CD2 stimulation leads to the delayed and prolonged activation of STAT1 in T cells but not NK cells

Experimental Hematology 29 (2001) 209–220

0301-472X/01 $–see front matter. Copyright © 2001 International Society for Experimental Hematology. Published by Elsevier Science Inc.PII S0301-472X(00)00652-4

CD2 stimulation leads to the delayed and prolonged activation of STAT1 in T cells but not NK cells

Sudipta Mahajan, Jared A. Gollob*, Jerome Ritz, and David A. Frank

Department of Adult Oncology, Dana-Farber Cancer Institute, Boston, Mass., USA; Departments of Medicine, Brigham and Women’s Hospital and Harvard Medical School, Boston, Mass., USA

(Received 4 August 2000; revised 5 October 2000; accepted 10 October 2000)

Objective.

T lymphocytes can be activated by soluble factors such as cytokines or through di-rect cell-cell interactions. Although cytokine receptors are known to signal through STATfamily transcription factors, the mechanisms by which other cell-surface molecules, such asCD2, transduce signals is unclear. The goal of this study was to determine whether stimulationof T cells through CD2 recapitulates aspects of cytokine-induced T-cell activation by use ofSTAT transcription factors.

Materials and methods.

T cells were treated with anti-CD2 antibodies or cells bearing the natu-ral CD2 ligand CD58, after which signaling through STAT transcription factors was assessed.

Results.

Stimulation of CD2 on primary T lymphocytes leads to the tyrosine phosphorylation,nuclear translocation, and DNA binding of STAT1. In contrast to stimulation by cytokines,the activation of STAT1 in response to CD2 ligation is delayed and does not involve Jak ki-nases. Furthermore, while STAT phosphorylation induced by cytokines is generally transient,STAT1 phosphorylation following CD2 stimulation persists for a period of days. Transcrip-tion of key target genes such as IRF1 and c-fos proceeds with delayed kinetics following CD2stimulation, suggesting that this unique pattern of STAT activation may lead to a distinct cel-lular response following CD2 ligation. This pathway appears to be restricted to T cells, asstimulation of CD2 on NK cells does not lead to STAT1 activation.

Conclusion.

Stimulation of T cells through cell-surface molecules such as CD2 involves activa-tion of STAT transcription factors, thus recapitulating elements of cytokine signaling. © 2001International Society for Experimental Hematology. Published by Elsevier Science Inc.

Keywords:

Signal transduction—Transcription factors—Adhesion molecules—Phosphorylation

Introduction

The physiologic activation of T lymphocytes occurs whenthe T cell receptor (TCR) is engaged by an antigenic peptidepresented in the context of cell-surface major histocompati-bility complex (MHC) molecules. Stimulation through theTCR-CD3 complex culminates in cellular proliferation andthe expression of proteins necessary for the function of dif-ferentiated T lymphocytes. T-cell activation may also occurthrough stimulation of other cell-surface molecules such asCD2 [1,2]. CD2 can bind to its physiologic ligands, CD48and CD58 (and possibly CD59) [3–5], and can also be acti-vated by pairs of antibodies that recognize distinct epitopesof CD2 [1].

There is a close association between signaling events in-duced through CD2 and the TCR-CD3 complex. AlthoughCD2 is present on the surface of T cells in a pattern that isdistinct temporally and spatially from CD3-TCR, the abilityof CD2 to transmit signals is dependent on the TCR-associ-ated

z

chain [6] or other TCR-associated signaling mole-cules [7]. However, there are also differences between CD2-and TCR-CD3–mediated signaling. In Jurkat cells, CD2 andCD3 stimulation can lead to the tyrosine phosphorylation ofdistinct subsets of cellular proteins with different kinetics[8,9]. In normal resting human T lymphocytes, stimulationthrough CD2 but not CD3 leads to a transient dephosphory-lation of a 19 kDa protein [10]. Furthermore, CD2 but notCD3 is expressed on natural killer (NK) cells. CD2 stimula-tion can lead to signaling events [10] and the activation ofcytotoxicity of NK cells [2], and thus CD2 must be able totransmit some or all of its actions in the absence of CD3. Aswith T cells, however, activation of NK cells through CD2

Offprint requests to: David A. Frank, M.D., Ph.D., Department ofAdult Oncology, Dana-Farber Cancer Institute, Mayer 522B, 44 BinneySt., Boston, MA 02115 USA; E-mail: [email protected]

*Dr. Gollob is presently affiliated with the Department of Hematology/Oncology, Beth Israel-Deaconess Medical Center, Boston, Mass., USA.

210

S. Mahajan et al./Experimental Hematology 29 (2001) 209–220

is also dependent on the

z

chain, which is associated withCD16 in NK cells [11].

Although T cells can become activated through cell-cellinteractions, their proliferation and function can also be stim-ulated by cytokines such as interleukin (IL)-2. These factorsbind to specific cell-surface receptors, then trigger a cascadeof intracellular signaling events culminating in the regula-tion of expression of specific target genes. Among the mech-anisms necessary for cytokine-mediated T-cell stimulationis the activation of signal transducer and activator of tran-scription (STAT) transcription factors. Following the bind-ing of a cytokine to its receptor, STATs are recruited to thereceptor cytoplasmic domain where they become phosphor-ylated on specific tyrosine residues by kinases of the Jakfamily. The phosphorylated STATs then dimerize, translo-cate to the nucleus, and bind to specific DNA sequences lo-cated in the promoter regions of target genes, where theyregulate transcription [12–15]. The importance of Jak-STATsignaling in T-lymphocyte function is clear in that loss ofability to activate this pathway is associated with severecombined immunodeficiency [16–18], and STAT1-deficientmice succumb to opportunistic infections [19,20]. Further-more, activation of Jak-STAT signaling through cytokinereceptors is able to overcome anergy [21] and to promotesurvival [22] of T cells. Thus, an abundance of evidence in-dicates this pathway is important in T-cell biology.

Given this, we examined the activation of STAT tran-scription factors in response to CD2 stimulation. We foundthat ligation of CD2 on T cells leads to the delayed and pro-longed phosphorylation, nuclear translocation, and DNAbinding of STAT1, with consequent effects on target geneactivation. Thus, the STAT pathway, normally activated inresponse to cytokines, may contribute to the activation of Tcells through the ligation of cell adhesion molecules.

Materials and methods

Cell lines

NKL [23], NK3.3 [24], and Jurkat cells were grown in RPMI 1640medium supplemented with 15% fetal bovine serum (FBS), 1 mMsodium pyruvate, 250 U/mL penicillin, and 250

m

g/mL streptomy-cin, and were grown at 37

8

C in a humidified atmosphere contain-ing 5% CO

2

. For NKL cells, the media was supplemented with 100U/mL IL-2 (Amgen, Thousand Oaks, CA, USA), and for NK3.3cells with 10% Lymphocult (Biotest Diagnostics Corp., Denville,NJ, USA), and 50 U/mL IL-2.

