative with the disease doubles PCa risk and two first-

degree relatives increasing risk by up to 11-fold2,4

. Racial and ethnic background further appears to have

association with PCa risk with African-Americans having amongst the highest rates and in general the

lowest rates being found among Asian populations. Although contributory effects of culture and

environment cannot be fully eliminated several potential genetic links have been identified5-7

.

Environmental factors can include diet, tobacco use and occupational exposure to chemicals such as

pesticides8,9

. Dietary studies have found a correlation between the consumption of red-meat as well as

high-fat diets to be positively associated with the development of PCa10-12

. While in contrast the

consumption of tomato and soy based products has been correlated to a reduction in the risk of

developing PCa2,13

.

2

1.2 Structure and development of the prostate

The prostate is an exocrine gland in the male reproductive system that functions to secrete

alkaline fluids contributing to the motility, and liquefaction of seminal fluids promoting successful

fertilization14,15

. The adult prostate consists of three regions, the central zone, the transition zone and the

peripheral zone each of different embryologic origin and structurally contains epithelial ductal regions

supported by smooth muscle stroma. The prostate gland originates from the urogenital sinus (UGS), in

contrast to the majority of male accessory sex gland that develop from the Wolffian ducts16

, and occurs

during the second and third trimester of pregnancy involving cross signaling between two components of

the UGS, the UGS mesenchyme (UGM) and the UGS epithelium (UGE)16,17

. Essential to the

differentiation and development of the prostate is the expression of the androgen receptor (AR), a nuclear

hormone receptor activated by natural ligands testosterone, and the more potent testosterone derivative

dihydrotestosterone (DHT). Produced predominantly in the testes of developed men, and to a smaller

extent by the adrenals and ovaries of women, androgen activation of the AR induces the expression of a

large number of genes18,19

.

Androgens initially act on the UGM, where AR activation initiates paracrine signaling that drives

the outgrowth of UGE derived epithelial buds into the surrounding UGM20

. The precise pattern of this

branching leads to the development of the mature glandular secretory epithelium21

. The developing UGE

will in turn promote UGM differentiation into the fibroblast and smooth muscle tissue observed in the

developed prostate. Several paracrine signaling pathways have been identified as playing important roles

in the development of the prostate including sonic hedgehog (SHH), fibroblast growth factor (FGF),

transforming growth factor beta (TGFβ) and insulin-like growth factor (IGF)16

.

1.3 Androgen receptor

Although not the primary focus of this thesis the AR is considered to be the central driver of PCa

and the focus of therapeutic approaches to disease management for patients with disseminated disease. In

brief, the AR belongs to the steroid hormone group of nuclear receptors which also includes the estrogen

3

receptor, and the glucocorticoid receptor among others22-24

. The 110 kDa protein, similar to other nuclear

receptor family members contains three major functional domains, the N-terminal domain (NTD), the

DNA binding domain (DBD) and the C-terminal ligand binding domain (LBD)22

. The NTD contains the

activation function -1 regions essential for AR transactivation, while the highly conserved DBD interacts

with the DNA promoter and the LBD provides a binding pocket for androgens25,26

. Once bound by DHT,

or other weaker activating androgens, displacing heat-shock proteins and binding importin-α the AR

translocates into the nucleus27,28

. Within the nucleus AR dimers bind to the androgen response element

(ARE) promoting the transcription of growth and survival genes28-31

.

1.4 Androgens and steroid hormones

Beyond the prostate, androgens and similar steroid hormones are an important part of the

endocrine system responsible for proper sexual development and function, metabolic homeostasis and

also help to regulate inflammation and immunity32,33

. Androgens are 19 carbon, four carbon ring

structures that are synthesized from the precursor cholesterol (Figure 1.1). Testosterone, containing a

ketone and hydroxyl functional group on opposing ends, is the primary circulating androgen in males

with significant levels of DHT and dehydroepiandrosterone sulfate (DHEAS) also being consistently

detectable34

. Controlled by the hypothalamic-pituitary-adrenal-gonadotropic axis, androgen production

takes place primarily in the Leydig cells of the testes with the adrenal cortex also producing DHEA35

.

Initially, the hypothalamus releases luteinizing hormone-releasing hormone (LHRH) which stimulates the

pituitary to in turn release luteinizing hormone (LH) and adrenocorticotropin hormone (ACTH). LH then

stimulates testosterone production in the testes while ACTH stimulates the adrenals to produce DHEA36

.

Testosterone is synthesized by the initial uptake of cholesterol into the mitochondria of steroidogenic cells

by steroidogenic acute regulatory protein (StAR) followed by side-chain cleavage of cholesterol into

pregnenolone by CYP11A1 (P450scc). This is followed by hydroxylase and lyase steps by CYP17A1 and

reduction steps by 3β-hydroxysteroid dehydrogenase (HSD) and 17β-HSD resulting in end product

testosterone36

.

4

Figure 1.1: Pathway of testosterone and DHT synthesis

The synthesis of AR-activating androgens testosterone and DHT from precursor cholesterol through the

standard (blue) and back-door pathways (red) displaying steroid structures and primary enzymes.

Circulating testosterone is mostly bound to serum sex hormone-binding globulin and albumin37,38

,

with debate surrounding the relative importance of free diffusion and protein bound endocytosed cellular

testosterone uptake39,40

. Once testosterone enters the prostate cell it is converted to the more potent AR

activating androgen DHT by 5α-reductase functioning to remove the Δ4,5 carbon double bond41

. Other

5

substrates for 5α-reductase include progesterone, androstenedione and aldosterone. 5α-reductase

inhibitors finasteride and dutasteride have been used to treat benign prostatic hyperplasia and hair loss in

men42,43

.

DHT is generally not highly excreted from tissue and is metabolized in the peripheral tissue in

which it is generated44,45

. Phase I metabolism of DHT by various isoforms of 3α/β-HSD and 17β-HSD

enzymes generates several constituents including androstenedione and androsterone46-48

. However,

potentially all of these tissues also possess the required HSD isoforms to convert the metabolized

constituents back into DHT and expression of phase I enzymes vary significantly between prostatic cell

types48-51

. It is believed that these constituents as well as DHT are capable of undergoing phase II

metabolism elimination. The UDP-glucuronosyltransferase (UGT) family of glucuronosyltransferases

catalyzes the transfer of glucuronic acid from UDP-glucuronic acid to various targeting molecules,

including androgens, generally resulting in a more polar and water soluble molecule for easy excretion.

The expression and role of individual UGTs in prostate cancer is still a debated topic with implicated

isoforms including UGT2B15 and UGT2B1752,53

.

1.5 Prostate cancer development

Tumorigenesis and malignant cancer development has long been understood to be a genetic

disease in which genetic mutations drive pre-malignant cells to overcome an inherent system of checks

and balances eventually leading to unabridged growth54

. Famously summarized by Hanahan and

Weinberg, these genetic mutations can be stratified into specific categories critical for malignant

transformation55,56

. Termed “Hallmarks of Cancer” these phenomena include sustained proliferative

signaling, evading growth suppressors, resisting cell death, enabling replicative immortality, inducing

angiogenesis and activating invasion and metastasis.

Although PCa is generally considered a cancer-type with low mutational burden and substantial

heterogeneity, several oncogenic mutations are consistently observed54

. In fact, recent sequencing efforts

have indicated that up 74% of primary prostate cancers can be stratified into one of seven subtypes

6

characterized by either gene fusions or mutations54

. Gene fusion events focus primarily on the E26

transcription specific (ETS) family of transcription factors (ERG, ETV1, ETV4, and FLI1) largely with

androgen regulated genes including TMPRSS2, SLC45A3, and NDRG154

. While common mutations

observed are SPOP, FOXA1, and IDH1. Other common, but not of the defined subtypes, drivers include

loss of functional phosphatase and tensin homolog (PTEN), p53 and retinoblastoma protein (pRB) tumor

suppressors54

. A vast majority of PCas including those with AR driven mutations and those with non-AR

related mutations express significant levels of the AR and validated AR target genes54

. This understanding

combined with the success of therapeutics that interrupt AR signaling and the mechanisms by which the

cancers evade these AR targeted therapies, discussed below, highlight the understanding that a majority of

PCas require sustained AR signaling to maintain proliferative signaling.

1.6 Diagnosis, Gleason grading and staging of prostate cancer

Initial PCa diagnosis generally consists of two important tests, the digital rectal exam (DRE) and

serum prostate specific antigen (PSA) measurement57

. A DRE allows for the detection of an enlarged

prostate and presence of abnormal nodules58

. The subjective nature of the test can lead to large amounts

of inter-examiner variability and is further limited due to it primarily addressing the dorsal prostate59

.

Serum PSA although used to aid in the diagnosis of PCa is primarily used to monitor changes in cancer

growth and progression as a correlate for monitoring tumor burden60

. PSA itself is an AR regulated serine

protease part of the kallikrein protease family, produced by prostatic epithelial tissue and secreted into the

lumen where it functions to cleave semenogelin I/II aiding in seminal fluid liquefaction61

. Normally

serum levels of PSA are low but can be elevated in response to several factors including PCa, benign

prostatic hyperplasia, prostatitis, urinary tract infection or trauma60

. Abnormal findings with these tests

are normally a precursor to a prostate biopsy for histopathological confirmation of cancer57

.

Originally developed in 1966 by Donald Gleason the Gleason grading system has since been used

to evaluate the prognosis of men diagnosed with PCa62

. Grading is based on the histological examination

of hematoxylin and eosin stained prostate biopsy specimens. The specimens are graded from 1,

7

characterized by a well-contained nodular lesion with well-differentiated glands, to grade 5 characterized

by poorly differentiated, stromal invasive cells often lacking glandular formation. As the obtained

specimens often harbor multiple Gleason patterns the Gleason scoring system was developed in which the

most common, primary, grade is combined with the second most common, secondary, grade yielding a

sum score with a higher number indicating a poorer prognosis62

. However, importantly the presence of

high-grade tertiary pattern is scored as the second component even if it is the third most present pattern.

Updates to the traditional Gleason grading system have been made, most notably in two distinct

forms. In 2005 the modified Gleason system was introduced by the International Society of Urologic

pathology. In summary the modified system essentially removed both 1 and 2 Gleason scores, citing low

reproducibility and inability to properly diagnose by needle biopsy and shifted certain growths including

cribriform growths from Gleason grade 3 to 462

. These changes led to an increase in the diagnosis of high

Gleason grade cancers and is generally considered to correlate better to clinical stage and patient

outcome63,64

. In 2016, the second major update to the Gleason grading system was proposed in which

patients are stratified into “Gleason grade groups” based on the correlation of specific Gleason scores to

progression free survival rates65

. The update included five groups of increasing odds of recurrence

following primary therapy. Grade group one includes all Gleason scores less than or equal to 6, grade

group two includes Gleason scores of 3 + 4 = 7, grade group three includes Gleason scores of 4 + 3 = 7,

Gleason group four includes Gleason scores equal to 8 and grade group five includes Gleason scores of 9

or higher. The five year biochemical recurrence free percentages following radical prostatectomy are 96%

for grade group one, 88% for grade group two, 63% for grade group three, 48% for grade group four and

26% for grade group five.

Beyond Gleason scoring the tumor-node-metastasis (TNM) staging system for the classification

of malignant tumors is a widely used standardized system for the classification of cancer66

. The system

describes the primary tumor (T) on a scale of 1 to 4 depending on the extent of external tissue invasion,

spread to the lymph node (N) generally ranked from 1 to 3 based on regional or distant lymph node

involvement and metastasis (M) present (1) or absent (0). The findings of this clinical staging process

8

combined with the Gleason scoring of the biopsy results provide critical information in guiding treatment

decisions and prognosis.

1.7 Local therapies for prostate cancer

Often times patients with low risk localized disease will defer active treatment opting instead for

an active surveillance approach involving increased frequency of PSA and DRE testing and prostate

biopsy67

. The increasing popularity of this approach has helped decrease instances of over-treatment and

the associated adverse effects. For local cancers considered too high risk for a surveillance approach,

based on factors described above, the potentially curative approaches of radical prostatectomy or radiation

therapy are generally considered. Radical prostatectomy involves the complete removal of the prostate

and surrounding tissues with the objective of removing all cancers tissue. This approach is generally

considered for lower risk patients with disease that remains encapsulated to the prostate due to concerns

over the ability to clear all cancerous tissue surgically in more disseminated disease68

. The procedure is

associated with a 10 year progression free survival rate of 88% in patients with low to intermediate risk

disease69

. Radiation therapy involves the use of ionizing radiation to kill malignant cells and is generally

considered for patients with extracapsular disease. External beam radiation therapy (EBRT), in which

ionizing radiation is externally applied to cancer, is associated with a 10 year progression free survival

rate of 90% and is the most common approach for intermediate to high risk PCa patients70

.

Brachytherapy, the insertion of sealed source radiation beads into or adjacent to the cancerous prostatic

tissue is also a treatment option for generally low-risk PCa patients.

For men with no evidence of metastatic disease these local therapies successfully remove or kill a

vast majority of the tumor leading to the observed high progression free survival rates. These numbers are

further bolstered by the heterogeneous nature of primary PCa tumors in that only an extremely limited

number of PCa cells possess the required mutations to escape the primary site and proliferate as a distant

metastasis71

. However, the highly unstable nature of these rapidly dividing cells drives genomic evolution

of populations of cells that not only display metastatic potential but also allow for the development of

9

therapeutic resistance72

. If these primary therapies fail to remove all cells with metastatic potential or if

metastatic populations already exist, whether dormant or of undetectable size, the likelihood of recurrence

is increased. For the approximately 20%-30% of surgery or radiation therapy patients that do eventually

recur following local treatment or those that present with high-risk localized or metastatic disease on

diagnosis systemic approaches are required73,74

.

1.8 Androgen deprivation therapy

Of those patients requiring systemic approaches, whether with confirmed metastatic disease or

progressed local disease, androgen deprivation therapy (ADT) has long been the mainstay approach,

functioning to reduce AR-mediated cell signaling through the reduction of circulating gonadal

testosterone57,75,76

. Used as a catch-all term for the reduction of circulating testosterone different

approaches have been used since the advent of the therapy. These approaches include surgically through

bilateral orchiectomy, or with small molecule LHRH agonist and antagonists75,76

. LHRH acting agents,

such as goserelin or leuprolide, decrease signaling through the hypothalamic-pituitary-adrenal-

gonadotropic axis leading to a near total reduction in testosterone production and similar or slightly

improved survival rates to orchiectomy but may result in increased adverse events77,78

. With the non-

invasive and reversible nature of small molecule approaches compared to surgery, LHRH agents are the

most common and preferred method of ADT.

ADT is believed to induce a therapeutic response in approximately 90% of patients and provide

varying progression-free and overall survival benefits depending on previous treatment and its use as a

primary, adjuvant or neoadjuvant therapy79

. In men with advanced disease ADT has approximate

progression free and overall survival times of 16 months and 36 months respectively, however beneficial

effects may be limited to quality of life improvements as opposed to true survival benefits75,80,81

.

However, when given as an adjuvant to EBRT, ADT has been shown to improve outcomes in a number

of studies68,75,82

, with increases in five year overall survival by up to 26% compared to solo radiation

therapy and increases in five year disease free rate of up to 37%. As such the National Comprehensive

10

Cancer Network (NCCN) recommends ADT plus EBRT for patients with high-risk disease75

. Despite

these described benefits ADT, when given alone or with EBRT, the approach is not considered curative as

a majority of patients will eventually suffer disease recurrence into what is termed castration-resistant

prostate cancer (CRPC)83

. Traditional findings place the median overall survival rate between 12 months

and 18 months for patients with CRPC84-86

, however recent investigations of the modern CRPC landscape

indicate median overall survival times could be up to 40 months or higher87-89

. This large improvement in

median overall survival is likely a result of the growing number of therapies available to CRPC patients

and the improved implementation of said therapies described below.

1.9 CRPC and mechanisms of progression

As described above PCas that fail primary ADT are termed CRPC. The multiple mechanisms by

which the cancer overcomes ADT are still being elucidated and remain an intense area of research90

. The

observed increase in PSA, an AR regulated protein, and the observed successes of abiraterone and

enzalutamide in castrate-resistant progression reflects the continued activation of the AR despite castrate-

level serum testosterone and as such a majority of CRPC mechanisms revolve around the AR axis91

.

Increased expression of the AR has been correlated to CRPC via gene amplification and may be

present in up to 30% of CRPCs92,93

. Further, increased activation and expression of the AR through the

loss of pRB has been demonstrated as a potential driver of castrate-resistant progression94

. pRB is a

critical negative regulator of tumor development through the suppression of cell cycle progression via

complex mechanisms including the suppression of activator E2Fs95,96

. The loss of pRB expression has

been demonstrated in up to 73% of CRPCs and is thought to both lead to increased AR-target gene

occupancy and AR mRNA dysregulation leading to increased AR expression94

. Efforts of impeding AR

activity directly have been made through the use of current generation AR antagonists, enzalutamide, and

traditional agents, such as flutamide and bicalutamide.

Several alterations directly to the AR have been proposed as drivers for castrate-resistant

progression. Thought to increase in frequency through the selective pressure of anti-androgens AR

11

mutations may be present in up to 50% of CRPCs97-99

. These mutations include alterations in the NTD

altering cofactor binding100

, and mutations in the LBD conferring a loss of ligand specificity97,101

. The

first described mutation to drive a loss in specificity was a threonine to alanine (T877A) substitution in

LNCaP based models which has since been confirmed in up to 30% of bone metastases97,101

. This

mutation allows for AR activation in response to estrogens, progestins and the activated form of

flutamide102

. Further mutations have since been documented allowing activation by alternative steroid

molecules, estrogens, corticosteroids and androgen precursor progesterone103,104

.

The identification of splice variants provided a further AR based explanation for the development

of CRPC105,106

. Several of these variants result in the deletion of the exons coding the LBD leading to a

constitutively active AR lacking the LBD107,108

. These splice variants are thought to be upregulated in the

presence of anti-androgens such as enzalutamide conferring resistance to multiple levels of androgen

targeted therapies109

. Further, AR based mechanisms include alterations in post-translational

modification110

and changes in co-regulator function111

. An in depth discussion of these mechanisms is

described by Karantanos et al.90

. Efforts to overcome these splice variants include the development of

DBD antagonists such as EPI-506 currently undergoing early clinical trials112

.

Several mechanisms of castration-resistant progression independent of AR pathway activity have

been proposed. C-myc expression is known to play a critical role in prostate cancer development113

, has

been shown to be amplified in up to 72% of CRPCs114

and prostate cancer cell growth under ADT

conditions has been correlated to c-myc expression115

. Alterations in the phosphoinositide 3-kinase

(PI3K) signaling pathway, notably PTEN loss, are also thought to play a role with very high incidence of

alterations in metastatic cancers116

and lead to alterations in protein kinase B (AKT) and mammalian

target of rapamycin (mTOR) signaling117-119

. Several compounds targeting these pathways have

progressed to early clinical trials, including PX-866 and GSK2636771 as PI3K inhibitors and

GSK2141795 and AZD5363 as AKT inhibitors, but to date none have achieved clinical success120

.

Despite the number of proposed mechanisms of castration-resistance, the concept of de novo

steroidogenesis has proven to be perhaps the most clinically validated and actionable. Despite continued

12

castrate serum levels of testosterone it has been found that intratumoral levels of both testosterone and

DHT remain similar to levels found in hormone-naïve cancers121

. Further, evidence suggests that essential

enzymes in the androgen synthesis pathway are stimulated within the tumor microenvironment and that

PCa bone metastases are capable of converting adrenal derived androgens to testosterone and DHT122-125

.

Mechanisms by which the tumor can synthesize DHT bypassing testosterone have also been identified

often referred to as the “backdoor pathway” (Figure 1.1)126,127

. From which precursor the late stage

androgens in CRPC are derived is currently a debated topic with likely multiple contributing pathways.

Testicular androgens have been demonstrated to potentially only account for as little as 60% of the total

androgen content of the prostate with the remainder likely a result of the conversion of adrenal derived

DHEA to testosterone and DHT (Figure 1.2)128-130

. This understanding has led to the belief that adrenal

derived DHEA is the predominant source of testosterone precursor following ADT131-133

. However, a

significant portion of the research describing the phenomenon of de novo steroidogenesis has been

performed in mouse based xenograft models123,126,134

. Mice are reported to not secrete DHEA or other

androgens from their adrenals which highlights the ability of testosterone production, at least in

experimental models, to be derived from precursor cholesterol within the tumor123,135-138

. While not fully

elucidated it appears likely that tumor testosterone production occurs from both cholesterol and adrenal

derived DHEA. The importance of these mechanisms is emphasized by the success of abiraterone

clinically, further described below139-141

.

1.10 Other androgen receptor pathway targeted treatments

In most cases advanced PCa is treated by an LHRH agent in concert with the use of an AR

inhibitor to reduce testosterone related side effects and further aid in the shutdown of AR

signaling57,75,76,142

. Common traditional AR inhibitors include flutamide and bicalutamide which

competitively bind to the LBD of the AR preventing activation and nuclear translocation. In theory the

addition of AR inhibitors to ADT prevent AR activation by remaining gonadal derived androgens, non-

gonadal derived androgens and mute any effects of the testosterone flair associated with LHRH agents.

13

However, the extent to which this combinatorial approach correspond to an improvement in overall

survival is minimal at best80,143-145

. The inability of these agents to improve the survival of men

undergoing ADT has been attributed primarily to both a lack of potency and concerns of partial agonism

of mutated AR146,147

Despite uncertainty surrounding survival benefits AR inhibitors are believed to aid in

pain relief and other side effects associated with testosterone flare148

. As such traditional AR antagonists

are still commonly prescribed, however with the recent successes of current generation AR antagonist

enzalutamide and CYP17A1 inhibitor abiraterone the treatment landscape is rapidly changing.

Figure 1.2: Mechanisms of cellular cholesterol and androgen metabolism in CRPC

Cholesterol is taken up into the cell through membrane transporters LDLr and SR-B1 and synthesized via

the mevalonate pathway and HMGCR. Cellular cholesterol can be converted for storage as cholesteryl

ester by ACAT, metabolized from cholesteryl ester to cholesterol by HSL and excreted from the cell by

ABCA1. Prior to conversion to DHT and AR-activation testosterone can be obtained by the cell through

uptake from circulation or synthesis from circulation derived DHEA, or cellular cholesterol.

14

Enzalutamide, first approved for clinical use in 2012, has come to represent the first of potentially

several current generation AR antagonists. Driving candidate selection for a novel AR antagonist was the

attempt to account for the shortcomings of traditional AR antagonists such that pre-clinically

enzalutamide (IC50: 36 nM) demonstrates at least four-fold higher binding affinity for the AR compared to

bicalutamide (IC50: 159 nM) and further impairs nuclear translocation and coactivator recruitment of the

AR appeasing concerns over agonist activity in mutated AR147

. Although improving on the potency of

traditional antagonists’ enzalutamide still pales in comparison to the potency of the primary AR activating

agonist DHT (IC50: 5.1 nM)147

. Clinically enzalutamide has been shown to significantly increase both the

progression free and overall survival of men with metastatic CRPC in both pre and post chemotherapy

settings149,150

. The AFFIRM trial showed an improved overall survival from 13.6 months to 18.4 months

with enzalutamide in metastatic CRPC patients that had previously received docetaxel chemotherapy

while the PREVAIL trial demonstrated a 51% increase in 12 month progression frees survival rate in

chemotherapy naïve metastatic CRPC patients receiving enzalutamide150,151

. As such enzalutamide is

seeing use in both pre-chemotherapy and post-chemotherapy patients. Clinical trials are ongoing testing

the effectiveness of enzalutamide for first line use alongside androgen deprivation therapy (ENZAMET,

NCT02446405).

Abiraterone is a current generation inhibitor of CYP17A1, thereby inhibiting the synthesis of AR

activating androgens. A pregnenolone analogue originally developed by the Institute of Cancer Research

in London following the limited success of the anti-fungal ketocanozole in the 1990s which demonstrated

limited inhibition of CYP17A1 abiraterone was abandoned due to the widespread belief that post-ADT

recurrent PCa, then referred to as hormone-refractory disease, proliferated independently of the need for

androgens and further concerns of adrenal insufficiency with the inhibition of CYP17A1. However, as the

community’s understanding of the continued importance of AR-mediated signaling in post-ADT recurrent

PCa evolved, interest returned and following changes in licensing and successful clinical trials,

abiraterone was approved for clinical use in 2011. Initially shown to improve the survival of men with

metastatic CRPC following chemotherapy, similarly to enzalutamide, it has since been demonstrated to be

15

efficacious in a pre-chemotherapy context75,141,151,152

. The COU-AA-301 trial demonstrated an

improvement in median survival of 15.8 months versus 11.2 months with the use of abiraterone in post-

chemotherapy metastatic PCa while the COU-AA-302 trial showed improved median progression free

survival of 16.5 months versus 8.3 months in chemotherapy naïve metastatic CRPC patients153-155

. As

such both abiraterone and enzalutamide are currently in use as late-stage agents for men suffering from

metastatic CRPC in both a pre- and post-chemotherapy setting. However, recent reports from the

STAMPEDE and LATITUDE trials have demonstrated the potential of abiraterone as an adjuvant agent

co-administered with LHRH agents. The STAMPEDE trial reported a 13.9 month improvement in mean

failure free survival time with abiraterone and ADT compared to ADT alone. While the LATITUDE trial

found an improvement of 18.2 months in median progression free survival time with the addition of

abiraterone to ADT in patients with advanced PCa139,140

. These promising results indicate that abiraterone

use at the time of ADT will likely soon see widespread implementation.

Despite the benefits observed with both enzalutamide and abiraterone several mechanisms of

resistance have been proposed for the eventual failure observed in several patients. These mechanisms

include the upregulation of CYP17A1 and the AR, as well as the proliferation of populations possessing

altered AR function including mutations allowing for activation by pre-CYP17A1 steroid precursors or

constitutively active AR splice variants156,157

. As with standard ADT, The potential role of constitutively

active AR splice variants, through the loss of the LBD, has been considered as a mechanism of

resistance158

. Interestingly recent evidence has demonstrated that patients possessing the constitutively

active AR splice variant AR-V7 can still show therapeutic response to both enzalutamide and abiraterone,

perhaps highlighting the heterogeneous nature of the disease159

. Although the improvements in survival

and quality of life seen with the current generation of AR pathway targeted therapeutics should not be

discounted, the continued inability to fully interrupt AR signaling despite the multiple approaches trialed

drives a need for further therapies.

16

1.11 Chemotherapeutic approaches to CRPC treatment

For patients that fail or are ineligible for AR targeted therapies the main approaches are anti-

neoplastic chemotherapeutic agents. Chemotherapeutic agents consist of a large family of anti-cancer

drugs used for a large range of cancer types and situations. Despite generally being considered poor

responders to chemotherapeutics, PCa patients do see limited benefit to specific agents making them

common clinical agents. Mitoxantrone, a topoisomerase inhibitor, was the first approved

chemotherapeutic for use in PCa in 1996. Although known to have little effect on overall survival

mitoxantrone was shown to provide palliative benefits and improved PSA response rates160,161

. In 2004

mitoxantrone was replaced after the taxane based docetaxel demonstrated improved overall survival in

patients with CRPC. In phase III trials the compound was shown to improve survival of patients by

approximately 3 months compared to mitoxantrone162-165

. Docetaxel, and other taxanes, function by

binding and stabilizing microtubule filaments which in turn physically prevent cellular division leading to

a forced mitotic arrest and cell death166

. The use of docetaxel with first-line ADT for highly advanced

PCa was demonstrated to improve median overall survival by more than 12 months in the CHAARTED

and STAMPEDE trials167,168

. As such, the NCCN now includes within its guidelines the use of docetaxel

with EBRT and ADT for fit men with high risk disease. Although docetaxel remains the most commonly

used chemotherapeutic for CRPC the second generation taxane cabazitaxel, designed for docetaxel-

resistant cancers, was approved in 2010. Unlike other taxanes cabazitaxel is not a substrate of p-

glycoprotein (MDR1) a known small molecule efflux protein driver of therapeutic resistance and has

demonstrated a survival benefit of approximately 2.4 months over mitoxantrone in CRPC patients

previously treated with docetaxel169-171

. Further chemotherapeutics such as platinum and anthracycline-

based compounds have shown little or no survival benefit in PCa and as such don’t see regular use in the

clinic172,173

.

17

1.12 Immunotherapies and other systemic treatments for CRPC

Beyond AR axis targeted therapies and chemotherapeutics a handful of other therapeutics have

been approved and seen sporadic use in the clinical treatment of CRPC. With bone being the most

common site for the development of metastatic lesions in PCa several bone targeted therapies have been

developed174

. These therapies are largely used in palliative approaches as bone metastasis often result in

severe pain alongside nerve compression and myelosuppression which can have significant impacts on

patient quality of life. These therapies include the RANKL targeted human monoclonal antibody,

denosumab, for bone loss and various radiopharmaceuticals. These radiopharmaceuticals include 89

Sr and

153Sm which emit β-particles and

223Ra which emits α-particles. Demonstrated to improve survival by

approximately three months and have comparably minimal side effects 223

Ra is the most commonly used

bone targeted agent for patients suffering from severe pain due to bone metastasis162,175,176

.

The recent advent of clinically approved immunotherapies has highlighted the ability to activate

the immune system to recognize cancer cell antigens and induce anti-tumor responses177,178

. Despite the

successes of immunotherapy treatment for other cancers to date only one immunotherapy has been

approved for the treatment and demonstrated improved survival of metastatic CRPC patients. The reason

for the relatively poor success of immunotherapies in PCa is not fully understood and likely varies

between the range of differing immunotherapy approaches but has been attributed to a highly

immunosuppressive tumor microenvironment and low mutational burden179

. Approved for minimally

asymptomatic metastatic patients by the FDA in 2010 and demonstrating an approximate four months

improvement on median survival, sipuleucel-T remains the only approved immunotherapy in PCa180

.

Using an autologous approach, blood mononuclear cells are transfected with recombinant human prostatic

acid phosphatase (PAP), an enzyme expressed in approximately 95% of prostate cancers, and

granulocyte-macrophage colony stimulating factor, a known immune cell activator181-184

. This process

results in active autologous antigen presenting cells and also contains T cells, B cells and natural killer

cells which are infused into the patient leading to an anti-PAP immune response181,185

.

18

Other immunotherapeutic approaches are being investigated for use in PCa. Cytotoxic T

lymphocyte-associated antigen 4 (CTLA4), an important negative regulator of regulatory T cell responses

which has demonstrated efficacy in melanoma, was trialed for use in PCa but did not show improvements

in overall survival despite initially promising effects on PSA declines and antitumor activity186-189

.

Programmed cell death protein 1 (PD-1), another immune checkpoint inhibitor, is currently being

investigated with tempered expectations following the failure of CTLA4 for use in PCa with similarly

mixed initial results190,191

. PROSTVAC is viral-based immunovaccine currently in phase III trials for use

in metastatic CRPC. The regimen includes the initial delivery of vaccinia vectors containing PSA and

immune stimulatory molecule transgenes followed by successive boost shots in a fowlpox vector192,193

.

This approach leads to a strong immune response to the viral proteins, including PSA, resulting in the

creation of anti-PSA cytotoxic T cells capable of attacking tumor cells. Phase II trials of PROSTVAC

demonstrated an 8.5 month improvement in median overall survival of patients with metastatic CRPC

compared to those receiving control empty vectors194

.

1.13 Cholesterol structure and distribution

As androgen axis targeting remains central to the management of CRPC the essential steroid

precursor, cholesterol, must be considered as part of a comprehensive understanding of the disease.

Cholesterol is a multifunctional lipid that plays numerous essential cellular functions including in the

context of CRPC serving as a precursor molecule for the synthesis of AR driving androgens. Consisting

of 4 hydrocarbon rings and a hydroxyl group and carbon chain on opposite ends, cholesterol is an

important component of the cellular membrane helping to regulate membrane fluidity and participates in

several membrane trafficking and signaling processes195

. Further, cholesterol functions as a precursor to

steroids, bile acids and vitamin D195

. Our understanding of cellular cholesterol trafficking by in large

comes from studies involving fibroblasts and only more recently have intercellular differences come to

light195

. The study of cholesterol transport in vertebrates has been, for the most part, conducted in mice or

19

rats, providing valuable insight but coming with significant caution due to the differing lipid profile

between mice, rats and humans196

.

Within the mammalian cell cholesterol is stored in the form of hydrophobic cholesteryl esters in

lipid droplets and non-ester cholesterol distributed heterogeneously between cellular membranes,

accounting for 20-25% of the membranes lipid content within the plasma membrane and similarly high

concentrations in the endocytic recycling compartment, trans-Golgi compartment and to a lesser extent

the endoplasmic reticulum (ER)197-199

. The rigid four ring sterol backbone of cholesterol results in its

positioning adjacently to saturated lipid chains in internal and external membranes, increasing lateral lipid

ordering resulting in a less fluidic section of the membrane200

. The clustering of these lipids and

cholesterol in small area make up important cell signaling interfaces known as lipid rafts195

. Lipid rafts

host numerous different proteins and cell signaling families including glycosylphosphatidylinositol-

anchored proteins, cholesterol-linked and palmitoylated proteins, such as hedgehog, and doubly acylated

proteins including Src-family kinases or the α-subunits of heterotrimeric G proteins201-203

. The presence of

the sterol sensing domain on several critical membrane embedded and anchored cholesterol regulatory

proteins including HMG-CoA reductase (HMGCR), sterol regulatory element-binding protein cleavage-

activating protein (SCAP) and Niemann-Pick C1 (NPC1) provides a binding site for cholesterol204

.

However, the promiscuous nature of the domain means that cholesterol may not be a common ligand and

only SCAP has been shown to specifically bind cholesterol205

.

1.14 Cellular cholesterol metabolism

Cells can obtain new cholesterol through two mechanisms, cholesterol synthesis through the

mevalonate pathway and the uptake of circulating cholesterol (Figure 1.2). The mevalonate pathway

functions to produce cholesterol, isoprenoids and other sterols from acetyl-CoA which itself is a result of

glucose, glutamine or acetate consumption206

. The rate limiting enzyme in the mevalonate pathway is the

integral ER membrane protein HMGCR, notably the target of the statin class of drug molecules207,208

.

HMGCR and other enzymes in the mevalonate pathway including HMG-CoA synthase and squalene

20

synthase are regulated at the transcriptional level by sterol regulatory element binding protein

(SREBP)209

. SREBP is itself is a membrane bound protein that resides in the ER and is transported to the

Golgi in sterol-deplete conditions bound to COPII vesicles210,211

. This translocation of SREBP is

prevented by sterol induced conformational changes in the SCAP and insulin induced gene 1 (INSIG)

chaperones, in which INSIG functions as an ER anchor while SCAP functions as an escort for SREBP to

the Golgi212,213

. Once within the Golgi SREBP is sequentially cleaved by the site 1 (S1P) and site 2 (S2P)

proteases which in turn release the NTD of SREBP allowing for its entrance into the nucleus and to

function as a transcription factor214

. Conversely the transcription factor liver x receptor (LXR) functions

to remove cholesterol from the cell increasing biliary sterol secretion. Active in the presence of oxysterols

LXR target genes include several important cholesterol metabolism proteins including ATP-binding

cassette transporter-A1 (ABCA1) and -G1 (ABCG1) which efflux cholesterol from the cell as well as

CYP7A1 the first and rate limiting enzyme in conversion of cholesterol into bile acids215,216

. Once

cholesterol is fully synthesized it is rapidly removed from the ER largely by non-vesicular mechanisms

that bypass the Golgi217,218

. The cholesterol can be targeted towards the plasma membrane, into the

mitochondria by the StAR protein for steroid synthesis, or esterified by acyl-CoA cholesterol

acyltransferase (ACAT) for storage in lipid droplets219-221

.

The inhibition of HMGCR, and thus cholesterol synthesis, by statins leads to increased tissue

uptake of circulating LDL and thus decreased circulating cholesterol. Initially isolated from the mold

Penicillium citrinum in the 1970s, the statin class of therapeutics now includes seven clinically used

agents that have become the most commonly used agents for the treatment of hypercholesterolemia222

. As

such these compounds have an established role in primary and secondary cardiovascular prevention being

shown to improve all-cause mortality and decrease the incidence of major coronary events223,224

. Beyond

the reduction of cholesterol production, the inhibition of HMGCR is known to result in a number of

unintended effects largely through the reduction of HMG-CoA-cholesterol intermediates. The inhibition

of HMGCR by statins results in reduced synthesis of mevalonate, the precursor for isoprenoid generation

including farnesyl pyrophosphate and geranyl pyrophosphate. These isoprenoids notably aid in the

21

anchoring of Ras and Rho proteins to the plasma membrane and help facilitate prostate cancer

proliferation225,226

.

The second mechanism by which cells obtain cholesterol is by uptake from circulating

lipoproteins largely through the low density lipoprotein receptor (LDLr) and scavenger receptor B1 (SR-

B1). The LDLr is a type I transmembrane protein which resides on the plasma membrane with an external

facing N-terminal ligand binding domain and a cytosol facing C-terminal domain that regulates

endocytosis and intracellular transport227

. Circulating LDL particles bind to the LDLr after which the

particle is endocytosed by clathrin coated vesicles and transported to acidic endocytic compartments

where acid lipase hydrolyses cholesteryl esters into free cholesterol which are then moved out of the

endosome by NPC1 and Niemann-Pick C2 (NPC2) proteins228,229

. The LDLr is regulated similarly to

HMGCR through SREBP and LXR mediated ubiquitination and lysosomal degradation and is

ubiquitously expressed with high expression in the liver and steroidogenic tissues230,231

.

1.15 Scavenger Receptor B1

Scavenger receptor class B type 1 (SR-B1), encoded by the SCARB1 gene, is a highly

glycosylated cell surface receptor that contains two transmembrane domains located near to the cytosolic

N- and C-terminal domains232-234

. Functioning to selectively uptake cholesterol from circulating high

density lipoprotein (HDL) SR-B1 is ubiquitously expressed, similarly to LDLr, but shows particularly

high expression in the liver as well as steroidogenic tissues including the adrenal glands, ovaries and

testes235,236

. Importantly with regard to the work described in this thesis, SR-B1 appears to be

differentially regulated between the liver and steroidogenic tissues. In steroidogenic cells SR-B1 appears

to be primarily regulated by trophic hormones (LH, follicle stimulating hormone [FSH], ACTH)232,233,236-

238. While the expression of SR-B1 in liver cells can be effected by dietary fats and pharmacologic agents

notably fibrates, on top of hormonal control236,239

. Prolonged adrenal stimulation by ACTH has been

shown to induce SR-B1 expression in adrenocortical cells and reduce hepatic expression in mice and rats

likely indicating a mechanism for preferential channeling of cholesterol to the adrenal tissue233,240,241

. On a

22

cellular level, SR-B1 has been shown to be regulated in rather a complex manner including genetic

transcription factor binding sites for SREBP, steroidogenic factor-1 (SF-1), LXR, liver receptor homolog

1 and others235,236,242,243

. Evidence demonstrates that SR-B1 regulation by trophic hormones may be

dependent on cAMP/protein kinase A signaling stimulating transcriptional function of SF-1 and Ccaat-

enhancer-binding proteins (C/EBP)244,245

, while cholesterol regulation of SR-B1 has also been

demonstrated through SREBP and LXR functions implicating multiple signaling pathways participation

in SR-B1 expression236

.

Beyond cholesterol uptake SR-B1 and HDL have been implicated in several cellular signaling

processes. SR-B1 has been shown as a critical receptor in the ability of HDL to induce activation of

endothelial nitric oxide synthase (eNOS) leading to, at least in part, the athero-protective effects

associated with HDL246-249

. The activation of eNOS in turn leads to increased concentrations of nitric

oxide (NO) known to have a number of effects leading to improved cardiovascular health including

vasodilation, endothelial regeneration, and inhibition of leukocyte chemotaxis250

. Further, the presence of

HDL and eNOS activation are thought to prevent SR-B1 mediated induction of apoptosis in endothelial

cells246,251

. Several pathways have been identified as potential mechanisms for this SR-B1 dependent

signaling. HDL is known to carry several lipids beyond cholesterol including lipid soluble vitamins and

sphingolipids246

. Although insufficient on its own, sphingosine-1-phosphate (Sp1P) when associated with

HDL has been shown to be involved in the activation of eNOS246,252-254

. The mechanism by which Sp1P

or other SR-B1 inducers drive eNOS activation is believed to be through the PI3K signaling pathway246

.

HDL binding to SR-B1 has been shown to lead to the activation of Src which in turn activates both the

PI3K/AKT and RAS/ERK1/2 pathways resulting in eNOS activation through serine 1179

phosphorylation255,256

. Although the relationship between SR-B1 and these signaling pathways has largely

only been established in endothelial cells, aberrations in the PI3K pathway and the RAS pathway, have

been identified and implicated in advanced PCa and highlight the importance of their consideration when

studying SR-B1 in the context of PCa116

.

23

1.16 Lipoproteins and cholesterol transport

Cholesterol is transported throughout the blood stream complexed within lipoproteins, both on

the surface as native cholesterol and within the core of these single phospholipid membrane structures, as

cholesteryl-ester, that function to transport hydrophobic constituents. Present on the membrane of

lipoproteins, apolipoproteins provide functional identity determining their roles within the human body

and although most lipoproteins carry multiple apolipoproteins only the primary functional constituents

will be discussed here. Lipoproteins are classified by the inverse relationship of size/density and are

generally classified as HDL, LDL, very low density lipoprotein (VLDL) and ultra low density lipoprotein

(ULDL), also known as chylomicrons. Cholesterol is taken up from the gut into enterocytes where it is

packaged into chylomicrons with other lipids before the chylomicrons enter the lacteals and the

bloodstream through the thoracic duct257

. These chylomicrons have the ApoB48 lipoprotein; a truncated

form of the apolipoprotein B (ApoB) and primarily consist of triglycerides. The triglyceride content of

these chylomicrons is metabolized by lipoprotein lipase resulting in circulating high cholesterol

chylomicron remnants which are then endocytosed by the liver258

. VLDL is secreted from the liver

containing similarly high levels of triglyceride and the LDLr recognized full form ApoB100257

. The

triglycerides within these particles are similarly metabolized by lipoprotein lipase resulting in smaller

particles sometimes referred to intermediate density lipoprotein (IDL) and eventually primarily

cholesterol containing LDL257,258

. These now smaller LDL particles, often oxidized, are considered

important factors in the development of atherosclerosis in which the particles are retained in the arterial

wall eliciting an immune response and leading to lesion development259

. The oxidation of either the lipid

or apolipoprotein constituents of LDL can lead to conformational changes preventing uptake via LDLr

and instead the uptake by scavenger receptors260,261

. This shift in lipoprotein-receptor interaction

manifests itself in the early stages of atherosclerosis as newly differentiated macrophages uptake large

quantities of oxidized-LDL derived cholesterol through highly expressed scavenger receptors, leading to

the creation of foam cells a fundamental part of atherosclerotic plaque formation260

.

