antimicrobial susceptibility and esbl prevalence in clinical ...

ANTIMICROBIAL SUSCEPTIBILITY AND ESBL

PREVALENCE IN CLINICAL PATHOGENIC

PSEUDOMONAS SPECIES

MANZOOR AHMAD

DEPARTMENT OF BIOCHEMISTRY

FACULTY OF HEALTH SCIENCES

HAZARA UNIVERSITY, MANSEHRA

PAKISTAN

2016

ANTIMICROBIAL SUSCEPTIBILITY AND ESBL

PREVALENCE IN CLINICAL PATHOGENIC

PSEUDOMONAS SPECIES

A thesis submitted in partial fulfillment for the award of the Degree of Doctor of

Philosophy (Ph.D) in Biochemistry

SUBMITTED BY: Manzoor Ahmad

Ph.D Scholar

SUPERVISOR : Prof. Dr. Mukhtiar Hassan

Dean, Faculty of Health Sciences

Chairmain Department of Biochemistry

Hazara University, Mansehra

CO-SUPERVISOR Prof. Dr. Jawad Ahmad

Director, Institute of Basic Medical

Sciences Khyber Medical University,

Peshawar

DEPARTMENT OF BIOCHEMISTRY

FACULTY OF HEALTH SCIENCES

HAZARA UNIVERSITY, MANSEHRA

2016

IN THE NAME OF ALLAH

THE MOST BENEFICENT, THE MOST

MERCIFUL

DEDICATION

THIS THESIS IS DEDICATED TO MY

BELOVED PARENTS AND SIBLINGS

FOR ENCOURAGING ME TO EXCEL

EVERY STEP OF MY LIFE.

i

ACKNOWLEDGEMENTS

All praises to the Almighty Allah, the most Beneficent and the Most Merciful. Who is the entire

source of knowledge to mankind. Innumerable thanks to Almighty Allah, the most Merciful,

who bestowed his mercy upon me and gave me vision, wisdom and courage to complete this

dissertation. All my tributes are to the Holy Prophet Hazrat Muhammad (PBUH), Who guided

his Ummah to seek knowledge from cradle to grave and enabled me to win honor of life.

I feel highly privileged in taking this opportunity to express sincerest thanks to my esteemed

Supervisor, Prof. Dr. Mukhtiar Hassan Dean, faculty of Health Sciences / Chairman,

Department of Biochemistry, Hazara University Mansehra, Pakistan for his keen supervision,

guidance, suggestions, friendly co-operation and for kindly attitude from the beginning to the

end of this research. I am really thankful to my Co-Supervisor, Prof. Dr. Jawad Ahmad

Director, Institute of Basics Medical Sciences, Khyber Medical University Peshawar, Pakistan,

for his encouragement, precious suggestions in data analysis and corrections in manuscript

despite his busy routine.

I am grateful to Habib Ullah Khan in-charge PCR section, Pathology Department Khyber

Teaching Hospital Peshawar for his cooperation, providing all privileges during my research

work. Anwar Khalid deserves special mention for his brotherly and friendly co-operation,

support and useful comments to improve my thesis and for help at every step throughout the

work. I would like to mention Dr. Faheem Jan, Ghulam Ishaq, Muhammad Ibrar Khan, Hazrat

Usman and Baber ali for their brotherly and friendly co-operation, valuable support and

encouragement for precious company during the course of this study.

My parents played a very important role in the initiation and then in the completion of this task.

I owe special gratitude to my all family members, brothers, sisters and my wife for persistent

and unconditional support in all my undertakings and scholastics. Otherwise, this would not

have been possible without the help and support of all these people who directly and indirectly

contributed a lot in my academic pursuits.

Last but not the least I am pleased to mention the financial support of the Higher

Education Commission of Pakistan for my Ph.D under indigenous Scholarship

Scheme.