Primary cells

Peripheral blood mononuclear cells (PBMC) were isolated fromanticoagulated blood obtained from normal donors by density gra-dient centrifugation using Ficoll-Paque (Pharmacia Biotech, Upp-sala, Sweden). Approximately 80% of cells recovered were Tcells. Purified T cells (

.

98% purity) were obtained by incubatingPBMC with phycoerythrin (PE)-conjugated CD5 and sorting byflow cytometry. The T cells were activated by culturing in RPMI

1640 medium containing 15% FBS and 2.5

m

g/mL PHA (Murex,Dartford, UK) for four days.

Primary NK cells (

.

96% purity) were obtained by first deplet-ing monocytes, B cells, and T cells from PBMC with B1 (CD20,IgG2a), My4 (CD14, IgG2b), T1 (CD5, IgG2a), and T3 (CD3,IgG1) antibodies and immunomagnetic anti-IgG beads (AdvancedMagnetics, Cambridge, MA, USA). The remaining cells were in-cubated with PE-conjugated CD56 and sorted on an EPICS EliteESP flow cytometer (Coulter, Miami, FL, USA). Activated NKcells were obtained by culturing primary NK cells for 4 days inRPMI 1640 medium containing 15% FBS and 10% Lymphocult,with 750 ng/mL ionomycin for the first 16 hours.

Sheep red blood cells (SRBC) were obtained from BioWhit-taker (Walkersville, MD, USA) and were washed and diluted to5% (vol/vol) in RPMI 1640 medium containing 15% FBS. 500

m

Lof SRBC was mixed with 500

m

L of PBMC or T cells (10

3

10

6

cells) for the indicated time intervals, then the cells were placed onice and cell extracts were prepared.

Cell extracts

After appropriate stimulation, cells were placed on ice, washedonce with ice-cold phosphate-buffered saline (PBS; 137 mMNaCl, 2.7 mM KCl, 10 mM Na

2

HPO

4

, 1.8 mM KH

2

PO

4

, pH 7.4),and extracted in EBC buffer containing 10 mM Tris, pH 8.0, 0.5%NP-40, 250 mM NaCl, 10 mM sodium orthovanadate, 100

m

Mphenylmethylsulfonyl fluoride (PMSF), 1

m

g/mL leupeptin, 1

m

g/mL pepstatin, and 1

m

g/mL aprotinin. Insoluble material was re-moved by centrifugation at 12,000

g

for one minute.

Immunoprecipitations

Cell extracts (500

m

L) were incubated with 2

m

g of the indicatedprimary antibody for one hour at 4

8

C. Forty

m

L of a 50% (vol/vol)slurry of Protein A-Sepharose beads were then added, and incu-bated with rotation at 4

8

C for one hour. The beads were washedtwo times with EBC buffer and once with PBS, then boiled inSDS-PAGE loading buffer.

Western blots

Protein was resolved by SDS-PAGE, transferred to nitrocellulose,and blocked with 5% nonfat dry milk (for anti-phospho-STATwestern blots) or 5% bovine serum albumin (BSA; for other west-ern blots) in TBST (100 mM Tris, pH 8.0, 150 mM NaCl, and0.05% Tween-20). Primary antibody was diluted 1:10,000 inTBST containing 3% BSA and incubated for one hour at roomtemperature. After extensive washing, the blot was incubated withhorseradish peroxidase–conjugated secondary antibody (Calbio-chem, La Jolla, CA, USA) diluted 1:20,000 in TBST containing1% BSA for one hour at room temperature. Bound antibody wasdetected by chemiluminescence (Renaissance Kit, NEN, Boston,MA, USA). Blots were stripped by incubating in 62.5 mM Tris,pH 6.9 containing 2% SDS and 100 mM 2-mercaptoethanol (2-ME) for one hour at 65

8

C.

Antibodies and reagents

Anti-CD2 antibodies T11-1, T11-2, and T11-3 were provided byDr. Ellis Reinherz (Dana-Farber, Boston, MA, USA) [1] and usedat concentrations of 5

m

g/mL. Antibodies to the tyrosine phosphor-ylated form of STAT1 were generated as described [25]. Antibod-ies to STAT1, Jak1, Jak2, Jak3, and Tyk2 were purchased fromSanta Cruz Biotechnology (Santa Cruz, CA, USA). Antiphospho-tyrosine western blots were performed with a 1:1 mixture of PY99


211

(Santa Cruz Biotechnology) and 4G10 (generously provided byDr. Thomas Roberts, Dana-Farber Cancer Institute). Interferon(IFN)-

a

was obtained from Roche (Nutley, NJ, USA) and used at1000 U/mL, and IFN-

g

was obtained from Genzyme (Cambridge,MA, USA) and used at 500 U/mL. Cycloheximide and PP2 wereobtained from Sigma (St. Louis, MO, USA).

Nuclear Extracts

Cells were placed on ice, washed once with cold PBS, then resus-pended in 5 mL of hypotonic buffer (10 mM Tris, pH 7.4, 10 mMNaCl, 6 mM MgCl

2

) and incubated on ice for 5 minutes. Thereaf-ter, the cells were centrifuged and resuspended in 0.8 mL of hypo-tonic buffer containing 1 mM

b

ME, 100

m

M PMSF, and 1 mM so-dium orthovanadate. Cells were disrupted by shearing in a Douncehomogenizer (type b pestle, 25 strokes). Nuclei were collected bya 10-second centrifugation at 12,000

g.

The supernatant was re-moved and cleared by centrifugation at 12,000

g

for 10 minutes at4

8

C, and designated the cytoplasmic extract. The nuclear pelletwas washed once with hypotonic buffer, then resuspended in 3volumes of high-salt buffer (20 mM Hepes, pH 7.9, 420 mM NaCl,25% glycerol, 1.5 mM MgCl

2

, 0.2 mM EDTA, 1 mM 2-ME, 1 mMsodium orthovanadate, 1

m

g/mL leupeptin, 1

m

g/mL pepstatin, 1

m

g/mL aprotinin, and 100

m

M PMSF), and rocked at 4

8

C for 30minutes. Intact nuclei were removed by centrifugation at 12,000

g

for 3 minutes at 4

8

C, and the supernatant was recovered and desig-nated the nuclear extract.

Electrophoretic mobility shift assay (EMSA)

Two

m

L of nuclear extract was mixed with 1 ng

32

P-labeled oligo-nucleotide (AGCCTGATTTCCCCGAAATGACGGC and its com-plement; [26]) in 10

m

L of binding buffer (25 mM Hepes, pH 7.9,100

m

M EGTA, 200

m

M MgCl

2

, 500

m

M dithiothreitol, 1

m

g/

m

LBSA, 0.2

m

g/

m

L poly dI:dC, 1% Ficoll, and 0.1

m

g/

m

L herring tes-tis DNA). The incubation was carried out at room temperature for15 minutes. For antibody competition, antiserum was added (1:200)at the end of the binding reaction and incubated at 4

8

C for an addi-tional 15 minutes. The products of the binding reaction were thenseparated on a 4% acrylamide gel in 0.2x tris-borate/EDTA.