24

The Apo-AI containing HDL plays a vital role in reverse cholesterol transport257,262

. The process

where in there is net cholesterol movement from peripheral tissues to the liver. Produced by the liver

HDL, in general, receives cholesterol through Apo-AI interaction with ABCA1 of peripheral tissues and

releases cholesterol to tissues expressing SR-B1, however SR-B1 has been demonstrated to facilitate

bidirectional flux of cholesterol under varying conditions262,263

. The mechanism of HDL-SR-B1 mediated

cholesterol uptake is not fully understood, but it was initially believed that the SR-B1, unlike LDL and the

LDLr, does not degrade HDL but does mediate selective cholesteryl ester uptake from HDL and in some

cases LDL in the absence of holo-HDL uptake264-266

. However, further study of the HDL-SR-B1

interaction has demonstrated that the HDL particle may be internalized in a non-clathrin-coated vesicle

manner in which cholesterol-deplete HDL is secreted after uptake267,268

.

1.17 Cholesterol and prostate cancer

Cholesterol has long been observed and studied in the field of cancer with first acknowledgments

of significant cholesterol accumulation taking place in the early 20th century and speculation of a role in

PCa malignancy beginning in 1940s by G. Swyer and colleagues269,270

. Further insights have since come

from a wealth of epidemiological evidence. Early studies produced confounding results with several

studies finding that cholesterol lowering in fact increased cancer incidence271,272

while others found no

association273,274

. K. Solomon and M. Freeman more recently reviewed fifty two population studies that

reported cholesterol and total cancer incidence or mortality275

. Thirty two of these studies found an

inverse association between cancer risk and cholesterol level while sixteen showed no association.

Interestingly the authors note that there did not appear to be an absolute level of cholesterol associated

with cancer but rather that the low cholesterol cohort, relative to cohort average, in any population has a

greater prevalence of cancer. Recent evidence has pointed towards a positive association between

cholesterol and PCa. Men with high blood-cholesterol levels have more recently been found to have an

increased risk of PCa276,277

and prostate cancer mortality278

. Further, cholesterol levels are elevated in

post-ADT patient serum279,280

. At issue is a distinction of cause and effect from these epidemiologic

25

observations and has led to the hypothesis that the presence of cancer reduces circulating cholesterol, as

opposed to the implication that low cholesterol somehow drives the development of cancer.

Investigations into understanding the specific alterations to cholesterol metabolism within the

tumor setting have generated evidence demonstrating that hypercholesterolemia is associated with

increased tumor growth, AKT activation and tumoral androgens in xenograft models281-283

, while

hypercholesterolemia was further found to increase tumor volume, progression, and incidence in the

TRansgenic Adenocarcinoma Mouse Prostate (TRAMP) model of spontaneous PCa284

. SR-B1

expression, for which elevated expression has previously been associated with aggressive characteristics

and poor prognosis of breast cancer285,286

, and clear cell renal carcinoma287

, may be a key alteration in the

development of PCa. Specifically SR-B1 expression has been found to be associated with high Gleason

grade primary cancers and that high expression was correlated with decreased disease-specific survival in

patients288

. Further, SR-B1 expression was correlated with androgen synthesis enzymes 3β-HSD and 17β-

HSD and mTOR complex 1 target ribosomal protein S6. Pre-clinically elevated SR-B1 expression is

observed in CRPC derivatives of LNCaP289,290

, and with western diet induced tumor development in the

TRAMP model284

. The siRNA silencing of SR-B1 has further been shown to decrease PSA secretion and

cell viability in C4-2 cells290

. These findings underlie the apparent potential in targeting cholesterol

metabolism as a mechanism for impeding the proliferation of PCa.

The popularity of the statin class of therapeutics used in a preventive fashion for cardiovascular

disease has allowed for fundamental clinical insight into their effect on PCa. The findings of several

studies have led to the belief that statins may also play a role as anti-cancer agents in PCa via both

cholesterol and pleiotropic non-cholesterol mediated effects291-294

. From an epidemiological perspective

several attempts have been made to understand the effect of statins on both the occurrence of PCa and the

clinical outcomes of those diagnosed with PCa293

. There is a vast body of literature with regards to total

PCa incidence producing conflicting results. Several studies have found an inverse association between

statin use and PCa risk295-301

but despite these findings a plurality of studies have found no association302-

310 and further three studies found a positive association

311-313. A recent meta-analysis of observational

26

studies found a 7% reduction in the risk of total PCa with statin use314

, while meta-analyses that included

randomized controlled trials of cardio-preventive statin use found no association between statin use and

overall PCa incidence315-317

. Concerns about diet interventions, statin choice and short follow-up time

have been raised as potential explanations for the difference between observational and randomized

trials293

.

Despite the uncertainty as to whether statins impact overall PCa incidence there is growing

evidence that statin use may reduce the incidence of advanced PCa. As with total incidence, there is

confounding evidence with regards to statins effect on advanced PCa. Studies finding a lack of

association308,309,318-321

and those finding an inverse association between advanced PCa and statin use have

been reported in numerous populations295-298,300,304,305,310,322,323

. A 2012 meta-analysis of observational

studies found that statin use was associated with a 20% reduction in risk of advanced PCa314

. Beyond the

potential impact of statins on PCa incidence and confounding results with regard to statins effect on time

to progression324-326

several studies have found that statins have a beneficial impact on the survival of

patients with PCa324,327-331

. One such study further noted that patients using statins prior to diagnosis

displayed a larger decrease in PCa mortality compared to those who initiated statin treatment post-

diagnosis (HR, 0.55; 95% CI, 0.41 to 0.74 vs HR, 0.82; 95% CI, 0.71 to 0.96)329

. In a preclinical setting,

simvastatin and lovastatin have been found to reduce cell viability through an induction of apoptosis and

G1 phase cell cycle arrest and induce AR-positive LNCaP and AR-negative PC-3 and DU145 cells. While

atorvastatin, simvastatin and rosuvastatin have all been shown to reduce the metastatic potential of PC-3

cells332,333

. Further, lovastatin reduced cellular adhesion through down-regulated Rho-signaling in colon

carcinoma and cerivastatin reduced tumor vascularization in a murine lung cancer model334,335

. Although

not without contradiction, the wealth of evidence including consistent preclinical findings appears to

demonstrate the possibility of targeting cholesterol metabolism, in this case through statins but also

potentially through other cholesterol metabolism proteins, as therapeutic target in PCa.

27

1.18 Research rationale

Despite successes of recent therapies, PCa remains a lethal disease. The understanding of the role

of de novo steroidogenesis, whether adrenally or tumor derived, from precursor cholesterol as a major

mechanism of resistance to ADT drove the creation novel AR-targeted therapies including abiraterone.

These findings combined with growing evidence of the importance of cholesterol in PCa development

and progression highlights a potential avenue for novel therapies in PCa. Statins have been shown to very

slightly reduce circulating testosterone336,337

, however, this decrease is thought to be negligible in the

context of non-inhibited gonadal production and other studies have demonstrated no effect338,339

. What is

not understood is whether statins directly affect CRPC steroidogenesis in the context of castrate levels of

circulating testosterone, particularly given that a high-fat, high cholesterol diet has been found to increase

intratumoral levels of androgens in LNCaP xenograft283

, or whether they potentiate the effect of other

steroidogenesis inhibitors. Given the clinically accessible and historically successful nature of statins, the

majority of research revolving around cholesterol-based therapeutics for PCa has focused on cholesterol

synthesis targeting. Alternatively, the role of SR-B1 in providing cholesterol for steroid synthesis and its

correlation to increased disease-specific PCa mortality provides an intriguing basis for its development as

a therapeutic target. As such developing a more in depth understanding of the clinical expression of SR-

B1 across the disease state and determining the effects of inhibition pre-clinically are essential initial

steps in determining whether SR-B1 is a viable target for future PCa treatments.

1.19 Hypothesis

Cholesterol modulation, through either synthesis or uptake inhibition, will impact essential signaling

processes impeding the growth of CRPC.

Specific Aims:

(1) Determine whether statins act synergistically with abiraterone in a clinical setting and whether

these compounds have the ability to impact de novo steroidogenesis.

28

(2) Assess the expression of SR-B1 across the PCa disease state and determine whether it is a viable

cholesterol metabolism target for PCa therapy through reduced de novo steroidogenesis or other

mechanisms.

(3) Assess the potential of the small molecule SR-B1 inhibitor BLT-1 as a potential basis for

therapeutic development.

29

CHAPTER 2: THE IMPACT OF STATIN USE ON DE NOVO STEROIDOGENESIS AND

CLINICAL OUTCOMES OF CRPC PATIENTS RECEIVING ABIRATERONE

2.1 Specific aim and rationale

As described above, there has been a vast amount of research on the effect of statins on PCa.

Clinically, statins are believed to improve PCa prognosis improving incidence of aggressive disease and

decreased mortality293,298,314,316,324,330

. Pre-clinically statins have been demonstrated to impede PCa

progression, including reduced PSA secretion340

, proliferation340,341

, adhesion334

and invasion333

. Now

seeing widespread clinical use, abiraterone is a known inhibitor of de novo steroidogenesis but recent

evidence into whether the use of concomitant statins improves outcomes for these patients is

inconclusive342,343

. Further, if statins do improve CRPC patient outcomes it was unknown whether this

effect would be solely due to established consequences of limiting cholesterol such as impacted

membrane synthesis and signaling or whether statins possessed the ability to directly impact the synthesis

of AR-driving steroids.

The studies described in this chapter aimed to elucidate the effect of statin use on the survival and

progression of metastatic CRPC patients receiving abiraterone therapy. To perform this research, a

database generated from the province-wide British Columbia Cancer Agency was analyzed for survival

and progression data. Further, the effect of statins on de novo steroidogenesis was assessed pre-clinically

using an LNCaP based xenograft mouse model. The progression and growth of castrate LNCaP tumors

were assessed alongside measurements for androgen production.

2.2 Methods

2.2.1 Analysis of abiraterone patients at the British Columbia Cancer Agency

Patient characteristics and response information was obtained from the British Columbia Cancer

Agency and used to generate a dataset of men being treated with abiraterone for locally advanced or

metastatic CRPC. Laboratory reports, British Columbia Cancer Agency pharmacy records and

consultation reports were used to generate the dataset. Information on statin use was obtained by patient

30

claims and admission and consultation reports. Summary statistics were used to describe patient

characteristics and responses and the Kaplan-Meier method was used to estimate overall survival times.

Cox proportional hazards regression was used to investigate prognostic factors of overall survival and

logistic regression was used to investigate prognostic factors of PSA response344

. A multivariable model

was constructed including factors which had nearly complete data and biological rationale for inclusion

and was used to assess the impact of statins. PSA response was assessed as both a decline of ≥ 30% and ≥

50% relative to baseline. Charlson index comorbidities were weighted according to Table 2.1345

.

Table 2.1: Comorbidity score weighting of Charlson Index.

2.2.2 LNCaP xenografts

All animal experiments described in this chapter were carried out in accordance with the

University of British Columbia’s Committee on Animal Care and approved protocol A12-0211 held by

Dr. Kishor Wasan at the Faculty of Pharmaceutical Sciences, UBC. Athymic nude mice (Crl:NU-Foxn1nu

;

Harlan, Indianapolis, IN) aged 6 to 8 weeks-old were inoculated on two sites of the hind flank with 2 x

Weight Comorbidity

1 Hypertension

Myocardial infarction

Congestive heart failure

Peripheral vascular disease

Cerebrovascular disease

Dementia

Chronic pulmonary disease

Connective tissue disease

Ulcer disease

Mild liver disease

Diabetes

2

Hemiplegia

Renal disease

Diabetes - end organ damage

Tumor without metastasis

Leukemia

Lymphoma

3 Severe liver disease

6

Metastatic solid tumour

AIDS

31

106 LNCaP cells (LNCaP cells cultured in RPMI + 10% FBS, 1% penicillin-streptomycin) in 100 µL

matrigel (BD Biosciences, Franklin Lakes, NJ).

Once weekly, serum PSA levels were measured using the ELISA-based Cobas e 411 analyzer

(Roche Diagnostics, Indianapolis, IN). Serum was obtained by performing tail vein bleeds with samples

being collected in hematocrit tubes and spun in a hematocrit centrifuge at 13,000 RPM for 4 min. 15 µL

of serum was diluted with 135 µL of phosphate-buffered saline (PBS) prior to performing the assay.

Once serum PSA exceeded 50 ng/mL, mice were castrated by an experienced animal technician

and randomized into control “standard” diet (Open Standard Diet containing 40 mg/kg cholesterol,

Research Diets Inc., New Brunswick, NJ), or a simvastatin diet (Open Standard Diet containing 0.1%

[w/w] simvastatin [Sanis, Dieppe, New Brunswick, Canada]). At 8 weeks post-castration, anesthetized

animals were exsanguinated by cardiac puncture to collect blood, from which serum was prepared, and

tumors were in part harvested, flash frozen with liquid nitrogen and in part fixed in 10% buffered

formalin solution over night before being transferred to 70% ethanol for long term storage. Throughout

the course of the experiment weekly measurements of body weight, tumor volume and PSA were

performed. PSA measurements were performed as described above and tumor volume was measured

using calipers and the equation: Tumor Volume = length x width x height x 0.5326 346

.

2.2.3 Simvastatin and simvastatin hydroxy acid LC-MS

50 µL of serum obtained via cardiac puncture was added to 200 uL of water with 50 µL of 10

ng/mL internal standard (lovastatin and lovastatin hydroxy acid, IS). This was extracted using 2 mL of

methyl tert-butyl ether (MTBE) and vortexed thoroughly. The samples were then placed in the -80 °C

freezer for 10 min to freeze the aqueous phase. The solvent phase was then decanted into separate tubes

and dried down using a nitrogen blow-down evaporator. The dried down sample was reconstituted in

30/70 water/methanol plus 5 mM ammonium acetate, for analysis of 20 µL injectable aliquot.

Simvastatin and simvastatin hydroxy acid were both quantitated using liquid chromatography-

mass spectrometry (LC-MS). This system consisted of an Agilent 1290 Infinity Binary Pump, a 1290

32

Infinity Sampler, a 1290 Infinity Thermostat and a 1290 Infinity Thermostatted Column Compartment

(Agilent, Mississauga, Ontario, Canada) connected to an AB Sciex QTrap® 5500 hybrid linear ion-trap

triple quadrupole mass spectrometer equipped with a Turbo Spray source (AB Sciex, Concord, Ontario,

Canada). Data was acquired using the Analyst 1.5.2 software. Separations were carried out using a Waters

Acquity UPLC C18 1.7 µm 2.1 x 100 mm column (Waters Corp., Milford, MA, USA) maintained at 30

°C and the autosampler tray temperature was maintained at 10 °C. The isocratic mobile phase consisted of

water (10%; Solvent A) and methanol (90%; Solvent B) with both solvents containing 5 mM ammonium

acetate. The flow rate was 0.2 mL/min and the run time 4.0 min. The mass spectrometer was operated in

multiple reaction monitoring (MRM) mode using polarity switching. Simvastatin and lovastatin were

monitored as their ammonium adducts in positive ionization (ES+) mode. The retention times for

simvastatin and lovastatin were 2.75 min and 2.53 min, respectively, and for simvastatin hydroxy acid

and lovastatin hydroxy acid 2.37 min and 2.25 min, respectively.

2.2.4 Creatine kinase assay

The creatine kinase fluorometric assay (Cat. #: 700630, Cayman Chemical, Ann Arbor, MI) was

performed according to manufacturer’s instructions. For each sample, standard, and control 10 µL of

serum obtained via cardiac puncture and 50 µL of diluted buffer was added to a well of the 96 well plate.

10 µL of ADP followed by 10 µL of “Enzyme Mixture” were then added to the well before initiating the

reaction with 20 µL of creatine phosphate. The plate was incubated for 15 min at 37°C, and followed by

the addition of 80 µL of ammonium acetate and 20 µL of formaldehyde detector. The plate was then

incubated for 15 min at room temperature and read on a plate reader (excitation wavelength: 365,

emission wavelength 465) to determine the average fluorescence of each standard, control and sample.

The fluorescent value for the 0 uM standard solution was subtracted from each of the standards,

controls and samples to produce the corrected florescence (RFU). The corrected fluorescence values for

each of the standards was plotted to create a standard curve. The creatine kinase activity of each sample

was then calculated using the following equation:

33

𝐶𝑟𝑒𝑎𝑡𝑖𝑛𝑒 𝐾𝑖𝑛𝑎𝑠𝑒 (𝑈 𝐿⁄ ) = [𝑅𝐹𝑈

𝑆𝑙𝑜𝑝𝑒 𝑜𝑓 𝑠𝑡𝑎𝑛𝑑𝑎𝑟𝑑 𝑐𝑢𝑟𝑣𝑒 (𝑅𝐺𝑈uM )

] 𝑥 𝑠𝑎𝑚𝑝𝑙𝑒 𝑑𝑖𝑙𝑢𝑡𝑖𝑜𝑛

2.2.5 Alanine transaminase assay

The alanine transaminase colorimetric assay (Cat. #: 700260, Cayman Chemical) was performed

according to manufacturer’s instructions. In each well of a 96 well plate 150 µL of “substrate”, 20 µL of

“cofactor” and 20 µL of sample or control were added. The plate was then incubated for 15 min at 37°C.

The reaction was then initiated by adding 20 µL of “ALT initiator” to each of the wells. The plate was

then immediately placed in a plate reader and each well measured at 340 nm every min for 5 min.

To determine the change in absorbance (A340) per min the absorbance values were plotted as a

function of time and the slope of the linear portion of the curve was used. The following equation was

then used to calculate ALT activity:

𝐴𝐿𝑇 𝑎𝑐𝑡𝑖𝑣𝑖𝑡𝑦 (𝑈 𝑚𝐿⁄ ) = [ΔA340 min 𝑥 0.21 𝑚𝐿⁄

4.11 𝑚𝑀−1 𝑥 0.02 𝑚𝐿] 𝑥 𝑠𝑎𝑚𝑝𝑙𝑒 𝑑𝑖𝑙𝑢𝑡𝑖𝑜𝑛

2.2.6 Cholesterol LC-MS

Cholesterol levels were assessed and quantified by LC-MS as previously described347

. Tumors

(50–150 mg) were homogenized (Precellys Tissue Homogenizer, Rockville, MD) for 2 x 20 sec at 6000

rpm in nine volumes of water. IS (deuterated cholesterol) was added and homogenates were extracted

twice with 90/10 MTBE/methanol. Extracts were dried and pooled under vacuum and reconstituted in 400

µL of 1/5 acetyl Cl/CHCl3. 50 µL serum samples were similarly processed without the initial

homogenization. These samples were then vortexed and dried down using a CentriVap (Labconco,

Kansas City, MO) before being dissolved in 70/30 methanol/CHCl3. All samples were analyzed using a

Waters Acquity UPLC Separations Module coupled to a Waters Quattro Premier XE Mass Spectrometer

(Waters, Milford, MA). Separations were carried out on a Waters 2.1x100mm BEH 1.7 µM C18 column

using an acetonitrile/0.1M ammonium acetate 9/1 isopropanol mobile phase gradient. Data was collected

in ES+ multiple reaction monitoring (MRM) mode and processed with Quanlynx (Waters) prior to

34

exporting to Excel (Microsoft, Redmond, WA) for additional normalization to weights and volumes as

required. Quantification was by area under curve (AUC) ratio of standard to IS.

2.2.7 Steroid LC-MS

Intratumoural and serum androgen levels were assessed and quantified by LC-MS as previously

described348

. Two volumes of water were added to tumours (50-150 mg) and homogenized (Precellys

Tissue Homogenizer) for 2 x 20 sec at 6000 rpm. IS (20 pg/40 pg deuterated testosterone/DHT; C/D/N

isotopes) was added and homogenates were twice extracted by 30 min vortexing with 2 mL of 60/40

hexane/ethyl acetate. Extracts were pooled, dried using a CentriVap, reconstituted in 50 µL of 50 mM

hydroxylamine and incubated 1 hour at 65˚C. 50 µL serum samples were similarly processed without the

initial homogenization. Resulting steroid-oxime derivatives were analyzed using a Waters Acquity UPLC

Separations Module coupled to a Waters Quattro Premier XE Mass Spectrometer (Waters). Separations

were carried out with a 2.1 x 100 mm BEH 1.7 µM C18 column, mobile phase water (A) and acetonitrile

(B) (gradient: 0.2 min, 25% B; 8 min, 70% B; 9-12 min, 98% B; 12.2 min, 25% B; 14 min run length).

Data was collected in ES+ by multiple reaction monitoring with instrument parameters optimized for the

mass-to-charge ratios and corresponding fragments of the oxime-steroids for all keto-steroids in the

androgen synthesis pathway. Data processing was done with Quanlynx (Waters) and exported to Excel

(Mircrosoft) for additional normalization to weights and volumes as required. Quantification was by AUC

ratio of standard to IS. Deuterated testosterone was used as the IS with all analytes other than DHT for

which deuterated DHT was used.

2.2.8 Quantitative PCR

RNA was isolated from homogenized (Precellys Tissue Homogenizer; 2 x 20sec, 6000 rpm)

tumors using a TRIzol (Life Technologies, Burlington, Ontario, Canada) chloroform extraction according

to manufacturer instructions. TRIzol (1 mL) was added to 50-100 mg of homogenized tissue and

incubated for 5 min after which 0.2 mL of chloroform was added and incubated for a further 3 min prior

to centrifugation for 15 min at 12,000 g, 4 °C. The aqueous phase was separated and incubated with 0.5

35

mL of isopropanol for 10 min prior to centrifugation for 10 min at 12,000 g, 4 °C. The pelleted RNA was

then washed with 1 mL 75% ethanol pelleted and suspended in 50 µL RNase-free water. cDNA was

synthesized from the RNA using a SuperScript® II Reverse Transcriptase kit (Life Technologies)

according to manufacturer instructions. First strand synthesis was carried out with 50 – 250 ng random

primers, 0.5 mM dNTP mix and 1 ng - 5 µg total RNA incubated at 65 °C for 5 min. Following this, 1x

First-strand buffer, 10 mM DTT and 40 U RNaseOUT were added to the mixture and incubated for 2 min

at 42 °C. 200 units of SuperScript® II Reverse Transcriptase was then added to the solution prior a 5 min

incubation at 42 °C followed by heat inactivation at 70 °C for 15 min. 2 U of RNase H was then added

and incubated at 37 °C for 20 min. Using this cDNA qPCR was performed on an ABI 7900HT (Life

Technologies) using FastStart Universal SyberGreen Master mix (Roche) and a Qiagen (Toronto, Ontario,

Canada) SYBR Green probe targeted to the gene of interest. The following thermocycler conditions were

used for qPCR: 50 °C for 2 min, 95 °C for 10 min, 40x: 95 °C for 15 sec, 60 °C for 1 min, 95 °C for 15

sec, 60 °C for 15 sec, 95 °C for 15 sec.

2.3 Results

2.3.1 Statin use improves the overall survival and PSA declines of men receiving abiraterone for locally

advanced or metastatic CRPC

There is limited and conflicting evidence as to the effect of statin use on the outcomes of patients

receiving abiraterone for CRPC. Analysis of existing clinical data retrospectively can provide valuable

insight into whether prospective studies are feasible. The British Columbia Cancer Agency is a

comprehensive cancer institute that provides cancer care through the operation of six regional centers to

the population of British Columbia. Data used to calculate patient survival, PCa progression and general

health was obtained from the British Columbia Cancer Agency and compared by statin status. In total 301

patients receiving abiraterone were included in the study of which 84 patients were statin users. The

specific statins used by these patients included 5 different types: atorvastatin (n = 45), lovastatin (n = 2),

pravastatin (n = 2), rosuvastatin (n = 24), simvastatin (n = 11). The patient median age was 74 and 68.6%

36

of which had a Gleason score of ≥ 8. Patients were maintained on abiraterone for a median time of 5.6

months and had a median overall survival time of 12.1 months. Further, information on the characteristics

of these patients can be found in the summary statistics (Table 2.2).

Table 2.2: Baseline characteristics and outcomes of British Columbia abiraterone patients

Statistic N Result

Concomitant Statins N (%) Yes

Atorovastin

Lovastatin

Pravastatin

Rosuvastatin

Simvastatin

301 84 (27.9)

45 (53.6)

2 (2.4)

2 (2.4)

24 (28.6)

11 (13.1)

Age at path. diagnosis Mean (std dev)

Med. (range)

300 66.1 (8.9)

65 (45, 95)

Age at Abi start date Mean (std dev)

Med.(range)

301 73.8 (9.8)

74 (45, 96)

Gleason Score N (%) ≥8 258 177 (68.6)

Charlson Score N (%) ≥7 298 156 (52.4)

PSA at Diagnosis Med. (range) 278 27 (0.2, 9832)

Alkaline Phosphatase Med. (range) 228 122 (8.9, 2189)

LDH Med. (range) 80 241 (108, 2598)

Albumin Med. (range) 102 3.7 (2.4, 5)

Neutrophils Med. (range) 291 4900 (100, 81500)

Lymphocytes Med. (range) 290 1135 (200, 30640)

Neutrophils/Lymphocyte Ratio Med. (range) 290 4.1 (0.19, 34.5)

Change in PSA, Diagnosis to Abi Med. (range) 276 48.3 (-6798, 7926)

Months, Diagnosis to Abi Med. (range) 300 71.2 (4.2, 324.5)

Months, Diagnosis to Metastases Med. (range) 236 43.5 (-6.3, 306.8)

Months, Diagnosis to CRPC Med. (range) 193 44.7 (2.5, 203.3)

Months, ADT to Abi Med. (range) 291 49.0 (1.1, 298.8)

Months, Metastases to Abi Med. (range)) 237 21.2 (0.2, 164.8)

Months, CRPC to Abi Med. (range) 193 23.1 (0.3, 183.5)

Months, Docetaxel to Abi Med. (range) 172 7.7 (-42.8, 86.5)

Months of ADT (1st line) Med. (range) 131 9.5 (0, 169.9)

Months of ADT (1st to last ever) Med. (range) 279 38.1 (0, 294.4)

Months, Docetaxel Duration Med. (range) 169 3.8 (0, 83.8)

Prior Prostatectomy N (%) Yes 290 53 (18.3)

Prior Radiation N (%) Yes 292 91 (31.2)

Opiates N (%) Yes 301 60 (19.9)

Metastases N (%) Any

Bone

Liver

Lung

Brain

LN

301 237 (78.7)

193 (64.1)

7 (2.3)

5 (1.7)

0 (0)

92 (30.6)

37

Table 2.2 Continued

Outcomes

Statistic N Result

Months, Duration of Abi Med. (range) 297 5.6 (0.3, 49.7)

PSA at Baseline Med. (range) 299 117.2 (0.2, 7938)

PSA at Week 4

Change

Med. (range) 249 92.0 (0.1, 5500)

-18.0 (-97.9, 1000)

PSA at Week 8

Change

Med. (range) 227 74.0 (0.01, 8800)

-23.4 (-99.6, 1041)

PSA at Week 12

Change

Med. (range) 213 67.6 (0.01, 6700)

-28.0 (-99.7, 1549)

Nadir PSA

Change

Med. (range) 213 66.1 (0.01, 6700)

-32.8 (-99.99, 1000)

Months to Nadir Med. (range) 291 1.8 (0, 17.4))

Overall Survival N (%) Deaths

Median (95% CI)

6-mo OS (95% CI)

1-year OS (95% CI)

2-year OS (95% CI)

301 289 (96.0)

12.1 (10.6, 13.8)

76.7 (71.5, 81.1)

50.7 (44.9, 56.2)

23.8 (19.1, 28.7)

A univariate analysis of statin vs non-statin use was performed to determine effects on overall

survival and PSA declines of patients taking abiraterone. Of the 217 non-statin users 5 patients were still

alive at the time of data collection while 7 of the statin patients remained alive. Statin users were found to

have improved overall survival having a median survival of 16.2 months compared to 11.3 months for

non-statin users (Hazard Ratio: 0.79, 95%CI = 0.62 – 1.02, log-rank test: p = 0.078; Gehan-Breslow-

Wilson Test: p = 0.022 Table 2.3, Figure 2.1). Although failing to reach statistical significance the

percentage of patients who saw a PSA response to abiraterone was increased in statin users (47.6%)

compared to non-statin users (37.6%, p = 0.10, Table 2.3). Time on abiraterone (Statin: 7.2 months; Non-

statin: 5.3 months; p = 0.078) and change in PSA at nadir (Statin: -41.0%; Non-statin: -30.1%; p = 0.086)

were also increased in statin users, but as with PSA response did not reach statistical significance (Table

2.3). Despite the difference in the number of PSA responders and the relative change in the response that

was observed with statin users, no difference was observed in the number of patients who saw borderline

PSA responses of >30% drop or robust PSA responses >50% drop in PSA at specific 4, 8 and 12 week

time points (Table 2.4).

38

Figure 2.1: Statin use prolongs survival of CRPC patients on abiraterone

A univariate retrospective analysis was performed on a cohort of CRPC patients treated with abiraterone

comparing overall survival of statin (blue line) and non-statin (black line) users. Statin users had a median

overall survival time of 16.2 months compared to non-statin users at 11.3 months (HR: 0.79; log rank test:

p = 0.078; Gehan-Brislow-Wilcoxon test: p = 0.022).

Table 2.3: Outcomes by Statin Status of abiraterone patients

Statistic No Statins Statins p-value

N N 217 84

PSA Response N (%) 81 (37.3) 40 (47.6) 0.10

PSA at Baseline Median (range) 120.0 (0.5, 7149) 90.6 (0.2, 7938) 0.23

Change in PSA at Nadir Median (range) -30.1 (-99.9, 1000) -41.0 (-99.6, 174.5) 0.086

Months to Nadir Median (range) 1.5 (0, 17.4) 2.3 (0, 13.7) 0.14

Months of Abi Median (range) 5.3 (0.3, 49.7) 7.2 (0.4, 47.5) 0.069

Overall Survival N (%) Deaths

Median (95% CI)

6-mo OS (95% CI)

1-year OS (95% CI)

210 (96.8)

11.3 (9.3, 12.7)

74.7 (68.3, 80.0)

45.8 (39.1, 52.3)

79 (94.0)

16.2 (13.2, 18.8)

82.1 (72.1, 88.8)

63.1 (51.8, 72.4)

LR: 0.078

GBW:

0.022

Table 2.4: PSA Declines of >30% and >50% by statin status of abiraterone patients


PSA >30%

4 wk N (%) 73 (39.3%) 30 (46.8%) 0.31

8 wk N (%) 70 (43.7%) 35 (51.5%) 0.31

12 wk N (%) 74 (49.3%) 30 (48.4%) 1.00

PSA >50%

4 wk N (%) 43 (23.2%) 22 (34.4%) 0.098

8 wk N (%) 54 (33.7%) 27 (39.7%) 0.45

12 wk N (%) 59 (39.3%) 23 (37.1%) 0.87

39

Multivariate analyses were performed to adjust for age, prior prostatectomy, radiation, time from

diagnosis, neutrophils-lymphocyte ratio and presence of metastases as prognostic factors for overall

survival and PSA response. The effect of statins on overall survival remained borderline by Cox

regression analysis (n = 279, hazard ratio = 0.78, 95% CI = 0.59-1.04, p = 0.087; Table 2.5). Interestingly

when Gleason score was included in the multivariate analysis, despite a smaller sample size, significant

improvement in overall survival for statin users was observed (n = 241, hazard ratio = 0.71, 95% CI =

0.52 – 0.96, p = 0.024). Similar to overall survival, the percentage of patients who saw PSA responses to

abiraterone with statin use trended towards improvement but remained borderline with regards to

statistical significance when assessed by a logistic regression analysis (multivariable odds ratio = 1.59,

95% CI = 0.91 - 2.78, p = 0.11, Table 2.6).

The Charlson Index was used to assess patient comorbidities and overall health. The total patient

dataset had 156 (52.4%) patients with a Charlson score of ≥7 (Table 2.2) with the most common

comorbidity, excluding the presence of metastasis, being hypertension effecting 140 (46%) patients

(Table 2.7). Statin users had a median Charlson score of 7, which was increased, compared to non-statin

users who had a median score of 6 (p < 0.001). Further, 87 (40.1%) non-statin users compared to 68

(80.9%) statin users had Charlson scores of seven or greater (p < 0.001) (Table 2.8). Specifically, statin

users had significantly increased rates of hypertension (statin: 61 [72.6%]; no statin: 79 [36.4%],

p<0.001), myocardial infarction (statin: 9 [10.7%]; no statin: 4 [1.8%], p = 0.002), peripheral disease

(statin: 12 [14.2%]; no statin: 4 [1.8%], p < 0.001), cerebrovascular disease (statin: 5 [6.0%]; no statin: 2

[0.9%], p=0.02), dementia (statin: 4 [4.76%]; no statin 1 [0.5%], p=0.02) and diabetes (statin: 25 [29.8%];

no statin: 16 [7.4%], p < 0.001, Table 2.7). The use of statins concomitantly with abiraterone indicated a

trend to improved prognosis, but failed to reach statistical significance in a number of categories. What

appears to be clear is that those patients taking statins are in considerably poorer health as measured by

the Charlson index, potentially acting as a confounding factor when attempting to determine effects on

overall survival.

40

Table 2.5: Prognostic factors for overall survival determined by multivariate Cox regression

analyses for British Columbia abiraterone patients

Type Hazard Ratio (95%CI) p-value

Age / decade 1.06 (0.94, 1.20) 0.32

Gleason Score ≥8 vs <8 1.20 (0.92, 1.58) 0.18

Prior Prostatectomy Y vs N 0.75 (0.55, 1.04) 0.081

Prior Radiation Y vs N 1.12 (0.87, 1.45) 0.36

Bone Metastases Y vs N 0.98 (0.77, 1.25) 0.88

Liver Metastases Y vs N 3.19 (1.49, 6.83) 0.003

Lung Metastases Y vs N 1.55 (0.64, 3.77) 0.33

Brain Metastases Y vs N - -

LN Metastases Y vs N 1.20 (0.93, 1.54) 0.16

Any Metastases Y vs N 1.01 (0.76, 1.33) 0.97

Opiates Y vs N 0.81 (0.61, 1.09) 0.16

Baseline PSA Log-transform 1.18 (1.10, 1.26) <0.001

Months of ADT Log-transform 0.73 (0.65, 0.83) <0.001

Months, Diagnosis to Abi Log-transform 0.81 (0.71, 0.92) 0.002

Alkaline Phosphatase Log-transform 1.55 (1.32, 1.82) <0.001

LDH Log-transform 3.13 (1.95, 5.04) <0.001

Albumin Log-transform 0.38 (0.25, 0.59) <0.001

Neutrophils Log-transform 1.75 (1.34, 2.28) <0.001

Lymphocytes Log-transform 0.66 (0.53, 0.82) <0.001

NL Ratio Log-transform 1.62 (1.36, 1.92) <0.001

Concomitant Statins Y vs N 0.79 (0.61, 1.03) 0.079

Multivariable – N=241

Age / decade 1.23 (1.05, 1.45) 0.013

Gleason Score ≥8 vs <8 0.89 (0.64, 1.23) 0.47



Confirmed Metastases Y vs N 1.11 (0.79, 1.57) 0.54

Baseline PSA Log-transform 1.18 (1.09, 1.28) <0.001

Months, Diagnosis to Abi Log-transform 0.61 (0.49, 0.75) <0.001




Age / decade 1.29 (1.10, 1.50) 0.002




Months, Diagnosis to Abi Log-transform 0.64 (0.53, 0.77) <0.001



41

Table 2.6: Prognostic factors for PSA response (50% decline from baseline) determined by

multivariate logistic regression analyses for British Columbia abiraterone patients

Type Odds Ratio (95% CI) p-value

Age / decade 1.15 (0.90, 1.45) 0.26

Gleason Score ≥8 vs <8 0.80 (0.47, 1.37) 0.41



Bone Metastases Y vs N 1.03 (0.63, 1.66) 0.92

Liver Metastases Y vs N 0.24 (0.03, 2.03) 0.19

Lung Metastases Y vs N 2.26 (0.37, 13.75) 0.38

Brain Metastases Y vs N - -

LN Metastases Y vs N 0.55 (0.32, 0.92) 0.023


Opiates Y vs N 1.28 (0.72, 2.26) 0.40

Baseline PSA Log-transform 0.96 (0.83, 1.10) 0.53

Months of ADT Log-transform 1.59 (1.23, 2.05) <0.001


Alkaline Phosphatase Log-transform 0.91 (0.67, 1.24) 0.55

LDH Log-transform 0.89 (0.40, 2.00) 0.78

Albumin Log-transform 1.53 (0.70, 3.36) 0.29

Neutrophils Log-transform 0.62 (0.39, 0.99) 0.047

Lymphocytes Log-transform 1.05 (0.70, 1.56) 0.82

NL Ratio Log-transform 0.78 (0.57, 1.06) 0.11



Age / decade 1.05 (0.74, 1.49) 0.77

Gleason Score ≥8 vs <8 1.40 (0.72, 2.74) 0.33




Baseline PSA Log-transform 0.99 (0.83, 1.16) 0.86





Age / decade 1.09 (0.79, 1.51) 0.59







42

Table 2.7: Breakdown of Charlson Index scoring by statin status


Charlson Score:

Hypertension N (%) 79 (36.4) 61 (72.6) <0.001

Myocardial Infarction N (%) 4 (1.8) 9 (10.7) 0.002

Congestive Heart Failure N (%) 3 (1.4) 3 (3.6) 0.35

Peripheral Disease N (%) 4 (1.8) 12 (14.2) <0.001

Cerebrovascular Disease N (%) 2 (0.9) 5 (6.0) 0.02

Dementia N (%) 1 (0.5) 4 (4.76) 0.02

Chronic Pulmonary

Disease

N (%) 7 (3.2) 0 (0.0) 0.20

Connective Tissue

Disease

N (%) 0 (0.0) 0 (0.0) -

Ulcer Disease N (%) 0 (0.0) 0 (0.0) -

Mild Liver Disease N (%) 0 (0.0) 1 (1.2) 0.28

Diabetes N (%) 16 (7.4) 25 (29.8) <0.001

Hemiplegia N (%) 0 (0.0) 0 (0.0) -

Renal Disease N (%) 4 (1.8) 2 (2.4) 0.67

Diabetes - organ damage N (%) 0 (0.0) 0 (0.0) -

Tumor without

metastasis

N (%) 0 (0.0) 0 (0.0) -

Leukemia N (%) 1 (0.5) 1 (1.2) 0.48

Lymphoma N (%) 0 (0.0) 0 (0.0) -

Sever Liver Disease N (%) 0 (0.0) 0 (0.0) -

Metastatic Solid Tumor N (%) 207 (95.4) 78 (92.8) 0.40

AIDS N (%) 0 (0.0) 0 (0.0) -

Table 2.8: Baseline characteristic comparison of abiraterone patients by statin status


Age at path. diagnosis Mean (std dev)

Median (range)

65.3 (9.3)

65 (45, 95)

68.1 (7.7)

67 (53, 90)

0.018

Age at Abi start date Mean (std dev)

Median (range)

73 (10.2)

72 (45, 96)

77 (7.9)

77 (59, 94)

0.001

Gleason Score N (%) ≥8 127 (69.4) 50 (66.7) 0.90

Charlson Score N (%) ≥7 87 (40.1) 68 (80.9) <0.001

PSA at Diagnosis Median (range) 29 (0.2, 9832) 23 (0.65, 2000) 0.04

Alkaline Phosphatase Median (range) 121 (8.9, 2189) 122 (25, 1707) 0.53

LDH Median (range) 239 (108, 2598) 254 (142, 289) 0.54

Albumin Median (range) 4 (2, 4) 4 (3, 5) 0.54

Neutrophils Median (range) 4800 (400, 81500) 4900 (100, 10700) 0.62

Lymphocytes Median (range) 1130 (200, 30640) 1140 (200, 17400) 0.91

Neutrophils/Lymphocyte Ratio Median (range) 4.0 (0.2, 34.5) 4.4 (0.2, 33.5) 0.76

43

Abiraterone is an established inhibitor of androgen synthesis by CYP17A1 blockade, however,

the mechanism by which statins may potentiate the effect of abiraterone as described above or other PCa

treatments is yet to be fully understood. The ability of statins to reduce the availability of pre-cursor

cholesterol used for androgen synthesis would seem a natural mechanism for impeding castration-

resistance and potentiation of the effects of abiraterone but had yet to be empirically established. As such

the following research describes in vivo based experiments analyzing the effect of simvastatin on de novo

steroidogenesis and castration-resistant progression of an LNCaP-based xenograft model.

2.3.2 Oral administration of simvastatin resulted in clinically relevant serum concentrations and reduced

serum cholesterol

Crucial to the ability to make inferences from xenograft based mouse models on potential

therapeutics is the use of clinically relevant concentrations349

. In order to determine whether the levels of

simvastatin and it’s active metabolite simvastatin hydroxy acid were physiologically relevant to those

seen in humans receiving simvastatin the concentrations of both were measured via LC-MS from

castrated mice with established LNCaP xenograft tumors treated with or without simvastatin. Serum

assessed from the simvastatin diet cohort at 8 weeks post castration had an average simvastatin

concentration of 3.29 ± 5.03 ng/mL and simvastatin hydroxy acid of 19.36 ± 11.34 ng/mL (Figure 2.2A).

These levels were comparable to clinical levels of simvastatin in humans taking 40 mg P.O., which

ranged from 1.0–10.0 ng/mL350

.