Manzoor Ahmad

ii

ABBREVIATIONS

µg/ml Microgram per Milli Litre

10X 10 Times

3G 3rd

Generations

AFIP Armed Forces Institute of Pathology

AK Amikacin

AMC Augmentin (Amoxycillin and Clavulanic acid)

AML Amoxicillin

AMP Ampicillin

API Analytical Profile Index

API’s Active Pharmaceutical Ingredients

ATCC American Type Culture Colonies

ATM Aztreonam

BD Bacton Dickison

BHI Brain Heart Infusion

Bla Beta Lactamase

β-lactams Beta Lactams

bp Base Pair

Ca + + Calcium Ion

CA Clavulanic Acid

iii

CAZ Ceftazidime

CDC-NHSN Centre for Disease Control and Prevention-National Health Safety

Network

CDST Combination Disc Synergy Test

CEC Cefaclor

CEF Cefepime

CFM Cefotaxime

CFU Colony Forming Unit

CI Confidence Interval

CIP Ciprofloxacin

CLED Cystine Lactose Electrolyte Deficient

CLR Clarithromycine

CLSI Clinical and Laboratory Standards Institute

CMY Cephamycins

CN Gentamycine

CRA Congo Red Agar

CRO Ceftriaxone

CTX-M Cefotaxime Hydrolyzing Capabilities

DD Disc Diffusion

DDDT Double Disc Diffusion Test

DDS Double Disc Synergy Test

iv

DHA Dhahran Hospital

DMSO Dimethyl Sulfo Oxide

DNA Deoxyribonucleic Acid

dNTP’s Deoxyribonucleotide Triphosphate

DO Doxycycline

E test Epsilon test

E Erythromycine

E.coli Escherichia coli

EDTA Ethylene- Diamine Tetra Acetic Acid

ELISA Enzyme-Linked Immunosorbent Assay

EMB Eosin-Methylene Blue

EPS Extracellular Polymeric Substance

ESBL Extended Spectrum Beta-lactamase

ESCs Extended Spectrum Cephalosporins

FEP Cefepime

g Gram

GES Guiana Extended Spectrum

GNR Gram Negative Rods

GP/ GN Gram Positive and Negative

GTI Gastro Intestinal Tract Infection

http://en.wikipedia.org/wiki/Extracellular_polymeric_substance

v

H2S Hydrogen Sulphide

HMC Hayatabad Medical Complex

HVS High Vaginal Swab

IBGE Institute of Biotechnology and Genetic Engineering

ICU Intensive Care Unit

IMP Imipenemase

IPM Imipenem

IRT Inhibitor-Resistant TEM

K.pneumoniae Klebsiella pneumoniae

Kb Kilobyte

KPK Khyber Pakhtunkhwa

KTH Khyber Teaching Hospital

LB Luria-Bertanii broth

LFX Enoxacin

LRH Lady Reading Hospital

MBL Metallo β-lactamase

MDR Multi Drug Resistance

MEM Meropenem

Mg ++ Magnesium Ion

mg Milligram

vi

MHA Mueller Hinton Agar

MIC Minimum Inhibitory Concentration

mm Millimeter

mRNA Messenger Ribonucleic Acid

MRSA Methecillin Resistant Staphylococcus aureus

MXF Moxifloxacin

NaCl Sodium Chloride

NAG N-acetylglucosamine

NAM N-acetylmuramic Acid

NCCLS National Committee for Clinical Laboratory Standards

NDM New Dehli Metallo Beta Lactamase

NLF Non Lactose Fermenter

nm Nanometre

oC Degree Centigrade

OD Optical Density

OM Outer Membrane

OPD Out Patient Department

OXA Oxacillin

P.aerugenosa Pseudomonas aerugenosa

PABL Plasmid-mediated AmpC β-lactamases

vii

PBP Penicillin Binding Protein

PBS Phosphate Buffer Saline

PCR Polymerase Chain Reaction

PER Pseudomonas Extended Resistant

PFGE Pulsed-field Gel Electrophoresis

PIP/TAZ Piperacillin/Tazobactam

Psi Pounds/inch2

QC Quality Control

RFLP Restriction Fragment Length Polymorphism

Rpm Revolution per Minute

S Svedberg Unit

S.aureus Staphylococcus aureus

S.D Standard Deviation

SCF Cefoperazone/Sulbactum

SHV Sulfa Hydryl Variables

SMART Surveillance Monitoring Programme of Antimicrobial Resistance

Trends

Spp Species

SPX Sparfloxacin

TAE Tris base Acetic acid and EDTA

Taq Thermus Aquaticus

viii

TEM Temoneira

TM Tube Method

TNE Tris, NaCl and EDTA

tRNA Transfer Ribonucleic acid

TS Throat Swab

TSA Tryptic Soya Agar

TSB Tryptic Soya Broth

TSI Triple Sugar Iron

UK United Kingdom

USA United State of America

UTI Urinary Tract Infection

UV light Ultra Violet Light

VIM Verona Integron-Encoded Metallo β-Lactamase

VRSA Vancomycin Resistant Staphylococcus aureus

WHO World Health Organization

WHONET Information System Supported by World Health Organization.