Reverse transcription (RT) polymerase chain reaction (PCR)

RNA was collected (RNeasy kit; Qiagen, Valencia, CA, USA) andreverse-transcribed using Superscript II RT (Life Technologies,Rockville, MD, USA). PCR was then performed to amplify inter-feron regulatory factor-1 (IRF-1) cDNA using primers for a 537-base pair (bp) fragment (sense, 5

9

-AAGGGAAATTACCTGAG-GACATCAT-3

9

; antisense, 5

9

-ATACACTGGTCTCAGAACCT-CATCTT-3

9

); to amplify c-fos cDNA using primers for a 482-bpfragment (sense, 5

9

-CTACGAGGCGTCATCCT-3

9

; antisense, 5

9

-TCTGTCTCCGCTTGGAGTGTA-3

9

); and to amplify glyceralde-hyde phosphate dehydrogenase (GAPDH) cDNA using primersfor a 226-bp fragment (sense, 5

9

-GAAGGTGAAGGTCG-GAGTC-3

9

; antisense, 5

9

-GAAGATGGTGATGGGATTC-3

9

).

Results

CD2 stimulation leads to the delayed and persistent activation of STAT1 in T cells

Stimulation of T cells through CD2 can induce activationsimilar to that induced by cytokines. To determine whether

activation of T cells through CD2 leads to similar intracellu-lar signaling events as cells exposed to cytokines, we exam-ined the tyrosine phosphorylation of STAT1 in response toCD2 stimulation. We focused on STAT1, as this transcrip-tion factor is known to become tyrosine phosphorylated in Tcells activated by mitogens [27] and in splenocytes activatedby superantigens in vivo [28], and STAT1 phosphorylationis induced by a number of cytokines that regulate T-cellfunction, including IL-2, IL-12, IL-15, IFN-

a

, and IFN-

g

.PBMC were treated with IFN-

a

or IFN-

g

, or with a pairof stimulating CD2 antibodies, T11-2 and T11-3, andSTAT1 phosphorylation on tyrosine 701 was determined byimmunoblotting with an antibody specific for phosphoryla-tion at this site [25]. Both IFN-

a

and IFN-

g

induced ty-rosine phosphorylation of STAT1

a

and STAT1

b

(Fig. 1A).As is typical for cytokine stimulation, STAT phosphoryla-tion reached maximal levels within minutes and returned tonear-basal levels within an hour. In contrast to the rapidphosphorylation of STAT1 seen following IFN treatment,CD2 stimulation led to no phosphorylation of STAT1 up to30 minutes after treatment of PBMC with these antibodies(Fig. 1B, lanes 1–3). However, by 60 minutes after treat-ment prominent tyrosine phosphorylation of both the

a

and

b

isoforms of STAT1 could be detected (Fig. 1B, lane 5).Detailed analysis of the kinetics of phosphorylation ofSTAT1 revealed that this phosphorylation reproducibly be-gan between 45 and 50 minutes following stimulation (datanot shown). Following tyrosine phosphorylation, some pro-teolytic cleavage of STAT1 occurs, which generates thelower-molecular-weight species seen [29]. While the phos-phorylation of STAT1 induced by cytokines was transient,the phosphorylation of STAT1 in response to CD2 persistedfor at least 72 hours (Fig. 1C). Neither STAT2, STAT3,STAT4, STAT5, nor STAT6 were found to be activated fol-lowing CD2 stimulation (data not shown). Identical STAT1activation was seen using purified T cells or unfractionatedPBMC (data not shown), and thus PBMC were used forsubsequent experiments. Both CD4

1

and CD8

1

T cells, pu-rified by fluorescence-activated cell sorting, showed identi-cal delayed STAT1 phosphorylation following CD2 stimu-lation (data not shown).

STATs mediate their action by dimerizing, translocatingto the nucleus, and binding to specific sequences in the pro-moters of target genes to regulate transcription. To deter-mine whether the phosphorylation of STAT1 seen afterCD2 stimulation is accompanied by nuclear translocationand DNA binding, nuclear extracts were prepared fromPBMC that had been untreated or treated with activating an-tibodies to CD2. EMSA was performed using these nuclearextracts and a radiolabeled oligonucleotide containing theSTAT binding sequence from the promoter of the IRF-1gene. Nuclear extracts from CD2-activated cells, but not un-treated cells, could form specific protein-DNA complexeswith the STAT binding sequence (complex I, Fig. 1D). Theaddition of antibodies to STAT1 led to a loss of complex I,

212


indicating that STAT1 is, in fact, present in the complex,and that STAT1 phosphorylation is accompanied by nucleartranslocation and DNA binding.

Two epitopes of CD2 have been described on resting Tcells, T11-1, which is involved in erythrocyte rosetting, and

T11-2 [1]. An additional epitope, T11-3, appears followingT-cell activation. While antibodies to these epitopes indi-vidually are unable to activate T cells, the combination ofT11-3 with either T11-1 or T11-2 can induce T-cell activa-tion. To determine whether STAT1 phosphorylation is in-

Figure 1. CD2 stimulation leads to the activation of STAT1 in PBMC. (A) PBMC from normal donors were incubated with IFN-a (lanes 1–6) or IFN-g(lanes 7–12) for the indicated times, then cell extracts were prepared, and western blots were performed with an antibody specific for the tyrosine phosphory-lated form of STAT1. (B) PBMC from normal donors were incubated with T11-2 and T11-3 for the indicated times, cell extracts were prepared, and westernblots were performed with an antibody specific for the tyrosine phosphorylated form of STAT1 (upper panel). The blot was stripped and reprobed with anantibody to total STAT1 (lower panel). (C) PBMC from normal donors were incubated with T11-2 and T11-3 for the indicated times, cell extracts were pre-pared, and western blots were performed with an antibody specific for the tyrosine phosphorylated form of STAT1. (D) EMSA was performed with nuclearextracts prepared from untreated cells (lanes 1 and 3) or cells treated with T11-2 and T 11-3 for one hour (lanes 2 and 4), using a STAT-binding probe derivedfrom the promoter of the IRF-1 gene. Antibody to STAT1 were added to the binding reaction in lanes 3 and 4.


213

duced merely by the binding of an antibody to CD2, orwhether a T cell–activating combination of antibodies is re-quired, PBMC were untreated or treated for one hour withantibodies to CD2 alone or in combination, and STAT1phosphorylation was assessed. STAT1 tyrosine phosphor-ylation was induced only when antibodies to T11-1 and/orT11-2 were combined with T11-3 (Fig. 2A, lanes 6–8), indi-cating that STAT1 phosphorylation could be induced throughCD2 only by a stimulus that leads to T-cell activation.