As simvastatin is an established inhibitor of cholesterol synthesis to ensure efficacious

concentrations were achieved both circulating and tumor cholesterol was assessed. Circulating cholesterol

levels were decreased in the simvastatin group (3.50 ± 0.47 μg/ml) compared to the control diet group

(4.20 ± 0.62 μg/ml, p = 0.032, Figure 2.2B) while no change in tumor cholesterol was observed

(simvastatin: 1.98 ± 0.177 mg/g, Standard: 1.90 ± 0.176 mg/g, p > 0.05, Figure 2.2C). These findings

suggest that simvastatin reached clinically relevant and efficacious concentrations.

44

2.3.3 Simvastatin administration does not result in overt toxicity

Although robust toxicity would be unlikely at the described concentrations of simvastatin, to

ensure the absence of potentially confounding alterations in mouse dietary habits and statin induced

toxicity, body weights were monitored once weekly (Figure 2.2D) and common toxicity markers were

assessed at end point (Figure 2.2E,F). The average body weight of the simvastatin treated mice was ~7%

less than that of the control diet over the treatment period (1 to 8 weeks post-castration) but neither group

displayed progressive weight loss. The statin group had a linear regression slope of −0.177 ± 0.0847 g per

week and the control group of 0.037 ± 0.0648 g per week over the treatment period. These body weights

were within the range of historically measured weights of castrated tumor bearing nude mice351

.

The two most common toxicities associated with simvastatin are myopathy and liver

dysfunction352

. As such two common serum markers for these conditions were selected, creatine kinase

(CK) for myopathy and alanine transaminase (ALT) for liver dysfunction. For both CK (Statin: 289.51 ±

79.41 U/L vs. Control: 282.32 ± 36.79 U/L, Figure 2.2E) and ALT (Statin: 0.044 ± 0.027 U/mL vs. 0.053

± 0.026 U/mL, Figure 2.2F) levels were indistinguishable between mice receiving the statin diet and those

receiving the control diet. These combined results indicate that the mice were not suffering any overt

toxicity from the simvastatin treatment.

2.3.4 Simvastatin administration reduces tumor volume

To assess the in vivo efficacy of simvastatin administration on castration-resistant progression and

tumor growth LNCaP xenografts were established on two sites subcutaneously in nude mice. Weekly

tumor volume and PSA measurements were taken and mice were castrated once PSA exceeded 50 ng/ml.

Following castration mice were randomized into standard control or simvastatin diet cohorts and

maintained for an additional 8 weeks. Tumor volume measurements were normalized to body weight to

account for the ~7% difference in average body weight between the two groups (Figure 2.3A). The tumor

volume of the control diet group had increased by more than 2-fold at 6 weeks post-castration and 4-fold

at 8 weeks post castration compared to the tumor volume at the time of castration with an apparent

45

Figure 2.2: Oral simvastatin administration results in efficacious and clinically relevant serum

concentrations in the absence of toxicity

The impact of dietary simvastatin on serum statin and cholesterol levels, muscle and liver toxicity and

body weight was assessed. (A) Circulating simvastatin (SV) and the active metabolite simvastatin

hydroxy acid (SV-HA) levels were measured at experimental endpoint by LC-MS (mean ± SEM, n=9).

(B) Total serum cholesterol was measured at experimental endpoint by LC-MS. The simvastatin (statin)

diet group had significantly reduced serum cholesterol compared to the standard diet group (Standard,

simvastatin: n = 6, standard: n = 10, mean ± SEM, p = 0.032, T-Test). (C) Tumor cholesterol was

measured from flash frozen tumors obtained at experimental end point. Tumor cholesterol levels were

unchanged between the simvastatin diet group and the standard group (simvastatin: n = 10, standard n =

9, mean ± SEM, t-test p > 0.05, T-Test). (D) Weekly body weigh measurements were made during the

course of the experiment. The simvastatin diet group (open circles, n = 10) was ~7% lighter than the

standard diet group (closed circles; n = 11) however neither group displayed progressive weight loss over

the course of the experiment. (E) Serum creatine kinase activity was assessed by enzymatic assay as a

measure of muscle toxicity in terminal serum samples. No difference was observed between the standard

diet group (n = 11) and the simvastatin diet group (n = 9, mean ± SEM, p > 0.05, T-Test). (F) Alanine

transaminase (ALT) was assessed by enzymatic assay as a measure of liver toxicity. The simvastatin diet

group (n = 9) had slightly elevated levels of ALT but no significant difference was observed when

compared to the standard diet group (n = 11, mean ± SEM, p > 0.05, T-Test).

46

exponential increase observed starting at 5 weeks post-castration. In contrast, the statin treated group did

not reach a 2-fold increase of castration tumor volume until 8 weeks post-castration. Tumor volume

growth rates were assessed by log-transforming tumor volume measurements and fitted versus time by

linear regression (Figure 2.3B). The growth rate of LNCaP xenograft tumors in castrated mice were

significantly reduced in the simvastatin treated group (0.0648 log mm3/g per week ± 0.0061) compared to

the control diet group (0.0921 log mm3/g per week ± 0.0055, Figure 2.3C).

Figure 2.3: Simvastatin suppresses post-castration LNCaP xenograft growth

Weekly tumor volume measurements were conducted using calipers for 8 weeks after castration. Mice

were castrated (week 0) when serum PSA values exceeded 50 ng/mL (A) Weekly body weight-

normalized tumor volume measurements. Following castration mice were randomized to either

simvastatin diet (Statin, open circles, n = 10) or control diet (Standard, closed circles, n =11) for 8 weeks

(mean ± SEM). (B) Weekly tumor volume measurements (weeks 1 to 8) were log transformed and

assessed by linear regression to determine slope and extrapolate growth rate. Solid lines represent the best

linear fit of mean log-transformed tumor volume (control diet, y = 0.0921x + 0.9729, r2 = 0.978, slope =

0.0921 log mm3/week ± 0.0055; Simvastatin diet, y = 0.0648x + 0.9061, r

2 = 0.941, slope = 0.0648 log

mm3/week ± 0.0066). (C) The log10 body weight-normalized tumor volume (TV/BW (mm

3/g)) growth per

week (mean ± SEM) was calculated from linear regression of tumors from the simvastatin (Statin) diet or

control diet (Std) groups. The tumor volume growth rate was significantly reduced in the simvastatin

treated group compared to the statin group (p = 0.008, T-Test).

47

2.3.5 Simvastatin treatment suppresses intratumoral androgen accumulation and alters androgen receptor

activity

As the expression of PSA is regulated through AR activity and the androgen response element

(ARE), PSA is regularly used as marker for AR activity pre-clinically. Clinically serum PSA is an

accepted measure of tumor burden and disease progression in men being managed for prostate cancer.

Generally two successive PSA increases is deemed PSA progression clinically however a strict definition

has yet to be determined353

. Due to the high variability and rapid tumor growth and progression seen in

the LNCaP xenograft model this definition is not ideal. Therefore, here we define PSA progression as the

time to two doublings (400%) of nadir serum PSA for each respective mouse. By three weeks post

castration it was observed that 5 of 11 standard diet mice had reached PSA progression and 10 out of 11

mice reached PSA progression by 6 weeks post castration (Figure 2.4). Conversely, within the simvastatin

treated group only 1 of 10 mice had reached PSA progression at three weeks post castration, 6 out of 10

mice by 6 weeks post castration and 3 of 10 mice never reached PSA progression over the 8 week study

period (Figure 2.4). Performing a Kaplan-Meier analysis to statistically assess time to PSA progression

the standard diet group progressed significantly faster than the simvastatin diet group (hazard ratio = 0.45,

Figure 2.4).

Figure 2.4: Simvastatin suppresses PSA progression in castrated LNCaP xenograft mice

Time to PSA progression was defined as two PSA doublings (400%) of the nadir post-castration and

serum PSA levels were measured once weekly over the course of the study. PSA nadir was defined as the

lowest weekly serum PSA level following castration, which occurred at either one or two weeks post

castration. The fraction of the group yet to undergo PSA progression (percent below 400% nadir PSA)

over the 8-week post-castration time course are presented (statin = simvastatin diet group; standard =

48

control diet group). The simvastatin diet group had significantly prolonged time to recurrence compared

with the control diet group (Log-rank, p = 0.049, hazard ratio = 0.45).

In order to assess the effect of simvastatin on post castration de novo steroidogenesis the levels of

testosterone, DHT and cholesterol-androgen intermediates was assessed by LC-MS in serum and

xenograft tissue collected 8 weeks post castration (Figure 2.5 & Figure 2.6). The tumoral levels of

steroidal intermediates were indistinguishable between the standard and simvastatin diet groups except for

pregnenolone which was modestly increased (Figure 2.5). Despite this, intratumoral testosterone

(Standard: 0.28 ± 0.08 ng/mL, Simvastatin: 0.11 ± 0.03 ng/mL) and DHT (Standard: 0.55 ± 0.16 ng/mL,

Simvastatin: 0.21 ± 0.06 ng/mL) levels were significantly reduced in simvastatin treated mice compared

to the standard diet cohort (Figure 2.6A). Waterfall plot analysis of the testosterone and DHT results

highlight that the highest steroid levels observed in the simvastatin diet group were approximately

proportional to the median level in the standard diet group (Figure 2.6C,D). Paralleling the results of the

intratumoral steroid analysis the observed testosterone concentration in serum was half in the simvastatin

diet group compared to the standard diet group but did not reach statistical significance (Standard: 0.06 ±

0.02 ng/mL, Simvastatin: 0.03 ± 0.01 ng/mL, Figure 2.6B,C). Serum DHT levels were below the lower

limit of quantification.

The expression of AR mRNA was assessed through SYBR green qPCR at end point. The

simvastatin diet group appeared to trend toward reduced expression of AR, however, expression levels

were statistically indistinguishable from the standard diet group (Figure 2.7A). Taken in total, the reduced

intratumoral tumor androgen accumulation, and PSA secretion indicate that simvastatin may reduce

CRPC tumor growth through inhibitory effects on de novo steroidogenesis.

2.3.6 Simvastatin treatment alters cholesterol metabolism

Further to the assessment of circulating and tumor based cholesterol the expression of key

cholesterol metabolism proteins SR-B1 and HMGCR were assessed. The mRNA expression of HMGCR

and SR-B1 was assessed by SYBR green qPCR. The simvastatin diet and standard diet groups were

49

indistinguishable for HMGCR expression (Figure 2.7C). While SR-B1 expression was increased seven

fold in the simvastatin treated group compared to the standard diet group (Figure 2.7B).

Figure 2.5: Simvastatin does not alter androgen precursor accumulation in castrated LNCaP

xenograft bearing mice

Androgen levels were assessed from tumor homogenates via LC-MS in the simvastatin diet group (Statin,

n = 10) and the control diet (Standard, n = 10) group (Mean ± SEM). Concentration of pregnenolone was

modestly increased in the simvastatin diet group (p = 0.01, ANOVA with Sidak’s Test).

50

Figure 2.6: Simvastatin suppresses intratumoral and serum steroid accumulation in castrated

LNCaP xenograft bearing mice

Androgen levels were assessed by LC-MS from both tumor homogenates and terminal cardiac puncture

serum. (A) Tumor testosterone (p = 0.031, T-Test) and DHT (p = 0.030, T-Test) levels were significantly

reduced in the simvastatin diet group (Statin, n = 10) compared to the standard diet group (Standard, n =

10, mean ± SEM, T-Test). (B) Serum testosterone was slightly reduced in the simvastatin diet group

(Statin, n = 10) compared to the standard diet group (Standard, n = 10) but did not reach statistical

significance (t-test, p > 0.05, mean ± SEM). Waterfall plots were generated for tumor testosterone (C),

tumor DHT (D) and serum testosterone (E) with each column representing an individual castrated LNCaP

xenograft mouse.

51

Figure 2.7: Simvastatin administration alters cholesterol metabolism in the absence of changes to

AR expression

qPCR analysis was performed on tumors obtained at study end to assess AR, SR-B1 and HMGCR mRNA

expression. (A) AR expression showed a trend towards decreased expression in the simvastatin (statin)

group compared to the standard diet (standard) group but did not reach statistical significance (p > 0.05,

T-Test; mean ± SEM). (B) SR-B1 expression was significantly increased in the simvastatin diet group

compared to the standard diet group (p = 0.013, T-Test; mean ± SEM). (C) HMGCR expression was

highly variable but did not display any significant difference between the simvastatin and standard diet

groups (p > 0.05, T-Test; mean ± SEM).

2.4 Discussion

The use of the lipid-lowering class of therapeutic agents known as statins has been shown to

reduce risk of and mortality from cardiovascular disease224,354,355

. With this understanding statins continue

to be prescribed to millions of at risk North American men every year356

. With the significant

demographic overlap between those suffering from prostate cancer and those receiving statins, middle

aged to senior aged men, gaining an epidemiological perspective on the effect of these statins at first

glance appears straight forward. However, with the rapidly changing landscape of prostate cancer

treatment, including the advent of PSA screening, novel therapeutics and our further understanding of

treatment altering disease heterogeneity, the picture rapidly becomes obscured. This natural disease

heterogeneity and treatment induced heterogeneity alongside the risks and comorbidities that drive the

prescription of statins to patients are, perhaps, the reasons that more broad studies have failed to find any

association between statin use and risk of cancer development308,309

. Despite this, several studies have

consistently found that statin use correlates to significantly improved outcomes after the diagnosis of

52

prostate cancer293

. A meta-analysis of several of these studies concluded that statin use correlated to a

22% reduction in the risk of metastases (HR: 0.78), a 24% decrease in the risk of both all-cause and

prostate cancer specific mortality (HR: 0.76)357

.

The success of both abiraterone and enzalutamide to improve the survival of metastatic CRPC

patients brought the role of tumor based de novo steroidogenesis, whether from adrenally derived DHEA

or tumor cholesterol, as a mechanism of ADT resistance into the spotlight123,124,141,150,325

. This sentiment is

furthered by the recent findings of the LATITUDE and STAMPEDE clinical trials studying the use of

abiraterone at the beginning of ADT. In the LATITUDE clinical trial the median length of progression

free survival was 33.0 months in the abiraterone group and 14.8 months in the placebo group (HR:

0.47)140

. The STAMPEDE trial reported that the three year failure free survival rate was 75% in the

abiraterone group and 45% in the ADT-only group (HR: 0.29)139

. These findings emphasize the

realization that the deactivation of gonadal androgen synthesis through LHRH targeting therapeutics is

largely insufficient to fully inhibit the tumoral AR signaling axis and that the addition of further

steroidogenic inhibiting therapeutics is essential. Despite these benefits, resistance to abiraterone and

other androgen synthesis inhibitors is common place and thought to be largely due to amplification of

enzymes, namely CYP17A1, that result in intratumoral accumulation of higher order steroids156,358

.

Further, abiraterone-resistant CRPCs can gain CYP17A1-independence by becoming responsive to

steroid precursors such as pregnenolone and progesterone indicating that despite initial successes in

halting AR signaling the combination of ADT and abiraterone is again insufficient to continually inhibit

AR activation359,360

.

What is yet to be fully understood is whether statins, either by reducing the availability of the

primary steroid precursor cholesterol, or by other mechanisms, will potentiate the beneficial effects of

abiraterone through reduced steroidogenesis and AR activity or via other nutrient deprivation

mechanisms. A recent retrospective report of 187 patients in European Urology Focus found improved

overall survival times (HR: 0.51) for patients taking statins and abiraterone as well as increased PSA

declines compared to patients only taking abiraterone342

. The publication reported an increased percentage

53

of abiraterone patients saw PSA responses when using statins at 8 weeks, 12 weeks and 16 weeks

following the start of treatment. Further, a second retrospective study was published in mid-2017 in two

patient cohorts from the Dana-Farber Cancer Institute, 224 patients, and John’s Hopkins University, 270

patients343

. The Dana-Farber Cancer Institute cohort displayed a trend toward improved survival (HR:

0.79) but failed to reach statistical significance and the John’s Hopkins University showed no difference

with statin use (HR: 0.89) as described by the authors. Here we report a validation study on a cohort of

patients from the British Columbia Cancer Agency receiving abiraterone for metastatic or locally

advanced CRPC. A clear, however muted in comparison to the findings of Di Lorenzo et al. (2017),

improvement in survival was observed in the British Columbia cohort (HR: 0.79) reaching statistical

significance using the Gehan-Breslow-Wilcoxon test (p = 0.022) but not the log-rank test (p = 0.078).

This differences likely being a result of the Gehan-Breslow-Wilcoxon test being better powered to detect

early differences in survival distributions compared to the log-rank test361

. Complete records on 279

patients allowed for multivariable modeling adjusting for age, prostatectomy, radiation, time from

diagnosis, neutrophils-lymphocyte ratio and presence of metastases. The effect of statin use on overall

survival remained borderline when using this model (p = 0.087) and did achieve statistical significance

when assessing the 241 patients that had available Gleason grade information allowing for its inclusion in

the multivariate model (p = 0.024). Unlike the European Urology Focus report only a very minor increase

in the percentage of patients who saw PSA responses at 8 and 12 weeks were observed with statin use.

However, both the number of patients who saw PSA response at any time and relative extent of PSA

decline to nadir were increased but failed to reach statistical significance (p = 0.10 and p = 0.086).

When assessed in the multivariable model similar borderline effects were observed for the

ability of concomitant statin use to predict a PSA response in abiraterone patients. Taken as a whole these

findings appear to indicate a trend of improved outcomes for men taking statins concomitantly with

abiraterone although to a lesser extent than the patients observed by Di Lorenzo et al (2017)342

. The

reason for the observed differences between the two datasets is likely a result of several compounding

factors. Both are limited to a relatively small sample size and come from different population centers,

54

British Columbia versus Italy. Contributing factors could include differing standards of care, ethnic

backgrounds, economic status, and dietary habits (western diet vs Mediterranean diet). Further, there are

specific factors of note in the British Columbia dataset that could have confounded the potential benefits

of statins. The average age of statin users was 4 years older than that of non-statin users at the time of the

patient starting abiraterone. The statin treated group, perhaps expectedly due to their use of statins, had a

significantly higher comorbidity burden and were in general in poorer health as indicated by the Charlson

index scoring. Although, the individual aspects of the index are likely underpowered to make definitive

conclusions there is a clear trend towards poorer cardiovascular health through the increases in

hypertension, myocardial infarction, peripheral disease and diabetes in the statin treated population. These

factors although not directly related to prostate cancer specific mortality do play a role in patient overall

survival and should not be ignored when analyzing retrospective studies of this nature.

These confounding factors combined with the heterogeneity of the disease state likely act to

mute differences between statin and non-statin users likely requiring a high number of patients to

establish statistical significance. As such, the results described within this chapter were combined into a

larger multi-institutional study that has been published in the in the peer-reviewed journal Oncotarget362

.

This study assessed 598 patients across eight Centers receiving abiraterone or enzalutamide. The results

of the combined study found a statistically significant increase in median overall survival of 7.9 months.

Further, multivariate analysis found both a statistical significant decrease of 53% in the risk of death and

statistically significant increase of 63% in potential for a > 30% PSA decline within the first 12 months of

abiraterone treatment. These findings help to further validate the trends observed within the British

Columbia Cancer Agency cohort indicating the beneficial role of statins in patients undergoing

abiraterone treatment for metastatic CRPC. With the mounting evidence for the beneficial role for statins

in both prostate cancer and abiraterone treated prostate cancer a prospective clinical trial seems

warranted. This would importantly allow for the correction of the potential confounding variable

discussed above such as patient general health and treatment history and help garner a true understanding

of the potential role of statins in the prostate cancer therapeutic landscape.

55

As the effectiveness of statins on improving prostate cancer outcomes clinically is becoming

clearer the necessity to understand the mechanism by which statins impact prostate cancer becomes

evident. Several separate mechanisms have been proposed including the inhibition of SLCO2B1325

,

geranylgeranyl pyrophosphate and farnesyl pyrophosphate synthesis inhibition363

and a novel mechanism

described here in which reduced synthesis of precursor cholesterol impedes androgen synthesis and AR

activation in CRPC364

. In order to evaluate this mechanism of beneficial statin use in prostate cancer we

performed an LNCaP xenograft study assessing the effect of simvastatin administration on castration-

resistant progression. The validity of oral administration through diet incorporation of simvastatin was

assessed by measuring circulating concentrations of simvastatin and simvastatin hydroxy acid. Further,

the common simvastatin toxicity markers CK and ALT were assessed to measure liver and muscle

toxicities. The observed serum levels of simvastatin were proportional to those seen in humans taking a

relatively high but clinically acceptable dose of 40 mg daily simvastatin350

. The ability to obtain this dose

in the absence of significant changes in toxicity markers indicates that any changes in cancer progression

of the LNCaP xenografts occurred at clinically achievable doses.

The determination of the best animal model for studies of cholesterol and lipid metabolism has

been a debated topic with rabbits, rats and mouse models all having significantly differing lipid profiles to

that of humans196

. Mice specifically are known to have lipoprotein profiles primarily composed of

circulating HDL while the human lipoprotein profile is LDL dominant196

. Statin treatment in these mice

does not consistently alter circulating cholesterol levels but has been reported to lower cholesterol

production in peripheral tissues (reviewed by Solomon and Freeman365

). Undoubtedly these differing lipid

profiles handicap the ability of one to make clinically based inferences, however, despite these differences

a decrease in serum cholesterol was measured in the simvastatin diet group indicating that efficacious

levels of the drug were reached. The reduction of serum cholesterol did not translate to a reduction of

total tumor cellular cholesterol levels. This relatively unsurprising finding is likely due to the large

discrepancy in cellular free cholesterol and cholesterol otherwise sequestered in the plasma membrane. It

has been reported that up to 80% of cellular cholesterol resides in the plasma membrane and the majority

56

of the remainder being distributed among internal membranes leaving only a limited pool of free

cholesterol to be used as a precursor for other purposes including de novo steroidogenesis366

. Earlier work

studying the effect of simvastatin on PCa cells in vitro also did not report measurable changes in cellular

cholesterol340

.

Previously, Zheng et al. reported the ability of atorvastatin to decrease post-castration LNCaP

xenograft growth concluding that the decreased tumor growth was a result of increased apoptosis367

. Here

we report a reduction in the AR ligands testosterone and DHT and observe that the time to PSA

progression following castration was significantly increased in the simvastatin treated group. These

findings are indicative of repressed AR reactivation and signaling correlating to delayed castration-

resistant progression of the xenografts corroborating previously reported findings that simvastatin

treatment decreases PSA production in C4-2 cells in vitro340

. Conversely it has been shown that a

hypercholesterolemia diet in LNCaP xenograft mice promoted elevated circulating cholesterol levels that

was in turn correlated to increased de novo steroidogenesis through elevated intratumoral testosterone and

expression of CYP17A1283

. These findings correlate to clinical findings that suggest the capacity of

tumors to acquire de novo steroidogenic potential is increased in bone metastases by the increased

expression of the factors responsible for the uptake of cholesterol from high-density lipoprotein (SR-B1)

and low-density lipoprotein (LDLr) and steroid synthesis368

. Taken as a whole these studies indicate the

importance of cholesterol availability in promoting CRPC progression through intratumoral

steroidogenesis.

Despite these findings, we cannot rule out the potential anti-cancer activities of prolonged

reduction of cholesterol availability and simvastatin administration that may have impacted non-AR based

mechanisms including non-cholesterol mediated pleiotropic effects365

. The ability of tumors to synthesize

testosterone directly from an available cholesterol pool and our ability to modify that mechanism through

reduction of said cholesterol pool does not preclude the ability of these tumors to uptake testosterone

synthesis intermediates to drive AR reactivation and castration-resistant progression. A recent report

concluded that the beneficial effects seen clinically with statin use may be due to the ability of some statin

57

class molecules to inhibit the uptake of DHEAS through SLCO2B1325

. Although potentially clinically

important, adult mice do not produce adrenal DHEAS369

making it likely irrelevant in mouse based

xenograft studies and making the finding of reduced androgen accumulation in simvastatin treated mice

more consistent with a cholesterol depletion based phenomenon. Lastly, the nude mice used in these

studies generally have circulating serum testosterone levels of 0.1 – 0.4 ng/mL prior to castration and

undetectable levels post-castration347

. The ability of castration to deplete serum testosterone was

confirmed by the low levels observed in the castrated mice. The presence of still detectable concentrations

of serum testosterone in the castrated hosts was likely the result of leakage from the highly vascularized

and rapidly growing LNCaP xenografts present at the time of euthanasia.

The beneficial effect of statins in treating prostate cancer clinically would likely be due to a

combination of several mechanisms including both AR-dependent and independent mechanisms of

cellular homeostasis. These mechanisms are of relevance to the current landscape of prostate cancer

treatment with the potential of statins to interfere with various mechanisms of resistance to current

therapeutics including the shuttling of androgens through the “back-door” pathway for testosterone

synthesis and mutant AR activation by pregnenolone to overcome abiraterone treatment370,371

. The

findings described in this chapter demonstrate the potential of statins in treating CRPC alongside

currently in use second-line AR axis inhibitors. Statins are the most commonly used therapeutic method

of lowering cholesterol in the clinic. However, the upregulation of SR-B1 in response to statin

administration described here, as well as it’s upregulation in models of CRPC289,290

, highlight the

multifaceted approach of the cancer cell to obtain cholesterol and implicate SR-B1 as a major mechanism

of cholesterol regulation in PCa. As such, an alternative approach to targeting cholesterol through SR-B1

antagonism will be described in the following chapter.

58

CHAPTER 3: SR-B1 A NOVEL TARGET FOR PROSTATE CANCER TREATMENT

THROUGH ANDROGEN RECEPTOR PATHWAY-DEPENDENT AND –INDEPENDENT

MECHANISMS


In comparison to the body of research regarding statin use in PCa, our understanding of the

potential of SR-B1 targeting as a therapeutic approach to PCa treatment remains limited. Initial evidence

demonstrated the upregulation of SR-B1 with castrate-resistant progression of pre-clinical LNCaP

xenografts289

. Clinically SR-B1 has recently been associated with high Gleason grade primary cancers

and correlated with decreased disease-specific survival288

. Further, SR-B1 expression was correlated with

androgen synthesis enzymes 3β-HSD and 17-βHSD, and the mTOR target, ribosomal protein S6,

indicating potential links to de novo steroidogenesis and critical metabolism regulatory pathways.

Despite, encouraging initial clinical evidence, further research was needed to confirm and expand our

understanding of the expression of SR-B1 across the PCa landscape. As such, clinical tumor samples

were assessed for major cholesterol metabolism proteins by immunohistochemical (IHC) and mRNA

expression analysis. Preliminary work by the Wasan & Cox research groups targeting SR-B1 pre-

clinically indicated the ability to suppress PSA secretion and reduce viability of C4-2 CRPC cells290

.

Remaining unresolved was the impact of SR-B1 antagonism on critical proliferative cellular functions

such as androgen synthesis and nutrient homeostasis, or in which disease context would targeting SR-B1

be most effective. As such, the studies described in this chapter aimed to elucidate the effects of SR-B1

inhibition by both interfering RNA and small molecule techniques in both the steroidogenic and steroid-

independent models of PCa.

3.2 Methods

3.2.1 Immunohistochemical and mRNA expression analysis of clinical samples

IHC staining of the Prostate Cancer Donor Rapid Autopsy Program at the University of

Washington (UWRA, Seattle, WA)372

samples was performed courtesy of the Dr. Colm Morrissey group

in the Department of Urology at University of Washington, using a 1:500 dilution of SR-B1 primary

59

antibody (AB52629, Abcam, Cambridge, United Kingdom) and a pH 9.0 antigen retrieval process.

mRNA expression data for SCARB1 (SR-B1), LDLr and HMGCR was obtained from several databases

for assessment of general expression, and the comparison of expression between cancerous prostatic

tissue and normal prostatic tissue as well as CRPC and neuroendocrine prostate cancer (NEPC).

Expression data from the Shanghai cohort (SC) was obtained courtesy of Dr. Colin Collins (Vancouver

Prostate Centre) for 28 patients with paired normal prostatic tissue and localized cancerous samples373

.

Expression data from the The Cancer Genome Atlas-PRAD (TCGA) dataset was acquired through the

National Cancer Institute GDC Data Portal for 375 localized cancer patients and 48 samples of normal

prostatic tissue. Expression data from the UWRA was obtained courtesy of Dr. Colm Morrissey for 83

rapid autopsy patients. Expression data from the Weill Cornell (WC) dataset was acquired courtesy of Dr.

Himisha Beltran (Weill Cornell) for 78 advanced stage prostate cancer patients374,375

.

3.2.2 Prostate cancer cell lines

The human CRPC cell lines C4-2 and PC-3 were maintained in phenol red-free Roswell Park

Memorial Institute (RPMI) 1640 media (Life Technologies) supplemented with 5% fetal bovine serum

(FBS, Life Technologies) and Dulbecco's Modified Eagle Medium (DMEM, Life Technologies) with

10% FBS (Life Technologies) respectively in a 5% CO2/37 °C incubator.

3.2.3 Antibodies

Information on sources, species of origin, and dilutions primary antibodies used can be found in

Table 3.1.

Table 3.1: Antibody specifications for primary antibodies used in western blotting

Antigen Host Dilution Source

β-actin Mouse 1:10000 Sigma-Aldrich (A2228)

Vinculin Mouse 1:10000 Sigma-Aldrich (V4505)

SR-B1 Rabbit 1:1000 Novus Biologicals (NB400-104)

Clusterin Goat 1:1000 Santa Cruz (sc-6419)

Clusterin Rabbit 1:1000 Cell Signaling (4214S)

Phospho-mTOR Rabbit 1:1000 Cell Signaling (5536)

mTOR Rabbit 1:1000 Cell Signaling (2983)

BiP Rabbit 1:1000 Cell Signaling (3177)

IRE1α Rabbit 1:1000 Cell Signaling (3294)

60

3.2.4 RNA-interference transfection protocol

Cells were seeded into 6-welled plates unless stated otherwise and transfected two days post

seeding. The transfection media consisted of RPMI or DMEM +1%FBS. Lipofectamine RNAiMAX

transfection reagent and either Stealth RNAi duplexes targeting SR-B1 (SRB1-KD, Oligo ID

HSS101571: AUAAUCCGAACUUGUCCUUGAAGGG, Cat. No. 1299001) or Lo GC Negative Control

duplexes (NC, Cat. No. 12935-110) were combined in Opti-MEM I reduced serum media for 20 min prior

to addition to transfection media to a final concentration of 10 nM RNAi and 0.25% Lipofectamine (All

purchased from Life Technologies). Cells were incubated with transfection media for 5 h following which

cells were allowed to recover overnight in Opti-MEM I. The following day the media was changed to

either RPMI-1640 with 5% charcoal-dextran stripped FBS (CSS, Life Technologies) to replicate

androgen deprived conditions for C4-2 cells, or DMEM with 10% FBS for PC-3 cells376

. For experiments

containing DHEA, DHEA was added to the culture medium of cells transfected with either the negative

control or the SR-B1 targeted siRNA as described above 1 day post-transfection. Unless otherwise stated

all assays were conducted at 4 days post-transfection as a previously established time point for nadir of

SR-BI expression in C4-2 cells by the group377

.

3.2.5 BLT-1 treatment protocol

Cells were seeded into 6-welled plates unless stated otherwise. Three days post seeding the media

was transferred to either RPMI-1640 with 5% CSS for C4-2 cells or DMEM with 10% FBS for PC-3 cells

and either dimethyl sulfoxide (DMSO, vehicle) or the specified concentration of BLT-1 was added.

Unless otherwise specified all assays were conducted at 3 days post treatment initiation to mirror the

siRNA treatment method for time spent in CSS supplemented media and replicate as close as possible the

time of SR-B1 antagonism between the two methods.

3.2.6 HDL-cholesterol uptake assay

Studies performed to approximate the cellular uptake of HDL-derived cholesterol were conducted

using the fluorescent lipid 1,1′-dioctadecyl-3,3,3′,3′-tetramethylindocarbocyanine perchlorate (DiI,

61

excitation max: 549 nm, emission max: 565 nm) from labelled HDL particles (DiI-HDL) similar to

previously published methods378-381

. For siRNA treated cells the assay was performed 4 days post-

transfection while BLT-1 treated cells were treated overnight prior to assay start. Cells were incubated in

standard media containing 0.5% bovine serum albumin (BSA) and DiI-HDL (10 μg HDL protein per mL,

Alfa Aesar, Haverhill, MA) for 2 h in a tissue culture incubator (37 °C/5% CO2). Following incubation

cells were washed with PBS and harvested by trypsinization. Cells were then twice washed via

centrifugation (1,000 rpm, 5 min) and suspended in PBS prior to being subjected to fluorescence activated

cell sorting (FACS) analysis on a BD FACSCANTO II flow cytometer (Beckman, Dickinson &

Company, Mississauga, Canada). Excitation was performed using a 488 nm laser line and fluorescence

was detected using the PE channel (585/42 bandpass). Mean fluorescent intensity data were analyzed

using BD FACSDiva software (Beckman, Dickinson & Company). Gating was performed based on

forward (FSC) and side (SSC) scatter characteristics according to previously published methods382

. Mean

fluorescent intensity was normalized to the mean fluorescent intensity of non-treated cells incubated with

DiI-HDL.

3.2.7 Quantitative PCR

RNA was isolated from cells using a TRIzol (Life Technologies) chloroform extraction according

to manufacturer instructions. 1 mL of TRIzol was used to suspend cells and incubated for 5 min. 0.2 mL

of chloroform was then added and incubated for 3 min prior to centrifugation (15 min, 12,000 g, 4 °C).

The aqueous phase was separated and incubated with 0.5 mL of isopropanol for 10 min prior to

centrifugation (10 min, 12,000 g, 4 °C). The RNA precipitate was pelleted then washed with 1 mL 75%

ethanol, pelleted and suspended in 25 µL RNase-free water. cDNA was synthesized from the RNA using

a SuperScript® II Reverse Transcriptase kit (Life Technologies) according to manufacturer instructions.

First strand synthesis was carried out with 50 – 250 ng random primers, 0.5 mM dNTP mix and 1 ng - 5

µg total RNA, incubated at 65 °C for 5 min. 1x First-strand buffer, 10 mM DTT and 40 U RNaseOUT

were then added to the mixture and incubated for 2 min at 42 °C. 200 U of SuperScript® II Reverse

62

Transcriptase were added prior to 42 °C incubation for 5 min and inactivation by heating to 70 °C for 15

min. 2 U of RNase H was then added to each tube and incubated at 37 °C for 20 min. qPCR was

performed on an ABI 7900HT (Life Technologies) using FastStart Universal SyberGreen Master mix

(Roche) and commercially available Qiagen SYBR Green probes targeted to SR-BI (QT00033488),

HMGCR (QT00004081), PSA (QT00027713) and NKX3.1 (QT00202650). The following conditions

were used: 50 °C for 2 min, 95 °C for 10 min, 40x: 95 °C for 15 s, 60 °C for 1 min, 95 °C for 15 s, 60 °C

for 15 sec, 95 °C for 15 sec.

3.2.8 IncuCyte Zoom cellular growth assay

The Incucyte Zoom live-cell analysis system (Essen Bioscience, Ann Arbor, MI) consists of a

tissue culture incubator with built-in imaging equipment capable of imaging tissue culture plates

undisturbed and tracking cellular growth within individual plate wells383

. Cells were either siRNA

transfected two days post seeding or treated with BLT-1 three days post seeding. Plates were then placed

into the Incucyte Zoom incubator (Essen Bioscience) and phase contrast imaging with internal software

processing was used to generate confluency readings taken every 6 h. Confluency readings were then

used to generate cell growth curves over time.

3.2.9 Live/Dead cytotoxicity assay

The Live/Dead Cytotoxicity assay (Invitrogen, Carlsbad, CA) was carried out according to

manufacturer instructions. Following BLT-1 treatment or siRNA transfection cells were harvested with

trypsin, pelleted (1,000 rpm, 5 min) and suspended in PBS containing 100 nM calcein AM and 8 µM

ethidium homodimer-1. Cells were then incubated at room temperature, away from light for 20 min prior

to FACS analysis on a BD FACSCANTO II flow cytometer. Excitation was performed using a 488 nm

laser line, green fluorescence was detected using the FITC channel (530/30 bandpass) and red

fluorescence was detected using the 7-AAD channel (670 longpass). Data were obtained and analyzed

using BD FACSDiva software. Gating was performed based on FSC and SSC characteristics. Cells were

then stratified by quadrant gating into two categories: those who displayed high green fluorescence

63

indicating intracellular esterase activity (living cells), and those who displayed high red fluorescence

indicating damaged or permeable membranes (dead or dying cells).

3.2.10 Cell cycle analysis

Cell cycle analysis was performed using the propidium iodide (PI) based method as previously

described384-386

. Samples previously fixed with ethanol and washed in PBS were suspended in DNA

staining buffer (50 μg/mL PI, 0.1 mg/mL RNAse A, 0.05% Triton X-100, PBS) for one hour in the dark

at room temperature. Immediately after staining, samples were subjected to FACS analysis on a BD

FACSCANTO II flow cytometer (Beckman, Dickinson & Company). A 488 nm laser line was used for

excitation and fluorescence was detected using the PE channel (585/42 bandpass). Data were obtained

and analyzed using BD FACSDiva software (Beckman, Dickinson & Company). Gating was performed

based on FSC and SSC characteristics and interval gates were used to separate cell cycle phase fractions

by DNA content according to established methods386

.

3.2.11 Western blotting

Whole cell lysates were prepared by incubating cells with ice cold modified

radioimmunoprecipitation assay (RIPA) buffer supplemented with protease and phosphatase inhibitors

(Roche) for 5 min prior to collection using cell scrapper. Lysed cells in RIPA buffer were centrifuged

(8,000 g, 10 min) and the supernatant recovered. Protein concentrations of cell lysates were measured

using the Pierce BCA Protein Assay (Fisher, Hampton, NH) or Bradford Protein Assay (Bio-Rad,

Hercules, CA) according to manufacturer’s instructions. Samples were subjected to SDS-polyacrylamide

gel electrophoresis (SDS-PAGE) and proteins were transferred to polyvinylidene difluoride membranes

(Millipore, Burlington, MA) using a semi-dry transfer apparatus (Trans-Blot Turbo, Bio-Rad) in the

presence of Towbin transfer buffer (20% methanol supplemented running buffer). Following protein

transfer membrane blocking with 5% BSA in tris-buffered saline, 0.1% Tween 20 (TBS-T) for 1 hour at

room temperature was performed. Primary antibody incubation was carried out overnight at 4 °C and

followed by secondary antibody incubation (Anti-rabbit IgG, HRP-linked Antibody, Cell Signaling

64

[7074]; IRDye® 800CW Goat anti-Mouse IgG, Li-Cor [925-32210]) for 1 hour at room temperature. In

between each step post-transfer the membrane was washed 3 times for 5 min in TBS-T. Membranes

imaging was performed either by enhanced chemiluminescence detection (Supersignal West Pico,

Thermo Fisher, Waltham, MA) or on an Odyssey CLx infrared imaging system using Odyssey software

version 3.0 (LI-COR, Lincoln, NE).

3.2.12 Fluorescent microscopy

C4-2 cell morphology following siRNA transfection was examined by fluorescent microscopy.

Cells were cultured on coverslips (Fisher) in 6-well plates and transfected as described previously. Cells

were then washed with PBS and fixed with 10% buffered formalin (Fisher) for 15 min at 37 °C. Cells

were then washed again and blocked in 10% goat serum, TBS supplemented with background sniper

blocking reagent (Biocare Medical, Concord, CA) for 1 hour at room temperature. Cells were then stained

with wheat germ agglutinin (WGA) labeling to highlight membranous cellular organelles using WGA

from Triticum vulgaris conjugated to Alexa Fluor 647 (WGA-647, Life Technologies) at a final

concentration of 10 μg/mL. Cells were incubated in WGA-647 diluted in TBS-T for one hour at room

temperature, protected from light. Cells were then washed in TBS and coverslips were mounted and

counterstained with Vectashield antifade mounting medium with DAPI (Vector Laboratories, Burlington,

ON). Imaging was performed on the Zeiss 780 confocal microscope (Toronto, Canada).

3.2.13 Steroid analysis by LC-MS

Cellular androgen levels were assessed and quantified from ~100 mg cell pellets following either

transfection or BLT-1 treatment by LC-MS similar to previously described348

. To obtain sufficient

material for analysis cells were seeded into five T75 cell cultures flasks (~4.2 x 109 cells) and treatment

groups merged prior to LC-MS analysis. Internal standard (20 pg/40 pg deuterated testosterone/DHT;

C/D/N isotopes, IS) was added and pellets were twice extracted by 30 min vortexing with 60/40

hexane/ethyl acetate. Extracts were pooled, dried using a CentriVap (Labconco), reconstituted in 50 µL of

50 mM hydroxylamine and incubated 1 hour at 65 °C. Resulting steroid-oxime derivatives were analyzed

65

using a Waters Acquity UPLC Separations Module coupled to a Waters Quattro Premier XE Mass

Spectrometer (Waters). Separations were carried out with a 2.1x100 mm BEH 1.7 µM C18 column,

mobile phase water (A) and acetonitrile (B) (gradient: 0.2 min, 25% B; 8 min, 70% B; 9-12 min, 98% B;

12.2 min, 25% B; 14 min run length). Data was collected in ES+ mode by multiple reaction monitoring

with instrument parameters optimized for the mass to charge ratios and corresponding fragments of the

oxime-steroids for all keto-steroids in the androgen synthesis pathway. Data processing was performed

with Quanlynx (Waters) and exported to Excel (Microsoft, Redmond, WA) for additional normalization

to pellet weights as required. Quantification was by AUC ratio of standard to IS. Deuterated T was used

as IS with all analytes other than DHT for which deuterated DHT was used and a curve of 6 calibration

standards (0.01-10 ng/mL) was generated (R2> 0.98) for determination of steroids concentrations in the

test samples.

3.2.14 PSA secretion quantification

PSA secreted into media was quantified for transfected or BLT-1 treated cells using an

electrochemiluminescent immunoassay on a Cobas e 411 analyzer (Roche Diagnostics) and analyzed

according to manufacturer’s instructions. 150 µL of media was analyzed using the fully automated

procedure. The Cobas e 411 analyzer is validated for clinical use and determining PSA concentrations

ranging from 0 – 100 ng/mL387

.