XDR Extensive Drug Resistance

ix

TABLE OF CONTENTS

ACKNOWLEDGEMENTS ........................................................................................ i

ABBREVIATIONS .................................................................................................... ii

LIST OF TABLES ................................................................................................... xv

LIST OF FIGURES ................................................................................................ xvii

ABSTRACT ......................................................................................................... xviii

CHAPTER 1 ............................................................................................................... 1

1 INTRODUCTION .............................................................................................. 1

1.1 Antibiotics ....................................................................................................... 1

1.1.1 Mechanism of Action of Antibiotics ........................................................ 2

1.1.2 Resistance to Antibiotics.......................................................................... 5

1.1.3 Mechanism of Bacterial Resistance to Different Antibiotics .................. 7

1.1.4 Resistance based on Altered Receptors for Drug .................................... 7

1.1.5 Destruction or Inactivation of Drug ......................................................... 7

1.1.6 A Decrease in the Concentration of Drug that Reaches the Receptors .... 8

1.1.7 Faliure to Metabolize the Drug ................................................................ 8

1.2 β-Lactam Antibiotics ....................................................................................... 8

1.2.1 Extended Spectrum β-lactamase .............................................................. 9

1.2.2 Emergence of Drug Resistance ................................................................ 9

1.2.3 Mechanism of Resistance to Antimicrobials ......................................... 10

1.2.3.1 Efflux of Antibiotics from Bacteria ................................................... 10

1.2.3.2 Outer Membrane Permeability ........................................................... 10

1.2.3.3 Target Modification............................................................................ 11

1.2.3.4 Enzymatic Modification of the Antibiotic ......................................... 11

1.2.4 The Achievement and Spread of Antibiotic Resistance in Bacteria ...... 12

1.3 β-lactams ....................................................................................................... 12

x

1.4 β- lactamase Enzymes ................................................................................... 13

1.4.1 Extended Spectrum Cephalosporin’s (ESCs) ........................................ 15

1.4.2 Extended Spectrum β- lactamases (ESBLs) .......................................... 15

1.4.3 Mechanism of Action ............................................................................. 15

1.4.4 Synthesis and Mode of Transfer ............................................................ 16

1.5 Evolution and Epidemiology ......................................................................... 16

1.6 Classification of ESBL’s ............................................................................... 20

1.7 Functional Classification ............................................................................... 20

1.7.1 Group 1 .................................................................................................. 20

1.7.2 Group 2 .................................................................................................. 20

1.7.3 Group 3 .................................................................................................. 22

1.7.4 Group 4 .................................................................................................. 22

1.8 Molecular Classification of β-lactamases ..................................................... 22

1.8.1 ESBLs Encoding Genes ......................................................................... 22

1.8.2 TEM and SHV β-lactamases .................................................................. 22

1.8.3 CTX-M β-lactamases ............................................................................. 23

1.9 Inhibitor-Resistant β-lactamases ................................................................... 24

1.10 Organism Responsible for ESBL .................................................................. 25

1.10.1 Risk Groups ........................................................................................... 25

1.10.2 Consider Screening all Admissions to High Risk Units. ....................... 25

High risk units include:......................................................................................... 25

1.11 ESBL Carriage .............................................................................................. 25

1.12 Reservoir ....................................................................................................... 26