Although activation of CD2 triggered by monoclonal an-tibodies clearly leads to STAT activation, we wished to de-termine if a natural ligand of CD2, such as CD58, induced asimilar event. When PBMC were incubated with SRBC,which express CD58, STAT1 became phosphorylated onlyafter 60 minutes, similar to the kinetics seen when a pair ofCD2-activating antibodies was used (Fig. 2B). SRBC them-selves do not contain STAT1 (Fig. 2B, lane 1), and thus theSTAT1 phosphorylation induced by the coincubation wasclearly arising from the PBMC. These experiments indicatethat the delayed STAT1 activation induced by activating

CD2 antibodies mimics the activation seen with the naturalligand.

Lck, but not Jak, kinases mediate delayed STAT1 phosphorylation following CD2 activation

Following cytokine stimulation, cytokine receptors dimer-ize, bringing their associated Jak kinases into juxtaposition.The Jaks then tyrosine phosphorylate the receptor-kinasecomplex, allowing STATs to become recruited and phos-phorylated by the Jaks. To investigate whether Jak kinaseswere involved in the delayed activation of STAT1 follow-ing CD2 stimulation, PBMC were stimulated with CD2 forone hour, a time point at which maximal STAT1 phosphor-ylation was occurring. Cell extracts were immunoprecipi-tated with antibodies to Jak1 (Fig. 3A, lane 2), Jak2 (Fig.3B, lane 2), Jak3 (Fig. 3C, lane 2), and Tyk2 (Fig. 3D, lane2), and western blots were performed with an antibody tophosphotyrosine. Although appropriate cytokines could in-duce the phosphorylation of each kinase, none of the Jakfamily members were activated following CD2 stimulation.

Figure 2. (A) Activating combinations of anti-CD2 antibodies are necessary to induce STAT1 tyrosine phosphorylation. PBMC from normal donors wereincubated with the indicated antibodies for one hour, cell extracts were prepared, and western blots were performed with an antibody specific for the tyrosinephosphorylated form of STAT1 (upper panel). The blot was stripped and reprobed with an antibody to total STAT1 (lower panel). (B) CD58 can inducedelayed STAT1 phosphorylation in T cells. SRBC and PBMC from normal donors were cultured alone or in combination for the indicated times, after whichcell extracts were prepared, and western blots were performed with an antibody specific for the tyrosine phosphorylated form of STAT1. The blot wasstripped and reprobed with an antibody to total STAT1.

214


Thus the pathway to STAT phosphorylation following CD2activation is distinct from that used by cytokines, and is alsounlikely to involve an autocrine loop.

It is known that tyrosine kinases other than Jaks can me-diate STAT phosphorylation, including Src family kinases[30,31]. Lck, a kinase homologous to Src, plays an impor-tant role in T-cell signaling, and CD2 stimulation of PBMCleads to rapid Lck activation [32]. To investigate the role ofLck in CD2-mediated STAT activation, PBMC were pre-treated for one hour with the Lck inhibitor PP2 [33] prior toCD2 stimulation. PP2 completely abolished CD2-mediatedSTAT activation though it had no effect on the tyrosine phos-phorylation of STAT1 induced by IFN-

a

(Fig. 3E). Thus Lck

but not Jak kinases are involved in CD2-mediated STAT ac-tivation.

CD2 stimulation leads to delayed expression of STAT1-responsive genes

As a transcription factor, the key role of STAT1 is to mediatethe transcriptional activation of target genes. If the delayedphosphorylation of STAT1 is of biological significance itwould be expected that the induction of STAT1-dependenttarget genes would show delayed kinetics compared to thatinduced by cytokines. To examine this, the expression of twokey STAT1-dependent genes was determined by semiquanti-tative RT-PCR: the proto-oncogene c-fos, which plays a role

Figure 3. (A)–(D) CD2-mediated STAT1 phosphorylation is not associated with Jak kinase activation. PBMC from normal donors were left untreated, stim-ulated with T11-2 and T11-3 for one hour, or treated with the indicated cytokine for 15 minutes. Cell extracts were prepared, and immunoprecipitation wasperformed with antibodies to Jak1 (A), Jak2 (B), Jak3 (C), or Tyk2 (D), followed by western blotting with antibodies to phosphotyrosine (upper panels). Theblots were then stripped and reprobed with antibodies to each Jak family member (lower panels). (E) STAT1 phosphorylation induced through CD2, but notIFN-a, requires Lck kinase activity. PBMC from normal donors were preincubated in medium alone (lanes 1, 3, and 5) or 5 mM PP2 (lanes 2, 4, and 6), thenleft untreated (lanes 1 and 2) or stimulated with T11-2 and T11-3 for one hour (lanes 3 and 4) or with IFN-a for 15 minutes (lanes 5 and 6). Cell extracts wereprepared, and western blots were performed with an antibody specific for the tyrosine phosphorylated form of STAT1.


215

in cell cycle progression, and IRF-1, which plays a role inT-cell differentiation [34]. IFN-

g

, which leads to immediateactivation of STAT1, induces rapid induction of both c-fosand IRF-1 (Fig. 4, lanes 5–7 and 12–14). In both cases,maximal induction is seen by 15 minutes; for c-fos maximalinduction persists for at least 120 minutes, whereas for IRF-1expression declines to basal levels by 120 minutes. By con-trast, following CD2 stimulation, induction of both c-fosand IRF-1 showed delayed and steadily increasing kinetics,reflecting the time course of STAT1 activation (Fig. 4, lanes2–4 and 9–11). Thus the unique kinetics of STAT1 activa-tion following CD2 stimulation lead to a distinct pattern ofSTAT1-dependent gene expression that may have conse-quences for cellular functions.

CD2-induced STAT1 phosphorylation requires new protein synthesis, but does not involve autocrine factorsThe induction of STAT tyrosine phosphorylation followingcytokine treatment is an extremely rapid process that occurswithin seconds of the addition of a cytokine. The steps in-volved in cytokine-induced STAT activation do not requirenew protein synthesis, thus allowing a cell to respond rapidlyto changes in the external environment. The delayed phos-phorylation of STAT1 seen in response to CD2 stimulationsuggested that the mechanisms leading to STAT phosphory-lation are distinct between cytokine receptors and CD2. Weconsidered the hypothesis that the delay in STAT1 phosphor-ylation following CD2 stimulation represented the time re-quired for new protein synthesis to occur, which then led toSTAT1 phosphorylation. To test this, PBMC were incubatedin the presence or absence of the protein synthesis inhibitorcycloheximide for 60 minutes prior to stimulation with theactivating CD2 antibodies T11-2 and T11-3. Whereas cells

not treated with cycloheximide showed prominent STAT1tyrosine phosphorylation by 60 minutes of stimulation, noSTAT phosphorylation was seen at any time in the cells pre-treated with cycloheximide (Fig. 5, lanes 2 and 5), indicat-ing that new protein synthesis was required for the phosphor-ylation of STAT1 following CD2 stimulation. The absenceof STAT1 phosphorylation in the presence of cyclohexim-ide was not due to nonspecific toxicity induced by this drug,as IFN-a-induced STAT1 phosphorylation was not inhib-ited by cycloheximide (Fig. 5, lanes 3 and 6).