3.2.15 Statistical analyses

Statistical analyses on all data were performed using GraphPad Prism software version 6

(GraphPad, La Jolla, CA). Two-sided Student’s t-tests and ANOVA with Tukey’s multiple comparisons

test were used to determine differences between treatment groups. Means of the data sets were considered

to be statistically significantly different if p < 0.05.

3.3 Results

3.3.1 SR-B1 is highly expressed in primary, metastatic and neuroendocrine prostate cancer

66

In order to assess the expression of SR-B1 across the PCa disease state IHC staining of rapid

autopsy specimens from the UWRA was performed and confirmed via analysis of multiple clinical

mRNA expression datasets372

. This included samples of cancerous prostate and patient matched adjacent

normal prostatic tissue from 127 patients as well as terminal rapid autopsy specimens of varying

metastatic sites including bone, lymph node, liver and lung from 71 patients. The tissue specimens

containing stromal and epithelial cells displayed a range of SR-B1 staining, with high expression samples

staining predominantly along the plasma membrane of epithelial cells with stromal adjacent epithelial

cells appearing to show the highest expression (Figure 3.1). Each sample was scored by an experienced

independent pathologist with a score between 0 and 3 (0 = no staining, 1 = low staining, 2 = moderate

staining, 3 = high staining). For normal prostatic tissue only 24% of samples were scored as moderate to

high staining for SR-B1 while 71% of local prostate cancer samples were scored as moderate to high

staining. Similarl to local PCa, metastatic samples showed high levels of SR-B1 staining. Moderate to

high staining of SR-B1 was scored in 57% of bone, 77% of liver, 84% of lymph node and 84% of lung

samples.

Clinical mRNA expression data for SCARB1 (SR-B1), LDLr and HMGCR was collected from

multiple datasets to analyze the expression level of important cholesterol metabolism proteins across the

disease state. In total four different datasets were analyzed, two allowed for the comparison of expression

levels in normal prostate to cancerous prostate (SC and TCGA datasets, Figure 3.2), one reporting

expression information from metastatic tumors (UWRA Dataset, Figure 3.2) and two allowing for the

comparison of CRPC to NEPC (UWRA and WC Datasets, Figure 3.3). Both databases assessed for the

comparison of normal prostatic tissue to cancerous prostatic tissue showed increased expression of SR-

B1, decreased expression of LDLr and a minor, but not significant, decrease in HMGCR in the cancerous

tissue (Figure 3.2A,B: SC: SCARB1: +18%; LDLr: -47%; HMGCR: -21%, n = 27; TCGA: SCARB1:

+68%; LDLr: -23%; HMGCR: -10%, normal n = 48, cancer n = 375). In these primary cancers SR-B1

expression was nearly double that of LDLr and four times HMGCR expression for the SC database (Mean

Counts: SCARB1: 2341, LDLr: 1267, HMGCR: 586, n = 27, Figure 3.2A) contrasting with the TCGA

67

database for which SR-B1 was the lowest expressed, although only slightly, of the three proteins (Mean

fragments per kilobase of transcript per million mapped reads [FPKM]: SCARB1: 9.47, LDLr: 11.48,

HMGCR: 11.31, n = 375, Figure 3.2B). The analysis of metastatic prostate cancer tissue, through the

UWRA database showed a high expression of SR-B1 compared to the other proteins (Mean FPKM:

SCARB1: 28.50, LDLr: 9.03 HMGCR: 11.50, n = 83). SR-B1 expression was highest in liver metastasis,

while bone metastasis had the lowest expression. Due to the differing protocols and units used in these

mRNA expression databases comparisons were not made between databases. Further, differing probe-

mRNA affinities for each target examined could impact the differences observed between SCARB1,

LDLr and HMGCR expression and as such should be considered when making conclusions.

Figure 3.1: SR-B1 expression is increased in local and metastatic prostate cancer

(A) Representative IHC staining for SR-B1 of University of Washington rapid autopsy samples across the

prostate cancer landscape and (B) pathological scoring by an independent pathologist. (Normal/NP =

Normal prostatic tissues, Cancer/PCa = Localized prostate cancer, Liver Met. = Liver metastasis, LN Met.

= Lymph node metastasis, Rib Met. = Rib bone metastasis, Adrenal Met. = Adrenal metastasis (p < 0.001,

Chi-square).

68

Figure 3.2 SR-B1 expression is increased in prostate cancer

The mRNA expression levels of important cholesterol metabolism proteins were assessed from available

expression datasets. (A) normalized mRNA sequencing counts were analyzed from the Shanghai Cohort.

SR-B1 (SCARB1) was more highly expressed than both LDLr and HMGCR (Left, n = 27, p < 0.001,

ANOVA with Tukey’s Test) and cancerous prostatic tissue (PCa) had increased expression of SR-B1 (p <

0.001) and decreased expression of LDLr (p = 0.002) when compared to matched normal prostatic tissue

(Normal)(Right, n = 28, ANOVA with Sidak’s Test). (B) Analysis of the mRNA expression reads

(FPKM) from the TCGA database found that SR-B1 (SCARB1) expression was lower than that of LDLr

and HMGCR (Left, n = 375, p < 0.001, ANOVA with Tukey’s Test). The expression of SR-B1 (p <

0.001) was increased in cancerous prostatic tissue (PCa) and LDLr (p < 0.001) expression decreased

when compared to normal prostatic tissue (Normal)(Right, Cancer: n = 375, Normal: n = 48, ANOVA

with Sidak’s Test). (C) mRNA expression (FPKM) analysis of metastatic tumors from the University of

Washington rapid autopsy dataset SR-B1 (SCARB1) was more highly expressed than LDLr and HMGCR

(Left, n = 83, p < 0.001, ANOVA with Tukey’s Test). (Right) The expression of SR-B1 (SCARB1),

LDLr and HMGCR by site of metastasis. The expression of SR-B1 was higher in liver (p = 0.008) than

69

bone and lymph node (LN, p < 0.001) tissue (n = 83, ANOVA with Sidak’s Test). For box and whisker

plots: middle line = median, box = 25th to 75th percentile, bars = min. to max.

To assess SR-B1 expression in NEPC two databases were assessed, UWRA and WC datasets

which sequenced and stratified metastatic prostate cancer into adeno-CRPC and neuroendocrine-CRPC.

Both of the databases showed increased expression of SR-B1 in the absence of changes to LDLr and

HMGCR expression (UWRA: SCARB1: +49%; LDLr: -8%, HMGCR: -9%; CRPC n = 65, NEPC n = 18,

Figure 3.3A; WC: SCARB1: +66%; LDLr: -10%; HMGCR: -17%, CRPC n = 34, NEPC n =15, Figure

3.3B). These results taken as whole suggest an increased expression of SR-B1 in primary, metastatic and

neuroendocrine prostate cancers highlighting its potential as a therapeutic target in CRPC.

Figure 3.3 SR-B1 expression is increased in NEPC

The mRNA expression levels of important cholesterol metabolism proteins in CRPC and NEPC were

assessed from available expression datasets. (A) Using the University of Washington rapid autopsy

database SR-B1 expression was found to be increased in NEPC (CRPC: n = 65, NEPC: n = 18, p < 0.001,

ANOVA with Sidak’s Test). (B) Using the Weill Cornell database SR-B1 expression was found to be

increased in NEPC (CRPC: n = 34, NEPC: n = 15, p = 0.036, ANOVA with Sidak’s Test). For box and

whisker plots: middle line = median, box = 25th to 75th percentile, bars = min. to max.

3.3.2 SR-B1 antagonism alters cholesterol metabolism of castration-resistant C4-2 cells

As a preliminary assessment into the viability of targeting SR-B1 in PCa initial experiments were

performed to validate potential approaches to SR-B1 antagonism. Both siRNA knockdown and small

molecule inhibition with block lipid transport-1 (BLT-1) were assessed for their ability to reduce HDL-

derived cholesterol uptake by the uptake of fluorescent lipid-DiI with flow cytometry. In order to interpret

this effect each sample was normalized to the fluorescent uptake of non-treated (NT) cells and presented

as a percent change in uptake for treated cells. The SR-B1 targeted siRNA reduced fluorescent uptake by

70

39% (NC: 89.9 %MFI/NT, 55.0 %MFI/NT*100, n = 3, Figure 3.4A) and BLT-1 by 62% in C4-2 cells

(Veh: 90.07 %MFI/NT*100, BLT-1: 34.3 %MFI/NT*100, n =3, Figure 3.4A). To confirm the ability of

SR-B1 targeted siRNA to reduce expression SR-B1 mRNA expression was measured by qPCR in C4-2

cells. The targeted siRNA reduced mRNA expression by 65% compared to scramble control (n = 3,

Figure 3.4B). Further confirmation of the effect of the siRNA treatment on SR-B1 expression can be

found in the western blots seen in Figure 3.9B. Due to the ability of simvastatin to induce SR-B1

expression as described Chapter 2 (Figure 2.7B) the effect of SR-B1 knockdown on HMGCR expression

was assessed by qPCR. C4-2 SR-B1 knockdown cells had an increase of HMGCR mRNA of 217% (n =

3, Figure 3.4C). The induction of SR-B1 expression with HMGCR inhibition as described in Chapter 2

and the increase in HMGCR expression described here may indicate a compensatory mechanism by

which the cell shifts the pathway through which it obtains cholesterol.

Figure 3.4 SR-B1 antagonism inhibits cholesterol uptake and induces HMGCR expression

(A) SR-B1 siRNA silencing or BLT-1 treatment C4-2 cells followed by DiI-HDL incubation and mean

fluorescence measured using flow cytometry. siRNA knockdown (SRB1-KD) and BLT-1 treatment in

C4-2 cells (n = 3, siRNA: p = 0.019, BLT-1: p = 0.0013, ANOVA with Sidak’s Test, mean ± SEM)

reduced DiI-HDL uptake compared to negative siRNA control (NC) and DMSO vehicle (Veh.)

respectively. Expression of SR-B1 mRNA (B) (n = 3, p < 0.001, T-Test, mean ± SEM) assessed by

qPCR, was reduced and expression of HMGCR (C) (n = 3, p = 0.012, T-Test, mean ± SEM) increased

following anti-SR-B1 siRNA (SRB1-KD) treatment compared to negative control (NC) in C4-2 cells.

3.3.3 SR-B1 antagonism inhibits cellular proliferation of C4-2 cells

To determine if the effects on cholesterol metabolism described above affected the proliferation

of the prostate cancer cells an Incucyte Zoom based cellular growth assay was performed. The confluency

of plated cells treated with siRNA transfection or BLT-1 was measured every 6 h. C4-2 cells grew to

71

almost 30% confluency when treated with the scramble control (NC) and despite seeing modest growth

initially cells treated with the targeted siRNA rapidly arrested (Figure 3.5A). The respective growth rates

were 0.192 ± 0.012 %/hour and 0.030 ± 0.005 %/hour for the scramble and targeted siRNA respectively

(n = 3, Figure 3.5C). BLT-1 treated C4-2 cells displayed progressive growth arrest with increasing

concentrations of BLT-1. A treatment of 1 µM BLT-1 resulted in a slight decrease in cell growth (0.365 ±

0.007 %/hour), 10 µM resulted in only very modest growth (0.087 ± 0.004 %/hour) and 20 µM treatment

caused near total growth arrest (0.019 ± 0.005 %/hour) when compared to the vehicle (0.440 ± 0.015

%/hour, n = 3, Figure 3.5B,D).

Figure 3.5 SR-B1 antagonism inhibits C4-2 cell growth

C4-2 cells were (A) transfected with SR-B1 silencing siRNA (SRBI-KD) or negative control (NC) or

treated with (B) BLT-1 or vehicle (right) prior to incubation in the IncuCyte Zoom system. Confluency

measurements were taken every 6 hours (n = 3, mean ± SEM). Linear regression was used to calculate the

slope of each treatment in order to determine growth rate (C)(D). siRNA silencing (p = 0.0002, T-Test)

and BLT-1 (p = 0.0053, ANOVA with Tukey’s Test) at concentrations greater than 10 µM significantly

reduced cell growth.

To determine the phenotypic cause of the observed arrested growth, a Live/Dead cytotoxicity

assay was performed. The assay combined two fluorescent dyes, calcein AM and ethidium homodimer-1.

Calcein AM, a membrane penetrable dye, is rapidly converted into a fluorescent metabolite by cytosolic

72

esterases of living cells while ethidium homodimer-1, a membrane non-penetrable dye, becomes

fluorescent when binding cellular DNA of porous membraned dead cells. C4-2 cells did not exhibit a

significant decrease in calcein AM or increase in ethidium homodimer-1 staining indicating no induction

of cell death with SR-B1 silencing (NC: 17.6 ± 1.43%, KD: 24.3 ± 6.53%, n = 3, Figure 3.6A) but a

significant induction was observed with BLT-1 treatment at 10 µM (45 ± 3.54%) and 20 µM (79.2 ±

0.13%) compared to the vehicle control (27.5 ± 5.77%, n = 3, Figure 3.6A). The apparent lack of cell

death in response to SR-B1 silencing or low concentrations BLT-1 combined with significant decreases in

cell growth indicates the likely induction of cell cycle arrest while the observed cell death at higher

concentrations of BLT-1 appears to indicate either on-target or off-target toxicity.

Figure 3.6 SR-B1 antagonism induces cell cycle arrest and death

(A) C4-2 cells were transfected with SR-B1 silencing siRNA (KD) or negative control (NC) or treated

with BLT-1 (BLT) or vehicle (Veh.). Following treatment, incubation with the Live/Dead cytotoxicity kit

reagents was performed and measured using flow cytometry. The number of dead cells was significantly

increased at BLT-1 concentrations of 10 µM and 20 µM (n = 3, p < 0.001, ANOVA with Tukey’s Test,

mean ± SEM) but not with siRNA SR-B1 knockdown. The proportion of cells in different cell cycle

phases was determined by PI staining and flow cytometry. In C4-2 cells the (B) siRNA knockdown

induced an accumulation of cells in the G0-G1 phase (n = 3, p < 0.001, ANOVA with Sidak’s Test, mean

± SEM), while (C) BLT-1 treatment induced accumulation of cells in the sub G0 phase and a

corresponding decrease of cells in the G2-M phase (n = 3, p < 0.001, ANOVA with Sidak’s Test, mean ±

SEM).

73

3.3.4 SR-B1 antagonism can induce sub G0 and G0 – G1 cell cycle accumulation

To gain an understanding of the mitotically inactive but apparently intact and functioning cells as

described above cell cycle analysis was performed using a PI based cell cycle assay. In C4-2 cells, the

silencing of SR-B1 expression induced a modest but significant G0 – G1 phase accumulation (NC: 47.1 ±

1.48%, SRB1-KD: 58.1 ± 1.23%, n=3, Figure 3.6B) and an approximate doubling in sub G0 phase

accumulation but failed to reach statistical significance (NC: 2.33 ± 0.67%, SRB1-KD: 5.53 ± 1.36%,

n=3, Figure 3.6B). Treatment with BLT-1 induced an increasing sub G0 phase accumulation for cells

treated with 5 µM and 10 µM BLT-1 (Veh: 2.1 ± 0.39%, 5 µM BLT-1: 13.5 ± 5.83%, 10 µM BLT-1:

18.4 ± 5.73%, n = 4, Figure 3.6C). These results appear to confirm cytotoxicity as evidenced through sub

G0 accumulation with high concentration of BLT-1 while further suggesting a G0 – G1 cell cycle arrest

with siRNA silencing to explain the absence of mitotic activity observed in the growth assay.

3.3.5 SR-B1 antagonism reduces cellular androgen accumulation and AR activity in steroidogenic C4-2

cells

Given that ligand driven AR-activation is considered the primary driver of PCa proliferation and

that cholesterol serves as the primary upstream precursor for the synthesis of AR activating androgens

and de novo steroidogenesis, the effects of impaired cholesterol procurement on androgen accumulation

were assessed as a potential cause of the observed cell cycle arrest388,389

. The methods by which the cells

can obtain the cholesterol necessary for androgen synthesis include cellular cholesterol synthesis or

uptake from extracellular sources through LDLr and SR-B1. SR-B1 specifically is known to provide

HDL-cholesterol to steroidogenic tissues and previous work from our group has demonstrated a reduction

in PSA secretion following SR-B1 knockdown235,290

. In Chapter 2, the decreased accumulation of

testosterone and DHT in castrated LNCaP tumors with the inhibition of cholesterol synthesis by statins

was described (Figure 2.6)364

. As such, cellular androgen levels and markers of AR activation were

examined in C4-2 cells cultured in charcoal stripped media as a steroidogenic model390

. Testosterone and

DHT levels were measured by LC-MS. Testosterone levels were decreased by nearly 60% in SR-B1

knockdown cells compared to the scramble control (NC: 0.062 ± 0.0129 ng/mL/mg, SRB1-KD: 0.025 ±

74

0.0079 ng/mL/mg, n = 3, Figure 3.7A) while BLT-1 treatments of 5 µM and 10 µM reduced testosterone

by approximately 50% and 65% respectively but failed to reach statistical significance (Veh: 0.189 ±

0.0693 ng/mL/mg, 5 µM BLT-1: 0.091 ± 0.0287 ng/mL/mg, 10 µM BLT-1: 0.063 ± 0.0134, n =3, Figure

3.7A). DHT levels were significantly decreased with SR-B1 knockdown and BLT-1 treatment. The

knockdown resulted in a decreased concentration of DHT by more than 80% (NC: 0. 087 ± 0.0278

ng/mL/mg, SRB1-KD: 0.015 ± 0.0076, n = 3, Figure 3.7B) and decreases of 70% and 80% for 5 µM and

10 µM BLT-1 treatment respectively (Veh: 0.251 ± 0.0507 ng/mL/mg, 5 µM BLT-1: 0.076 ± 0.0149

ng/mL/mg, 10 µM BLT-1: 0.048 ± 0.0096 ng/mL/mg, n = 3, Figure 3.7B). These findings indicate,

similarly to cholesterol synthesis inhibition, that SR-B1 antagonism whether by siRNA or BLT-1

treatment can reduce the accumulation of the androgenic AR ligands testosterone and DHT. However,

whether the reduced cellular concentration of these androgens actually translated to reduced AR activity

needed to be confirmed.

The mRNA expression of PSA and NKX3.1, AR regulated genes, was assessed to determine

whether the decrease in cellular androgen levels translated to decreased activation of the AR. PSA mRNA

expression was reduced by 86% (n = 3) and NKX3.1 by 43% (n = 3) indicating decreased AR activation

likely due to the reduction in AR ligands (Figure 3.7C). This finding was further confirmed by a

significant decrease in PSA secretion for both the SR-B1 knockdown and dose dependent decrease with

BLT-1 reaching significance with 5 µM and 10 µM BLT-1 (NC: 0.0055 ± 0.00038 ng/mL/µg, SRB1-KD:

0.0011 ± 0.00013 ng/mL/µg, n = 3 BLT-1 IC50: 1.07 µM, n = 3 Figure 3.7D). The decreased expression

of AR regulated genes as well as decreased PSA secretion suggest that the decreased accumulation of

AR-activating androgens is in fact translating to decreased activation of the AR for both siRNA silencing

and BLT-1 treatment. Taken in total these findings indicate that SR-B1 antagonism negatively impacts

the ability of C4-2 cells to undergo de novo steroidogenesis and drive AR activation in the absence of

extracellular androgens.

75

Figure 3.7 SR-B1 antagonism reduces cellular androgen accumulation and AR activity

Alterations in androgen accumulation and AR activation were assessed in C4-2 cells. Testosterone (A)

and DHT (B) levels following siRNA transfection (left) or BLT-1 (right) treatment were measured by

LC-MS from ~100 mg cell pellets normalized to protein content. Testosterone accumulation was

significantly reduced with siRNA knockdown and trended towards decrease with BLT-1 treatment

(siRNA: n = 3, p = 0.0384, T-Test; BLT-1: n = 3, p = 0.1844, ANOVA with Tukey’s Test, mean ± SEM).

DHT accumulation was significantly reduced with both siRNA knockdown and BLT-1 treatment (siRNA:

n = 3, p = 0.0336, T-Test; BLT-1: n = 3, p = 0.0070, ANOVA with Tukey’s Test, mean ± SEM). (C)

Expression of AR regulated PSA and NKX3.1mRNA was assessed by qPCR. Both PSA (n = 3, p < 0.001,

T-Test, mean ± SEM) and NKX3.1 (n = 3, p < 0.001, T-Test, mean ± SEM) mRNA was significantly

reduced with SR-B1 knockdown. (D) PSA secretion into media was assessed using the Cobas e 411

analyzer. PSA secretion was significantly reduced with siRNA knockdown (n = 3, p < 0.001, t-test, mean

± SEM) and with 5 µM and 10 µM BLT-1 treatment (n = 3, p < 0.001, ANOVA with Tukey’s Test, mean

± SEM).

3.3.6 SR-B1 knockdown phenotype is not rescued by exogenous steroid

In order to determine whether the anti-proliferative effects of SR-B1 antagonism in C4-2 cells

were primarily a result of decreased presence of cellular AR activating androgens experiments were

performed in the presence of the exogenous steroid DHEA. DHEA is an androgen intermediate in the

testosterone synthesis pathway primarily produced by the adrenal glands. Although a weaker activator of

76

the AR than T or DHT, DHEA serves primarily as endogenous precursor to more potent AR activating

androgens, in theory replacing the need for pre-cursor cholesterol for androgen synthesis391

. The

knockdown of SR-B1 in the absence of DHEA resulted in a decrease of 80.1% in PSA secretion

compared to control (NC: 0.0055 ± 0.00038 ng/mL/µg, SRB1-KD: 0.0011 ± 0.00013 ng/mL/µg, n = 3

Figure 3.8A). A concentration of 2.5 µM DHEA was capable of inducing robust androgen receptor

activation in negative control treated cells as measured by PSA secretion (NC: 0.0055 ± 0.00038

ng/mL/µg, NC + DHEA: 0.0465 ± 0.00617 ng/mL/µg, n = 3, Figure 3.8A). The silencing of SR-B1

expression in the presence of DHEA resulted in a 74% decrease in PSA secretion compared to the

negative control treated cells in the presence of DHEA (SRB1-KD + DHEA: 0.0121 ± 0.00105

ng/mL/µg, Figure 3.8A). Although the addition of DHEA resulted higher absolute PSA secretion, as

would be expected from steroidogenic cells growing in otherwise androgen-replete medium, the relative

decrease in PSA secretion observed with SR-B1 silencing remained nearly unchanged (80% vs 74%

decrease) in the presence or absence of external steroid.

If AR activation is sufficient to drive C4-2 proliferation then the addition of exogenous steroid

with SR-B1 silencing should avert the induction of the G0 – G1 cell cycle arrest observed with SR-B1

silencing alone. SR-B1 cells in the absence of DHEA had an increase of 16% in the G0 – G1 phase

fraction, assessed by PI staining, compared to negative control whereas SR-B1 knockdown cells in the

presence of DHEA had an increase of 20% in the same fraction compared to negative control in the

presence of DHEA (G0 – G1 phase fraction: NC: 70.0 ± 0.96%, SRB1-KD: 86.4 ± 0.63%, NC + DHEA:

64.5 ± 1.25%, SRB1-KD + DHEA: 84.4 ± 1.05%, n = 3, Figure 3.8B). Lastly, clusterin (Clu), used as a

marker of autophagy described below, was assessed by immunoblotting and it was found that SRB1-KD

cells in the presence of DHEA still displayed a robust induction of Clu expression compared to the

negative control (Figure 3.8C). The induction of G0 – G1 cell cycle arrest in the presence and absence of

exogenous steroid indicates that AR activity alone is insufficient to drive C4-2 proliferation. The inability

of exogenous steroid to fully restore AR activation or prevent cell cycle arrest with SR-B1 silencing

suggests that the arrested phenotype is not solely driven by alterations to the AR axis.

77

Figure 3.8 Arrested SRBI knockdown phenotype is not rescued by exogenous steroid

siRNA-transfected C4-2 cells were cultured in the presence or absence of DHEA (2.5 μM). (A) PSA

secretion into media was assessed using the Cobas e 411 analyzer. PSA secretion was significantly

reduced with siRNA knockdown both in the presence and absence of DHEA (n = 3, p < 0.001, ANOVA

with Tukey’s Test, mean ± SEM). (B) The proportion of cells in different cell cycle phases was

determined by PI staining and flow cytometry. Similar levels of sub G0 and G0 – G1 accumulation were

observed in the presence and absence of DHEA (n = 3, p < 0.001, ANOVA with Tukey’s Test, mean ±

SEM). (C) Representative western blot analysis of autophagy pathway marker Clu. Clu expression was

increased in both the presence and absence of DHEA (n = 3).

3.3.7 SR-B1 antagonism induces cell stress and autophagy pathways

While consistently suppressing growth and androgen accumulation the addition of exogenous

steroid failed to reverse the SR-B1 antagonized phenotype, therefore other cell stress features that might

account for the growth suppression observed by both SR-B1 antagonizing methods were considered. As

such, induction of autophagy was considered as a potential mechanism for the observed growth arrest.

Cancer cells undergoing nutritional or other external stresses have been demonstrated to employ several

mechanisms to evolve and adapt388,392

. Autophagy, one such survival mechanism, is a process in which

the cell recycles and degrades unnecessary cellular constituents. Initial evidence of autophagy was

discovered serendipitously during the visualization of SR-B1 knockout cells by fluorescent microscopy

78

using WGA as a membrane stain. The silencing of SR-B1 expression appeared to induce the

accumulation of perinuclear vacuoles easily visible in Figure 3.9A. The presence of membranous

vacuoles has been demonstrated to be a hallmark of autophagy which functions as the center of lysosomal

degradation of cellular components392

. To further evaluate whether cells were undergoing autophagy the

induction of Clu expression was assessed as a validated molecular marker. Clu is a molecular chaperone

known to be upregulated during cellular stress that functions to prevent protein aggregation and assist in

LC3-I/II lipidation thereby promoting survival and autophagic flux392

. Mature Clu levels were robustly

induced by both the siRNA knockdown and the BLT-1 treatment indicating a strong induction of

autophagy (Figure 3.9B). Induction of an autophagic phenotype is further supported by work from Ankur

Midha who demonstrated increased LC3-I/II lipidation in response to SR-B1 knockdown377

.

Figure 3.9 SR-B1 antagonism induces cell stress and autophagy pathways

(A) C4-2 cells were transfected with SR-B1 siRNA (KD) or negative control (NC) and stained with wheat

germ agglutinin to image intracellular membrane structures by confocal microscopy and compare levels

of ER/Golgi blebbing and vacuole formation. (B) Representative western blot analysis of autophagy and

ER stress pathway markers following transfection as above, or BLT-1 (BLT) or DMSO vehicle (Veh)

treatment in C4-2 cells (n = 3).

Although independent mechanisms of autophagy regulation have been found mTOR is generally

considered to be the primary regulator393

. Within nutrient starved conditions the dephosphorylation and

therefore inactivation of mTOR leads to the downstream activation of autophagy pathways394

. As such,

79

the levels of mTOR phosphorylation were assessed through western blotting in C4-2 cells and were

noticeably decreased when cells were treated with SR-B1 targeted siRNA or treated with the BLT-1

compound (Figure 3.9B). There are several different types of cellular stress that can lead to mTOR

regulated autophagy including low glucose and ATP through AMPK 394

. Altered cholesterol metabolism

is known to be involved in ER stress mechanisms and disrupted lipid equilibriums have been shown to

induce the unfolded protein response (UPR) 395,396

. The UPR, generally in response to an accumulation of

misfolded proteins, activates adaptive pathways that attenuate general protein translation, increase

molecular chaperone expression and induce cell cycle arrest in an attempt to alleviate the ER stress397

.

This process has further been demonstrated to induce autophagic activity through both mTOR

mediated and mTOR independent pathways398,399

. As such, binding immunoglobulin protein (BiP) an

essential chaperone and regulator of ER stress was assessed alongside inositol-requiring enzyme 1 alpha

(IRE1α) a known inducer of ER stress chaperones through the unconventional splicing x-box binding

protein 1 (XBP1)400,401

. It was found that both siRNA knockdown and high concentrations of BLT-1 (10

µM and 20 µM) can induce BiP expression, while comparatively modest inductions of IREα were also

observed (Figure 3.9B). Taken as a whole these results appear to indicate that SR-B1 antagonism induces

a strong autophagic phenotype that is at least in part through the activation of ER stress pathways and the

inhibition of mTOR activity.

Due to the decreasing detection of the internal structural protein actin, used here as a loading

control, detected in Figure 3.9A, methods of protein quantification were compared to insure that

misleading results were not being obtained. The two compared methods were the Pierce BCA Protein

Assay Kit and the Bradford Protein Assay, both performed according to manufacturer instructions (Figure

3.10). The BCA protein assay indicated lower concentrations of protein than the Bradford assay at higher

concentrations of BLT-1 (5 µM, 10 µM and 20 µM) however neither assay showed a large progressive

decrease of protein concentration with increasing concentration of BLT-1 that could account for the large

decrease in actin expression. Further, 10 µM BLT-1 treatment leads to a large increase in detectable

levels of Clu despite the decrease in actin detection (Figure 3.9B). This indicates that the decreasing

80

intensity of the actin band was not likely due to decreased protein loading but perhaps due to the cellular

death processes that were indicated in Figure 3.6.

Figure 3.10 Comparison of protein quantification assays

The concentrations of whole cell lysates prepared for western blots were assessed and compared using

both the BCA and Bradford based protein quantification assays.

3.3.8 SR-B1 antagonism reduces cholesterol uptake and induces robust cell death in androgen

independent PC-3 cells

As the reduction of androgen accumulation appeared to play a limited role on the observed anti-

proliferative effects of SR-B1 antagonism, PC-3 cells, generally considered to be AR negative, were

chosen as a non-steroidogenic model to assess the impact of SR-B1 antagonism on cellular proliferation

by non-AR dependent pathways390

. As with C4-2 cells, the ability of SR-B1 antagonism to reduce HDL-

derived cholesterol uptake was assessed in PC-3 cells. The SR-B1 targeted siRNA reduced fluorescent

uptake by 81% in PC-3 cells (NC: 142.5 %MFI/NT, KD: 26.6 %MFI/NT, n = 3, Figure 3.11) and 10 µM

BLT-1 treatment reduced uptake by 38% in PC-3 cells (Veh: 103.2 %MFI/NT*100, BLT-1: 64.9

%MFI/NT*100, n = 3, Figure 3.11)

81

Figure 3.11 SR-B1 antagonism inhibits cholesterol in PC-3 cells

SR-B1 siRNA silencing or BLT-1 treatment in PC-3 cells followed by DiI-HDL incubation and mean

fluorescence measured using flow cytometry. siRNA knockdown (SRB1-KD) and BLT-1 treatment in

PC-3 (n = 3, siRNA: p < 0.001, BLT-1: p = 0.021, ANOVA with Sidak’s Test, mean ± SEM) reduced

DiI-HDL uptake compared to negative siRNA control (NC) and DMSO vehicle (Veh.) respectively.

To again assess the effects of SR-B1 antagonism on cell growth an Incucyte Zoom based cellular

growth assay was performed. PC-3 cells transfected with the scramble control grew to nearly 80%

confluency over the time course of the experiment while cells treated with SR-B1 targeted siRNA showed

no growth over the same time course, never surpassing 20% confluency (Figure 3.12A). This translated to

a growth rate of 0.560 ± 0.096 %/hour for the scramble treated cells and -0.002 ± 0.009 %/hour for the

SR-B1 knockdown cells (n = 3, Figure 3.12C). When treated with BLT-1 PC-3 cells show a significant

and near complete growth arrest for each dose of BLT-1 tested including from the lowest dose tested at 1

µM BLT-1 (0.075 ± 0.002 %/hour) in comparison to the vehicle only treated cells which grew to

approximately 50% confluency by the end of the experiment (0.407 ± 0.018 %/hour, Figure 3.12B,D).

The silencing of SR-B1 expression in PC-3 cells resulted in the death of 78.0 ± 3.81% of cells

compared to only 11.1 ± 3.85% of scramble transfected cells (n = 3, Figure 3.13A) as assessed by

Live/Dead cytotoxicity assay. The BLT-1 treated cells did not display a significant induction of cell death

except for at 20 µM (29.0 ± 7.00%) when compared to the vehicle treated cells (3.6 ± 0.51%, n = 4,

Figure 3.13A). These findings translated to a large accumulation of cells in the sub-G0 phase (NC: 7.1 ±

0.56%, SRB1-KD: 66.5 ± 4.87%, n = 5, Figure 3.13B) consistent with the robust cell death observed in

Figure 3.13A as measured by cell cycle analysis. The BLT-1 treated cells displayed a significant

82

accumulation of cells in the G0 – G1 phase when treated with 5 µM and 10 µM BLT-1 concentrations,

although modest compared to the differences seen with the siRNA transfection (Veh: 67.8 ± 2.4%, 5 µM

BLT-1: 78.7 ± 2.81%, 10 µM BLT-1: 80.5 ± 1.76%, n = 5, Figure 3.13C). Given the inability of

exogenous steroid to revert the SR-B1 antagonized phenotype, alongside the observation of a robust

response of PC-3 cells, the importance of non-AR mediated effects to SR-B1 antagonism indicates further

the likely impact of nutrient starvation and induction of cellular stresses.

Figure 3.12 SR-B1 antagonism inhibits cell growth in PC-3 cells

PC-3 cells were (A) transfected with SR-B1 silencing siRNA (SRBI-KD) or negative control (NC) or (B)

treated with BLT-1 or vehicle prior to incubation in the IncuCyte Zoom system. Confluency

measurements were taken every 6 hours (n = 3, mean ± SEM). Linear regression was used to calculate the

slope of each treatment in order to determine growth rate (C)(D). siRNA silencing (p = 0.0043, T-Test)

and BLT-1 (p = 0.0028, ANOVA with Tukey’s Test) at concentrations 1 µM or higher significantly

reduced cell growth.

83

Figure 3.13 SR-B1 antagonism induces robust cell cycle arrest and death in PC-3 cells

PC-3 cells were transfected with SR-B1 silencing siRNA (KD) or negative control (NC) or treated with

BLT-1 (BLT) or vehicle (Veh.). (A) Following treatment, incubation with the Live/Dead cytotoxicity kit

reagents was performed and measured using flow cytometry. The number of dead cells was significantly

increased in the siRNA knockdown cells and at a BLT-1 concentration of 20 µM (n = 3, p < 0.001,

ANOVA with Tukey’s Test, mean ± SEM). The proportion of cells in different cell cycle phases was

determined by PI staining and flow cytometry. In PC-3 cells the (B) siRNA knockdown induced

accumulation of cells in the sub G0 phase and corresponding decrease of cells in the G0-G1 and G2-M

phases (n = 5, p < 0.001, ANOVA with Sidak’s Test, mean ± SEM), (C) while BLT-1 treatment induced

accumulation of cells in the G0-G1 phase and a corresponding decrease in the G2-M phase (n = 5, p <

0.001, ANOVA with Sidak’s Test, mean ± SEM).

3.3.9 SR-B1 co-targeting can amplify the effects of singular agents

As SR-B1 knockdown was demonstrated to induce expression of HMGCR (Figure 3.4C)

indicating a potential mechanism of compensation for the lost HDL-derived cholesterol the effect of co-

targeting SR-B1 and HMGCR was assessed. Simvastatin and BLT-1 were used in combination and the

effects on PSA secretion in C4-2 cells were assessed. Simvastatin concentrations of 1 µM and 10 µM did

not, by themselves, lead to a significant decrease in PSA secretion, although 10 µM simvastatin did

84

display a modest decrease (n = 3, Figure 3.14A). When combined with BLT-1, however, a near 50%

decrease in PSA secretion was observed with 0.1 µM BLT-1 in the presence of 1 µM simvastatin as

compared to the 1 µM BLT-1 required to reach a comparable decrease as a singular agent (n = 3, Figure

3.14A). These results demonstrate the essential role of these mechanisms to provide cholesterol as a

metabolite and indicate that targeting multiple mechanisms by which cells obtain cholesterol may

potentiate the effects of solo targeting.

Figure 3.14 SR-B1 co-targeting can amplify the effects of singular agents

Potential strategies for co-targeting SR-B1 were assessed. (A) PSA secretion with SR-B1 inhibition by

BLT-1 and HMGCR inhibition with simvastatin was measured by the Cobas e 411 analyzer. The addition

of simvastatin sensitized cells to BLT-1 treatment (right, n = 3, p < 0.001, Extra sum of squares F-test,

mean ± SEM) at concentrations of simvastatin that themselves did not decrease PSA (left, n = 3, p =

0.369, ANOVA, mean ± SEM). (B) The percentage of cells in the sub G0 phase following transfection

and treatment with autophagy inhibitor chloroquine (CQ) was assessed by propidium iodide staining and

flow cytometry. Cells transfected with SR-B1 knockdown showed significantly increased accumulation in

the sub G0 phase compared to the negative control at 80 µM and 100 µM CQ (n = 2, p < 0.001, ANOVA

with Sidak’s Test, mean ± SEM).

With the induction of autophagy and other cell stress mechanisms becoming a mainstay of

therapeutic resistance in oncology, methods of inhibition for these mechanisms are becoming more

prominent392

. Chloroquine, a small molecule lysosomal alkalizer known to inhibit the binding of the

lysosome and autophagosome, has been a staple in preclinical investigation of autophagy inhibition and

serves as an established agent for a proof-of-principle assessment in SR-B1 antagonized cells402

. To

determine whether the inhibition of autophagy would result in a more robust cellular death in SR-B1

knockdown C4-2 cells sub-G0 phase accumulation was measured with increasing concentrations of

chloroquine. The percentage of SR-B1 knockdown cells in the sub-G0 drastically increased with

85

increasing chloroquine concentration reaching 36% with 100 µM chloroquine (Figure 3.14B). Although,

modest increases in sub-G0 fraction were observed with negative control transfected cells the SR-B1

knockdown cells had a significantly higher percentage of cells in the sub-G0 phase at 80 µM and 100 µM

chloroquine (n =2). Although limited by replicate number these preliminary results indicate the ability to

induce a robust cell death response by inhibiting the autophagy response of SR-B1 antagonized cells.

3.4 Discussion

Selective cholesterol ester uptake through SR-B1 is a critical way cells acquire precursor

cholesterol for steroid hormone biosynthesis in steroidogenic tissues403

. The receptor further signals the

growth and survival of both non-steroidogenic endothelial cells and breast cancer cells255,256,404,405

.

Research into the role of SR-B1 in cancer has related its expression to aggressive characteristics in

multiple cancer types including breast cancer and clear cell renal carcinoma285,286

. In prostate cancer,

clinically elevated SR-B1 expression is correlated with high risk PCa and decreased disease-specific

survival288

. Further, elevated SR-B1 expression is observed in CRPC derivatives of LNCaP, and with

increased tumor growth in the TRAMP model284,289,290

. These results implicate SR-B1 as an actionable

target for managing CRPC.

In this thesis the increased expression of SR-B1 in the progression from normal prostatic tissue to

cancerous localized disease through both IHC analyses of radical prostatectomy specimens and available

expression databases is described. Specimens derived from radical prostatectomy allowed for matched

comparisons of cancerous tissue and adjacent-normal prostatic tissue. The SC dataset was generated from

the sequencing of paired samples of normal prostatic and cancerous tissue obtained from the same patient

similarly allowing for a direct comparison of expression between the tissues. Although conflicting on

which cholesterol metabolism protein was most highly expressed in localized disease both the SC and

TCGA datasets showed increased expression of SR-B1 in cancerous tissue, and perhaps just as

importantly, a stark decrease in LDLr expression indicating a potential shift in the mechanism by which

the cancerous prostatic tissue acquires cholesterol compared to non-cancerous prostatic tissue.

86

These findings, alongside the evidence of high expression of SR-B1 in metastatic tissues,

correlate with the findings by Schorghofer et al. who reported the high expression of SR-B1 in high

Gleason grade primary tumors from US Biomax (Rockville, MD) tissue samples288

. Together with the

understanding that cholesterol accumulation underlies prostate cancer aggressiveness, these findings

strongly implicate SR-B1 as a major factor in the progression of the disease270

. Notably however, a recent

2017 publication in Carcinogenesis correlated squalene monooxygenase (SQLE) with lethal prostate

cancers in the Health Professional Follow-up Study, the Physicians’ Health Study and the Swedish

Watchful Waiting Study406

. Although generally not considered to serve the same regulatory function as

SR-B1, LDLr or HMGCR, SQLE catalyzes an essential step, downstream of HMGCR, in cholesterol

synthesis and has been a target for the development of hypercholesterolemia therapeutics407

. Recently,

SQLE has been identified as a potential oncogenic driver of breast cancer407,408

. The growing number of

cholesterol metabolism proteins implicated in the proliferation of various cancers indicates that systems

or pathway approaches to analysis, such as gene set enrichment analysis, would provide valuable

understanding of global cholesterol metabolism alterations.

NEPC comprises a small, but highly aggressive and lethal, subset of PCa patients. Although a

strict definition is not agreed upon, NEPC is generally considered to take on small cell carcinoma like

features, may or may not express classical IHC markers (chromogranin, synaptophysin, etc.) and is often

AR negative409

. In rare cases de novo NEPC has been identified410

but in the context of modern PCa

management, a vast majority of cases arise as variant of recurrent CRPC including in response to current

generation androgen receptor pathway inhibitors enzalutamide and abiraterone409

. The mechanism by

which adenocarcinoma becomes NEPC remains a complex and unanswered question but several factors

and pathways have been implicated including MYCN, cAMP, BRN2 or loss of p53, pRB or REST374,411-

416. Here we report the increased expression of SR-B1 in post-ADT NEPC compared to standard CRPC as

assessed in both the UWRA and WC datasets. NE differentiated cells have been shown to have

accumulation of free cholesterol as well as close relationship between NE differentiation and cholesterol

rich lipid membranes417,418

. Whether the increased expression of SR-B1 is necessary for providing

87

cholesterol to facilitate essential NE differential signaling pathways, or a larger pool of available

cholesterol is required for the rapid cell division associated with aggressive prostate cancers such as

NEPC, or other undetermined reasons is unknown, but may provide an intriguing avenue for further

research419

.

The finding that SR-B1 antagonism leads to differential responses between PCa models belies the

heterogeneous nature of the disease. The cell lines used within represent, as far as a single immortalized

cell line can, two very different types of recurrent metastatic prostate cancer. The C4-2 cell line is a

derivative line of the well-known LNCaP cell line, itself taken from a biopsy of the left supraclavicular

lymph node of a 50-year-old Caucasian male with metastatic CRPC. C4-2 cells were generated through

the inoculation and growth of LNCaP cells in a castrated athymic mouse resulting in a line capable of

androgen independent growth420

. These cells are p53 positive and maintain AR activation and signaling

even in serum depleted conditions through de novo steroidogenesis358

. PC-3 cells were obtained from a

bone metastasis of a 62 year old Caucasian male421

. Unlike C4-2 and LNCaP cells, PC-3 cells do not

express the AR making them fully androgen-independent and further do not express functional p53422,423

.

Interestingly SR-B1 knockdown in PC-3 cells resulted in robust cellular death in contrast to C4-2 cells

which entered an autophagic phenotype. This finding would emphasize an extra-steroidal mechanism to

the effects seen.

Autophagy is a highly conserved mechanism by which cells regulate several homeostatic process

including the removal of protein aggregates and intracellular toxins as well regulating cytoplasmic

biomass424

. Autophagic responses to cancer treatments are a common survival mechanism employed by

cancer. This includes responses to ADT and androgen pathway inhibitors, taxanes and kinase

inhibitors425-428

. PC-3 cells are capable of entering into an autophagic state following treatment with direct

autophagy inducing agents including the proteasome inhibitor MG 132 and mTOR inhibitor rapamycin392

.

However, the strong induction of cell death as opposed to autophagy in PC-3 cells is likely a result of a

distinct regulatory environment compared to C4-2 cells429

. One major distinction between the two cell

lines is the absence of p53 in PC-3 cells, a transcription factor which is known to positively and

88

negatively regulate autophagy through, at this point, poorly understood mechanisms430

. Notably p53

activation inhibits mTOR, a master regulator of autophagy known to inhibit autophagy in its activated

state394,431,432

. Further, the effect of ER stress on p53 activation has been enigmatic with evidence

demonstrating both p53 activation and deactivation within ER stressed environments433,434

. Although

mechanistic understanding of the role of p53 in autophagy is poorly understood, the absence of p53 in

PC-3 may have impeded the cells ability to enter an autophagic state in a similar manner to C4-2 cells.

The lack of p53 or other regulatory alterations may be providing an opportunity to maintain a proliferative

state under impaired nutrient conditions due to SR-B1 loss. This would result in cells replicating and

dividing with insufficient nutrients to maintain viability leading to the robust cellular death response

observed. In contrast if C4-2 cells maintain a stronger nutrient regulatory environment, highlighted by

active p53, allowing them to enter into an autophagic state through functional stress response mechanisms

avoiding large amounts of cellular death. More general potential reasons for the differing responses to

SR-B1 antagonism may include the differing environment, treatment stage or progression status from

which the studied cell lines were obtained. In particular bone metastases, the origin site of PC-3, have

been noted for high levels of cholesterol and cholesterol metabolism proteins potentially indicating an

increased dependence on cholesterol368

.

BLT-1 is an established small molecule inhibitor of SR-B1. The molecule was first identified by

high-throughput screening of inhibition of SR-B1 selective lipid uptake using DiI-HDL435

. Interestingly

the compound was found not to inhibit, rather enhance, the binding of HDL to SR-B1 and in turn prevent

the transfer of cholesterol or cholesteryl ester across the membrane435

. The treatment of PC-3 and C4-2

cells with BLT-1 was able to successfully replicate the growth arrest observed with the siRNA

knockdown. However, different responses were observed with cell cycle and Live/Dead analysis both

within SR-B1 targeting methods of a single cell line and the cellular response to BLT-1 between C4-2 and

PC-3 cells. Interestingly the treatment of PC-3 cells with BLT-1 did not result in a similar robust cell

death as seen with SR-B1 knockdown. This is potentially explained by the inability of BLT-1 to fully shut

down the transfer of cholesterol by the SR-B1 receptor due to issues relating to affinity binding. Despite

89

this, BLT-1 does appear to induce autophagy in a similar manner to the siRNA knockdown in C4-2 cells,

as measured through decreased mTOR activation and increased Clu expression while also demonstrating

similar markers of ER stress. Further, BLT-1 had similar effects on cellular androgen accumulation

confirming the importance of SR-B1 derived cholesterol in androgen synthesis.

What cannot be fully accounted for when using a small molecule inhibitor such as BLT-1 is

potential off-target binding and effects. A notable potential off-target is CD36 also a member of the

Scavenger Receptor B family which has several natural ligands including oxidized phospholipids,

oxidized low-density lipoproteins and long chain fatty acids436

. The inhibition of CD36 could prevent the

accumulation of nutrients essential for proliferation, notably fatty acids, potentially resulting in a similar

nutrient deprived phenotype437

. CD36 and SR-B1 maintain a high level of structural homology including

similarities in the ligand binding area of the protein438

. The homology of SR-B1 and CD36 is such that

HDL can readily bind to CD36 receptors but lacks the structure to facilitate transport of HDL-derived

cholesterol439,440

. The cysteine 384 residue located in the tunnel domain of SR-B1 has been shown to be

essential for cholesterol uptake inhibition by BLT-1, a residue that is absent from CD36378

. Despite the

lack of cysteine 384 negating the ability of BLT-1 to inhibit cholesterol transfer, what is not known is the

ability of BLT-1 to bind CD36 or whether it impedes other CD36 functions such as long chain fatty acid

uptake. The potential off target effects described here or other unknown effects may be the reason for the

difference in response to BLT-1 as compared to the siRNA knockdown.

As described in Chapter 2 the success of both abiraterone and enzalutamide in managing

metastatic CRPC patients brought the role of de novo steroidogenesis in ADT resistance into the

spotlight141,150

. The initial success of these therapies, despite eventual resistance, displays the continued

potential of novel AR pathway therapies. Here we describe how SR-B1 inhibition reduces androgen

accumulation and AR activation in steroidogenic C4-2 cells. If the inhibition of HDL-derived cholesterol

uptake through SR-B1 was in fact impacting androgen accumulation by impeding de novo steroidogenesis

there would be high potential to overcome several proposed mechanisms of resistance to other androgen

pathway inhibitors. This would include amplification of enzymes, such as CYP17A1, that result in

90

intratumoral accumulation of higher order steroids and CYP17A1-independence by becoming responsive

to steroid precursors156,358-360

. However, the inability of DHEA to reverse the effects of SR-B1 knockdown

indicates that the observed effects are due in part to factors other than solely de novo steroidogenesis

antagonism. Specifically, the inability to return PSA secretion to levels seen in non-SR-B1 antagonized

cells may indicate that the reduction of androgens was not through reduction of precursor or that the

extra-steroidal effects of SR-B1 antagonism impede the ability of the cell to convert DHEA to more

potent androgenic AR ligands. The ability of androgens, through AR activation, to negatively regulate

autophagic activity under what would normally be considered sub-optimal environmental conditions, such

as culturing in charcoal stripped serum, was initially considered441,442

. The reduction of androgen

accumulation through de novo steroidogenesis antagonism could potentially have lead the induction of

autophagy. However, the inability of external steroid to revert said autophagy phenotype makes this

unlikely, and further provides evidence that the observed autophagy and anti-proliferative effects of SR-

B1 antagonism were largely external to the effects observed within the AR pathway.

The ability of prostate cancer cells obstructed from obtaining cholesterol to compensate via other

mechanistic sources provides an intriguing basis for combination therapy. As described in Chapter 2,

castrated mice bearing LNCaP xenografts being treated with simvastatin to inhibit HMGCR upregulate

SR-B1 and SR-B1 antagonized C4-2 cells similarly upregulate HMGCR expression. These changes in

expression, as well as the entrance of the cell into a nutrient deprived autophagic state, indicate that, at

least, the C4-2 cancer cell is able to detect cholesterol depleted conditions and attempt to induce

compensatory changes. Theoretically, therefore impeding the cells ability to use such compensatory

mechanisms by co-targeting both SR-B1 and HMGCR or other cholesterol metabolism proteins may

amplify the anti-proliferative effects seen with individual approaches. Here we describe early preliminary

data co-targeting SR-B1 and HMGCR to potentiate the anti-PSA effects seen with the individual

inhibitors. However, further studies are required to determine the effect of co-targeting on cellular

proliferation, cell death and autophagic induction.

91

The targeting of autophagy alongside autophagy-inducing primary treatment is a commonly

employed technique including, to date, unsuccessful attempts at the development of clinical stage

autophagy inhibitors for PCa treatment443

. Preclinical research has commonly used CQ as an autophagy

inhibitor, including co-targeting to induce more robust cell death effects in PCa444,445

. Here we show that

the inhibition of autophagy with cholesterol in SR-B1 antagonized cells can result in a robust cellular

death as measured through an accumulation of the sub G0 cell phase fraction. This result highlights

autophagy as a potential co-target with SR-B1 to significantly impair prostate cancer growth by reducing

the cells ability to overcome stress results in a more robust cellular death.

Although the two above described potential co-targets for SR-B1 have been rationally identified

and provide promising future avenues of investigation, the advent of modern high throughput techniques

allows for genomic screening for synergistically lethal targeting. With the advent of CRISPR/Cas9

silencing and the development of stable Cas9 expressing cell lines the potential of screening such libraries

for lethal co-targets of BLT-1 treated or SR-B1 knockdown cells is promising446,447

. In addition to

providing potential co-targets, these screening techniques would likely provide valuable insight into

which cell signaling pathways are perturbed through SR-B1 antagonism.

The findings presented in this chapter have identified the high likelihood of SR-B1 being an

important protein for the progression and survival of prostate cancer, the inhibition of which leads to

distinct anti-proliferative effects likely through both steroidal and non-steroidal mechanisms. Further

examination of the mechanisms altered by SR-B1 loss and the investigation of its potential as a

therapeutic target is warranted.

92

CHAPTER 4: EVALUATION OF BLT-1 AS AN IN VIVO INHIBITOR OF SR-B1


Central to the process of target evaluation and drug development is establishing the “drugability”

of the target in an in vivo setting. Such investigations generally involve research into the pharmacokinetic

and toxicity profiles of candidate compounds. As both interfering RNA and small molecule approaches to

targeting SR-B1 displayed high efficacy in vitro (Chapter 3), this chapter assessed the potential of the

small molecule inhibitor BLT-1 as candidate for both further research in vivo and as a proof of principal

for the development of SR-B1 targeted therapeutics. Specifically, the pharmacokinetic and toxicity

profiles of BLT-1 were assessed to determine whether potentially efficacious circulating concentrations

could be achieved in the absence of significant toxicity. These concentrations were then tested in

xenograft based efficacy studies to confirm the ability of BLT-1 to impede tumor growth in vivo.

4.2 Methods

4.2.1 Microsomal assay

Working stocks of BLT-1, VPC-13574 and enzalutamide were prepared in DMSO to 1 mM.

VPC-13574 is a compound originally designed as an inhibitor of the Binding Function 3 (BF3) domain of

the AR448,449

. For the purposes of this chapter it was used as an in house metabolically labile positive

control. Compounds were added to 100 mM potassium phosphate buffer (pH 7.4) to a final concentration

of 1 µM followed by the addition of mouse liver microsomes (Xenotech, Kansas City, KS) to a final

concentration of 0.15 mg/mL. “NADPH regenerating solution” (BD Biosciences, Franklin Lakes, NJ)

was then added and the incubation started in a 37 °C water bath. Aliquots were taken and combined with

stopping solution (Acetonitrile+0.05% formic acid) for analysis by LC-MS at specified time points.

4.2.2 Pharmacokinetic and toxicity analysis

All animal experiments in Chapter 4 were conducted in accordance with the University of British

Columbia’s Committee on Animal Care and approved protocol A16-0072 held by Dr. Emma Guns at the

Vancouver Prostate Centre.

93

Athymic nude mice (Crl:NU-Foxn1nu

; Harlan) were dosed by oral gavage with either 25 mg/kg or

50 mg/kg BLT-1. Due to the highly hydrophobic nature of BLT-1 propylene glycol was used, as a

previously established vehicle for hydrophobic compounds, to allow for complete dissolution of the

compound450

. Blood samples were obtained (approximately 50 µL per sample) via capillary collection of

tail vein bleeds at the following time points: 0, 0.5, 1, 1.5, 2, 4, 8 and 24 h post dosing. Capillaries were

spun by centrifuge at 3000 g for 10 min to isolate serum for analysis. Following the final tail vein bleed

mice were exsanguinated by cardiac puncture to collect blood from which serum was prepared, and

organs were in part flash frozen and in part fixed in 10% buffered formalin solution over night before

being transferred to 70% ethanol for long term storage.

Toxicity analysis was performed using collected terminal serum and the VetScan VS2 (Abaxis,

Union City, CA) and VetScan Comprehensive Diagnostic Profile (Abaxis) according to manufacturer

instructions451

. The Comprehensive Diagnostic Profile includes quantification of serum albumin (ALB),

alkaline phosphatase (ALP), alanine transaminase (ALT), amylase (AMY), total bilirubin (TBIL), blood

urea nitrogen (BUN), calcium (CA), phosphorus (PHOS), creatinine (CRE), glucose (GLU), sodium

(NA+), potassium (K+), total protein (TP), globulin (GLOB).

4.2.3 BLT-1 analysis by LC-MS

Serum samples for each of the time points collected were subjected to LC-MS analysis. Sample

extraction was performed in which 2 µL of 1 µM VPC-13226 IS was combined with 8 µL of serum and

22 µL of acetonitrile (ACN) prior to vortexing for 10 sec. Precipitate was pelleted by centrifugation at

20,000 g for 5 min and supernatant transferred to LC vials for analysis. Standards were prepared in a

similar fashion with standard/IS spiked mouse serum (2 µL standard/2µl IS/20µl ACN) while parallel

standards made up in 67% ACN were used to characterize matrix effects. Samples and standards were

analyzed using a Waters Acquity UPLC Separations Module coupled to a Waters Quattro Premier XE

Mass Spectrometer (Waters). Separations were carried out with a 2.1x100 mm BEH 1.7 µM C18 column

(Waters) and a 50-98% acetonitrile (ACN) gradient from 0.2-3 min (0.3 mL/min) used for separation

94

(with 1 min 98% ACN flush and a 2 min re-equilibration; 6 min run length; 0.1% formic acid

throughout). Data was collected in ES+ mode and compounds were detected by multiple reaction

monitoring with mass to charge (m/z) transitions of 242.1>166 and 242.1>95.9 for BLT1 and m/z

256.1>110.8 for IS. Retention times for BLT-1 and IS were 3.16 min and 2.83 min respectively. Data

analysis was performed with Quanlynx (Waters) with AUC of BLT-1 normalized to IS AUC.

Comparisons with acetonitrile based and serum based standard extracts indicated high extraction

efficiency (>90%) but substantial ion suppression with BLT-1 (~50%), therefore serum-based standards

were used for the generation of the standard curve with 7 calibration standards (4 nM to 4 µM, R2>0.99)

for the determination of BLT-1 concentration in test samples.

4.2.4 Xenograft experiments

For C4-2 xenografts, athymic nude mice (Crl:NU-Foxn1nu

; Age: 12 weeks; Harlan) were

surgically castrated and allowed to recover and for circulating testosterone to nadir for 2 weeks prior to

inoculation on two sites of the hind flank with 2 x 106 C4-2 cells (cultured in RPMI + 5% FBS, 1%

penicillin/streptomycin) in 100 µL matrigel (BD Biosciences). Tumor volume was calculated by caliper

measurements and the equation: Tumor Volume = length x width x height x 0.5326. Once tumor volume

exceeded 100 mm3 mice were given 50 mg/kg BLT-1 (vehicle: propylene glycol) by oral gavage daily.

Treatment was continued for 6 weeks or until tumor burden exceeded 10% of body weight or weight loss

exceeding 20%. At the time of euthanasia, mice were exsanguinated by cardiac puncture following

cervical dislocation under CO2 to collect blood from which serum was prepared. Tumors were in part

flash frozen and in part fixed in 10% buffered formalin solution over night before being transferred to

70% ethanol for long term storage. Serum was isolated from whole blood as described above.

For PC-3 xenografts, athymic nude mice (Crl:NU-Foxn1nu

; Age: 16 weeks; Harlan) were

inoculated on one site of the hind flank with 2 x 106 PC-3 cells (cultured in DMEM + 10% FBS, 1%

penicillin/streptomycin). Tumor volume measurements were taken twice weekly as described above and

once tumor volume exceeded 100 mm3 mice were treated with 25 mg/kg BLT-1(vehicle: propylene

95

glycol) by oral gavage daily. Treatment was continued for four weeks or until tumor burden exceeded

10% of body weight or weight loss exceeding 20%. Post-euthanasia treatment of animals was the same as

with C4-2 xenografts.

4.3 Results

4.3.1 BLT-1 is rapidly metabolized by mouse liver microsomes

Prior knowledge regarding the effects of BLT-1 use in vivo was limited to the reported ability of

1 mg/kg oral BLT-1 to impede chylomicron formation in Syrian golden hamsters which detailed no

pharmacokinetic or robust toxicity analysis452

. Given this paucity of available information initial

experiments were performed to gain an understanding of the stability of BLT-1 in vivo and further how

the compound would fair in use for xenograft experiments. A microsomal stability assay in which the

compound is incubated in the presence of mouse liver microsomes was performed (Figure 4.1).

Enzalutamide was used as a known metabolically stable control compound and was by in large not

metabolized by the microsomes as there was still 97.7% fraction remaining after 60 min incubation with

liver microsomes. VPC-13574 was rapidly metabolized with only 14.7% fraction remaining after 60 min

incubation, translating to a half-life of 22 min. In comparison BLT-1 was metabolized even more rapidly

than the VPC-13574 positive control with only 8.14% fraction remaining at 45 min incubation and having

a half-life of 8 min when incubated with the mouse liver microsomes. The apparent intrinsic clearance

(CLint-app) was estimated for each compound using the equation453

:

𝐶𝐿𝑖𝑛𝑡−𝑎𝑝𝑝 = (0.693

𝑡1/2) (

𝑉𝑜𝑙. 𝑜𝑓 𝑖𝑛𝑐𝑢𝑏𝑎𝑡𝑖𝑜𝑛

𝑚𝑔 𝑚𝑖𝑐𝑟𝑜𝑠𝑜𝑚𝑎𝑙 𝑝𝑟𝑜𝑡𝑒𝑖𝑛) (

𝑚𝑔 𝑜𝑓 𝑚𝑖𝑐𝑟𝑜𝑠𝑜𝑚𝑒

𝑔 𝑜𝑓 𝑙𝑖𝑣𝑒𝑟) (

𝑙𝑖𝑣𝑒𝑟 𝑤𝑒𝑖𝑔ℎ𝑡 (𝑔)

𝑏𝑜𝑑𝑦 𝑤𝑒𝑖𝑔ℎ𝑡 (𝑘𝑔))

Literature values of 45 mg/g for (mg of microsome / g of liver) and 87 g/kg of (liver weight / body

weight) were used, while the reaction volume was 0.5 mL with 0.075 mg microsomal protein453

. The

CLint-app of VPC-13574 was 822.12 mL/min/kg and 2260.92 mL/min/kg for BLT-1. Such a high CLint-app

would not be considered ideal for the development of the compound as a lead candidate, and indicate that

BLT-1 is likely not an ideal candidate for use in in vivo experiments. These results further indicate BLT-1

96

would require relatively high dosing to achieve the efficacious levels observed in the in vitro experiments,

approximately ~5 µM for C4-2 cells and ~1 µM for PC-3 cells as described in Chapter 3. However, the

microsomal stability assay works under the assumption that the compound is completely protein unbound

in serum and that the liver would have ample access to free compound, which is unlikely given the highly

hydrophobic nature of BLT-1454

. Given the limited alternative options and considerations to the

limitations of the microsomal study, mouse based pharmacokinetic studies were performed to determine if

sufficient circulating concentrations could be obtained for the purposes of pre-clinical study of SR-B1

inhibition.

Figure 4.1 BLT-1 is rapidly metabolized by liver microsomes

BLT-1 was incubated in the presence of mouse liver microsomes and concentration was measured over

time. Enzalutamide (Enza) and VPC-13574 were used as non-labile and labile controls, respectively (n =

1).

4.3.2 Oral administration of BLT-1 results in relevant serum concentrations

To determine if actionable levels of circulating BLT-1 could be achieved, despite the rapid

metabolism by mouse microsomes, mice were dosed with either 25 mg/kg or 50 mg/kg by oral gavage

and serum samples obtained to develop a pharmacokinetic profile. Mice dosed with 25 mg/kg BLT-1 had

a Cmax of 552.5 ng/mL (2.28 µM) at 0.5 hours post-dose the first measured dose (Figure 4.3A). The

elimination half-life was 10.4 hours with the final measured concentration at 24 hours post dose being

97

relatively low at 0.783 ng/mL (0.189 µM) resulting in an AUC0-∞ of 3971.2 ng*hr/mL. Mice dosed with

50 mg/kg had an only slightly higher Cmax of 640.1 ng/mL (2.65 µM) and a much longer absorption

phase reaching Cmax at 2 hours post-dose (Figure 4.2A). With 50 mg/kg oral dosing an elimination half-

life of 7.2 hours and an AUC0-∞ of 3913.5 ng*hr/mL was observed.

Figure 4.2 BLT-1 reduces survival of C4-2 xenografts

(A) Serum samples from mice dosed with 50 mg/kg BLT-1 were assessed for BLT-1 concentration over

time and used to calculate basic pharmacokinetic parameters (n = 3). C4-2 xenografts were established on

the hind flank of athymic nude mice. Mice were dosed with either 50 mg/kg BLT-1 (n = 9) or vehicle (n =

7) and body weight (B) and tumor measurements were taken weekly (C). (D) Survival of mice being

treated with vehicle and BLT-1. BLT-1 treated mice had significantly decreased survival time compared

to vehicle treated mice (Hazard Ratio = 0.16, 95%CI = 0.04 – 0.63, p = 0.009, Log-Rank).

4.3.3 50 mg/kg BLT-1 induces overt toxicity in C4-2 tumor bearing mice

The use of C4-2 xenograft mice would have provided an ideal model for the testing of BLT-1 in

vivo. Notably a majority of the SR-B1 targeted work has been within the C4-2 model resulting a larger

understanding of the cellular reaction to SR-B1 antagonism. Further, although the reduction of androgen

98

accumulation in C4-2 was found not to be a primary driver of the SR-B1 antagonized phenotype, an

understanding of the ability of BLT-1 to reduce tumoral androgen accumulation would still provide

valuable insight into placing SR-B1 among other successful AR-axis targeted therapeutics. However, the

minimum efficacious concentration of BLT-1 in C4-2 appears to be ~5 µM as described in Chapter 3. As

such the highest tested dose of 50 mg/kg (Cmax: 2.65 µM) was selected in order to achieve as close to

efficacious circulating concentrations as possible.

To best model the castration-resistant environment mice were castrated and allowed to recover

for two weeks in order to allow sufficient time for the metabolism of remaining serum testosterone prior

to tumor inoculation. Once tumor volume reached 100 mm3 treatments began for a planned six weeks. Of

the nine mice that started BLT-1 treatment, none survived past four weeks of treatment with only four of

the mice surviving to the four-week time point. One mouse was euthanized due to tumor volume size

approaching an inhumane limit while the eight remaining were euthanized due to body weight loss at

differing points over the four weeks. Of the seven mice treated with the vehicle four survived past the

four week time point with three having to be euthanized due to body weight loss. The effect of this body

weight loss on the overall survival of the two treatment groups is exemplified in Figure 4.2D. Both groups

showed a decrease of approximately 2 g mean body weight over the treatment period (Figure 4.2B).

However, the number of mice being euthanized due to body weight loss and removed from the pool over

the course of the experiment means that the mean body weight does not adequately represent the severe

body weight loss being observed. Terminal serum samples were used to complete a comprehensive

toxicity profile of 14 markers451

. The BLT-1 treated mice had significantly elevated levels of ALB, ALP,

ALT, TBIL and TP alongside significant decrease in GLU levels (Table 4.1). Altered serum

concentrations of these markers could indicate dysfunction among several organs and processes in the

body including kidney disease for ALB and TP, and diabetic and nutritional disorders with GLU and

TP451

. However, the group observed as a whole appears to indicate that mice treated with BLT-1 were

experiencing significant liver toxicity. Each of the significantly altered markers is known to be effected in

99

response to liver damage. In particular ALB, ALP and ALT are generally considered strong indicators of

liver dysfunction451,455

.

Table 4.1 Assessment of common serum toxicity markers following repeated BLT-1 dosing in mice

*CRE levels were only detectable at >18.0 mmol/L, as such 18 mmol/L was used to represent all values

less than or equal to 18 mmol/L. **K+ levels were only quantifiable at < 8.5 mmol/L, as such 8.5 mmol/L

was used to represent all values greater than or equal to 8.5 mmol/L.

Marker Vehicle (SD) 25 mg/kg BLT-1

(SD)

50 mg/kg BLT-1

(SD)

P - Value

ALB (g/L) 45.2 (3.69) 42.3 (2.06) 50.3 (5.35) 0.006

ALP (U/L) 42.7 (12.10) 45.2 (15.04) 86.1 (42.91) 0.004

ALT (U/L) 47.8 (15.41) 37.2 (12.12) 131.6 (141.46) 0.047

AMY (U/L) 1161.9 (489.96) 952.2 (180.25) 1243.0 (168.39) 0.387

TBIL (mmol/L) 4.8 (0.72) 4.6 (0.52) 6.3 (1.03) 0.001

BUN (mmol/L) 6.8 (0.93) 6.8 (0.64) 6.1 (1.26) 0.325

CA (mmol/L) 2.9 (0.23) 2.8 (0.13) 2.9 (0.18) 0.911

PHOS (mmol/L) 2.8 (0.66) 3.2 (0.24) 2.5 (0.77) 0.144

CRE (mmol/L) 18.7 (2.60)* 19.5 (3.67)* 18.0 (0.00)* 0.614*

GLU (mmol/L) 13.4 (2.44) 13.7 (2.21) 8.4 (2.00) <0.001

NA+ (mmol/L) 167.4 (5.95) 169.1 (6.18) 169.3 (1.03) 0.700

K+ (mmol/L) 8.5 (0.00)** 8.5 (0.00)** 8.5 (0.00)** ----**

TP (g/L) 58.8 (4.80) 57.6 (5.16) 67.6 (5.28) 0.003

GLOB (g/L) 14.0 (3.22) 15.5 (3.51) 17.3 (4.03) 0.183

Despite the obvious toxicity associated with 50 mg/kg dosing of BLT-1 tumor volumes were

assessed over the course of the treatment. Mice were randomized into treatment groups as tumors

exceeded 100 mm3 with both treatment groups having a median inoculation to treatment time of 5 weeks.

Retrospective comparison of initial and final tumor volume showed that mice undergoing vehicle

treatment had a mean initial tumor volume of 161.1 mm3 and grew to a mean of 1305.0 mm

3 by week

four of the treatment period. The BLT-1 treated mice had an initial mean tumor volume of 160.1 mm3 and

a mean tumor volume of 1925.8 mm3 four weeks into the treatment period (Figure 4.2C). The growth of

the tumors for both groups appeared to closely mirror each other for a majority of the experiment. To

confirm, linear regression analysis was performed on the two treatment groups to determine whether

growth rate was significantly impacted by BLT-1 administration. The observed growth rate of the BLT-1

treated group was slightly higher than the vehicle treated group however the two were statistically

100

indistinguishable (Vehicle: 310.0 ± 27.69 mm3/week; BLT-1: 364.7 ± 64.38 mm

3/week, p = 0.415).

Although the robust toxicity observed with 50 mg/kg oral administration of BLT-1 significantly hampers

the ability to reach sound conclusions on the effects of BLT-1 on tumor volume it appears unlikely that 50

mg/kg BLT-1 is sufficient to impede C4-2 tumor growth.

4.3.4 BLT-1 administration reduces PC-3 tumor growth

As 1 µM BLT-1 was sufficient to arrest in vitro PC-3 growth (Figure 3.5) and concerns of

toxicity at high concentrations of BLT-1, as observed with the 50 mg/kg dose in C4-2 tumor bearing mice

(Table 4.2), the lower dose of 25 mg/kg, which resulted in a potentially efficacious Cmax of 2.28 uM,

was selected for the PC-3 based xenograft experiments. Mice inoculated with PC-3 tumors began daily

oral dosing of 25 mg/kg BLT-1 when tumor volume reached 100 mm3. A majority of both BLT-1 (7 of 13

mice) and vehicle treated (7 of 12 mice) reached dosing tumor volume by one week post inoculation with

all mice starting treatment by 1.5 weeks post inoculation. Of the mice receiving vehicle treatment 10 of

12 successfully completed all four weeks on treatment. One mouse was euthanized after 2.5 weeks due to

body weight loss and another died of undetermined causes overnight 1.5 weeks into treatment. Of mice

receiving BLT-1 treatment 8 of 13 mice successfully completed all four weeks on treatment. One mouse

was euthanized after 3.5 weeks due to body weight loss, another at 2 weeks due to sickly appearance and

behaviour and one found dead of unknown causes after 2 weeks treatment. The remaining two mice were

sacrificed due to tumor ulceration and total tumor volume at 3 weeks and 2.5 weeks treatment

respectively. Mice treated with BLT-1 displayed an average body weight of ~2 g less than that of the

vehicle treated group but neither group displayed treatment wide progressive weight loss (Figure 4.3B).

As with the C4-2 xenografts, terminal serum samples were used to complete a comprehensive

toxicity profile of 14 common markers451

. Mice treated with 25 mg/kg BLT-1 did not display significantly

increased or decreased expression of any of the assessed markers (Table 4.1). These findings indicate that

likely only 3 of the BLT-1 treated mice, the two euthanized for body weight and sickly appearance and

the one mouse found dead, experienced major toxicities. However, in a similar manner two mice

101

receiving vehicle treatment, one euthanized due to body weight loss and one found dead, were also likely

experiencing toxicity. The similarity in toxicity rates indicate that BLT-1 was not inducing toxicity at 25

mg/kg and that the observed toxicities were probably due to vehicle based toxicity or issues related to the

presence of rapidly growing xenografts.

Figure 4.3 BLT-1 reduces PC-3 xenograft tumor growth

(A) Serum samples from mice dosed with 25 mg/kg BLT-1 were assessed for BLT-1 concentration over

time and used to calculate basic pharmacokinetic parameters (n = 3). PC-3 xenografts were established on

the hind flank of athymic nude mice. Mice were dosed with either 25 mg/kg BLT-1 (n = 13) or vehicle (n

= 12) and body weight (B) and tumor measurements were taken twice weekly (C). (D) Time to tumor

volume doubling in vehicle and BLT-1 treated tumors. BLT-1 tumors had significantly increased time to

tumor volume doubling (Hazard Ratio = 0.19, 95%CI = 0.06 – 0.60, p = 0.004, Log-Rank).

Mice receiving both vehicle and BLT-1 treatment displayed progressive tumor growth over the 4

week experiment (Figure 4.3C). Vehicle treated mice had a mean tumor volume of 106.8 mm3 at the start

of treatment and a four week tumor volume of 799.3 mm3 while BLT-1 treated mice had an initial mean

102

tumor volume of 103.25 mm3 and a four week tumor volume of 554.8 mm

3. While initial tumor volumes

were indistinguishable (p = 0.669), linear regression was performed to assess the growth rates of each

treatment group during treatment as previously published by our group and described in Chapter 2364

.

Mice receiving BLT-1 treatment had significantly reduced tumor growth rate compared to the vehicle

treatment group, growing approximately 30% slower (Vehicle: 156.6 ± 10.74 mm3/week; BLT-1: 110.3 ±

9.28 mm3/week, p = 0.005). Tumor volume doubling times were assessed between the two groups. BLT-1

treated mice had significantly longer tumor doubling times than vehicle treated mice (Hazard Ratio =

0.19, 95%CI = 0.06 – 0.60, Figure 4.3D). By one week of treatment 50% of mice treated with vehicle had

doubled in tumor volume with all mice in the group reaching double the initial tumor volume at 2 weeks

of treatment. In comparison, it took two weeks for 50% of mice treated with BLT-1 to reach double tumor

volume and not all mice reached this threshold until 4 weeks of treatment. These results indicate that

BLT-1 dosed at 25 mg/kg orally is capable of reducing PC-3 tumor volume growth in the absence of overt

toxicity.

4.4 Discussion

Despite a substantial number of publications on BLT-1 use in vitro, in vivo based publications

remain scarce452,456-458

. The apparently singular publication (Lino et. al, 2015) features the oral dosing of

BLT-1, likely as mixture rather than solution due to use of PBS as a vehicle given our anecdotal

experience finding an inability to solubilize BLT-1 in PBS, focused on the effects of BLT-1

administration on chylomicron formation from the gut and lacked any systemic analysis of BLT-1452

.

Here we report for the first time a drug metabolism – pharmacokinetic assessment of the compound as

well as studies into the efficacy of the compound in limiting xenograft tumor growth. BLT-1 is composed

of three structural features; the cyclopentyl, linear alkyl and thiosemicarbazone moieties454

. Both the

thiosemicarbazone and linear alkyl appear to be critical to the potency of the molecule while the

cyclopentyl moiety has little apparent impact on activity. The predictably high hydrophobicity (cLogP =

4.41) also appears to be essential for inhibitory activity454

. Although this high cLogP does not surpass the

103

outlined boundary of cLogP = 5 set out by Lipinski’s “rule of five”, the most general of guidelines for

determining drug like qualities of a molecule, it’s hydrophobicity does present potential issues with

regard to suitable vehicles and methods of delivery, absorption and free drug concentration459,460

. This

understanding highlighted the reasoning for using propylene glycol as a safe, miscible vehicle, as opposed

to the published PBS vehicle, in an effort to provide consistent dosing and ideal conditions for

absorption450,452

.

Microsomal stability assays are a commonly used component of the absorption, distribution,

metabolism and excretion (ADME) studies performed to assess a compounds potential in pre-clinical

drug discovery and development. The microsomal fraction of livers contains major drug metabolism

proteins including CYP and UGT enzymes and is commonly used to predict the intrinsic clearance of the

compound in humans461

. The extremely rapid metabolism and high intrinsic clearance of BLT-1 observed

following incubation in the presence of mouse liver microsomes indicates that the compound would likely

be similarly rapidly metabolized within the serum. Rapid hepatic metabolism is a common occurrence of

highly hydrophobic compounds a phenomenon observed here462

. Despite the rapid metabolism observed

within the microsomal study with 25 mg/kg and 50 mg/kg oral administration of BLT-1 sufficient peak

serum concentrations (>1 µM) were obtained in pharmacokinetic studies. Although at Cmax the required

concentration to inhibit PC-3 growth was observed the BLT-1 was fairly quickly removed from

circulation meaning that at once daily dosing the amount of time BLT-1 levels remained in the therapeutic

window were likely minimal. Serum concentrations never reached the required in vitro concentration to

fully arrest growth of C4-2 cells. Although potentially efficacious levels were reached for PC-3 cells,

even if only briefly, the protein unbound fraction is unknown.

Lipophilic compounds, like BLT-1, commonly display high amounts of protein binding462

. A high

level of protein binding could highlight several important implications from the observed data. If BLT-1

is highly protein bound the fraction available for the liver to rapidly metabolize would be minimal

compared to the microsomal assay, an assay based on the assumption that compound is completely

unbound. The inability of the liver to access unbound BLT-1 would in turn translate to slower metabolism

104

and increased half-life. Concurrent with reduced access of BLT-1 to metabolizing enzymes, access of

BLT-1 to tumor-based or other SR-B1 would be reduced. If this was the case the lack of available

unbound drug to act on and inhibit SR-B1 would have significant implications with regards to the

traditional understanding of the “free-drug hypothesis” which states only free unbound drug at the site of

action can act on target462

. However, the importance of low protein binding in candidate drugs is

increasingly being called into question463

. This would be further complicated by evidence that BLT-1 may

act in a largely irreversible manner on SR-B1378

.

The rapid metabolism observed with the microsomal assay and high hydrophobicity alongside the

ability to only briefly reach the potential therapeutic window in pharmacokinetic studies indicate that

BLT-1 is not an ideal candidate beyond in vitro studies for SR-B1 inhibition. However, the lack of well

classified options means that at the time it remained the best option for assessing in vivo efficacy by

xenograft experiments. Here we report for the first time the ability of SR-B1 antagonism through BLT-1

administration to reduce CRPC tumor growth as demonstrated in the PC-3 xenografts. The significant

reduction in tumor volume growth and increase in tumor volume doubling time was successfully achieved

but likely muted by the inability to achieve efficacious serum concentrations for extended period of time

with once daily dosing. Notably, however, the doubling of the dose to 50 mg/kg appeared to have a muted

effect on AUC0 - ∞ and Cmax but a significant induction of toxicity meaning that increasing a single daily

dose is likely impossible. Unknown is what level of toxicity would be observed in mice dosed twice daily

at 25 mg/kg or lower concentrations likely providing increased time in the potential therapeutic window.

What appears clear is that maximum tolerated dose of BLT-1 lies somewhere between 25 mg/kg and 50

mg/kg via oral gavage and that the apparent therapeutic window varies from narrow in the case of PC-3

xenografts to non-existent in the case of C4-2 xenografts.

The toxicity observed when mice were dosed with 50 mg/kg manifested both in significant

weight loss and alterations in circulating concentrations of several serum toxicity markers. The significant

increase in particularly ALT, ALP and TBIL indicate that liver toxicity is the primarily observed form of

toxicity and leading to significant weight loss in the mice. What is unknown is whether the toxicity is

105

related to on-target effects of SR-B1 inhibition or unrelated off-target effects. With the importance of the

liver for both drug metabolism and cholesterol metabolism determining the mechanism by which

hepatotoxicity occurred is likely an arduous task. The liver is considered to be one of the highest

expressers of SR-B1 where the membrane protein plays a critical role in reverse cholesterol transport

functioning to uptake cholesterol from circulating HDL for bile acid synthesis and redistribution236,464

.

The idea that the liver may therefore be suffering from a lack of cholesterol seems unlikely due to the

liver’s multiple mechanisms of obtaining cholesterol including direct blood flow from newly obtained

digestive cholesterol as well as cholesterol synthesis464

. What is perhaps more likely is an increase to

toxic levels of liver based cholesterol. Although generally observed for its ability to provide cholesterol to

the cell SR-B1 maintains bidirectional flux allowing for the uptake of cholesterol to HDL from cells with

high levels of cholesterol465,466

. Non-alcoholic fatty acid liver disease (NAFLD) is a common liver

disorder present in obese patients. The disease is characterized by the accumulation of fat in the liver and

is associated with hepatitis, fibrosis and cirrhosis, conditions which in turn often lead to the differential

expression of the toxicity markers observed with BLT-1 treatment467

. Although only corollary and

potentially only a side-effect of greater dyslipidemic processes, low-HDL has been associated with

NAFLD potentially indicating a role in HDL for helping to remove accumulating cholesterol in the

liver468

. It is possible that the inhibition of cholesterol flux to HDL with BLT-1 had similar effects to low

circulating HDL resulting in cholesterol accumulation and NAFLD-like toxicity in the liver.

BLT-1 itself appears to be a poor candidate for further work in animals or humans due to stability

and toxicity issues. However, the ability of the compound to impede PC-3 tumor growth in spite of the

issues highlights the potential and serves as a proof of principle for the targeting of SR-B1 clinically to

impede CRPC growth. As alluded to previously, despite BLT-1 being the most robustly studied inhibitor

of SR-B1 other compounds have recently been shown to inhibit HDL-derived cholesterol uptake through

SR-B1469,470

. Notably, ML278 was a recent result of a high-throughput screen and the development of a

structure activity relationship for compounds targeted to SR-B1469,470

. ML278 displays a ten-fold

increased potency for the inhibition of SR-B1 compared to BLT-1 and displays no significant toxicity in

106

Chinese hamster ovary (CHO) cells. Further, the compound appears to bind in reversible manner and

displays high selectivity to SR-B1 but does still does experience a high level of protein binding due to its

hydrophobicity. These improvements over the current most common inhibitor BLT-1 indicate that

ML278 may be an ideal option for further investigations into targeting SR-B1 in both in vitro and in vivo

settings.

107

CHAPTER 5: DISCUSSION AND CONCLUSIONS

Our understanding of cholesterol metabolism on both cellular and systemic levels remains a

continually evolving and complex facet of human biology257

. This fact combined with the now well-

developed appreciation for the heterogeneous nature of PCa and cancer in general drive the necessity for

cautious conclusions to the described findings. The overarching hypothesis of this thesis was that

cholesterol modulation, through either synthesis or uptake inhibition, will impact essential signaling

processes impeding the proliferation of CRPC.

To assess the effects of cholesterol synthesis inhibition on CRPC Chapter 2 focused the effects of

statin use with the current generation CRPC therapeutic abiraterone, alongside pre-clinical work assessing

the ability of statins to impede the accumulation of AR-activating androgens. In the BCCA patient cohort

receiving abiraterone, statin use was associated with a trend towards improved outcomes, however only

reaching statistical significance when merged into a larger multi-institutional study. Pre-clinically the

ability of statins to reduce the accumulation of AR-activating androgens in a castrated LNCaP xenograft

model was demonstrated. The central understanding derived from the chapter is that statins are capable of

impacting the ability of CRPC to drive AR activation and as such may provide a mechanism by which

statin use potentiates the beneficial effects of abiraterone or other AR axis targeted therapies.

The second portion of the thesis focused on the assessment of the expression cholesterol uptake

protein SR-B1 in PCa and the preclinical effects of SR-B1 antagonism in Chapter 3, while Chapter 4

contained an assessment of the in vivo potential of the small molecule SR-B1 inhibitor BLT-1 in CRPC. It

was found that SR-B1 was highly expressed in clinical prostate cancer and that pre-clinically inhibition

leads to distinct anti-proliferative effects likely occurring through both steroidal and non-steroidal

mechanisms and while BLT-1 itself may not serve as an ideal candidate for SR-B1 targeting due to

inherent dose limiting toxicity, it has the capacity to decrease in vivo tumor growth. Although the results

of both cholesterol synthesis and uptake inhibition are promising several limitations must be taken into

account when forming conclusions.