Given the requirement for new protein synthesis for STAT1phosphorylation, we considered the possibility that a cytokinewas produced by T cells in response to CD2 stimulation, whichled to a secondary phosphorylation of STAT1 through an auto-crine process. Since no Jak kinases were activated followingCD2 stimulation (Fig. 3), this seemed unlikely. Nonetheless, toexamine the possibility that a cytokine is secreted by cells fol-lowing CD2 stimulation, PBMC were untreated or treatedwith CD2-activating antibodies, and conditioned medium wascollected after 60 minutes. At this time prominent tyrosinephosphorylation of STAT1 can be detected with CD2 stimula-tion (Fig. 5B, lane 2). If the STAT1 phosphorylation were in-duced by a soluble cytokine, it would be expected that suffi-cient quantities would be present in the medium to induce thetyrosine phosphorylation of STAT1 when applied to naivecells, and that this phosphorylation would be seen within 15minutes, as occurs with cytokine-induced STAT1 phosphory-lation. However, conditioned medium from CD2-treated cellswas unable to induce STAT1 phosphorylation in fresh cells(Fig. 5B, lane 4), indicating that an autocrine factor is not me-diating CD2-induced STAT1 phosphorylation. It could be ar-gued that CD2 stimulation induces production not only of anautocrine factor, but also of its cognate cytokine receptor.

Figure 4. Activation of PBMC through CD2 is associated with delayed induction of STAT1-dependent genes. PBMC from normal donors were left untreated(lanes 1 and 8), or stimulated with T11-2 and T11-3 (lanes 2–4 and 9–11), or IFN-g (lanes 5–7 and 12–14) for the times indicated. RNA was harvested, andRT-PCR was performed to detect mRNA for c-fos (lanes 1–7, top panel), IRF-1 (lanes 8–14, top panel), or GAPDH (bottom panels).

216 S. Mahajan et al./Experimental Hematology 29 (2001) 209–220

However, with the sensitive techniques employed, even thelow level of STAT1 phosphorylation induced by IL-2 in theseresting lymphocytes could be detected (Fig. 6C, discussed be-low), making this extremely unlikely.

We also considered the possibility that a cytokine is beingsecreted in response to CD2 stimulation that binds rapidly tocell-surface receptors, and thus is not present in conditionedmedium in sufficient concentrations to induce STAT1 phos-phorylation in naive cells. IFN-g is the only cytokine knownto activate only STAT1, though it is conceivable that in thecontext of CD2 stimulation other cytokines could induce theactivation solely of STAT1. We employed antibodies thatcan block the interaction of IFN-a, IFN-g, or IL-2 with theirspecific cell-surface receptors to exclude the possibility thatany of these cytokines could mediate STAT1 phosphoryla-tion in response to CD2 stimulation. Incubation of PBMCwith an antibody to IFN-a, which can block IFN-a–induced

STAT1 phosphorylation (Fig. 6A, lanes 5 and 6), had no ef-fect on the phosphorylation of STAT1 induced by CD2 (Fig.6A, lanes 2 and 4). Similarly, an antibody that can block theeffect of IFN-g had no effect on STAT1 phosphorylation in-duced through CD2 (Fig. 6B, lanes 2 and 4), although it wasable to abrogate IFN-g–induced STAT1 phosphorylation(Fig. 6B, lanes 5 and 6). CD2 stimulation can eventually leadto the release of IL-2, which may contribute in part to theproliferation of T cells that occurs following engagement ofCD2 [1]. However, an antibody that blocks the activation ofSTATs in response to IL-2 (Fig. 6C, lanes 4 and 5) had noeffect on STAT1 phosphorylation induced through CD2(Fig. 6C, lanes 1 and 3). Furthermore, IL-2 induces the phos-phorylation of STAT5 in addition to STAT1, which can beseen as a band with mobility slightly slower than that ofSTAT1a (Fig. 6C, lane 4), which cross reacts with the anti-phospho-STAT1 antibody [35,36]. CD2 stimulation does

Figure 5. (A) Cycloheximide inhibits STAT1 tyrosine phosphorylation induced by activating CD2 antibodies. PBMC from normal donors were incubated forone hour in the absence (lanes 1–3) or presence (lanes 4–6) of cycloheximide (CHX; 100 mg/mL), then stimulated with T11-2 and T11-3 for one hour (lanes2 and 5) or with IFN-a for 15 minutes (lanes 3 and 6). Cell extracts were prepared, and western blots were performed with an antibody specific for the tyrosinephosphorylated form of STAT1 (upper panel). The blot was stripped and reprobed with an antibody to total STAT1 (lower panel). (B) Conditioned mediumfrom PBMC stimulated through CD2 cannot mediate STAT activation in naive cells. PBMC from a normal donor were untreated (lane 1) or treated with T11-2 and T11-3 for one hour (lane 2). The supernatants from the untreated cells (lane 3) and from the treated cells (lane 4) were then transferred to naive PBMCfrom the same donor for 15 minutes. Cell extracts were prepared at the end of each incubation, and western blots were performed with an antibody specific forthe tyrosine phosphorylated form of STAT1.

S. Mahajan et al./Experimental Hematology 29 (2001) 209–220 217

not lead to STAT5 phosphorylation (Fig. 6C, lane 1), whichalso excludes IL-2 from having a role in CD2-mediatedSTAT1 phosphorylation.

Stimulation of CD2 on NK cells fails to induce STAT1 phosphorylationIn addition to T cells, CD2 is also expressed on NK cells. Todetermine if CD2 stimulation could lead to STAT1 phosphor-

ylation in NK cells, NK cells were isolated from normal do-nors by fluorescence-activated cell sorting. CD2 expressionon the sorted NK cells was confirmed by flow cytometry,and was qualitatively similar in surface density to that on Tcells (data not shown). Despite the cell-surface expressionof CD2, STAT1 phosphorylation could not be induced inNK cells by incubation with T11-2 and T11-3 (Fig. 7A).That STAT1 phosphorylation could occur in these NK cellsunder appropriate conditions was demonstrated by the pro-nounced tyrosine phosphorylation of STAT1 induced byIFN-a (Fig. 7A, lane 3). We considered the possibility thatactivation of NK cells was required for expression of all thecomponents of the STAT activation pathway. However, evenfollowing activation of the NK cells by incubation with Lym-phocult and ionomycin, no STAT1 phosphorylation could bedetected with CD2 stimulation (Fig. 7B). Similarly, in twoNK-derived cell lines, NKL and NK3.3, CD2 stimulation didnot induce STAT1 tyrosine phosphorylation (data not shown).Thus CD2 stimulation in resting or activated NK cells, whileable to induce functional activation, does not lead to STAT1phosphorylation.

DiscussionIn the present study we have shown that activation of CD2on T cells but not NK cells leads to the delayed and pro-longed activation of STAT1 and STAT1-dependent geneexpression. STAT1 plays an important role in the immuneresponse, as mice in which the STAT1 gene is disrupted dis-play a striking immunodeficiency [19,20]. Some of this ef-fect may be due to a loss of IFN responsiveness. However,STAT1-deficient animals are extremely sensitive to oppor-tunistic infections, particularly those dependent on T-cellimmunity. This immune deficiency appears much more se-vere than that found in mice lacking IFN-g [37] or IFN re-ceptors [38,39], suggesting that impairment of T-cell activa-tion through CD2 might also contribute to the susceptibilityto infection of STAT1-null animals.