108

5.1 Limitations and alternatives

5.1.1 Pleiotropic effects of statin therapy

The most pressing limitations include the multiple effects of HMGCR inhibition through statin

use and the ability of statins to inhibit the DHEA transporter SLCO2B1. As described in Chapter 2, the

inhibition of HMGCR through statins reduces not only the ability of the cell to synthesize cholesterol but

also HMG-CoA-cholesterol intermediates. These include non-steroid isoprenoid intermediates such as

geranylgeranyl pyrophosphate and farnesyl pyrophosphate363

. Integral molecules for the post-translational

modifications of several proteins including GTP-bound proteins Ras and Ras-like proteins these

isoprenoids aid in sub-cellular localization and intracellular trafficking471

. These alterations in isoprenoid

synthesis are believed to be responsible for a number of the non-cholesterol mediated effects of statins.

This includes the induction of eNOS expression, activation of the PI3K/Akt pathway and modulation of

immune responses471-475

. These effects, if present, could result in unaccounted for pleiotropic effects when

using statins as a mechanism of cholesterol inhibition.

However, perhaps the most relevant pleiotropic effect of statins is their ability to reduce DHEA

uptake through the inhibition SLCO2B1, presenting an intriguing potential method by which statins may

impede steroidogenesis and AR activation by mechanisms superfluous to cholesterol synthesis. As

discussed in Chapter 2, it appears unlikely that this mechanism played a significant role in the xenograft

experiments as adult male mice are known to not produce DHEA369

. Yet, this mechanism must be

considered when attempting to dissect mechanisms for the observed benefits of statin use in PCa patients.

Pre-clinically alternative approaches to targeting cholesterol, such as SR-B1 antagonism, and non-

HMGCR cholesterol synthesis inhibition exist. The targeting of downstream enzymes in the mevalonate

pathway would in theory avoid interruptions in geranylgeranyl pyrophosphate and farnesyl pyrophosphate

production and potentially prevent confounding inhibition of SLCO2B1. The inhibitors of squalene

synthase, SQLE and oxidosqualene cyclase all present potential options for reducing cellular cholesterol

synthesis476

. SQLE, as described in Chapter 3, has been correlated to poor outcomes in breast and

109

PCa406,408

. Further, the inhibition of SQLE with terbinafine has been shown to decrease cell viability in a

number of breast cancer cell lines408

. These compounds would almost certainly present with their own set

of confounding factors but would provide valuable comparators to the effects seen with statins.

5.1.2 Alternative mechanisms of cholesterol targeting

Beyond targeting cholesterol synthesis, alternative mechanisms of cholesterol reduction have

been explored in this thesis through antagonism of SR-B1 as discussed in Chapter 3. However, further

mechanisms of cholesterol mediation are worthy of consideration. Clinically available cholesterol

modulators include fibrates, niacin and cholestyramine. Fibrates are known to activate peroxisome

proliferator-activated receptors leading to expression of lipid metabolism genes and have been shown to

have a neutral effect on cancer outcomes477

. Niacin functions through the G protein coupled receptors

niacin receptor 1/2 inhibiting cAMP production and leading to a reduction in liver derived lipoprotein

production478

and cholestyramine is a bile acid sequestering agent preventing gut reabsorption and leading

to increased bile acid synthesis from plasma cholesterol. Notably, each of these approaches is less direct

than either synthesis or uptake inhibition for reducing cholesterol and as such would likely come with

significant confounding variables.

5.1.3 Pleiotropic effects of SR-B1 antagonism

Although the effects of the inhibition of SR-B1 are less well understood than that of HMGCR

inhibition, there are still several potential limitations. The primary function of SR-B1 is the uptake of

extracellular cholesterol, but the protein further plays a functional role in cell signaling pathways such as

eNOS-mediated signaling which is in turn known to interact with established oncogenic pathways as

described in Chapter 1. Particularly the role of Src- and nuclear factor kappa-light-chain-enhancer of

activated B cells (NF-kB)-mediated signaling in cancer proliferation is well established479,480

and as such,

perturbations to these pathways via SR-B1 antagonism should be considered as mechanisms for the anti-

proliferative effects and warrant investigation with future work.

110

As detailed in Chapter 4, the use of BLT-1 comes with significant concerns for toxicity. Although

the on target effect of BLT-1 was confirmed through the inhibition of HDL-mediated cholesterol uptake

in Chapter 3 what is not known are sites of off-target binding and to what extent they influence the

observed results. Further, it is unknown if the observed toxicity is a result of on-target toxicity, likely due

to the high expression of SR-B1 in liver tissue, or off-targeted effects. In order to help understand the

contribution of on/off-target effects on both toxicity and efficacy the use of alternative small molecule

inhibitors, such as ML278 described in detail in Chapter 4, which share little structural similarity to BLT-

1 could be used in a similar fashion.

5.2 Future directions

The results described in this thesis provide a fundamental backbone for further investigation into

the potential of cholesterol based therapeutic targets in PCa and CRPC progression. This section will

outline potential future experiments which may provide answers to remaining questions and further build

on the knowledge developed within the literature and here.

5.2.1 Statins and PCa

As our understanding of the role of statins in a clinical setting continues to expand and evidence

continues to grow and dictate under which circumstances a clinical trial may prove successful the

continually changing landscape of PCa provides further avenues of investigation. With the success of

abiraterone administration alongside ADT in the STAMPEDE and LATITUDE trials the approach has

been approved for widespread use within the clinic. In Chapter 2, a trend towards improved outcomes was

observed with statin use alongside abiraterone in the post-ADT setting. Once combined into a larger

multi-institutional study both abiraterone and enzalutamide patients were found to have improved

outcomes with statin use. Investigation into the effects of statin use in the STAMPEDE and LATITUDE

trials may elucidate further benefits of statin use. Further, the strict inclusion and follow up criteria and

highly detailed medical record keeping associated with such clinical trials would provide an ideal dataset

for analysis.

111

The growing body of epidemiological research finding improved outcomes for patients receiving

statins across multiple stages of PCa emphasizes its potential clinical use. However, by nature

epidemiological studies are limited by the risk of systemic error, bias and inability to fully account for

confounding variables. This has led to calls for prospectively designed trials as an essential step prior to

the clinical introduction of statin use for PCa293,481

. Determining which disease state such a trial should

focus on remains an unanswered question. Recently, L. Mucci and P. Kantoff proposed initial

investigations in high-risk non-metastatic patients undergoing ADT, using primary endpoint as metastases

free survival as surrogate marker for overall survival481

. Although there is limited evidence demonstrating

prolonged time to progression with statin use at the time of ADT, the effect of statins on metastases free

survival is unknown and its rationale relies on its surrogacy for overall survival325,482

. This approach has

the advantage of having an anchored and rationalized start point for statin use while using metastases free

survival as opposed to overall survival expedites the evaluation of statins as an adjuvant therapy. With

increasing evidence, including the findings described here, that statin use may improve outcomes of

patients receiving abiraterone and enzalutamide an adjuvant post-ADT approach may provide an

alternative trial strategy. Due to the relatively short survival time of men on post-ADT abiraterone or

enzalutamide this approach would have a manageable time length while having overall survival as

primary endpoints, consistent with where statins appear to show the most dependable benefits. However,

the length of time required for a patient to see positive effects with statin use is unknown. It is possible

that prolonged statin use is required for beneficial effects which may be potentially unobtainable at such

late stage CRPC. Despite potential pitfalls of these approaches their undertaking would provide crucial

information to guide the use of statins as therapeutic agents in PCa.

5.2.2 SR-B1 and PCa

Despite the promising results obtained from quantifying SR-B1 expression clinically in Chapter 3

further analysis could be performed to validate and expand on the findings described here and the earlier

report that SR-B1 expression is elevated in high Gleason grade PCa and linked to decreased disease-free

112

survival288

. Analysis of the correlation of SR-B1 expression with patient outcomes could be performed

using one of the available predictive TMAs. These arrays include a Vancouver Prostate Centre in-house

designed TMA and the Canary Prostate Cancer Tissue Microarray designed to identify biomarkers for

recurrence-free survival483

. The arrays consist of radical prostatectomy derived specimens and

corresponding patient follow up allowing for direct comparison of protein expression to clinical outcome.

Specifically this would allow for the analysis of the role of cholesterol metabolism proteins in

biochemical recurrence as well as assessment of expression across the disease state.

In this thesis the results of targeting SR-B1 in two established PCa cell lines are described,

however, determining the expression of SR-B1 and the effects of targeting in further cell lines may

provide valuable insight into the role of SR-B1 in PCa. Models could include the AR driven, but

androgen-independent cell lines LN-AI, LN95 and 22Rv1. The androgen independence of these lines is

attributed to increased LBD-deficient AR splice variant, AR-V7, expression and should therefore not be

dependent on cholesterol for de novo steroidogenesis but remain AR driven484

. The apparent increased

expression of SR-B1 in NEPC mRNA datasets and sensitivity of PC-3 to antagonism described in

Chapter 3 provides an intriguing basis for further investigation for a role of SR-B1 in neuroendocrine

differentiation or proliferation. NEPC models: H660, and enzalutamide-resistant LNCaP-derived 42D and

42F cells415,485

can be used as both a direct test of the transcript predictions of increased SR-B1 expression

in NEPC and a model for analyzing SR-B1 antagonism in NEPC. Further, PCa cells that maintain

steroidogenic potential and AR expression such as VCaP would provide further context to effects on

steroidogenic potential358

. While the DU145 cell line is AR-negative, and despite expressing some NE

markers is considered a non-NE model which provides a comparative model to PC-3 cells486

.

Although the use of immortalized PCa cell lines provide valuable tools for evaluating potential

therapeutic targets these models are limited by selective pressures including adaptions to continued

proliferation in a non-tumor environment leading to poor correlation to clinical outcome487,488

. The advent

of patient derived xenografts maintained in murine hosts provides a powerful new approach to evaluating

therapeutic potential across the heterogeneity of the disease. These xenograft tumors, directly implanted

113

from patient to mouse, are thought to better replicate clinical PCa avoiding the genetic drift observed

within immortalized cell lines488

. Several research institutions have developed patient derived xenograft

programs, including the Vancouver Prostate Centre489

and the University of Washington490

, either of

which would be ideal candidates for experiments investigating SR-B1 antagonism. Examining the effects

of SR-B1 antagonism in either the cell lines described above or patient described derived xenografts

would provide insight into the role of SR-B1 in PCa and which PCa phenotype is most impacted by its

antagonism.

Beyond an understanding of where SR-B1 antagonism would be most significant further

investigation into the mechanism of the observed anti-proliferative effects is warranted for both

cholesterol synthesis and uptake inhibition. The findings in this thesis describe the ability to impede PCa

growth and progression through the limiting of cholesterol availability and propose a novel potential

contributory mechanism being reduced precursor availability for de novo steroidogenesis. However, the

inability of DHEA administration to revert the effects of SR-B1 antagonism indicates that although

reducing steroid availability, at least by SR-B1 antagonism, is not primarily responsible for the arrested

phenotype. This finding emphasized the potential impact of more general nutrient-deprived stress

mechanisms driven as a result of impacted cholesterol accumulation. In order to adapt to cellular stresses

such as nutrient deprivation both cancerous and non-cancerous cells employ several mechanisms of

adaptation allowing for continued survival in harsh tumor microenvironments. Specifically intracellular

cholesterol is generally regulated through SREBP which under cholesterol-deplete conditions induces the

expression of proteins responsible for cholesterol uptake and synthesis491

. Activity of SREBP pathway

should therefore be examined as the mechanism by which SR-B1-antagonized cells upregulate HMGCR

expression and vice versa with SR-B1 overexpression following statin inhibition of HMGCR. For cells

unable to replenish cholesterol cellular dysfunction could impact function through several processes

including impaired membrane synthesis and lipid-raft mediated signaling leading to the manifestation of

cell stress responses492-494

.

114

Autophagy functions as a robust mechanism by which PCa copes with several cellular stresses

including ADT, chemotherapy and nutrient deprivation which would otherwise be lethal424

. This thesis

describes what appears to be stark induction of autophagy in SR-B1 antagonized cells. Although initial

results indicate the role of reduced mTOR signaling as a driver of autophagic phenotype further

characterization of the mechanism of the observed stress should be investigated. These include

downstream mTOR signaling pathways including S6 Kinase 1 (S6K1), the eIF-4E binding proteins (4E-

BP1/2) or Unc-51 like autophagy activating kinase (ULK1/2) through which mTOR mediated signaling

drives its regulatory effects495

. External to mTOR–regulated autophagy AMP-activated protein kinase

(AMPK) is a critical energy/nutrient regulatory protein, which functions as a sensor to depleted ATP

conditions within the cell promoting catabolic processes to generate more ATP and has been connected to

metabolic processes including autophagy496

. Capable of activating autophagy through both ULK1

phosphorylation and mTOR inhibition AMPK activity has been shown to be reduced by androgen-driven

reduced expression of liver kinase B1 (LKB1) and could play a role in SR-B1 driven autophagy496,497

.

Autophagy can manifest in response to several disruptions to cellular signaling processes. This

thesis describes the apparent induction of ER-stress and the UPR in response to SR-B1 antagonism as

measured through increased expression of BiP and IRE1α. ER-stress is generally thought to be result off a

disruption of protein homeostasis but has also been demonstrated in response to disrupted lipid

homeostasis396

. Further, ER stress is known to induce autophagy which could mechanistically explain the

SR-B1 antagonized phenotype398

. There are several proposed mechanisms of ER stress mediated

autophagy that could be investigated to assess the connection including eukaryotic initiation factor 2

(eIF2α)-autophagy-related protein 12 (Atg12) expression, IRE1α-TNF receptor-associated factor 2

(TRAF2)- c-Jun N-terminal kinase (JNK) expression and measuring cellular Ca2+

and calmodulin-

dependent protein kinase kinase 2 (CaMKK-β).

Although generally considered to be cholesterol-poor, increased tumoral cholesterol has been

demonstrated in mitochondria and may indicate a role in sustained oncogenic signaling498

. It has been

postulated that this increased cholesterol plays a role in facilitating hypoxia-inducible factor 1-alpha

115

(HIF1α) activity and mitochondrial function in the hypoxic environment generally observed in cancer498

.

The loss of this cholesterol could result in decreased HIF1α signaling and increased hypoxic stress

leading to the observed induction of autophagy with SR-B1 antagonism498,499

. To assess this, general

measurements of mitochondrial function could be taken including ATP production and reactive oxygen

species concentration or more specific assessment of HIF1α signaling.

Cholesterol constitutes a critical component of lipid rafts, membrane domains essential for

several proliferative signaling pathways500

. These include receptor tyrosine kinases insulin-like growth

factor 1 receptor (IGFR) and epidermal growth factor receptor (EGFR) lipid raft signaling and the small

GTPase Ras family with established roles in prostate cancer proliferation500-503

. Both IGFR and EGFR are

known to induce cancer proliferation through PI3K/AKT and Ras/MAPK signaling pathways the

disruption of which can lead to the induction of autophagy504,505

. PI3K functions to phosphorylate

phosphatidylinositol 4,5-bisphosphate (PI[4,5]P2) to PI[3,4,5}P3 leading to a conformational change

inducing AKT binding and activation leading to a proliferative phenotype through many different

branches including increased growth through mTOR activation, increased nutrient metabolism through

the inhibition of glycogen synthase kinase 3 (GSK3), and decreased apoptotic signaling through NF-KB

activation506

. Ras is a small GTPase which in its active state recruits and activates a kinase signaling

cascade through RAF and MAPK kinases leading to the phosphorylation of numerous targets including

pro-proliferation transcription factors Fos, Jun and Myc507,508

. These pathways are considered some of the

most critical oncogenic pathways the disruption of which through impaired lipid raft formation could lead

to reduced proliferative signaling and the induction of autophagy. However, as described in Chapter 1,

SR-B1 is capable of inducing PI3K/AKT and Ras/MAPK signaling via Src independent of its effects on

cellular cholesterol255,256

. The examination of the activity of these pathways would provide insight into

their role in the induction of autophagy in SR-B1 antagonized cells however determining whether the

altered activity of these pathways is a result of cholesterol mediated or independent effects would be

necessary. Both fluorescent probe and detergent resistance assessment could be used to directly assess

membrane formation in SR-B1 antagonized cells509,510

. In general, understanding alterations in cellular

116

signaling processes that drive the observed autophagic phenotype in response to SR-B1 antagonism

provide not only valuable mechanistic insight into the role of SR-B1 in PCa but may also guide the design

of novel small molecule SR-B1 inhibitors and provide rational candidates for synthetic lethal co-targeting.

As described in Chapter 4, one of the major potential issues for further development of BLT-1 is

the significant toxicity associated with use in vivo. The identification of novel small-molecule inhibitors

of BLT-1 would therefore be of high priority. The recently established SR-B1 inhibitor ML278 presents

an intriguing option for this approach. Notably the likely reduction in toxicity and increase in potency

could significantly improve the therapeutic window over that observed with BLT-1 making ML278 more

suitable for use in vivo. Prior to use in vivo, however, ML278 or any other potential inhibitor would need

to be studied in vitro in a similar manner to the experiments described in Chapter 3.

Synthetic lethal co-targeting can be approached by either high-throughput identification or

rational design as a method to increase the cytotoxicity of individual cholesterol metabolism targeted

agents446,447

. In theory high-throughput approaches would employ genome-wide knockout libraries in

concert with SR-B1 antagonism to identify candidates resulting in robust cytotoxicity. While examples of

the potential of rationale co-targeting of SR-B1 with either HMGCR or autophagy inhibitors were

demonstrated in Figure 3.12. Chloroquine and hydroxychloroquine, clinically used prophylactically

against malaria, inhibit the lysosomal degradation of cellular components of autophagic vacuoles and are

commonly employed as an in vitro autophagy inhibitor511

. Clinically, a number of trials are currently

underway combining chloroquine or hydroxychloroquine with standard therapy in an effort to prevent

therapy induced autophagic resistance in several cancer types. Of those trials that have reported, largely in

limited numbers of glioblastoma multiforme patients, minimal to modest improvements in outcomes have

been reported512-519

. Although the clinical potential of chloroquine or hydroxychloroquine appears limited,

there use for pre-clinical proof of principal experiments would still be valuable. Further, more potent

autophagy inhibitors have been developed which may demonstrate superior co-targeting than traditional

agents520

. Notably, SR-B1 antagonized cells displayed significant upregulation of Clu (Figure 3.8). As

described previously, Clu is a stress-activated chaperone that regulates protein homeostasis by preventing

117

protein aggregation, and enhancing autophagosome biogenesis, inhibiting apoptosis and promoting

survival of PCa392,521

. In order to determine if Clu expression affects SR-B1-antagonism-induced cell

stress SR-B1 antagonized cells could be targeted with either Clu-targeted siRNA or OGX-011 antisense

oligonucleotide. Evaluating these co-targeting approaches or those identified through high-throughput

approaches in a similar manner to the experiments described in this thesis would likely provide

therapeutic options for inducing a more robust cytotoxic response in SR-B1 antagonized cells. The

research proposed here would further the understanding of the role and potential of targeting cholesterol

metabolism in PCa, through expanding both the knowledge of clinical expression and impact and effects

of targeting cholesterol metabolism pre-clinically.

5.3 Conclusions

For patients diagnosed with advanced local or metastatic CRPC the mainstay treatment remains

ADT generally through the use of LHRH targeting agents in combination with an AR inhibitor such as

bicalutamide. For those patients that recur following ADT treatment options remain limited. Currently

only the anti-androgens abiraterone and enzalutamide and chemotherapeutic docetaxel are in regular use

and providing significant although limited improvements in patient survival. With taxane-based

chemotherapies remaining the most commonly used non-AR axis based agent in PCa treatment the

discovery of the role of androgens and their use as a therapeutic target remains the central thesis in the

treatment of PCa. The success and failure of AR axis targeting agents in PCa has driven investigation into

the understanding of multiple complex mechanisms of therapeutic resistance, in turn leading to

modifications of approach in how novel AR axis therapeutics are developed. The continual success and

eventual failure of AR axis targeted therapeutics belays both the critical importance and the robust

adaptive potential of the pathway. The continued resistance to these therapies due to AR centered

mechanisms would in theory direct focus to targeting other PCa signaling pathways. However, the paucity

of non-AR axis targeted therapies highlights the difficulty of such approaches.

118

The multifunctional sterol, cholesterol, underlies several essential cellular processes and its role

in human disease is continually developing across multiple ailments. The role of cholesterol in cancer and

more specifically PCa is intently being investigated from multiple angles and appears to have an

important role in the aggressiveness and proliferation of the disease. Here a therapeutic approach where in

the multifaceted role of cholesterol in steroid driven and steroid independent cellular proliferation is

leveraged as a mechanism for halting CRPC growth. The ability of multiple approaches to cholesterol

targeting to impede steroid accumulation integrates the approach with other clinically successful AR axis

targeted therapies. This approach of limiting pre-cursor cholesterol for androgen synthesis would likely in

turn obstruct several mechanisms of resistance to existing AR-axis targeted therapies, including

CYP17A1 over expression and AR hypersensitivity and promiscuity. However, precursor reduction, as

with all clinically approved AR-axis therapies, would be limited by resistance mechanisms that preclude

steroid accumulation for AR activation or growth such as constitutively active AR splice variants and

neuroendocrine differentiation for which steroid reduction would be insufficient to impact CRPC growth.

This understanding emphasizes the importance of the findings described within this thesis that although

cholesterol targeting does reduce androgen accumulation, external mechanisms, likely revolving around

nutritional stress, significantly contribute to the arrest of CRPC growth. This is exemplified by both the

inability of exogenous steroid to reverse the cholesterol antagonized phenotype and the significant impact

of that antagonism in AR negative models of CRPC. This multifaceted approach to targeting CRPC

provides a unique opportunity to tackle a large subset of the heterogeneous recurrent CRPCs.

Beyond establishing the potential window in which cholesterol targeting may prove to be a viable

therapeutic target, by examining the outcomes of patients receiving abiraterone while on statins, this

thesis further attempts to confirm the “drugablility” of a novel therapeutic target in SR-B1. The

circulating concentrations of cholesterol, regularly at superfluous levels, observed in western populations

alongside its role in the development of atherosclerosis have driven the development of several

cholesterol targeted therapeutics, namely statins. Although often overstated, side effects of statin use do

exist but in general statins are considered to be safe for use and demonstrate the feasibility of targeting

119

cholesterol and more specifically HMGCR in a clinical setting224

. This clinical use of statins allows for

the relatively simple investigation of its effects on PCa outcomes as demonstrated here and provides the

ability to develop rationale and design for prospective clinical trials in a relatively straightforward

manner. If a positive role for statin use in PCa treatment was confirmed it would provide a low toxicity,

low cost method for improving the survival of PCa patients. However, statins do not necessarily provide

the best method of cholesterol antagonism for the treatment of PCa but rather the most convenient. The

apparent overexpression of SR-B1 in PCa, its correlation to survival and the comparative specificity of

expression versus HMGCR may indicate a more favorable target for cholesterol modulation in PCa

treatment. Here not only is the ability to impede PCa growth through SR-B1 antagonism demonstrated

but further the viability of SR-B1 targeting in vivo was assessed. Although issues of hydrophobicity and

toxicity at high concentrations were observed with the specific small molecule, BLT-1, the ability to

reach efficacious concentrations was demonstrated and highlights the potential for other SR-B1 targeted

small molecules.

The findings described here contribute to existing literature on the role of cholesterol metabolism

in PCa and can function as a base for further investigation into the topic. The targeting of cholesterol

metabolism for the treatment of PCa has the potential to provide a multifaceted approach to dealing with

the highly heterogeneous nature of the recurrent disease state.

120

References

1 Canadian Cancer Society’s Advisory Committee on Cancer Statistics. Canadian Cancer Statistics

2017. (Toronto, ON, 2017).

2 Gronberg, H. Prostate cancer epidemiology. Lancet 361, 859-864 (2003).

3 American Cancer Society. Cancer Facts & Figures. (Atlanta, GA, 2017).

4 Bratt, O. Hereditary prostate cancer: clinical aspects. J. Urol. 168, 906-913 (2002).

5 Kheirandish, P. & Chinegwundoh, F. Ethnic differences in prostate cancer. Br. J. Cancer 105,

481-485 (2011).

6 Ostrander, E. A. & Udler, M. S. The role of the BRCA2 gene in susceptibility to prostate cancer

revisited. Cancer Epidemiol. Biomarkers Prev. 17, 1843-1848 (2008).

7 Eeles, R. A. et al. Multiple newly identified loci associated with prostate cancer susceptibility.

Nat. Genet. 40, 316-321 (2008).

8 Huncharek, M., Haddock, K. S., Reid, R. & Kupelnick, B. Smoking as a risk factor for prostate

cancer: a meta-analysis of 24 prospective cohort studies. Am. J. Public Health 100, 693-701

(2010).

9 Silva, J. F., Mattos, I. E., Luz, L. L., Carmo, C. N. & Aydos, R. D. Exposure to pesticides and

prostate cancer: systematic review of the literature. Rev. Environ. Health 31, 311-327 (2016).

10 Giovannucci, E. et al. A prospective study of dietary fat and risk of prostate cancer. J. Natl.

Cancer Inst. 85, 1571-1579 (1993).

11 Wright, M. E., Bowen, P., Virtamo, J., Albanes, D. & Gann, P. H. Estimated phytanic acid intake

and prostate cancer risk: a prospective cohort study. Int. J. Cancer 131, 1396-1406 (2012).

12 Whittemore, A. S. et al. Prostate cancer in relation to diet, physical activity, and body size in

blacks, whites, and Asians in the United States and Canada. J. Natl. Cancer Inst. 87, 652-661

(1995).

13 Crawford, E. D. Epidemiology of prostate cancer. Urology 62, 3-12 (2003).

14 Veveris-Lowe, T. L., Kruger, S. J., Walsh, T., Gardiner, R. A. & Clements, J. A. Seminal fluid

characterization for male fertility and prostate cancer: kallikrein-related serine proteases and

whole proteome approaches. Semin. Thromb. Hemost. 33, 87-99 (2007).

15 Stewart, A. B. et al. Prostasomes: a role in prostatic disease? BJU Int. 94, 985-989 (2004).

16 Prins, G. S. & Putz, O. Molecular signaling pathways that regulate prostate gland development.

Differentiation 76, 641-659 (2008).

17 Cunha, G. R. et al. Hormonal, cellular, and molecular regulation of normal and neoplastic

prostatic development. J. Steroid Biochem. Mol. Biol. 92, 221-236 (2004).

121

18 Matsumoto, T. et al. The androgen receptor in health and disease. Annu. Rev. Physiol. 75, 201-

224 (2013).

19 Dehm, S. M. & Tindall, D. J. Androgen receptor structural and functional elements: role and

regulation in prostate cancer. Mol. Endocrinol. 21, 2855-2863 (2007).

20 Marker, P. C., Donjacour, A. A., Dahiya, R. & Cunha, G. R. Hormonal, cellular, and molecular

control of prostatic development. Dev. Biol. 253, 165-174 (2003).

21 Timms, B. G., Mohs, T. J. & Didio, L. J. Ductal budding and branching patterns in the

developing prostate. J. Urol. 151, 1427-1432 (1994).

22 Mangelsdorf, D. J. et al. The nuclear receptor superfamily: the second decade. Cell 83, 835-839

(1995).

23 Tsai, M. J. & O'Malley, B. W. Molecular mechanisms of action of steroid/thyroid receptor

superfamily members. Annu. Rev. Biochem. 63, 451-486 (1994).

24 Committee, N. R. N. A unified nomenclature system for the nuclear receptor superfamily. Cell

97, 161-163 (1999).

25 McEwan, I. J. Molecular mechanisms of androgen receptor-mediated gene regulation: structure-

function analysis of the AF-1 domain. Endocr Relat Cancer 11, 281-293 (2004).

26 He, B., Kemppainen, J. A., Voegel, J. J., Gronemeyer, H. & Wilson, E. M. Activation function 2

in the human androgen receptor ligand binding domain mediates interdomain communication

with the NH(2)-terminal domain. J. Biol. Chem. 274, 37219-37225 (1999).

27 Srinivas-Shankar, U. & Wu, F. C. Drug insight: testosterone preparations. Nat Clin Pract Urol 3,

653-665 (2006).

28 Shang, Y., Myers, M. & Brown, M. Formation of the androgen receptor transcription complex.

Mol. Cell 9, 601-610 (2002).

29 Dehm, S. M. & Tindall, D. J. Molecular regulation of androgen action in prostate cancer. J. Cell.

Biochem. 99, 333-344 (2006).

30 Wang, Q., Carroll, J. S. & Brown, M. Spatial and temporal recruitment of androgen receptor and

its coactivators involves chromosomal looping and polymerase tracking. Mol. Cell 19, 631-642

(2005).

31 Heinlein, C. A. & Chang, C. Androgen receptor in prostate cancer. Endocr. Rev. 25, 276-308

(2004).

32 Rousseau, G. G. Fifty years ago: the quest for steroid hormone receptors. Mol. Cell. Endocrinol.

375, 10-13 (2013).

33 Biddie, S. C., John, S. & Hager, G. L. Genome-wide mechanisms of nuclear receptor action.

Trends Endocrinol Metab 21, 3-9 (2010).

34 Hopper, B. R. & Yen, S. S. Circulating concentrations of dehydroepiandrosterone and

dehydroepiandrosterone sulfate during puberty. J. Clin. Endocrinol. Metab. 40, 458-461 (1975).

122

35 Rainey, W. E., Carr, B. R., Sasano, H., Suzuki, T. & Mason, J. I. Dissecting human adrenal

androgen production. Trends Endocrinol Metab 13, 234-239 (2002).

36 Miller, W. L. & Auchus, R. J. The molecular biology, biochemistry, and physiology of human

steroidogenesis and its disorders. Endocr. Rev. 32, 81-151 (2011).

37 Rosner, W., Hryb, D. J., Khan, M. S., Nakhla, A. M. & Romas, N. A. Sex hormone-binding

globulin: anatomy and physiology of a new regulatory system. J. Steroid Biochem. Mol. Biol. 40,

813-820 (1991).

38 Baker, M. E. Albumin, steroid hormones and the origin of vertebrates. J. Endocrinol. 175, 121-

127 (2002).

39 Mendel, C. M. The free hormone hypothesis: a physiologically based mathematical model.

Endocr. Rev. 10, 232-274 (1989).

40 Hammes, A. et al. Role of endocytosis in cellular uptake of sex steroids. Cell 122, 751-762

(2005).

41 Azzouni, F., Godoy, A., Li, Y. & Mohler, J. The 5 alpha-reductase isozyme family: a review of

basic biology and their role in human diseases. Adv Urol 2012, 530121 (2012).

42 Aggarwal, S., Thareja, S., Verma, A., Bhardwaj, T. R. & Kumar, M. An overview on 5alpha-

reductase inhibitors. Steroids 75, 109-153 (2010).

43 Wu, C. & Kapoor, A. Dutasteride for the treatment of benign prostatic hyperplasia. Expert Opin

Pharmacother 14, 1399-1408 (2013).

44 Horton, R. Dihydrotestosterone is a peripheral paracrine hormone. J. Androl. 13, 23-27 (1992).

45 Horton, R. & Lobo, R. Peripheral androgens and the role of androstanediol glucuronide. Clin.

Endocrinol. Metab. 15, 293-306 (1986).

46 Dufort, I., Labrie, F. & Luu-The, V. Human types 1 and 3 3 alpha-hydroxysteroid

dehydrogenases: differential lability and tissue distribution. J. Clin. Endocrinol. Metab. 86, 841-

846 (2001).

47 Labrie, F., Luu-The, V., Lin, S. X., Simard, J. & Labrie, C. Role of 17 beta-hydroxysteroid

dehydrogenases in sex steroid formation in peripheral intracrine tissues. Trends Endocrinol

Metab 11, 421-427 (2000).

48 Luu-The, V. Analysis and characteristics of multiple types of human 17beta-hydroxysteroid

dehydrogenase. J. Steroid Biochem. Mol. Biol. 76, 143-151 (2001).

49 Andersson, S. Steroidogenic enzymes in skin. Eur. J. Dermatol. 11, 293-295 (2001).

50 Huang, X. F. & Luu-The, V. Characterization of the oxidative 3alpha-hydroxysteroid

dehydrogenase activity of human recombinant 11-cis-retinol dehydrogenase. Biochim. Biophys.

Acta 1547, 351-358 (2001).

51 Huang, X. F. & Luu-The, V. Molecular characterization of a first human 3(alpha-->beta)-

hydroxysteroid epimerase. J. Biol. Chem. 275, 29452-29457 (2000).

123

52 Kpoghomou, M. A., Soatiana, J. E., Kalembo, F. W., Bishwajit, G. & Sheng, W. UGT2B17

Polymorphism and Risk of Prostate Cancer: A Meta-Analysis. ISRN Oncol 2013, 465916 (2013).

53 Belanger, A., Pelletier, G., Labrie, F., Barbier, O. & Chouinard, S. Inactivation of androgens by

UDP-glucuronosyltransferase enzymes in humans. Trends Endocrinol Metab 14, 473-479 (2003).

54 Cancer Genome Atlas Research Network. The Molecular Taxonomy of Primary Prostate Cancer.

Cell 163, 1011-1025 (2015).

55 Hanahan, D. & Weinberg, R. A. The hallmarks of cancer. Cell 100, 57-70 (2000).

56 Hanahan, D. & Weinberg, R. A. Hallmarks of cancer: the next generation. Cell 144, 646-674

(2011).

57 Heidenreich, A. et al. EAU guidelines on prostate cancer. part 1: screening, diagnosis, and local

treatment with curative intent-update 2013. Eur. Urol. 65, 124-137 (2014).

58 Hoffman, R. M. Clinical practice. Screening for prostate cancer. N. Engl. J. Med. 365, 2013-2019

(2011).

59 Smith, D. S. & Catalona, W. J. Interexaminer variability of digital rectal examination in detecting

prostate cancer. Urology 45, 70-74 (1995).

60 Simmons, M. N., Berglund, R. K. & Jones, J. S. A practical guide to prostate cancer diagnosis

and management. Cleve. Clin. J. Med. 78, 321-331 (2011).

61 Balk, S. P., Ko, Y. J. & Bubley, G. J. Biology of prostate-specific antigen. J. Clin. Oncol. 21,

383-391 (2003).

62 Chen, N. & Zhou, Q. The evolving Gleason grading system. Chin J Cancer Res 28, 58-64 (2016).

63 Helpap, B. & Egevad, L. Correlation of modified Gleason grading with pT stage of prostatic

carcinoma after radical prostatectomy. Anal. Quant. Cytol. Histol. 30, 1-7 (2008).

64 Naito, S. et al. Validation of Partin tables and development of a preoperative nomogram for

Japanese patients with clinically localized prostate cancer using 2005 International Society of

Urological Pathology consensus on Gleason grading: data from the Clinicopathological Research

Group for Localized Prostate Cancer. J. Urol. 180, 904-909; discussion 909-910 (2008).

65 Epstein, J. I. et al. A Contemporary Prostate Cancer Grading System: A Validated Alternative to

the Gleason Score. Eur. Urol. 69, 428-435 (2016).

66 Cheng, L., Montironi, R., Bostwick, D. G., Lopez-Beltran, A. & Berney, D. M. Staging of

prostate cancer. Histopathology 60, 87-117 (2012).

67 Klotz, L. Active surveillance for low-risk prostate cancer. Curr Opin Urol 27, 225-230 (2017).

68 Fang, L. C., Merrick, G. S. & Wallner, K. E. Androgen deprivation therapy: a survival benefit or

detriment in men with high-risk prostate cancer? Oncology (Williston Park) 24, 790-796, 798

(2010).

124

69 Han, M., Partin, A. W., Pound, C. R., Epstein, J. I. & Walsh, P. C. Long-term biochemical

disease-free and cancer-specific survival following anatomic radical retropubic prostatectomy.

The 15-year Johns Hopkins experience. Urol. Clin. North Am. 28, 555-565 (2001).

70 Demanes, D. J., Rodriguez, R. R., Schour, L., Brandt, D. & Altieri, G. High-dose-rate intensity-

modulated brachytherapy with external beam radiotherapy for prostate cancer: California

endocurietherapy's 10-year results. Int. J. Radiat. Oncol. Biol. Phys. 61, 1306-1316 (2005).

71 Langley, R. R. & Fidler, I. J. The seed and soil hypothesis revisited--the role of tumor-stroma

interactions in metastasis to different organs. Int. J. Cancer 128, 2527-2535 (2011).

72 Gundem, G. et al. The evolutionary history of lethal metastatic prostate cancer. Nature 520, 353-

357 (2015).

73 Freedland, S. J. et al. Time trends in biochemical recurrence after radical prostatectomy: results

of the SEARCH database. Urology 61, 736-741 (2003).

74 Brawer, M. K. Radiation therapy failure in prostate cancer patients: risk factors and methods of

detection. Rev Urol 4 Suppl 2, S2-S11 (2002).

75 Sharifi, N., Gulley, J. L. & Dahut, W. L. Androgen deprivation therapy for prostate cancer. JAMA

294, 238-244 (2005).

76 Connolly, R. M., Carducci, M. A. & Antonarakis, E. S. Use of androgen deprivation therapy in

prostate cancer: indications and prevalence. Asian J Androl 14, 177-186 (2012).

77 Kaisary, A. V., Tyrrell, C. J., Peeling, W. B. & Griffiths, K. Comparison of LHRH analogue

(Zoladex) with orchiectomy in patients with metastatic prostatic carcinoma. Br. J. Urol. 67, 502-

508 (1991).

78 Sun, M. et al. Comparison of Gonadotropin-Releasing Hormone Agonists and Orchiectomy:

Effects of Androgen-Deprivation Therapy. JAMA Oncol 2, 500-507 (2016).

79 Collette, L. et al. Is prostate-specific antigen a valid surrogate end point for survival in

hormonally treated patients with metastatic prostate cancer? Joint research of the European

Organisation for Research and Treatment of Cancer, the Limburgs Universitair Centrum, and

AstraZeneca Pharmaceuticals. J. Clin. Oncol. 23, 6139-6148 (2005).

80 Crawford, E. D. et al. A controlled trial of leuprolide with and without flutamide in prostatic

carcinoma. N. Engl. J. Med. 321, 419-424 (1989).

81 Loblaw, D. A. et al. Initial hormonal management of androgen-sensitive metastatic, recurrent, or

progressive prostate cancer: 2006 update of an American Society of Clinical Oncology practice

guideline. J. Clin. Oncol. 25, 1596-1605 (2007).

82 Bolla, M. et al. Improved survival in patients with locally advanced prostate cancer treated with

radiotherapy and goserelin. N. Engl. J. Med. 337, 295-300 (1997).

83 Labrie, F. Medical castration with LHRH agonists: 25 years later with major benefits achieved on

survival in prostate cancer. J. Androl. 25, 305-313 (2004).

125

84 Halabi, S. et al. Prognostic model for predicting survival in men with hormone-refractory

metastatic prostate cancer. J. Clin. Oncol. 21, 1232-1237 (2003).

85 Berry, W. R., Laszlo, J., Cox, E., Walker, A. & Paulson, D. Prognostic factors in metastatic and

hormonally unresponsive carcinoma of the prostate. Cancer 44, 763-775 (1979).

86 Scher, H. I. et al. Post-therapy serum prostate-specific antigen level and survival in patients with

androgen-independent prostate cancer. J. Natl. Cancer Inst. 91, 244-251 (1999).

87 Afshar, M., Evison, F., James, N. D. & Patel, P. Shifting paradigms in the estimation of survival

for castration-resistant prostate cancer: A tertiary academic center experience. Urol Oncol 33, 338

e331-337 (2015).

88 Sharifi, N. et al. A retrospective study of the time to clinical endpoints for advanced prostate

cancer. BJU Int. 96, 985-989 (2005).

89 Oefelein, M. G., Agarwal, P. K. & Resnick, M. I. Survival of patients with hormone refractory

prostate cancer in the prostate specific antigen era. J. Urol. 171, 1525-1528 (2004).

90 Karantanos, T., Corn, P. G. & Thompson, T. C. Prostate cancer progression after androgen

deprivation therapy: mechanisms of castrate resistance and novel therapeutic approaches.

Oncogene 32, 5501-5511 (2013).

91 Attard, G., Cooper, C. S. & de Bono, J. S. Steroid hormone receptors in prostate cancer: a hard

habit to break? Cancer Cell 16, 458-462 (2009).

92 Bubendorf, L. et al. Survey of gene amplifications during prostate cancer progression by high-

throughout fluorescence in situ hybridization on tissue microarrays. Cancer Res. 59, 803-806

(1999).

93 Visakorpi, T. et al. In vivo amplification of the androgen receptor gene and progression of human

prostate cancer. Nat. Genet. 9, 401-406 (1995).

94 Sharma, A. et al. The retinoblastoma tumor suppressor controls androgen signaling and human

prostate cancer progression. J. Clin. Invest. 120, 4478-4492 (2010).

95 Burkhart, D. L. & Sage, J. Cellular mechanisms of tumour suppression by the retinoblastoma

gene. Nat Rev Cancer 8, 671-682 (2008).

96 Whitaker, L. L., Su, H., Baskaran, R., Knudsen, E. S. & Wang, J. Y. Growth suppression by an

E2F-binding-defective retinoblastoma protein (RB): contribution from the RB C pocket. Mol.

Cell. Biol. 18, 4032-4042 (1998).

97 Taplin, M. E. et al. Mutation of the androgen-receptor gene in metastatic androgen-independent

prostate cancer. N. Engl. J. Med. 332, 1393-1398 (1995).

98 Taplin, M. E. et al. Selection for androgen receptor mutations in prostate cancers treated with

androgen antagonist. Cancer Res. 59, 2511-2515 (1999).

99 Shi, X. B., Ma, A. H., Xia, L., Kung, H. J. & de Vere White, R. W. Functional analysis of 44

mutant androgen receptors from human prostate cancer. Cancer Res. 62, 1496-1502 (2002).

126

100 Buchanan, G. et al. Structural and functional consequences of glutamine tract variation in the

androgen receptor. Hum. Mol. Genet. 13, 1677-1692 (2004).