An important unanswered question arising from ourwork is the mechanism for the delay in tyrosine phosphory-lation of STAT1. Since cytokine-induced STAT phosphory-lation is a very rapid event, CD2-induced STAT1 activationis likely to occur by a distinct mechanism. One clue to thepathway by which this occurs is the fact that the proteinsynthesis inhibitor cycloheximide blocks the delayed phos-phorylation of STAT1. This raised the possibility that a cy-tokine was newly synthesized following CD2 stimulationthat then leads to STAT1 phosphorylation through an auto-crine pathway. Although it is difficult to prove the absenceof an autocrine effect, many lines of evidence argue againstsuch a mechanism. First and foremost, no Jak kinase is acti-vated at the time that maximal CD2-triggered STAT1 phos-phorylation is occurring, essentially excluding cytokine-medi-ated signaling. Second, cytokine stimulation of cells generallyleads to a transient phosphorylation of STATs that reaches

Figure 6. Antibodies that block IFN-a, IFN-g, or IL-2 activity do notinterfere with STAT1 phosphorylation induced through CD2. (A) PBMCfrom a normal donor were incubated for 15 minutes with no antibody(lanes 1, 2, and 5) or an antibody to IFN-a (lanes 3, 4, and 6), then leftuntreated (lane 1) or stimulated for 15 minutes with IFN-a (lanes 5 and 6)or for one hour with T11-2 and T11-3 (lanes 2 and 4). Cells were har-vested, extracts prepared, and western blots were performed with an anti-body to the tyrosine phosphorylated form of STAT1. (B) PBMC from anormal donor were incubated for 15 minutes with no antibody (lanes 1, 2,and 5) or an antibody to IFN-g (lanes 3, 4, and 6), then left untreated (lane1) or stimulated for 15 minutes with IFN-g (lanes 5 and 6) or for one hourwith T11-2 and T11-3 (lanes 2 and 4). Cells were harvested, extracts pre-pared, and western blots were performed with an antibody to the tyrosinephosphorylated form of STAT1. (C) PBMC from a normal donor wereincubated for 15 minutes with no antibody (lanes 1 and 4) or an antibody toIL-2 (lanes 2, 3, and 5), then stimulated for 15 minutes with IL-2 (lanes 4and 5) or for one hour with T11-2 and T11-3 (lanes 1 and 3). Cells wereharvested, extracts prepared, and western blots were performed with anantibody to the tyrosine phosphorylated form of STAT1.


maximal phosphorylation after 15 to 30 minutes, then returnsto baseline after 60 to 120 minutes. This transient STAT acti-vation in peripheral blood T cells was clearly seen followingtreatment with IFN-a or IFN-g (Fig. 1A), suggesting thatproduction of such a cytokine was unlikely to lead to the pro-longed phosphorylation seen following CD2 stimulation.Third, transfer of conditioned medium from cells treated withactivating CD2 antibodies to naive cells was unable to inducetyrosine phosphorylation of STAT1. This indicates that suffi-cient quantities of a cytokine are not present in the media ofCD2-activated cells to induce activation of STAT phospho-rylation in untreated cells. It is conceivable that CD2 stimu-lation leads to the expression of a cytokine receptor not foundon resting cells, allowing the CD2-treated cells to respond toan autocrine factor that would have no effect on resting cells.However, the high sensitivity of the antibody to tyrosine phos-phorylated STAT1 allowed the clear detection of the minimalSTAT1 phosphorylation induced by IL-2 in these resting lym-phocytes (Fig. 6C), making this possibility unlikely. Fourth,neutralizing antibodies to IL-2, IFN-a, and IFN-g, three cy-tokines with prominent roles in T-cell activation, had no effecton STAT1 phosphorylation triggered through CD2. Finally,mRNA for IFN-g, the only cytokine known to stimulate onlySTAT1 activation, could not be detected at the time of CD2-mediated STAT1 phosphorylation (data not shown).

In the absence of autocrine activation, several mecha-nisms could explain how one or more new proteins can in-duce the tyrosine phosphorylation of STAT1 following CD2stimulation. Activation of CD2 could induce the synthesis ofa tyrosine kinase that directly phosphorylates STAT1, such asa member of the Tec family of tyrosine kinases [40]. Alterna-tively, a newly synthesized kinase or docking protein couldinteract with a preexisting tyrosine kinase, thereby leading

to STAT1 phosphorylation [41]. Finally, the protein synthe-sis–dependent loss of a phosphatase or protease might allowphosphorylation of STAT1 to occur by removing the inhibi-tory limb of a regulatory network.

There is precedence for the delayed, protein synthesis–dependent tyrosine phosphorylation of STAT1 in lympho-cytes, as a similar signaling event occurs in B cells activatedby cross linking of surface IgM [42]. Although the kineticsof STAT1 activation in B cells are slightly delayed comparedto that induced through CD2 in T cells, other aspects arehighly analogous. Thus, delayed STAT1 activation may be acommon event in lymphocyte activation, and it will be im-portant to determine whether other cell-surface molecules onT cells, such as the T-cell receptor and costimulatory mole-cules, also utilize a similar mechanism.

The finding that STAT1-dependent genes such as c-fosand IRF-1 show delayed induction following CD2 stimula-tion compared to that induced by cytokines indicates that thedistinct kinetics of STAT1 activation has ramifications ingene expression. Transcriptional activation is dependent onthe presence of multiple activated transcription factors on apromoter at a given time [43]. The absence of STAT phos-phorylation during the first 45 to 60 minutes after CD2 stim-ulation, a period during which other transcription factors maybe transiently activated, may limit the genes that become acti-vated during this “immediate early” phase. Conversely, thedelayed and prolonged activation of STAT1 mediated byCD2 might allow the activation of unique genes dependent onthe presence of activated STATs as well as newly synthesizedtranscription factors that may appear during this time interval,such as c-fos and IRF-1.

Another characteristic of the phosphorylation of STAT1in response to CD2 stimulation is the prolonged time during

Figure 7. CD2 stimulation of NK cells does not lead to STAT1 tyrosine phosphorylation. (A) Resting NK cells purified from a normal donor were leftuntreated (lane 1), treated with T11-2 and T11-3 for one hour (lane 2), or treated with IFN-a for 15 minutes (lane 3). Cells were harvested, extracts prepared,and western blots were performed with an antibody to the tyrosine phosphorylated form of STAT1 (upper panel); the blot was then stripped and probed withan antibody to total STAT1 (lower panel). (B) NK cells purified from a normal donor were activated in vitro with Lymphocult and ionomycin, then leftuntreated (lane 1), treated with T11-1 and T11-3 for the indicated time (lane 2–3), or treated with IFN-a for 15 minutes (lane 4). Cells were harvested, extractsprepared, and western blots were performed with an antibody to the tyrosine phosphorylated form of STAT1 (upper panel); the blot was then stripped andprobed with an antibody to total STAT1 (lower panel).

S. Mahajan et al./Experimental Hematology 29 (2001) 209–220 219

which this phosphorylation persists, which may be impor-tant in mediating lymphocyte activation through this cell-surface molecule. Endogenous cellular inhibitors of the Jak-STAT pathway have been described that may play a role inlimiting the time and magnitude of STAT phosphorylationfollowing a given stimulus [44–46]. The prolonged phos-phorylation of STAT1 that occurs following CD2 stimula-tion may reflect the utilization of a pathway for STAT acti-vation that bypasses these negative regulators. Similarly,cross linking of CD40 on the surface of B cells also leads toa sustained activation of STAT proteins [47]. Thus, engage-ment of cell-surface molecules on lymphocytes may lead toprolonged STAT activation compared to that occurringthrough activation of cytokine receptors.

The utilization of the STAT pathway by both cytokine re-ceptors and molecules such as CD2 may allow integration of di-verse external signals. For example, it is known that in activatedT cells CD2 acts as a costimulatory molecule for IL-12–inducedproliferation and IFN-g production [48,49]. Since IL-12 in-duces STAT1 tyrosine phosphorylation in T cells differentiatingalong the Th1 pathway [27], the prominent and prolonged ty-rosine phosphorylation of STAT1 induced by CD2 stimulationmay serve to accentuate the transcription of target genes in-duced by IL-12. CD2 stimulation does not alter the response toIL-12 in NK cells (J.A.G. and J.R., unpublished data), which isconsistent with the absence of CD2-mediated STAT1 phospho-rylation in NK cells.

Although CD2 can clearly trigger the activation of T cells,there is evidence to suggest that CD2 may be involved in me-diating apoptosis in activated T cells [50–52]. Recent evi-dence indicates that STAT1 may be involved in inducingcaspases and mediating apoptosis in certain systems [53,54].Thus, while CD2-mediated STAT1 activation may play a rolein the activation of T lymphocytes, prolonged STAT1 activa-tion may also prime these cells to undergo programmed celldeath when their function is no longer required.

In conclusion, we have found that stimulation of CD2 inprimary T lymphocytes leads to a delayed and prolonged acti-vation of STAT1 and STAT1-dependent gene expression.That a similar phenomenon has been described in B lympho-cytes following stimulation of the antigen receptor [42] sug-gests that this might represent a unique mechanism to activateSTAT transcription factors during lymphocyte activation.

AcknowledgmentsPurified NK cells were generously provided by Kathy Wang. Theauthors thank Ellis Reinherz for helpful discussions. This work wassupported by NIH grant CA41619 and the Lillian N. Neri family.

References1. Meuer SC, Hussey RE, Fabbi M, et al. (1984) An alternative pathway

of T-cell activation: a functional role for the 50-kDa T11 sheep eryth-rocyte receptor protein. Cell 36:897

2. Siliciano RF, Pratt JC, Schmidt RE, Reinherz EL (1985) Activation of

cytolytic T lymphocyte and natural killer cell function through the T11sheep erythrocyte binding protein. Nature 317:428

3. Kato L, Koyanagi M, Okada H, et al. (1992) CD48 is a counter-receptorfor mouse CD2 and is involved in T cell activation. J Exp Med 176:1241

4. Hahn WC, Menu E, Bothwell ALM, Sims BJ, Bierer BE (1992) Over-lapping but nonidentical binding sites on CD2 for CD58 and a secondligand CD59. Science 256:1805

5. Tiefenthaler G, Hunig T, Dustin ML, Springer TA, Meuer SC (1987)Purified lymphocyte function-associated antigen-3 and T11 targetstructure are active in CD2-mediated T-cell stimulation. Eur J Immu-nol 17:1847

6. Howard FD, Moingeon P, Moebius U, et al. (1992) The CD3 z cyto-plasmic domain mediates CD2-induced T cell activation. J Exp Med176:139

7. Steeg C, von Bonin A, Mittrucker H-W, Malissen B, Fleischer B(1997) CD2-mediated signaling in T cells lacking the z-chain-specificimmune receptor tyrosine-based activation (ITAM) motif. Eur J Im-munol 27:2233

8. Hubert P, Debre P, Boumsell L, Bismuth G (1993) Tyrosine phosphor-ylation and association with phospholipase Cg-1 of the GAP-associ-ated 62-kD protein after CD2 stimulation of Jurkat cells. J Exp Med178:1587

9. Samelson LE, Fletcher MC, Ledbetter JA, June CH (1990) Activationof tyrosine phosphorylation in human T cells via the CD2 pathway:Regulation by the CD45 tyrosine phosphatase. J Immunol 145:2448

10. Samstag Y, Bader A, Meuer SC (1991) A serine phosphatase is in-volved in CD2-mediated activation of human T lymphocytes and natu-ral killer cells. J Immunol 147:788

11. Moingeon P, Lucich JL, McConkey DJ, et al. (1992) CD3z depen-dence of the CD2 pathway of activation in T lymphocytes and naturalkiller cells. Proc Natl Acad Sci U S A 89:1492

12. Darnell JE Jr (1997) STATs and gene regulation. Science 277:163013. Schindler C, Darnell JE Jr (1995) Transcriptional responses to

polypeptide ligands: the Jak-Stat pathway. Ann Rev Biochem 64:62114. Ihle JN, Witthuhn BA, Quelle FW, Yamamoto K, Silvennoinen O

(1995) Signaling through hematopoietic cytokine receptors. Ann RevImmunol 13:369

15. Frank DA, Greenberg ME (1996) Signal transduction pathways acti-vated by ciliary neurotrophic factor and related cytokines. Perspec De-vel Neurobiol 4:3

16. Macchi P, Villa A, Gillani S, et al. (1995) Mutations of Jak-3 gene inpatients with autosomal severe combined immune deficiency (SCID).Nature 377:65

17. Noguchi M, Yi H, Rosenblatt HM, et al. (1993) Interleukin-2 receptorg chain mutation results in X-linked severe combined immunodefi-ciency in humans. Cell 73:147

18. Russell SM, Tayebi N, Nakajima H, et al. (1995) Mutation of Jak3 in apatient with SCID: essential role of Jak3 in lymphoid development.Science 270:797

19. Durbin JE, Hackenmiller R, Simon MC, Levy DE (1996) Targeted dis-ruption of the mouse Stat1 gene results in compromised innate immu-nity to viral disease. Cell 84:443

20. Meraz MA, White JM, Sheehan KCF, et al. (1996) Targeted disruptionof the Stat1 gene in mice reveals unexpected physiologic specificity ofthe JAK-STAT signaling pathway. Cell 84:431

21. Boussiotis VA, Barber DL, Nakari T, et al. (1994) Prevention of T cellanergy by signaling through the gc chain of the IL-2 receptor. Science266:1039