101 Veldscholte, J. et al. The androgen receptor in LNCaP cells contains a mutation in the ligand

binding domain which affects steroid binding characteristics and response to antiandrogens. J.

Steroid Biochem. Mol. Biol. 41, 665-669 (1992).

102 Berrevoets, C. A., Veldscholte, J. & Mulder, E. Effects of antiandrogens on transformation and

transcription activation of wild-type and mutated (LNCaP) androgen receptors. J. Steroid

Biochem. Mol. Biol. 46, 731-736 (1993).

103 Zhao, X. Y. et al. Glucocorticoids can promote androgen-independent growth of prostate cancer

cells through a mutated androgen receptor. Nat. Med. 6, 703-706 (2000).

104 Culig, Z. et al. Mutant androgen receptor detected in an advanced-stage prostatic carcinoma is

activated by adrenal androgens and progesterone. Mol. Endocrinol. 7, 1541-1550 (1993).

105 Dehm, S. M. & Tindall, D. J. Alternatively spliced androgen receptor variants. Endocr Relat

Cancer 18, R183-196 (2011).

106 Li, Y. et al. AR intragenic deletions linked to androgen receptor splice variant expression and

activity in models of prostate cancer progression. Oncogene 31, 4759-4767 (2012).

107 Hu, R., Isaacs, W. B. & Luo, J. A snapshot of the expression signature of androgen receptor

splicing variants and their distinctive transcriptional activities. Prostate 71, 1656-1667 (2011).

108 Sun, S. et al. Castration resistance in human prostate cancer is conferred by a frequently

occurring androgen receptor splice variant. J. Clin. Invest. 120, 2715-2730 (2010).

109 Hu, R. et al. Distinct transcriptional programs mediated by the ligand-dependent full-length

androgen receptor and its splice variants in castration-resistant prostate cancer. Cancer Res. 72,

3457-3462 (2012).

110 Guo, Z. et al. Regulation of androgen receptor activity by tyrosine phosphorylation. Cancer Cell

10, 309-319 (2006).

111 Wang, Q. et al. Androgen receptor regulates a distinct transcription program in androgen-

independent prostate cancer. Cell 138, 245-256 (2009).

112 Antonarakis, E. S. et al. Targeting the N-Terminal Domain of the Androgen Receptor: A New

Approach for the Treatment of Advanced Prostate Cancer. Oncologist 21, 1427-1435 (2016).

113 Gurel, B. et al. Nuclear MYC protein overexpression is an early alteration in human prostate

carcinogenesis. Mod. Pathol. 21, 1156-1167 (2008).

114 Nupponen, N. N., Kakkola, L., Koivisto, P. & Visakorpi, T. Genetic alterations in hormone-

refractory recurrent prostate carcinomas. Am. J. Pathol. 153, 141-148 (1998).

115 Bernard, D., Pourtier-Manzanedo, A., Gil, J. & Beach, D. H. Myc confers androgen-independent

prostate cancer cell growth. J. Clin. Invest. 112, 1724-1731 (2003).

127

116 Taylor, B. S. et al. Integrative genomic profiling of human prostate cancer. Cancer Cell 18, 11-22

(2010).

117 Chee, K. G. et al. The AKT inhibitor perifosine in biochemically recurrent prostate cancer: a

phase II California/Pittsburgh cancer consortium trial. Clin Genitourin Cancer 5, 433-437 (2007).

118 Kinkade, C. W. et al. Targeting AKT/mTOR and ERK MAPK signaling inhibits hormone-

refractory prostate cancer in a preclinical mouse model. J. Clin. Invest. 118, 3051-3064 (2008).

119 Zhang, W. et al. Inhibition of tumor growth progression by antiandrogens and mTOR inhibitor in

a Pten-deficient mouse model of prostate cancer. Cancer Res. 69, 7466-7472 (2009).

120 Crumbaker, M., Khoja, L. & Joshua, A. M. AR Signaling and the PI3K Pathway in Prostate

Cancer. Cancers (Basel) 9 (2017).

121 Harris, W. P., Mostaghel, E. A., Nelson, P. S. & Montgomery, B. Androgen deprivation therapy:

progress in understanding mechanisms of resistance and optimizing androgen depletion. Nat Clin

Pract Urol 6, 76-85 (2009).

122 Mohler, J. L. et al. The androgen axis in recurrent prostate cancer. Clin. Cancer. Res. 10, 440-448

(2004).

123 Locke, J. A. et al. Androgen levels increase by intratumoral de novo steroidogenesis during

progression of castration-resistant prostate cancer. Cancer Res. 68, 6407-6415 (2008).

124 Montgomery, R. B. et al. Maintenance of intratumoral androgens in metastatic prostate cancer: a

mechanism for castration-resistant tumor growth. Cancer Res. 68, 4447-4454 (2008).

125 Stanbrough, M. et al. Increased expression of genes converting adrenal androgens to testosterone

in androgen-independent prostate cancer. Cancer Res. 66, 2815-2825 (2006).

126 Chang, K. H. et al. Dihydrotestosterone synthesis bypasses testosterone to drive castration-

resistant prostate cancer. Proc. Natl. Acad. Sci. U. S. A. 108, 13728-13733 (2011).

127 Stuchbery, R., McCoy, P. J., Hovens, C. M. & Corcoran, N. M. Androgen synthesis in prostate

cancer: do all roads lead to Rome? Nat Rev Urol 14, 49-58 (2017).

128 Labrie, F. et al. Gonadotropin-releasing hormone agonists in the treatment of prostate cancer.

Endocr. Rev. 26, 361-379 (2005).

129 Labrie, F. et al. Comparable amounts of sex steroids are made outside the gonads in men and

women: strong lesson for hormone therapy of prostate and breast cancer. J. Steroid Biochem.

Mol. Biol. 113, 52-56 (2009).

130 Labrie, F. Blockade of testicular and adrenal androgens in prostate cancer treatment. Nat Rev

Urol 8, 73-85 (2011).

131 Vermeulen, A., Schelfhout, W. & De Sy, W. Plasma androgen levels after subcapsular

orchiectomy or estrogen treatment for prostatic carcinoma. Prostate 3, 115-121 (1982).

128

132 Belanger, A., Dupont, A. & Labrie, F. Inhibition of basal and adrenocorticotropin-stimulated

plasma levels of adrenal androgens after treatment with an antiandrogen in castrated patients with

prostatic cancer. J. Clin. Endocrinol. Metab. 59, 422-426 (1984).

133 Nishii, M. et al. Luteinizing hormone (LH)-releasing hormone agonist reduces serum adrenal

androgen levels in prostate cancer patients: implications for the effect of LH on the adrenal

glands. J. Androl. 33, 1233-1238 (2012).

134 Locke, J. A. et al. Steroidogenesis inhibitors alter but do not eliminate androgen synthesis

mechanisms during progression to castration-resistance in LNCaP prostate xenografts. J. Steroid

Biochem. Mol. Biol. 115, 126-136 (2009).

135 van Weerden, W. M., Bierings, H. G., van Steenbrugge, G. J., de Jong, F. H. & Schroder, F. H.

Adrenal glands of mouse and rat do not synthesize androgens. Life Sci. 50, 857-861 (1992).

136 Perkins, L. M. & Payne, A. H. Quantification of P450scc, P450(17) alpha, and iron sulfur protein

reductase in Leydig cells and adrenals of inbred strains of mice. Endocrinology 123, 2675-2682

(1988).

137 Brock, B. J. & Waterman, M. R. Biochemical differences between rat and human cytochrome

P450c17 support the different steroidogenic needs of these two species. Biochemistry (Mosc). 38,

1598-1606 (1999).

138 Luu-The, V., Pelletier, G. & Labrie, F. Quantitative appreciation of steroidogenic gene expression

in mouse tissues: new roles for type 2 5alpha-reductase, 20alpha-hydroxysteroid dehydrogenase

and estrogen sulfotransferase. J. Steroid Biochem. Mol. Biol. 93, 269-276 (2005).

139 James, N. D. et al. Abiraterone for Prostate Cancer Not Previously Treated with Hormone

Therapy. N. Engl. J. Med. 377, 338-351 (2017).

140 Fizazi, K. et al. Abiraterone plus Prednisone in Metastatic, Castration-Sensitive Prostate Cancer.

N. Engl. J. Med. 377, 352-360 (2017).

141 de Bono, J. S. et al. Abiraterone and increased survival in metastatic prostate cancer. N. Engl. J.

Med. 364, 1995-2005 (2011).

142 Klotz, L. Maximal androgen blockade for advanced prostate cancer. Best Pract Res Clin

Endocrinol Metab 22, 331-340 (2008).

143 Dijkman, G. A., Janknegt, R. A., De Reijke, T. M. & Debruyne, F. M. Long-term efficacy and

safety of nilutamide plus castration in advanced prostate cancer, and the significance of early

prostate specific antigen normalization. International Anandron Study Group. J. Urol. 158, 160-

163 (1997).

144 Janknegt, R. A. et al. Orchiectomy and nilutamide or placebo as treatment of metastatic prostatic

cancer in a multinational double-blind randomized trial. J. Urol. 149, 77-82; discussion 83

(1993).

145 Group, P. C. T. C. Maximum androgen blockade in advanced prostate cancer: an overview of the

randomised trials. Prostate Cancer Trialists' Collaborative Group. Lancet 355, 1491-1498 (2000).

129

146 Kelly, W. K., Slovin, S. & Scher, H. I. Steroid hormone withdrawal syndromes. Pathophysiology

and clinical significance. Urol. Clin. North Am. 24, 421-431 (1997).

147 Tran, C. et al. Development of a second-generation antiandrogen for treatment of advanced

prostate cancer. Science 324, 787-790 (2009).

148 Thompson, I. M. Flare Associated with LHRH-Agonist Therapy. Rev Urol 3 Suppl 3, S10-14

(2001).

149 Greasley, R., Khabazhaitajer, M. & Rosario, D. J. A profile of enzalutamide for the treatment of

advanced castration resistant prostate cancer. Cancer Manag Res 7, 153-164 (2015).

150 Scher, H. I. et al. Increased survival with enzalutamide in prostate cancer after chemotherapy. N.

Engl. J. Med. 367, 1187-1197 (2012).

151 Beer, T. M. et al. Enzalutamide in metastatic prostate cancer before chemotherapy. N. Engl. J.

Med. 371, 424-433 (2014).

152 Grist, E. & Attard, G. The development of abiraterone acetate for castration-resistant prostate

cancer. Urol Oncol 33, 289-294 (2015).

153 Fizazi, K. et al. Abiraterone acetate for treatment of metastatic castration-resistant prostate

cancer: final overall survival analysis of the COU-AA-301 randomised, double-blind, placebo-

controlled phase 3 study. Lancet Oncol 13, 983-992 (2012).

154 Ryan, C. J. et al. Abiraterone in metastatic prostate cancer without previous chemotherapy. N.

Engl. J. Med. 368, 138-148 (2013).

155 Ryan, C. J. et al. Abiraterone acetate plus prednisone versus placebo plus prednisone in

chemotherapy-naive men with metastatic castration-resistant prostate cancer (COU-AA-302):

final overall survival analysis of a randomised, double-blind, placebo-controlled phase 3 study.

Lancet Oncol 16, 152-160 (2015).

156 Mostaghel, E. A. et al. Resistance to CYP17A1 Inhibition with Abiraterone in Castration-

Resistant Prostate Cancer: Induction of Steroidogenesis and Androgen Receptor Splice Variants.

Clin. Cancer. Res. 17, 5913-5925 (2011).

157 Giacinti, S. et al. Resistance to Abiraterone in Castration-resistant Prostate Cancer: A Review of

the Literature. Anticancer Res. 34, 6265-6269 (2014).

158 Wadosky, K. M. & Koochekpour, S. Androgen receptor splice variants and prostate cancer: From

bench to bedside. Oncotarget 8, 18550-18576 (2017).

159 Bernemann, C. et al. Expression of AR-V7 in Circulating Tumour Cells Does Not Preclude

Response to Next Generation Androgen Deprivation Therapy in Patients with Castration

Resistant Prostate Cancer. Eur. Urol. 71, 1-3 (2017).

160 Berry, W., Dakhil, S., Modiano, M., Gregurich, M. & Asmar, L. Phase III study of mitoxantrone

plus low dose prednisone versus low dose prednisone alone in patients with asymptomatic

hormone refractory prostate cancer. J. Urol. 168, 2439-2443 (2002).

130

161 Tannock, I. F. et al. Chemotherapy with mitoxantrone plus prednisone or prednisone alone for

symptomatic hormone-resistant prostate cancer: a Canadian randomized trial with palliative end

points. J. Clin. Oncol. 14, 1756-1764 (1996).

162 Lorente, D., Mateo, J., Perez-Lopez, R., de Bono, J. S. & Attard, G. Sequencing of agents in

castration-resistant prostate cancer. Lancet Oncol 16, e279-292 (2015).

163 Berthold, D. R. et al. Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced

prostate cancer: updated survival in the TAX 327 study. J. Clin. Oncol. 26, 242-245 (2008).

164 Petrylak, D. P. et al. Docetaxel and estramustine compared with mitoxantrone and prednisone for

advanced refractory prostate cancer. N. Engl. J. Med. 351, 1513-1520 (2004).

165 Lorente, D. & De Bono, J. S. Molecular alterations and emerging targets in castration resistant

prostate cancer. Eur. J. Cancer 50, 753-764 (2014).

166 Martin, S. K. & Kyprianou, N. Exploitation of the Androgen Receptor to Overcome Taxane

Resistance in Advanced Prostate Cancer. Adv. Cancer Res. 127, 123-158 (2015).

167 James, N. D. et al. Addition of docetaxel, zoledronic acid, or both to first-line long-term hormone

therapy in prostate cancer (STAMPEDE): survival results from an adaptive, multiarm, multistage,

platform randomised controlled trial. Lancet 387, 1163-1177 (2016).

168 Sweeney, C. J. et al. Chemohormonal Therapy in Metastatic Hormone-Sensitive Prostate Cancer.

N. Engl. J. Med. 373, 737-746 (2015).

169 Petrioli, R. et al. Role of chemotherapy in the treatment of metastatic castration-resistant prostate

cancer patients who have progressed after abiraterone acetate. Cancer Chemother. Pharmacol.

76, 439-445 (2015).

170 de Bono, J. S. et al. Prednisone plus cabazitaxel or mitoxantrone for metastatic castration-

resistant prostate cancer progressing after docetaxel treatment: a randomised open-label trial.

Lancet 376, 1147-1154 (2010).

171 Paller, C. J. & Antonarakis, E. S. Cabazitaxel: a novel second-line treatment for metastatic

castration-resistant prostate cancer. Drug Des Devel Ther 5, 117-124 (2011).

172 Oh, W. K., Tay, M. H. & Huang, J. Is there a role for platinum chemotherapy in the treatment of

patients with hormone-refractory prostate cancer? Cancer 109, 477-486 (2007).

173 Harris, K. A., Harney, E. & Small, E. J. Liposomal doxorubicin for the treatment of hormone-

refractory prostate cancer. Clin Prostate Cancer 1, 37-41 (2002).

174 Body, J. J., Casimiro, S. & Costa, L. Targeting bone metastases in prostate cancer: improving

clinical outcome. Nat Rev Urol 12, 340-356 (2015).

175 El-Amm, J. & Aragon-Ching, J. B. Radium-223 for the treatment of castration-resistant prostate

cancer. Onco Targets Ther 8, 1103-1109 (2015).

176 Saad, F. et al. The 2015 CUA-CUOG Guidelines for the management of castration-resistant

prostate cancer (CRPC). Can Urol Assoc J 9, 90-96 (2015).

131

177 Dougan, M. & Dranoff, G. Immune therapy for cancer. Annu. Rev. Immunol. 27, 83-117 (2009).

178 Cavallo, F., De Giovanni, C., Nanni, P., Forni, G. & Lollini, P. L. 2011: the immune hallmarks of

cancer. Cancer Immunol. Immunother. 60, 319-326 (2011).

179 De Velasco, M. A. & Uemura, H. Prostate cancer immunotherapy: where are we and where are

we going? Curr Opin Urol 28, 15-24 (2018).

180 Kantoff, P. W. et al. Sipuleucel-T immunotherapy for castration-resistant prostate cancer. N.

Engl. J. Med. 363, 411-422 (2010).

181 Patel, P. H. & Kockler, D. R. Sipuleucel-T: a vaccine for metastatic, asymptomatic, androgen-

independent prostate cancer. Ann. Pharmacother. 42, 91-98 (2008).

182 Small, E. J. et al. Immunotherapy of hormone-refractory prostate cancer with antigen-loaded

dendritic cells. J. Clin. Oncol. 18, 3894-3903 (2000).

183 Burch, P. A. et al. Priming tissue-specific cellular immunity in a phase I trial of autologous

dendritic cells for prostate cancer. Clin. Cancer. Res. 6, 2175-2182 (2000).

184 Small, E. J. et al. Placebo-controlled phase III trial of immunologic therapy with sipuleucel-T

(APC8015) in patients with metastatic, asymptomatic hormone refractory prostate cancer. J. Clin.

Oncol. 24, 3089-3094 (2006).

185 Higano, C. S. et al. Sipuleucel-T. Nat Rev Drug Discov 9, 513-514 (2010).

186 Wing, K. et al. CTLA-4 control over Foxp3+ regulatory T cell function. Science 322, 271-275

(2008).

187 Small, E. J. et al. A pilot trial of CTLA-4 blockade with human anti-CTLA-4 in patients with

hormone-refractory prostate cancer. Clin. Cancer. Res. 13, 1810-1815 (2007).

188 Slovin, S. F. et al. Ipilimumab alone or in combination with radiotherapy in metastatic castration-

resistant prostate cancer: results from an open-label, multicenter phase I/II study. Ann. Oncol. 24,

1813-1821 (2013).

189 Kwon, E. D. et al. Ipilimumab versus placebo after radiotherapy in patients with metastatic

castration-resistant prostate cancer that had progressed after docetaxel chemotherapy (CA184-

043): a multicentre, randomised, double-blind, phase 3 trial. Lancet Oncol 15, 700-712 (2014).

190 Martin, A. M. et al. Paucity of PD-L1 expression in prostate cancer: innate and adaptive immune

resistance. Prostate Cancer Prostatic Dis 18, 325-332 (2015).

191 Graff, J. N. et al. Early evidence of anti-PD-1 activity in enzalutamide-resistant prostate cancer.

Oncotarget 7, 52810-52817 (2016).

192 Singh, P., Pal, S. K., Alex, A. & Agarwal, N. Development of PROSTVAC immunotherapy in

prostate cancer. Future Oncol 11, 2137-2148 (2015).

193 Yap, T. A. et al. Drug discovery in advanced prostate cancer: translating biology into therapy.

Nat Rev Drug Discov 15, 699-718 (2016).

132

194 Kantoff, P. W. et al. Overall survival analysis of a phase II randomized controlled trial of a

Poxviral-based PSA-targeted immunotherapy in metastatic castration-resistant prostate cancer. J.

Clin. Oncol. 28, 1099-1105 (2010).

195 Ikonen, E. Cellular cholesterol trafficking and compartmentalization. Nat Rev Mol Cell Biol 9,

125-138 (2008).

196 Yin, W. et al. Plasma lipid profiling across species for the identification of optimal animal models

of human dyslipidemia. J. Lipid Res. 53, 51-65 (2012).

197 Coxey, R. A., Pentchev, P. G., Campbell, G. & Blanchette-Mackie, E. J. Differential

accumulation of cholesterol in Golgi compartments of normal and Niemann-Pick type C

fibroblasts incubated with LDL: a cytochemical freeze-fracture study. J. Lipid Res. 34, 1165-1176

(1993).

198 Mukherjee, S., Zha, X., Tabas, I. & Maxfield, F. R. Cholesterol distribution in living cells:

fluorescence imaging using dehydroergosterol as a fluorescent cholesterol analog. Biophys. J. 75,

1915-1925 (1998).

199 Lange, Y. Disposition of intracellular cholesterol in human fibroblasts. J. Lipid Res. 32, 329-339

(1991).

200 Simons, K. & Vaz, W. L. Model systems, lipid rafts, and cell membranes. Annu. Rev. Biophys.

Biomol. Struct. 33, 269-295 (2004).

201 Brown, D. A. & London, E. Functions of lipid rafts in biological membranes. Annu. Rev. Cell

Dev. Biol. 14, 111-136 (1998).

202 Hooper, N. M. Detergent-insoluble glycosphingolipid/cholesterol-rich membrane domains, lipid

rafts and caveolae (review). Mol. Membr. Biol. 16, 145-156 (1999).

203 Resh, M. D. Fatty acylation of proteins: new insights into membrane targeting of myristoylated

and palmitoylated proteins. Biochim. Biophys. Acta 1451, 1-16 (1999).

204 Nohturfft, A., Brown, M. S. & Goldstein, J. L. Sterols regulate processing of carbohydrate chains

of wild-type SREBP cleavage-activating protein (SCAP), but not sterol-resistant mutants Y298C

or D443N. Proc. Natl. Acad. Sci. U. S. A. 95, 12848-12853 (1998).

205 Radhakrishnan, A., Sun, L. P., Kwon, H. J., Brown, M. S. & Goldstein, J. L. Direct binding of

cholesterol to the purified membrane region of SCAP: mechanism for a sterol-sensing domain.

Mol. Cell 15, 259-268 (2004).

206 Mullen, P. J., Yu, R., Longo, J., Archer, M. C. & Penn, L. Z. The interplay between cell

signalling and the mevalonate pathway in cancer. Nat Rev Cancer 16, 718-731 (2016).

207 Goldstein, J. L. & Brown, M. S. Regulation of the mevalonate pathway. Nature 343, 425-430

(1990).

208 Buhaescu, I. & Izzedine, H. Mevalonate pathway: a review of clinical and therapeutical

implications. Clin. Biochem. 40, 575-584 (2007).

133

209 Brown, M. S. & Goldstein, J. L. The SREBP pathway: regulation of cholesterol metabolism by

proteolysis of a membrane-bound transcription factor. Cell 89, 331-340 (1997).

210 Goldstein, J. L., DeBose-Boyd, R. A. & Brown, M. S. Protein sensors for membrane sterols. Cell

124, 35-46 (2006).

211 Xu, X., So, J. S., Park, J. G. & Lee, A. H. Transcriptional control of hepatic lipid metabolism by

SREBP and ChREBP. Semin. Liver Dis. 33, 301-311 (2013).

212 Radhakrishnan, A., Ikeda, Y., Kwon, H. J., Brown, M. S. & Goldstein, J. L. Sterol-regulated

transport of SREBPs from endoplasmic reticulum to Golgi: oxysterols block transport by binding

to Insig. Proc. Natl. Acad. Sci. U. S. A. 104, 6511-6518 (2007).

213 Sun, L. P., Seemann, J., Goldstein, J. L. & Brown, M. S. Sterol-regulated transport of SREBPs

from endoplasmic reticulum to Golgi: Insig renders sorting signal in Scap inaccessible to COPII

proteins. Proc. Natl. Acad. Sci. U. S. A. 104, 6519-6526 (2007).

214 Horton, J. D., Goldstein, J. L. & Brown, M. S. SREBPs: activators of the complete program of

cholesterol and fatty acid synthesis in the liver. J. Clin. Invest. 109, 1125-1131 (2002).

215 Edwards, P. A., Kennedy, M. A. & Mak, P. A. LXRs; oxysterol-activated nuclear receptors that

regulate genes controlling lipid homeostasis. Vascul Pharmacol 38, 249-256 (2002).

216 Lorbek, G., Lewinska, M. & Rozman, D. Cytochrome P450s in the synthesis of cholesterol and

bile acids--from mouse models to human diseases. FEBS J 279, 1516-1533 (2012).

217 Baumann, N. A. et al. Transport of newly synthesized sterol to the sterol-enriched plasma

membrane occurs via nonvesicular equilibration. Biochemistry (Mosc). 44, 5816-5826 (2005).

218 Heino, S. et al. Dissecting the role of the golgi complex and lipid rafts in biosynthetic transport of

cholesterol to the cell surface. Proc. Natl. Acad. Sci. U. S. A. 97, 8375-8380 (2000).

219 Lusa, S., Heino, S. & Ikonen, E. Differential mobilization of newly synthesized cholesterol and

biosynthetic sterol precursors from cells. J. Biol. Chem. 278, 19844-19851 (2003).

220 Prattes, S. et al. Intracellular distribution and mobilization of unesterified cholesterol in

adipocytes: triglyceride droplets are surrounded by cholesterol-rich ER-like surface layer

structures. J. Cell Sci. 113 ( Pt 17), 2977-2989 (2000).

221 Bose, H. S., Lingappa, V. R. & Miller, W. L. Rapid regulation of steroidogenesis by

mitochondrial protein import. Nature 417, 87-91 (2002).

222 Gu, Q., Paulose-Ram, R., Burt, V. L. & Kit, B. K. Prescription cholesterol-lowering medication

use in adults aged 40 and over: United States, 2003-2012. NCHS Data Brief, 1-8 (2014).

223 Naci, H. et al. Comparative benefits of statins in the primary and secondary prevention of major

coronary events and all-cause mortality: a network meta-analysis of placebo-controlled and

active-comparator trials. Eur J Prev Cardiol 20, 641-657 (2013).

224 Collins, R. et al. Interpretation of the evidence for the efficacy and safety of statin therapy. Lancet

388, 2532-2561 (2016).

134

225 Weber, M. J. & Gioeli, D. Ras signaling in prostate cancer progression. J. Cell. Biochem. 91, 13-

25 (2004).

226 Graaf, M. R., Richel, D. J., van Noorden, C. J. & Guchelaar, H. J. Effects of statins and

farnesyltransferase inhibitors on the development and progression of cancer. Cancer Treat. Rev.

30, 609-641 (2004).

227 Gent, J. & Braakman, I. Low-density lipoprotein receptor structure and folding. Cell. Mol. Life

Sci. 61, 2461-2470 (2004).

228 Goldstein, J. L., Anderson, R. G. & Brown, M. S. Receptor-mediated endocytosis and the cellular

uptake of low density lipoprotein. Ciba Found. Symp., 77-95 (1982).

229 Sturley, S. L., Patterson, M. C., Balch, W. & Liscum, L. The pathophysiology and mechanisms of

NP-C disease. Biochim. Biophys. Acta 1685, 83-87 (2004).

230 Attie, A. D. & Seidah, N. G. Dual regulation of the LDL receptor--some clarity and new

questions. Cell Metab 1, 290-292 (2005).

231 Zelcer, N., Hong, C., Boyadjian, R. & Tontonoz, P. LXR regulates cholesterol uptake through

Idol-dependent ubiquitination of the LDL receptor. Science 325, 100-104 (2009).

232 Landschulz, K. T., Pathak, R. K., Rigotti, A., Krieger, M. & Hobbs, H. H. Regulation of

scavenger receptor, class B, type I, a high density lipoprotein receptor, in liver and steroidogenic

tissues of the rat. J. Clin. Invest. 98, 984-995 (1996).

233 Rigotti, A. et al. Regulation by adrenocorticotropic hormone of the in vivo expression of

scavenger receptor class B type I (SR-BI), a high density lipoprotein receptor, in steroidogenic

cells of the murine adrenal gland. J. Biol. Chem. 271, 33545-33549 (1996).

234 Canton, J., Neculai, D. & Grinstein, S. Scavenger receptors in homeostasis and immunity. Nat

Rev Immunol 13, 621-634 (2013).

235 Krieger, M. Charting the fate of the "good cholesterol": identification and characterization of the

high-density lipoprotein receptor SR-BI. Annu. Rev. Biochem. 68, 523-558 (1999).

236 Rigotti, A., Miettinen, H. E. & Krieger, M. The role of the high-density lipoprotein receptor SR-

BI in the lipid metabolism of endocrine and other tissues. Endocr. Rev. 24, 357-387 (2003).

237 Gwynne, J. T. & Mahaffee, D. D. Rat adrenal uptake and metabolism of high density lipoprotein

cholesteryl ester. J. Biol. Chem. 264, 8141-8150 (1989).

238 Gwynne, J. T., Mahaffee, D., Brewer, H. B., Jr. & Ney, R. L. Adrenal cholesterol uptake from

plasma lipoproteins: regulation by corticotropin. Proc. Natl. Acad. Sci. U. S. A. 73, 4329-4333

(1976).

239 Shen, W. J., Hu, J., Hu, Z., Kraemer, F. B. & Azhar, S. Scavenger receptor class B type I (SR-

BI): a versatile receptor with multiple functions and actions. Metabolism 63, 875-886 (2014).

240 Gwynne, J. T., Hess, B., Hughes, T., Rountree, R. & Mahaffee, D. The role of serum high density

lipoproteins in adrenal steroidogenesis. Endocr. Res. 10, 411-430 (1984).

135

241 Galman, C., Angelin, B. & Rudling, M. Prolonged stimulation of the adrenals by corticotropin

suppresses hepatic low-density lipoprotein and high-density lipoprotein receptors and increases

plasma cholesterol. Endocrinology 143, 1809-1816 (2002).

242 Beaven, S. W. & Tontonoz, P. Nuclear receptors in lipid metabolism: targeting the heart of

dyslipidemia. Annu. Rev. Med. 57, 313-329 (2006).

243 Cao, G. et al. Structure and localization of the human gene encoding SR-BI/CLA-1. Evidence for

transcriptional control by steroidogenic factor 1. J. Biol. Chem. 272, 33068-33076 (1997).

244 Parker, K. L. The roles of steroidogenic factor 1 in endocrine development and function. Mol.

Cell. Endocrinol. 140, 59-63 (1998).

245 Lekstrom-Himes, J. & Xanthopoulos, K. G. Biological role of the CCAAT/enhancer-binding

protein family of transcription factors. J. Biol. Chem. 273, 28545-28548 (1998).

246 Al-Jarallah, A. & Trigatti, B. L. A role for the scavenger receptor, class B type I in high density

lipoprotein dependent activation of cellular signaling pathways. Biochim. Biophys. Acta 1801,

1239-1248 (2010).

247 Li, X. A. et al. High density lipoprotein binding to scavenger receptor, Class B, type I activates

endothelial nitric-oxide synthase in a ceramide-dependent manner. J. Biol. Chem. 277, 11058-

11063 (2002).

248 Mineo, C. & Shaul, P. W. HDL stimulation of endothelial nitric oxide synthase: a novel

mechanism of HDL action. Trends Cardiovasc. Med. 13, 226-231 (2003).

249 Yuhanna, I. S. et al. High-density lipoprotein binding to scavenger receptor-BI activates

endothelial nitric oxide synthase. Nat. Med. 7, 853-857 (2001).

250 Napoli, C. et al. Nitric oxide and atherosclerosis: an update. Nitric Oxide 15, 265-279 (2006).

251 Li, X. A., Guo, L., Dressman, J. L., Asmis, R. & Smart, E. J. A novel ligand-independent

apoptotic pathway induced by scavenger receptor class B, type I and suppressed by endothelial

nitric-oxide synthase and high density lipoprotein. J. Biol. Chem. 280, 19087-19096 (2005).

252 Nofer, J. R. et al. HDL induces NO-dependent vasorelaxation via the lysophospholipid receptor

S1P3. J. Clin. Invest. 113, 569-581 (2004).

253 Murata, N. et al. Interaction of sphingosine 1-phosphate with plasma components, including

lipoproteins, regulates the lipid receptor-mediated actions. Biochem. J. 352 Pt 3, 809-815 (2000).

254 Igarashi, J. & Michel, T. Sphingosine 1-phosphate and isoform-specific activation of

phosphoinositide 3-kinase beta. Evidence for divergence and convergence of receptor-regulated

endothelial nitric-oxide synthase signaling pathways. J. Biol. Chem. 276, 36281-36288 (2001).

255 Wood, P. et al. Ras/mitogen-activated protein kinase (MAPK) signaling modulates protein

stability and cell surface expression of scavenger receptor SR-BI. J. Biol. Chem. 286, 23077-

23092 (2011).

136

256 Mineo, C., Yuhanna, I. S., Quon, M. J. & Shaul, P. W. High density lipoprotein-induced

endothelial nitric-oxide synthase activation is mediated by Akt and MAP kinases. J. Biol. Chem.

278, 9142-9149 (2003).

257 Charlton-Menys, V. & Durrington, P. N. Human cholesterol metabolism and therapeutic

molecules. Exp. Physiol. 93, 27-42 (2008).

258 Feingold, K. R. & Grunfeld, C. Introduction to Lipids and Lipoproteins. (2000).

259 Gistera, A. & Hansson, G. K. The immunology of atherosclerosis. Nat Rev Nephrol 13, 368-380

(2017).

260 Gao, S. & Liu, J. Association between circulating oxidized low-density lipoprotein and

atherosclerotic cardiovascular disease. Chronic Dis Transl Med 3, 89-94 (2017).

261 Parthasarathy, S., Raghavamenon, A., Garelnabi, M. O. & Santanam, N. Oxidized low-density

lipoprotein. Methods Mol. Biol. 610, 403-417 (2010).

262 Zhou, L., Li, C., Gao, L. & Wang, A. High-density lipoprotein synthesis and metabolism

(Review). Mol Med Rep 12, 4015-4021 (2015).

263 Ji, A. et al. Scavenger receptor SR-BI in macrophage lipid metabolism. Atherosclerosis 217, 106-

112 (2011).

264 Rodrigueza, W. V. et al. Mechanism of scavenger receptor class B type I-mediated selective

uptake of cholesteryl esters from high density lipoprotein to adrenal cells. J. Biol. Chem. 274,

20344-20350 (1999).

265 Stangl, H., Hyatt, M. & Hobbs, H. H. Transport of lipids from high and low density lipoproteins

via scavenger receptor-BI. J. Biol. Chem. 274, 32692-32698 (1999).

266 Azhar, S., Nomoto, A., Leers-Sucheta, S. & Reaven, E. Simultaneous induction of an HDL

receptor protein (SR-BI) and the selective uptake of HDL-cholesteryl esters in a physiologically

relevant steroidogenic cell model. J. Lipid Res. 39, 1616-1628 (1998).

267 Silver, D. L., Wang, N., Xiao, X. & Tall, A. R. High density lipoprotein (HDL) particle uptake

mediated by scavenger receptor class B type 1 results in selective sorting of HDL cholesterol

from protein and polarized cholesterol secretion. J. Biol. Chem. 276, 25287-25293 (2001).

268 Rohrl, C. & Stangl, H. HDL endocytosis and resecretion. Biochim. Biophys. Acta 1831, 1626-

1633 (2013).

269 White, C. P. On the occurrence of crystals in tumours. The Journal of Pathology 13, 3-10 (1909).

270 Swyer, G. I. M. The cholesterol content of normal and enlarged prostates. Cancer Res. 2, 372-375

(1942).

271 Pearce, M. L. & Dayton, S. Incidence of cancer in men on a diet high in polyunsaturated fat.

Lancet 1, 464-467 (1971).

272 Muldoon, M. F., Manuck, S. B. & Matthews, K. A. Lowering cholesterol concentrations and

mortality: a quantitative review of primary prevention trials. BMJ 301, 309-314 (1990).

137

273 Ederer, F., Leren, P., Turpeine.O & Frantz, I. D. Cancer among Men on Cholesterol-Lowering

Diets - Experience from 5 Clinical Trials. Lancet 2, 203-& (1971).

274 Yusuf, S., Wittes, J. & Friedman, L. Overview of results of randomized clinical trials in heart

disease. II. Unstable angina, heart failure, primary prevention with aspirin, and risk factor

modification. JAMA 260, 2259-2263 (1988).

275 Solomon, K. R. & Freeman, M. R. The complex interplay between cholesterol and prostate

malignancy. Urol. Clin. North Am. 38, 243-259 (2011).

276 Bravi, F. et al. Self-reported history of hypercholesterolaemia and gallstones and the risk of

prostate cancer. Ann. Oncol. 17, 1014-1017 (2006).

277 Platz, E. A., Clinton, S. K. & Giovannucci, E. Association between plasma cholesterol and

prostate cancer in the PSA era. Int. J. Cancer 123, 1693-1698 (2008).

278 Batty, G. D., Kivimaki, M., Clarke, R., Smith, G. D. & Shipley, M. J. Modifiable risk factors for

prostate cancer mortality in London: forty years of follow-up in the Whitehall study. Cancer

Causes Control 22, 311-318 (2011).

279 Yannucci, J., Manola, J., Garnick, M. B., Bhat, G. & Bubley, G. J. The effect of androgen

deprivation therapy on fasting serum lipid and glucose parameters. J. Urol. 176, 520-525 (2006).

280 Mohamedali, H. Z., Breunis, H., Timilshina, N. & Alibhai, S. M. H. Changes in blood glucose

and cholesterol levels due to androgen deprivation therapy in men with non-metastatic prostate

cancer. Cuaj-Canadian Urological Association Journal 5, 28-32 (2011).

281 Zhuang, L., Kim, J., Adam, R. M., Solomon, K. R. & Freeman, M. R. Cholesterol targeting alters

lipid raft composition and cell survival in prostate cancer cells and xenografts. J. Clin. Invest.

115, 959-968 (2005).

282 Solomon, K. R. et al. Ezetimibe is an inhibitor of tumor angiogenesis. Am. J. Pathol. 174, 1017-

1026 (2009).

283 Mostaghel, E. A., Solomon, K. R., Pelton, K., Freeman, M. R. & Montgomery, R. B. Impact of

circulating cholesterol levels on growth and intratumoral androgen concentration of prostate

tumors. Plos One 7, e30062 (2012).

284 Llaverias, G. et al. A Western-type diet accelerates tumor progression in an autochthonous mouse

model of prostate cancer. Am. J. Pathol. 177, 3180-3191 (2010).

285 Li, J. et al. Up-regulated expression of scavenger receptor class B type 1 (SR-B1) is associated

with malignant behaviors and poor prognosis of breast cancer. Pathol. Res. Pract. 212, 555-559

(2016).

286 Yuan, B. et al. High scavenger receptor class B type I expression is related to tumor

aggressiveness and poor prognosis in breast cancer. Tumour Biol. 37, 3581-3588 (2016).

287 Xu, G. et al. Diagnostic and prognostic value of scavenger receptor class B type 1 in clear cell

renal cell carcinoma. Tumour Biol. 39, 1010428317699110 (2017).

138

288 Schorghofer, D. et al. The HDL receptor SR-BI is associated with human prostate cancer

progression and plays a possible role in establishing androgen independence. Reprod Biol

Endocrinol 13, 88 (2015).

289 Leon, C. G. et al. Alterations in Cholesterol Regulation Contribute to the Production of

Intratumoral Androgens During Progression to Castration-Resistant Prostate Cancer in a Mouse

Xenograft Model. Prostate 70, 390-400 (2010).

290 Twiddy, A. L., Cox, M. E. & Wasan, K. M. Knockdown of scavenger receptor Class B Type I

reduces prostate specific antigen secretion and viability of prostate cancer cells. Prostate 72, 955-

965 (2012).

291 Demierre, M. F., Higgins, P. D., Gruber, S. B., Hawk, E. & Lippman, S. M. Statins and cancer

prevention. Nat Rev Cancer 5, 930-942 (2005).

292 Papadopoulos, G., Delakas, D., Nakopoulou, L. & Kassimatis, T. Statins and prostate cancer:

molecular and clinical aspects. Eur. J. Cancer 47, 819-830 (2011).

293 Alfaqih, M. A., Allott, E. H., Hamilton, R. J., Freeman, M. R. & Freedland, S. J. The current

evidence on statin use and prostate cancer prevention: are we there yet? Nat Rev Urol 14, 107-

119 (2017).

294 Mucci, L. A. & Stampfer, M. J. Mounting evidence for prediagnostic use of statins in reducing

risk of lethal prostate cancer. J. Clin. Oncol. 32, 1-2 (2014).

295 Shannon, J. et al. Statins and prostate cancer risk: a case-control study. Am. J. Epidemiol. 162,

318-325 (2005).

296 Jespersen, C. G., Norgaard, M., Friis, S., Skriver, C. & Borre, M. Statin use and risk of prostate

cancer: a Danish population-based case-control study, 1997-2010. Cancer Epidemiol 38, 42-47

(2014).

297 Tan, N., Klein, E. A., Li, J., Moussa, A. S. & Jones, J. S. Statin use and risk of prostate cancer in

a population of men who underwent biopsy. J. Urol. 186, 86-90 (2011).

298 Farwell, W. R., D'Avolio, L. W., Scranton, R. E., Lawler, E. V. & Gaziano, J. M. Statins and

Prostate Cancer Diagnosis and Grade in a Veterans Population. J. Natl. Cancer Inst. 103, 885-892

(2011).

299 Murtola, T. J. et al. Prostate cancer and PSA among statin users in the Finnish prostate cancer

screening trial. Int. J. Cancer 127, 1650-1659 (2010).

300 Breau, R. H. et al. The association between statin use and the diagnosis of prostate cancer in a

population based cohort. J. Urol. 184, 494-499 (2010).

301 Lustman, A., Nakar, S., Cohen, A. D. & Vinker, S. Statin use and incident prostate cancer risk:

does the statin brand matter? A population-based cohort study. Prostate Cancer Prostatic Dis 17,

6-9 (2014).

302 Freedland, S. J. et al. Statin use and risk of prostate cancer and high-grade prostate cancer: results

from the REDUCE study. Prostate Cancer Prostatic Dis 16, 254-259 (2013).

139

303 Friis, S. et al. Cancer risk among statin users: a population-based cohort study. Int. J. Cancer 114,

643-647 (2005).

304 Platz, E. A. et al. Statin drugs and risk of advanced prostate cancer. J. Natl. Cancer Inst. 98,

1819-1825 (2006).

305 Jacobs, E. J. et al. Cholesterol-lowering drugs and advanced prostate cancer incidence in a large

U.S. cohort. Cancer Epidemiol. Biomarkers Prev. 16, 2213-2217 (2007).

306 Smeeth, L., Douglas, I., Hall, A. J., Hubbard, R. & Evans, S. Effect of statins on a wide range of

health outcomes: a cohort study validated by comparison with randomized trials. Br. J. Clin.

Pharmacol. 67, 99-109 (2009).

307 Hippisley-Cox, J. & Coupland, C. Unintended effects of statins in men and women in England

and Wales: population based cohort study using the QResearch database. BMJ 340, c2197 (2010).

308 Jacobs, E. J., Newton, C. C., Thun, M. J. & Gapstur, S. M. Long-term use of cholesterol-lowering

drugs and cancer incidence in a large United States cohort. Cancer Res. 71, 1763-1771 (2011).

309 Chan, J. M. et al. Statin use and risk of prostate cancer in the prospective Osteoporotic Fractures

in Men (MrOS) Study. Cancer Epidemiol. Biomarkers Prev. 21, 1886-1888 (2012).

310 Friedman, G. D. et al. Screening statins for possible carcinogenic risk: up to 9 years of follow-up

of 361,859 recipients. Pharmacoepidemiol Drug Saf 17, 27-36 (2008).

311 Murtola, T. J., Tammela, T. L., Lahtela, J. & Auvinen, A. Cholesterol-lowering drugs and

prostate cancer risk: a population-based case-control study. Cancer Epidemiol. Biomarkers Prev.

16, 2226-2232 (2007).

312 Chang, C. C., Ho, S. C., Chiu, H. F. & Yang, C. Y. Statins increase the risk of prostate cancer: a

population-based case-control study. Prostate 71, 1818-1824 (2011).

313 Haukka, J. et al. Incidence of cancer and statin usage--record linkage study. Int. J. Cancer 126,

279-284 (2010).

314 Bansal, D., Undela, K., D'Cruz, S. & Schifano, F. Statin Use and Risk of Prostate Cancer: A

Meta-Analysis of Observational Studies. Plos One 7 (2012).

315 Fulcher, J. et al. Efficacy and safety of LDL-lowering therapy among men and women: meta-

analysis of individual data from 174,000 participants in 27 randomised trials. Lancet 385, 1397-

1405 (2015).

316 Bonovas, S., Filioussi, K. & Sitaras, N. M. Statin use and the risk of prostate cancer: A

metaanalysis of 6 randomized clinical trials and 13 observational studies. Int. J. Cancer 123, 899-

904 (2008).

317 Kuoppala, J., Lamminpaa, A. & Pukkala, E. Statins and cancer: A systematic review and meta-

analysis. Eur. J. Cancer 44, 2122-2132 (2008).

318 Platz, E. A. et al. Statin drug use is not associated with prostate cancer risk in men who are

regularly screened. J. Urol. 192, 379-384 (2014).

140

319 Boudreau, D. M., Yu, O., Buist, D. S. & Miglioretti, D. L. Statin use and prostate cancer risk in a

large population-based setting. Cancer Causes Control 19, 767-774 (2008).

320 Coogan, P. F., Kelly, J. P., Strom, B. L. & Rosenberg, L. Statin and NSAID use and prostate

cancer risk. Pharmacoepidemiol Drug Saf 19, 752-755 (2010).

321 Fowke, J. H. et al. The associations between statin use and prostate cancer screening, prostate

size, high-grade prostatic intraepithelial neoplasia (PIN), and prostate cancer. Cancer Causes

Control 22, 417-426 (2011).

322 Flick, E. D. et al. Statin use and risk of prostate cancer in the California Men's Health Study

cohort. Cancer Epidemiol. Biomarkers Prev. 16, 2218-2225 (2007).

323 Kantor, E. D. et al. Statin use and risk of prostate cancer: Results from the Southern Community

Cohort Study. Prostate 75, 1384-1393 (2015).

324 Geybels, M. S. et al. Statin Use in Relation to Prostate Cancer Outcomes in a Population-based

Patient Cohort Study. Prostate 73, 1214-1222 (2013).

325 Harshman, L. C. et al. Statin Use at the Time of Initiation of Androgen Deprivation Therapy and

Time to Progression in Patients With Hormone-Sensitive Prostate Cancer. JAMA Oncol 1, 495-

504 (2015).

326 Park, H. S. et al. Statins and prostate cancer recurrence following radical prostatectomy or

radiotherapy: a systematic review and meta-analysis. Ann. Oncol. 24, 1427-1434 (2013).

327 Nielsen, S. F., Nordestgaard, B. G. & Bojesen, S. E. Statin use and reduced cancer-related

mortality. N. Engl. J. Med. 367, 1792-1802 (2012).

328 Grytli, H. H., Fagerland, M. W., Fossa, S. D. & Tasken, K. A. Association between use of beta-

blockers and prostate cancer-specific survival: a cohort study of 3561 prostate cancer patients

with high-risk or metastatic disease. Eur. Urol. 65, 635-641 (2014).

329 Yu, O. et al. Use of statins and the risk of death in patients with prostate cancer. J. Clin. Oncol.

32, 5-11 (2014).

330 Marcella, S. W., David, A., Ohman-Strickland, P. A., Carson, J. & Rhoads, G. G. Statin use and

fatal prostate cancer A Matched Case-Control Study. Cancer 118, 4046-4052 (2012).

331 Larsen, S. B. et al. Postdiagnosis Statin Use and Mortality in Danish Patients With Prostate

Cancer. J. Clin. Oncol. 35, 3290-3297 (2017).

332 Hoque, A., Chen, H. & Xu, X. C. Statin induces apoptosis and cell growth arrest in prostate

cancer cells. Cancer Epidemiol. Biomarkers Prev. 17, 88-94 (2008).

333 Brown, M. et al. The differential effects of statins on the metastatic behaviour of prostate cancer.

Br. J. Cancer 106, 1689-1696 (2012).

334 Nubel, T., Dippold, W., Kleinert, H., Kaina, B. & Fritz, G. Lovastatin inhibits Rho-regulated

expression of E-selectin by TNFalpha and attenuates tumor cell adhesion. FASEB J. 18, 140-142

(2004).

141

335 Weis, M., Heeschen, C., Glassford, A. J. & Cooke, J. P. Statins have biphasic effects on

angiogenesis. Circulation 105, 739-745 (2002).

336 Dobs, A. S. et al. Effects of high-dose simvastatin on adrenal and gonadal steroidogenesis in men

with hypercholesterolemia. Metabolism 49, 1234-1238 (2000).

337 Hyyppa, M. T., Kronholm, E., Virtanen, A., Leino, A. & Jula, A. Does simvastatin affect mood

and steroid hormone levels in hypercholesterolemic men? A randomized double-blind trial.

Psychoneuroendocrinology 28, 181-194 (2003).

338 Bohm, M., Herrmann, W., Wassmann, S., Laufs, U. & Nickenig, G. Does statin therapy influence

steroid hormone synthesis? Z. Kardiol. 93, 43-48 (2004).

339 Hall, S. A. et al. Do statins affect androgen levels in men? Results from the Boston area

community health survey. Cancer Epidemiol. Biomarkers Prev. 16, 1587-1594 (2007).

340 Kim, J. H., Cox, M. E. & Wasan, K. M. Effect of simvastatin on castration-resistant prostate

cancer cells. Lipids in Health and Disease 13 (2014).

341 Rao, S. et al. Lovastatin-mediated G1 arrest is through inhibition of the proteasome, independent

of hydroxymethyl glutaryl-CoA reductase. Proc. Natl. Acad. Sci. U. S. A. 96, 7797-7802 (1999).

342 Di Lorenzo, G. et al. Statin Use and Survival in Patients with Metastatic Castration-resistant

Prostate Cancer Treated with Abiraterone Acetate. Eur Urol Focus (2017).

343 Harshman, L. C. et al. The impact of statin use on the efficacy of abiraterone acetate in patients

with castration-resistant prostate cancer. Prostate 77, 1303-1311 (2017).

344 Bewick, V., Cheek, L. & Ball, J. Statistics review 12: survival analysis. Crit Care 8, 389-394

(2004).

345 Goyal, J. et al. Association of the Charlson comorbidity index and hypertension with survival in

men with metastatic castration-resistant prostate cancer. Urol Oncol 32, 36 e27-34 (2014).

346 Ibuki, N. et al. The tyrphostin NT157 suppresses insulin receptor substrates and augments

therapeutic response of prostate cancer. Mol Cancer Ther 13, 2827-2839 (2014).

347 Fokidis, H. B. et al. A low carbohydrate, high protein diet suppresses intratumoral androgen

synthesis and slows castration-resistant prostate tumor growth in mice. J. Steroid Biochem. Mol.

Biol. 150, 35-45 (2015).

348 Toren, P. J. et al. Anticancer activity of a novel selective CYP17A1 inhibitor in preclinical

models of castrate-resistant prostate cancer. Mol Cancer Ther 14, 59-69 (2015).

349 Yamazaki, S. Translational pharmacokinetic-pharmacodynamic modeling from nonclinical to

clinical development: a case study of anticancer drug, crizotinib. AAPS J 15, 354-366 (2013).

350 Backman, J. T., Kyrklund, C., Kivisto, K. T., Wang, J. S. & Neuvonen, P. J. Plasma

concentrations of active simvastatin acid are increased by gemfibrozil. Clin. Pharmacol. Ther. 68,

122-129 (2000).

142

351 Ibuki, N. et al. TAK-441, a novel investigational smoothened antagonist, delays castration-

resistant progression in prostate cancer by disrupting paracrine hedgehog signaling. Int. J. Cancer

133, 1955-1966 (2013).

352 Zocor (simvastatin) prescription notes. (Cramlington, Northumberland, UK, 2015).

353 Paller, C. J. & Antonarakis, E. S. Management of biochemically recurrent prostate cancer after

local therapy: evolving standards of care and new directions. Clin Adv Hematol Oncol 11, 14-23

(2013).

354 Tonelli, M. et al. Efficacy of statins for primary prevention in people at low cardiovascular risk: a

meta-analysis. CMAJ 183, E1189-1202 (2011).

355 Chou, R., Dana, T., Blazina, I., Daeges, M. & Jeanne, T. L. Statins for Prevention of

Cardiovascular Disease in Adults: Evidence Report and Systematic Review for the US Preventive

Services Task Force. JAMA 316, 2008-2024 (2016).

356 Adedinsewo, D. et al. Prevalence and Factors Associated With Statin Use Among a Nationally

Representative Sample of US Adults: National Health and Nutrition Examination Survey, 2011-

2012. Clin. Cardiol. 39, 491-496 (2016).

357 Raval, A. D. et al. Association between statins and clinical outcomes among men with prostate

cancer: a systematic review and meta-analysis. Prostate Cancer Prostatic Dis 19, 151-162

(2016).

358 Cai, C. et al. Intratumoral de novo steroid synthesis activates androgen receptor in castration-

resistant prostate cancer and is upregulated by treatment with CYP17A1 inhibitors. Cancer Res.

71, 6503-6513 (2011).

359 Taplin, M. E. et al. Androgen receptor mutations in androgen-independent prostate cancer:

Cancer and Leukemia Group B Study 9663. J. Clin. Oncol. 21, 2673-2678 (2003).

360 Nacusi, L. P. & Tindall, D. J. Androgen receptor abnormalities in castration-recurrent prostate

cancer. Expert Rev Endocrinol Metab 4, 417-422 (2009).

361 Flora M. Hammond, James F. Malec, Todd G. Nick & Buschbacher., R. M. Handbook for

clinical research : design, statistics, and implementation. (Demos Medical Publishing, 2015).

362 Gordon, J. A. et al. Statin use and survival in patients with metastatic castrationresistant prostate

cancer treated with abiraterone or enzalutamide after docetaxel failure: the international

retrospective observational STABEN study. Oncotarget 9, 19861-19873 (2018).

363 Roy, M., Kung, H. J. & Ghosh, P. M. Statins and prostate cancer: role of cholesterol inhibition vs.

prevention of small GTP-binding proteins. Am J Cancer Res 1, 542-561 (2011).

364 Gordon, J. A. et al. Oral simvastatin administration delays castration-resistant progression and

reduces intratumoral steroidogenesis of LNCaP prostate cancer xenografts. Prostate Cancer

Prostatic Dis 19, 21-27 (2016).

365 Solomon, K. R. & Freeman, M. R. Do the cholesterol-lowering properties of statins affect cancer

risk? Trends Endocrinol. Metab. 19, 113-121 (2008).

143

366 Maxfield, F. R. & Wustner, D. Intracellular cholesterol transport. J. Clin. Invest. 110, 891-898

(2002).

367 Zheng, X. et al. Atorvastatin and Celecoxib in Combination Inhibits the Progression of

Androgen-Dependent LNCaP Xenograft Prostate Tumors to Androgen Independence. Cancer

Prevention Research 3, 114-124 (2010).

368 Thysell, E. et al. Metabolomic characterization of human prostate cancer bone metastases reveals

increased levels of cholesterol. Plos One 5, e14175 (2010).

369 Bair, S. R. & Mellon, S. H. Deletion of the mouse P450c17 gene causes early embryonic

lethality. Mol. Cell. Biol. 24, 5383-5390 (2004).

370 Grigoryev, D. N., Long, B. J., Njar, V. C. & Brodie, A. H. Pregnenolone stimulates LNCaP

prostate cancer cell growth via the mutated androgen receptor. J. Steroid Biochem. Mol. Biol. 75,

1-10 (2000).

371 Attard, G. et al. Clinical and biochemical consequences of CYP17A1 inhibition with abiraterone

given with and without exogenous glucocorticoids in castrate men with advanced prostate cancer.

J. Clin. Endocrinol. Metab. 97, 507-516 (2012).

372 Don-Doncow, N. et al. Expression of STAT3 in Prostate Cancer Metastases. Eur. Urol. 71, 313-

316 (2017).

373 Ren, S. et al. Whole-genome and Transcriptome Sequencing of Prostate Cancer Identify New

Genetic Alterations Driving Disease Progression. Eur. Urol. (2017).

374 Beltran, H. et al. Molecular characterization of neuroendocrine prostate cancer and identification

of new drug targets. Cancer Discov 1, 487-495 (2011).

375 Beltran, H. et al. Divergent clonal evolution of castration-resistant neuroendocrine prostate

cancer. Nat. Med. 22, 298-305 (2016).

376 Pernicova, Z. et al. Androgen depletion induces senescence in prostate cancer cells through

down-regulation of Skp2. Neoplasia 13, 526-536 (2011).

377 Midha, A. Determining the Role of Scavenger Receptor Class B Type I as a Source of Cholesterol

for de novo Androgen Synthesis in Castration-resistant Prostate Cancer Master of Science thesis,

University of British Columbia, (2015).

378 Yu, M. et al. Exoplasmic cysteine Cys384 of the HDL receptor SR-BI is critical for its sensitivity

to a small-molecule inhibitor and normal lipid transport activity. Proc. Natl. Acad. Sci. U. S. A.

108, 12243-12248 (2011).

379 Yen, C. F. et al. Flow cytometric evaluation of LDL receptors using DiI-LDL uptake and its

application to B and T lymphocytic cell lines. J. Immunol. Methods 177, 55-67 (1994).

380 Pagler, T. A. et al. SR-BI-mediated high density lipoprotein (HDL) endocytosis leads to HDL

resecretion facilitating cholesterol efflux. J. Biol. Chem. 281, 11193-11204 (2006).

144

381 Stephan, Z. F. & Yurachek, E. C. Rapid fluorometric assay of LDL receptor activity by DiI-

labeled LDL. J. Lipid Res. 34, 325-330 (1993).

382 Tung, J. W. et al. Modern flow cytometry: a practical approach. Clin. Lab. Med. 27, 453-468, v

(2007).

383 EssenBioScience. IncuCyte ZOOM live cell imaging, <http://www.essenbioscience.com/essen-

products/incucyte/ > (2018).

384 Furukawa, J. et al. Antisense oligonucleotide targeting of insulin-like growth factor-1 receptor

(IGF-1R) in prostate cancer. Prostate 70, 206-218 (2010).

385 Riccardi, C. & Nicoletti, I. Analysis of apoptosis by propidium iodide staining and flow

cytometry. Nat Protoc 1, 1458-1461 (2006).

386 Nunez, R. DNA measurement and cell cycle analysis by flow cytometry. Curr Issues Mol Biol 3,

67-70 (2001).

387 Schambeck, C. M. Evaluation of the COBAS CORE Immunoassay for measuring prostate-

specific antigen (PSA)--multi-centre study results. The PSA Study Group. Eur. J. Clin. Chem.

Clin. Biochem. 33, 541-547 (1995).

388 Wyatt, A. W. & Gleave, M. E. Targeting the adaptive molecular landscape of castration-resistant

prostate cancer. EMBO Mol Med 7, 878-894 (2015).

389 Feldman, B. J. & Feldman, D. The development of androgen-independent prostate cancer. Nat

Rev Cancer 1, 34-45 (2001).

390 Chlenski, A., Nakashiro, K., Ketels, K. V., Korovaitseva, G. I. & Oyasu, R. Androgen receptor

expression in androgen-independent prostate cancer cell lines. Prostate 47, 66-75 (2001).

391 Chen, F. et al. Direct agonist/antagonist functions of dehydroepiandrosterone. Endocrinology

146, 4568-4576 (2005).

392 Zhang, F. et al. Clusterin facilitates stress-induced lipidation of LC3 and autophagosome

biogenesis to enhance cancer cell survival. Nat Commun 5, 5775 (2014).

393 Thorburn, A. Apoptosis and autophagy: regulatory connections between two supposedly different

processes. Apoptosis 13, 1-9 (2008).

394 Jung, C. H., Ro, S. H., Cao, J., Otto, N. M. & Kim, D. H. mTOR regulation of autophagy. FEBS

Lett. 584, 1287-1295 (2010).

395 Rohrl, C. et al. Endoplasmic reticulum stress impairs cholesterol efflux and synthesis in hepatic

cells. J. Lipid Res. 55, 94-103 (2014).

396 Hou, N. S. et al. Activation of the endoplasmic reticulum unfolded protein response by lipid

disequilibrium without disturbed proteostasis in vivo. Proc. Natl. Acad. Sci. U. S. A. 111, E2271-

2280 (2014).

397 Hetz, C. & Papa, F. R. The Unfolded Protein Response and Cell Fate Control. Mol. Cell 69, 169-

181 (2018).

145

398 Hoyer-Hansen, M. & Jaattela, M. Connecting endoplasmic reticulum stress to autophagy by

unfolded protein response and calcium. Cell Death Differ. 14, 1576-1582 (2007).

399 Rashid, H. O., Yadav, R. K., Kim, H. R. & Chae, H. J. ER stress: Autophagy induction, inhibition

and selection. Autophagy 11, 1956-1977 (2015).

400 Wang, M., Wey, S., Zhang, Y., Ye, R. & Lee, A. S. Role of the unfolded protein response

regulator GRP78/BiP in development, cancer, and neurological disorders. Antioxid Redox Signal

11, 2307-2316 (2009).

401 Chen, Y. & Brandizzi, F. IRE1: ER stress sensor and cell fate executor. Trends Cell Biol. 23, 547-

555 (2013).

402 Yang, Y. P. et al. Application and interpretation of current autophagy inhibitors and activators.

Acta Pharmacol Sin 34, 625-635 (2013).

403 Azhar, S. & Reaven, E. Scavenger receptor class BI and selective cholesteryl ester uptake:

partners in the regulation steroidogenesis. Mol. Cell. Endocrinol. 195, 1-26 (2002).

404 Grewal, T. et al. High density lipoprotein-induced signaling of the MAPK pathway involves

scavenger receptor type BI-mediated activation of Ras. J. Biol. Chem. 278, 16478-16481 (2003).

405 Danilo, C. et al. Scavenger receptor class B type I regulates cellular cholesterol metabolism and

cell signaling associated with breast cancer development. Breast Cancer Res 15, R87 (2013).

406 Stopsack, K. H. et al. Cholesterol uptake and regulation in high-grade and lethal prostate cancers.

Carcinogenesis 38, 806-811 (2017).

407 Belter, A. et al. Squalene monooxygenase - a target for hypercholesterolemic therapy. Biol.

Chem. 392, 1053-1075 (2011).

408 Brown, D. N. et al. Squalene epoxidase is a bona fide oncogene by amplification with clinical

relevance in breast cancer. Sci Rep 6, 19435 (2016).

409 Beltran, H. et al. Aggressive variants of castration-resistant prostate cancer. Clin. Cancer. Res.

20, 2846-2850 (2014).

410 Parimi, V., Goyal, R., Poropatich, K. & Yang, X. J. Neuroendocrine differentiation of prostate

cancer: a review. Am J Clin Exp Urol 2, 273-285 (2014).

411 Zhou, Z. et al. Synergy of p53 and Rb deficiency in a conditional mouse model for metastatic

prostate cancer. Cancer Res. 66, 7889-7898 (2006).

412 Cox, M. E., Deeble, P. D., Bissonette, E. A. & Parsons, S. J. Activated 3',5'-cyclic AMP-

dependent protein kinase is sufficient to induce neuroendocrine-like differentiation of the LNCaP

prostate tumor cell line. J. Biol. Chem. 275, 13812-13818 (2000).

413 Deeble, P. D., Murphy, D. J., Parsons, S. J. & Cox, M. E. Interleukin-6- and cyclic AMP-

mediated signaling potentiates neuroendocrine differentiation of LNCaP prostate tumor cells.

Mol. Cell. Biol. 21, 8471-8482 (2001).

146

414 Cox, M. E., Deeble, P. D., Lakhani, S. & Parsons, S. J. Acquisition of neuroendocrine

characteristics by prostate tumor cells is reversible: implications for prostate cancer progression.

Cancer Res. 59, 3821-3830 (1999).

415 Bishop, J. L. et al. The Master Neural Transcription Factor BRN2 Is an Androgen Receptor-

Suppressed Driver of Neuroendocrine Differentiation in Prostate Cancer. Cancer Discov 7, 54-71

(2017).

416 Zhang, X. et al. SRRM4 Expression and the Loss of REST Activity May Promote the Emergence

of the Neuroendocrine Phenotype in Castration-Resistant Prostate Cancer. Clin. Cancer. Res. 21,

4698-4708 (2015).

417 Cerasuolo, M. et al. Neuroendocrine Transdifferentiation in Human Prostate Cancer Cells: An

Integrated Approach. Cancer Res. 75, 2975-2986 (2015).

418 Kim, J., Adam, R. M., Solomon, K. R. & Freeman, M. R. Involvement of cholesterol-rich lipid

rafts in interleukin-6-induced neuroendocrine differentiation of LNCaP prostate cancer cells.

Endocrinology 145, 613-619 (2004).

419 Yue, S. et al. Cholesteryl ester accumulation induced by PTEN loss and PI3K/AKT activation

underlies human prostate cancer aggressiveness. Cell Metab 19, 393-406 (2014).

420 Horoszewicz, J. S. et al. LNCaP model of human prostatic carcinoma. Cancer Res. 43, 1809-

1818 (1983).

421 Kaighn, M. E., Narayan, K. S., Ohnuki, Y., Lechner, J. F. & Jones, L. W. Establishment and

characterization of a human prostatic carcinoma cell line (PC-3). Invest. Urol. 17, 16-23 (1979).

422 van Bokhoven, A. et al. Molecular characterization of human prostate carcinoma cell lines.

Prostate 57, 205-225 (2003).

423 Carroll, A. G., Voeller, H. J., Sugars, L. & Gelmann, E. P. p53 oncogene mutations in three

human prostate cancer cell lines. Prostate 23, 123-134 (1993).

424 Farrow, J. M., Yang, J. C. & Evans, C. P. Autophagy as a modulator and target in prostate cancer.

Nat Rev Urol 11, 508-516 (2014).

425 Nguyen, H. G. et al. Targeting autophagy overcomes Enzalutamide resistance in castration-

resistant prostate cancer cells and improves therapeutic response in a xenograft model. Oncogene

33, 4521-4530 (2014).

426 Bennett, H. L. et al. Does androgen-ablation therapy (AAT) associated autophagy have a pro-

survival effect in LNCaP human prostate cancer cells? BJU Int. 111, 672-682 (2013).

427 Kung, H. J. Targeting tyrosine kinases and autophagy in prostate cancer. Horm Cancer 2, 38-46

(2011).

428 Wu, Z. et al. Autophagy Blockade Sensitizes Prostate Cancer Cells towards Src Family Kinase

Inhibitors. Genes Cancer 1, 40-49 (2010).

147

429 Dozmorov, M. G. et al. Unique patterns of molecular profiling between human prostate cancer

LNCaP and PC-3 cells. Prostate 69, 1077-1090 (2009).

430 Levine, B. & Abrams, J. p53: The Janus of autophagy? Nat Cell Biol 10, 637-639 (2008).

431 Budanov, A. V. & Karin, M. p53 target genes sestrin1 and sestrin2 connect genotoxic stress and

mTOR signaling. Cell 134, 451-460 (2008).

432 Loayza-Puch, F. et al. p53 induces transcriptional and translational programs to suppress cell

proliferation and growth. Genome Biol 14, R32 (2013).

433 Lin, W. C. et al. Endoplasmic reticulum stress stimulates p53 expression through NF-kappaB

activation. Plos One 7, e39120 (2012).

434 Qu, L. et al. Endoplasmic reticulum stress induces p53 cytoplasmic localization and prevents

p53-dependent apoptosis by a pathway involving glycogen synthase kinase-3beta. Genes Dev. 18,

261-277 (2004).

435 Nieland, T. J., Penman, M., Dori, L., Krieger, M. & Kirchhausen, T. Discovery of chemical

inhibitors of the selective transfer of lipids mediated by the HDL receptor SR-BI. Proc. Natl.

Acad. Sci. U. S. A. 99, 15422-15427 (2002).

436 Park, Y. M. CD36, a scavenger receptor implicated in atherosclerosis. Exp. Mol. Med. 46, e99

(2014).

437 Wu, X., Daniels, G., Lee, P. & Monaco, M. E. Lipid metabolism in prostate cancer. Am J Clin

Exp Urol 2, 111-120 (2014).

438 Neculai, D. et al. Structure of LIMP-2 provides functional insights with implications for SR-BI

and CD36. Nature 504, 172-176 (2013).

439 Connelly, M. A., Klein, S. M., Azhar, S., Abumrad, N. A. & Williams, D. L. Comparison of class

B scavenger receptors, CD36 and scavenger receptor BI (SR-BI), shows that both receptors

mediate high density lipoprotein-cholesteryl ester selective uptake but SR-BI exhibits a unique

enhancement of cholesteryl ester uptake. J. Biol. Chem. 274, 41-47 (1999).

440 Gu, X. et al. The efficient cellular uptake of high density lipoprotein lipids via scavenger receptor

class B type I requires not only receptor-mediated surface binding but also receptor-specific lipid

transfer mediated by its extracellular domain. J. Biol. Chem. 273, 26338-26348 (1998).

441 Li, M. et al. Autophagy protects LNCaP cells under androgen deprivation conditions. Autophagy

4, 54-60 (2008).

442 Jiang, Q. et al. Targeting androgen receptor leads to suppression of prostate cancer via induction

of autophagy. J. Urol. 188, 1361-1368 (2012).

443 Beer, T. M. et al. Custirsen (OGX-011) combined with cabazitaxel and prednisone versus

cabazitaxel and prednisone alone in patients with metastatic castration-resistant prostate cancer

previously treated with docetaxel (AFFINITY): a randomised, open-label, international, phase 3

trial. Lancet Oncol (2017).

148

444 Lamoureux, F. et al. Blocked autophagy using lysosomotropic agents sensitizes resistant prostate

tumor cells to the novel Akt inhibitor AZD5363. Clin. Cancer. Res. 19, 833-844 (2013).

445 Kimura, T., Takabatake, Y., Takahashi, A. & Isaka, Y. Chloroquine in cancer therapy: a double-

edged sword of autophagy. Cancer Res. 73, 3-7 (2013).

446 Sajesh, B. V., Guppy, B. J. & McManus, K. J. Synthetic genetic targeting of genome instability in

cancer. Cancers (Basel) 5, 739-761 (2013).

447 Paul, J. M., Templeton, S. D., Baharani, A., Freywald, A. & Vizeacoumar, F. J. Building high-

resolution synthetic lethal networks: a 'Google map' of the cancer cell. Trends Mol Med 20, 704-

715 (2014).

448 Munuganti, R. S. et al. Identification of a potent antiandrogen that targets the BF3 site of the

androgen receptor and inhibits enzalutamide-resistant prostate cancer. Chem. Biol. 21, 1476-1485

(2014).

449 Lallous, N. et al. Targeting Binding Function-3 of the Androgen Receptor Blocks Its Co-

Chaperone Interactions, Nuclear Translocation, and Activation. Mol Cancer Ther 15, 2936-2945

(2016).

450 European Medicines Agency. Background review for the excipient propylene glycol. (European

Medicines Agency, 2014).

451 Abraxis Inc. VetScan Comprehensive Diagnostic Profile. (2015).

452 Lino, M. et al. Intestinal scavenger receptor class B type I as a novel regulator of chylomicron

production in healthy and diet-induced obese states. Am J Physiol Gastrointest Liver Physiol 309,

G350-359 (2015).

453 Huang, Z. et al. Characterization of preclinical in vitro and in vivo pharmacokinetics properties

for KBP-7018, a new tyrosine kinase inhibitor candidate for treatment of idiopathic pulmonary

fibrosis. Drug Des Devel Ther 9, 4319-4328 (2015).

454 Nieland, T. J. et al. Identification of the molecular target of small molecule inhibitors of HDL

receptor SR-BI activity. Biochemistry (Mosc). 47, 460-472 (2008).

455 Gowda, S. et al. A review on laboratory liver function tests. Pan Afr Med J 3, 17 (2009).

456 Sharma, M. et al. Lipoprotein (a) upregulates ABCA1 in liver cells via scavenger receptor-B1

through its oxidized phospholipids. J. Lipid Res. 56, 1318-1328 (2015).

457 de Beer, M. C. et al. The Impairment of Macrophage-to-Feces Reverse Cholesterol Transport

during Inflammation Does Not Depend on Serum Amyloid A. J Lipids 2013, 283486 (2013).

458 Beaslas, O. et al. Sensing of dietary lipids by enterocytes: a new role for SR-BI/CLA-1. Plos One

4, e4278 (2009).

459 Lipinski, C. A., Lombardo, F., Dominy, B. W. & Feeney, P. J. Experimental and computational

approaches to estimate solubility and permeability in drug discovery and development settings.

Adv Drug Deliv Rev 46, 3-26 (2001).

149

460 Savjani, K. T., Gajjar, A. K. & Savjani, J. K. Drug solubility: importance and enhancement

techniques. ISRN Pharm 2012, 195727 (2012).

461 Zhang, D., Luo, G., Ding, X. & Lu, C. Preclinical experimental models of drug metabolism and

disposition in drug discovery and development. Acta Pharmaceutica Sinica B 2, 549-561 (2012).

462 Smith, D. A., Di, L. & Kerns, E. H. The effect of plasma protein binding on in vivo efficacy:

misconceptions in drug discovery. Nat Rev Drug Discov 9, 929-939 (2010).

463 Liu, X., Wright, M. & Hop, C. E. Rational use of plasma protein and tissue binding data in drug

design. J. Med. Chem. 57, 8238-8248 (2014).

464 Phillips, M. C. Molecular mechanisms of cellular cholesterol efflux. J. Biol. Chem. 289, 24020-

24029 (2014).

465 Yancey, P. G. et al. High density lipoprotein phospholipid composition is a major determinant of

the bi-directional flux and net movement of cellular free cholesterol mediated by scavenger

receptor BI. J. Biol. Chem. 275, 36596-36604 (2000).

466 Rothblat, G. H. et al. Cell cholesterol efflux: integration of old and new observations provides

new insights. J. Lipid Res. 40, 781-796 (1999).

467 Benedict, M. & Zhang, X. Non-alcoholic fatty liver disease: An expanded review. World J

Hepatol 9, 715-732 (2017).

468 Trojak, A., Walus-Miarka, M., Wozniakiewicz, E., Malecki, M. T. & Idzior-Walus, B.

Nonalcoholic fatty liver disease is associated with low HDL cholesterol and coronary angioplasty

in patients with type 2 diabetes. Med Sci Monit 19, 1167-1172 (2013).

469 Faloon, P. W. et al. A Small Molecule Inhibitor of Scavenger Receptor BI-mediated Lipid Uptake-

Probe 1. (2010).

470 Dockendorff, C. et al. Indolinyl-Thiazole Based Inhibitors of Scavenger Receptor-BI (SR-BI)-

Mediated Lipid Transport. ACS Med Chem Lett 6, 375-380 (2015).

471 Wang, C. Y., Liu, P. Y. & Liao, J. K. Pleiotropic effects of statin therapy: molecular mechanisms

and clinical results. Trends Mol Med 14, 37-44 (2008).

472 Laufs, U., La Fata, V., Plutzky, J. & Liao, J. K. Upregulation of endothelial nitric oxide synthase

by HMG CoA reductase inhibitors. Circulation 97, 1129-1135 (1998).

473 Laufs, U. & Liao, J. K. Post-transcriptional regulation of endothelial nitric oxide synthase mRNA

stability by Rho GTPase. J. Biol. Chem. 273, 24266-24271 (1998).

474 Kureishi, Y. et al. The HMG-CoA reductase inhibitor simvastatin activates the protein kinase Akt

and promotes angiogenesis in normocholesterolemic animals. Nat. Med. 6, 1004-1010 (2000).

475 Kwak, B., Mulhaupt, F., Myit, S. & Mach, F. Statins as a newly recognized type of

immunomodulator. Nat. Med. 6, 1399-1402 (2000).

476 Trapani, L., Segatto, M., Ascenzi, P. & Pallottini, V. Potential role of nonstatin cholesterol

lowering agents. IUBMB Life 63, 964-971 (2011).

150

477 Bonovas, S., Nikolopoulos, G. K. & Bagos, P. G. Use of fibrates and cancer risk: a systematic

review and meta-analysis of 17 long-term randomized placebo-controlled trials. Plos One 7,

e45259 (2012).

478 Ganji, S. H., Kamanna, V. S. & Kashyap, M. L. Niacin and cholesterol: role in cardiovascular

disease (review). J Nutr Biochem 14, 298-305 (2003).

479 Baud, V. & Karin, M. Is NF-kappaB a good target for cancer therapy? Hopes and pitfalls. Nat

Rev Drug Discov 8, 33-40 (2009).

480 Kim, L. C., Song, L. & Haura, E. B. Src kinases as therapeutic targets for cancer. Nat Rev Clin

Oncol 6, 587-595 (2009).

481 Mucci, L. A. & Kantoff, P. W. Is the Evidence Sufficient to Recommend Statins for All Men

With Prostate Cancer? J. Clin. Oncol. 35, 3272-+ (2017).

482 Xie, W. et al. Metastasis-Free Survival Is a Strong Surrogate of Overall Survival in Localized

Prostate Cancer. J. Clin. Oncol. 35, 3097-3104 (2017).

483 Hawley, S. et al. A model for the design and construction of a resource for the validation of

prognostic prostate cancer biomarkers: the Canary Prostate Cancer Tissue Microarray. Adv. Anat.

Pathol. 20, 39-44 (2013).

484 Liu, L. L. et al. Mechanisms of the androgen receptor splicing in prostate cancer cells. Oncogene

33, 3140-3150 (2014).

485 Bishop, J. L. et al. PD-L1 is highly expressed in Enzalutamide resistant prostate cancer.

Oncotarget 6, 234-242 (2015).

486 Leiblich, A. et al. Human prostate cancer cells express neuroendocrine cell markers PGP 9.5 and

chromogranin A. Prostate 67, 1761-1769 (2007).

487 Daniel, V. C. et al. A primary xenograft model of small-cell lung cancer reveals irreversible

changes in gene expression imposed by culture in vitro. Cancer Res. 69, 3364-3373 (2009).

488 Tentler, J. J. et al. Patient-derived tumour xenografts as models for oncology drug development.

Nat Rev Clin Oncol 9, 338-350 (2012).

489 Davies, A. H., Wang, Y. & Zoubeidi, A. Patient-derived xenografts: A platform for accelerating

translational research in prostate cancer. Mol. Cell. Endocrinol. 462, 17-24 (2018).

490 Nguyen, H. M. et al. LuCaP Prostate Cancer Patient-Derived Xenografts Reflect the Molecular

Heterogeneity of Advanced Disease an--d Serve as Models for Evaluating Cancer Therapeutics.

Prostate 77, 654-671 (2017).

491 Shao, W. & Espenshade, P. J. Expanding roles for SREBP in metabolism. Cell Metab 16, 414-

419 (2012).

492 Subczynski, W. K., Pasenkiewicz-Gierula, M., Widomska, J., Mainali, L. & Raguz, M. High

Cholesterol/Low Cholesterol: Effects in Biological Membranes: A Review. Cell Biochem.

Biophys. 75, 369-385 (2017).

151

493 Sheng, R. et al. Cholesterol modulates cell signaling and protein networking by specifically

interacting with PDZ domain-containing scaffold proteins. Nat Commun 3, 1249 (2012).

494 Altman, B. J. & Rathmell, J. C. Metabolic stress in autophagy and cell death pathways. Cold

Spring Harb Perspect Biol 4, a008763 (2012).

495 Hsu, P. P. et al. The mTOR-regulated phosphoproteome reveals a mechanism of mTORC1-

mediated inhibition of growth factor signaling. Science 332, 1317-1322 (2011).

496 Mihaylova, M. M. & Shaw, R. J. The AMPK signalling pathway coordinates cell growth,

autophagy and metabolism. Nat Cell Biol 13, 1016-1023 (2011).

497 McInnes, K. J., Brown, K. A., Hunger, N. I. & Simpson, E. R. Regulation of LKB1 expression by

sex hormones in adipocytes. Int J Obes (Lond) 36, 982-985 (2012).

498 Ribas, V., Garcia-Ruiz, C. & Fernandez-Checa, J. C. Mitochondria, cholesterol and cancer cell

metabolism. Clin Transl Med 5, 22 (2016).

499 Papandreou, I., Lim, A. L., Laderoute, K. & Denko, N. C. Hypoxia signals autophagy in tumor

cells via AMPK activity, independent of HIF-1, BNIP3, and BNIP3L. Cell Death Differ. 15,

1572-1581 (2008).

500 de Laurentiis, A., Donovan, L. & Arcaro, A. Lipid rafts and caveolae in signaling by growth

factor receptors. Open Biochem J 1, 12-32 (2007).

501 Day, K. C. et al. HER2 and EGFR Overexpression Support Metastatic Progression of Prostate

Cancer to Bone. Cancer Res. 77, 74-85 (2017).

502 Wu, J. & Yu, E. Insulin-like growth factor receptor-1 (IGF-IR) as a target for prostate cancer

therapy. Cancer Metastasis Rev. 33, 607-617 (2014).

503 Mukherjee, R. et al. Upregulation of MAPK pathway is associated with survival in castrate-

resistant prostate cancer. Br. J. Cancer 104, 1920-1928 (2011).

504 Siddle, K. Molecular basis of signaling specificity of insulin and IGF receptors: neglected corners

and recent advances. Front Endocrinol (Lausanne) 3, 34 (2012).

505 Shanware, N. P., Bray, K. & Abraham, R. T. The PI3K, metabolic, and autophagy networks:

interactive partners in cellular health and disease. Annu. Rev. Pharmacol. Toxicol. 53, 89-106

(2013).

506 Liu, P., Cheng, H., Roberts, T. M. & Zhao, J. J. Targeting the phosphoinositide 3-kinase pathway

in cancer. Nat Rev Drug Discov 8, 627-644 (2009).

507 Molina, J. R. & Adjei, A. A. The Ras/Raf/MAPK pathway. J Thorac Oncol 1, 7-9 (2006).

508 Dhillon, A. S., Hagan, S., Rath, O. & Kolch, W. MAP kinase signalling pathways in cancer.

Oncogene 26, 3279-3290 (2007).

509 Klymchenko, A. S. & Kreder, R. Fluorescent probes for lipid rafts: from model membranes to

living cells. Chem. Biol. 21, 97-113 (2014).

152

510 Lingwood, D. & Simons, K. Detergent resistance as a tool in membrane research. Nat Protoc 2,

2159-2165 (2007).

511 Redmann, M. et al. Inhibition of autophagy with bafilomycin and chloroquine decreases

mitochondrial quality and bioenergetic function in primary neurons. Redox Biol 11, 73-81 (2017).

512 Briceno, E., Reyes, S. & Sotelo, J. Therapy of glioblastoma multiforme improved by the

antimutagenic chloroquine. Neurosurg Focus 14, e3 (2003).

513 Sotelo, J., Briceno, E. & Lopez-Gonzalez, M. A. Adding chloroquine to conventional treatment

for glioblastoma multiforme: a randomized, double-blind, placebo-controlled trial. Ann. Intern.

Med. 144, 337-343 (2006).

514 Briceno, E., Calderon, A. & Sotelo, J. Institutional experience with chloroquine as an adjuvant to

the therapy for glioblastoma multiforme. Surg. Neurol. 67, 388-391 (2007).

515 Rojas-Puentes, L. L. et al. Phase II randomized, double-blind, placebo-controlled study of whole-

brain irradiation with concomitant chloroquine for brain metastases. Radiat Oncol 8, 209 (2013).

516 Eldredge, H. B. et al. Concurrent Whole Brain Radiotherapy and Short-Course Chloroquine in

Patients with Brain Metastases: A Pilot Trial. J Radiat Oncol 2 (2013).

517 Kyle, R. A. et al. Mutiple myeloma resistant to melphalan (NSC-8806) treated with

cyclophosphamide (NSC-26271), prednisone (NSC-10023), and chloroquine (NSC-187208).

Cancer Chemother. Rep. 59, 557-562 (1975).

518 Rangwala, R. et al. Phase I trial of hydroxychloroquine with dose-intense temozolomide in

patients with advanced solid tumors and melanoma. Autophagy 10, 1369-1379 (2014).

519 Rosenfeld, M. R. et al. A phase I/II trial of hydroxychloroquine in conjunction with radiation

therapy and concurrent and adjuvant temozolomide in patients with newly diagnosed

glioblastoma multiforme. Autophagy 10, 1359-1368 (2014).

520 Chude, C. I. & Amaravadi, R. K. Targeting Autophagy in Cancer: Update on Clinical Trials and

Novel Inhibitors. Int J Mol Sci 18 (2017).

521 Jones, S. E. & Jomary, C. Clusterin. Int. J. Biochem. Cell Biol. 34, 427-431 (2002).

CHOLESTEROL METABOLISM AS A TARGET IN CASTRATION ...

Documents

Transcript of CHOLESTEROL METABOLISM AS A TARGET IN CASTRATION ...