22. Akbar AN, Borthwick NJ, Wickremasinghe RG, et al. (1996) Interleu-kin-2 receptor common g-chain signaling cytokines regulate activatedT cell apoptosis in response to growth factor withdrawal: selective in-duction of anti-apoptotic (bcl-2, bcl-xL) but not pro-apoptotic (bax,bcl-xS) gene expression. Eur J Immunol 26:294

23. Robertson MJ, Cochran KJ, Cameron C, Le JM, Tantravahi R, Ritz J(1996) Characterization of a cell line, NKL, derived from an aggres-sive human natural killer cell leukemia. Exp Hematol 24:406


24. Kornbluth J, Flomenberg N, Dupont B (1982) Cell surface phenotypeof a cloned line of human natural killer cells. J Immunol 129:2831

25. Frank DA, Robertson M, Bonni A, Ritz J, Greenberg ME (1995) IL-2signaling involves the phosphorylation of novel Stat proteins. ProcNatl Acad Sci U S A 92:7779

26. Bonni A, Frank DA, Schindler C, Greenberg ME (1993) Characteriza-tion of a pathway for ciliary neurotrophic factor signaling to the nu-cleus. Science 262:1575

27. Gollob JA, Murphy EA, Mahajan S, Schnipper CP, Ritz J, Frank DA(1998) Altered IL-12 responsiveness in Th1 and Th2 cells is associatedwith the differential activation of STAT5 and STAT1. Blood 91:1341

28. Gimeno R, Codony-Servat J, Plana M, Rodriguez-Sanchez JL, JuarezC (1996) Stat1 implication in the immune response to superantigens invivo. J Immunol 156:1378

29. Kim TK, Maniatis T (1996) Regulation of interferon-g-activatedSTAT1 by the ubiquitin-proteasome pathway. Science 273:1717

30. Chaturvedi P, Reddy MV, Reddy EP (1998) Src kinases and not JAKsactivate STATs during IL-3 induced myeloid cell proliferation. Onco-gene 16:1749

31. Garcia R, Jove R (1998) Activation of STAT transcription factors inoncogenic tyrosine kinase signaling. J Biomed Sci 5:79

32. Eljaafari A, Soula M, Dorval I, et al. (1994) Contribution of tyrosinekinases to the selective orientation of human CD41 bifunctionalcloned T cells toward proliferation or cytolytic function. J Immunol153:3882

33. Hanke JH, Gardner JP, Dow RL, et al. (1996) Discovery of a novel, potent,and Src family–selective tyrosine kinase inhibitor. J Biol Chem 271:695

34. Harada H, Taniguchi T, Tanaka N (1998) The role of interferon regu-latory factors in the interferon system and cell growth control. Bio-chimie 80:641

35. Frank DA, Varticovski L (1996) BCR/abl leads to the constitutive acti-vation of Stat proteins, and shares an epitope with tyrosine phosphory-lated Stats. Leukemia 10:1724

36. Sattler M, Durstin MA, Frank DA, et al. (1995) The thrombopoietinreceptor c-MPL activates JAK2 and TYK2 tyrosine kinases. Exp He-matol 23:1040

37. Dalton DK, Pitts-Meek S, Keshav S, Figari IS, Bradley A, Stewart TA(1993) Multiple defects of immune cell function in mice with dis-rupted interferon-g genes. Science 259:1739

38. Muller U, Steinhoff U, Reis LFL, et al. (1994) Functional role of type Iand type II interferons in antiviral defense. Science 264:1918

39. Huang S, Hendriks W, Althage A, et al. (1993) Immune response inmice that lack the interferon-g receptor. Science 259:1742

40. Saharinen P, Ekman N, Sarvas K, Parker P, Alitalo K, Silvennoinen O

(1997) The Bmx tyrosine kinase induces activation of the Stat signal-ing pathway, which is specifically inhibited by protein kinase Cd.Blood 90:4341

41. Yamashita Y, Watanabe S, Miyazato A, et al. (1998) Tec and Jak2 co-operate to mediate cytokine-driven activation of c-fos transcription.Blood 91:1496

42. Karras JG, Huo L, Wang ZH, Frank DA, Zimmet JM, Rothstein TL(1996) Delayed tyrosine phosphorylation and nuclear expression ofStat1 following antigen receptor stimulation of lymphocytes. J Immu-nol 157:2299

43. Bonni A, Ginty DD, Dudek H, Greenberg ME (1995) Serine 133–phosphorylated CREB induces transcription via a cooperative mecha-nism that may confer specificity to neurotrophin signals. Mol CellNeurosci 6:168

44. Starr R, Willson TA, Viney EM, et al. (1997) A family of cytokine-inducible inhibitors of signaling. Nature 387:917

45. Endo TA, Masuhara M, Yokouchi M, et al. (1997) A new protein con-taining an SH2 domain that inhibits JAK kinases. Nature 387:921

46. Naka T, Narazaki M, Hirata M, et al. (1997) Structure and function ofa new STAT-induced STAT inhibitor. Nature 387:924

47. Karras JG, Wang Z, Huo L, Frank DA, Rothstein TL (1997) Inductionof STAT protein signaling through the CD40 receptor in B lympho-cytes: distinct STAT activation following surface Ig and CD40 recep-tor engagement. J Immunol 159:4350

48. Gollob JA, Li J, Kawasaki H, et al. (1996) Molecular interaction be-tween CD58 and CD2 counter-receptors mediates the ability of mono-cytes to augment T cell activation by IL-12. J Immunol 157:1886

49. Gollob JA, Li J, Reinherz EL, Ritz J (1995) CD2 regulates responsive-ness of activated T cells to interleukin-12. J Exp Med 182:721

50. Dumont C, Deas O, Mollereau B, et al. (1998) Potent apoptotic signal-ing and subsequent unresponsiveness induced by a single CD2 mAb(BTI-322) in activated human peripheral T cells. J Immunol 160:3797

51. Fournel S, Robinet E, Bonnefoy-Berard N, et al. (1998) A noncomito-genic CD2R monoclonal antibody induces apoptosis of activated Tcells by a CD95/CD95-L-dependent pathway. J Immunol 160:4313

52. Mollereau B, Deckert M, Deas O, et al. (1996) CD2-induced apoptosisin activated human peripheral T cells: a Fas-independent pathway thatrequires early protein tyrosine phosphorylation. J Immunol 156:3184

53. Chin YE, Kitagawa M, Kuida K, Flavell RA, Fu XY (1997) Activationof the STAT signaling pathway can cause expression of caspase 1 andapoptosis. Mol Cell Biol 17:5328

54. Kumar A, Commane M, Flickinger TW, Horvath CM, Stark GR(1997) Defective TNF-a–induced apoptosis in STAT1-null cells dueto low constitutive levels of caspases. Science 278:1630

CD2 stimulation leads to the delayed and prolonged activation of STAT1 in T cells but not NK cells

Documents

Transcript of CD2 stimulation leads to the delayed and prolonged activation of STAT1 in T cells but not NK cells