1.13 Transmission ................................................................................................. 26

1.14 Preventions .................................................................................................... 27

1.15 Patient Placement .......................................................................................... 27

xi

1.16 Laboratory Procedures .................................................................................. 27

1.17 Screening Test for ESBLs ............................................................................. 28

1.17.1 Disc Diffusion Method .......................................................................... 28

1.17.2 Minimum Inhibitory Concentration (MIC) ............................................ 28

1.17.3 Confirmatory Tests for ESBLs .............................................................. 28

1.17.4 Modified Double Disc Diffusion Test ................................................... 29

1.17.4.1 Disc Replacement Method for ESBL Confirmation .......................... 30

1.17.4.2 Phenotypic Confirmatory Test with Combination Disc ..................... 30

1.17.5 ESBL Vitek Cards.................................................................................. 30

1.17.6 BD Phonex Programmed Microbiology System ................................... 31

1.17.7 The E test Method (Epsilon test) ........................................................... 31

1.17.8 Genotypic Detection .............................................................................. 32

1.18 Treatment ...................................................................................................... 32

1.18.1 β-lactam /β-lactamases Inhibitors .......................................................... 33

1.18.2 Carbanepems .......................................................................................... 33

1.18.3 Quinolones ............................................................................................. 33

1.18.4 Aminoglycosides.................................................................................... 33

1.18.5 Tigecycline ............................................................................................. 33

1.18.6 Colistin ................................................................................................... 34

1.19 Pseudomonas Spp. ........................................................................................ 34

1.20 Biofilm Formation ......................................................................................... 35

1.20.1 Development of Biofilm ........................................................................ 36

1.20.2 Extracellular Matrix ............................................................................... 37

1.20.3 Biofilms and Infectious Diseases ........................................................... 37

1.21 Aims and Objectives ..................................................................................... 38

CHAPTER 2 ............................................................................................................. 39

xii

2 LITERATURE REVIEW ................................................................................. 39

CHAPTER 3 ............................................................................................................. 52

3 MATERIALS AND METHODS ...................................................................... 52

3.1 Collection of Samples (Bacterial Isolates). ................................................... 52

3.1.1 Collection of Pus .................................................................................... 53

3.1.2 Collection of Blood ................................................................................ 53

3.1.3 Collection of Urine Specimen ................................................................ 53

3.2 Inoculation of Specimens (Pathogenic Bacteria) .......................................... 53

3.3 Composition of Reagents/Culture Media and their Preparation ................... 54

3.3.1 Blood Agar Base (Facklam, 1980)........................................................ 54

3.3.2 Nutrient Agar (Brit. Pharma) ................................................................. 55

3.3.3 CLED Agar (Cystine Lactose Electrolyte Deficient) ............................ 55

3.3.4 MacConkey Agar (Eur. Phar, 2002) ...................................................... 56

3.3.5 Mueller Hinton Agar (MHA)(CLSI, 2006) ........................................... 57

3.3.6 Tryptic Soya Agar .................................................................................. 58

3.4 Isolation and Identification of Bacteria ......................................................... 58

3.4.1 Grams Staining....................................................................................... 58

3.4.2 Preservation and Maintenance of Bacterial Isolates. ............................. 59

3.4.3 Biochemical Identification ..................................................................... 60

3.5 Antimicrobial Susceptibility Protocol (Method) ........................................... 62

3.5.1 Disc Diffusion Method by Kirby-Bauer Sensitivity Testing ................. 62

3.5.2 Determination of Minimal Inhibitory Concentration (MIC) ................. 63

3.5.3 Testing Isolates using Agar Dilution Method ........................................ 66

3.6 Phenotypic Detection of ESBL ..................................................................... 69

3.6.1 Inoculum and Inoculation ...................................................................... 69

3.6.2 Screening of Isolates for ESBLs ............................................................ 70

xiii

3.6.2.1 Synergy Disc Diffusion Method ........................................................ 70

3.6.2.2 ESBLs Phenotypic Confirmatory Test ............................................... 70

3.6.2.3 Combination Disc Synergy Test (CDST)........................................... 70

3.7 Detection of Biofilm Formation .................................................................... 70

3.7.1 Biofilm Assay ........................................................................................ 71

3.7.2 Crystal Violet Staining ........................................................................... 71

3.7.3 Safranin Staining .................................................................................... 72

3.8 Molecular Analysis Detecting β-lactamase Genes TEM, SHV and CTX-M 73

3.8.1 Extraction of DNA from Bacterial Isolate. ............................................ 73

3.8.2 Amplification of DNA ........................................................................... 73

3.8.3 Gel Electrophoresis ................................................................................ 75

CHAPTER 4 ............................................................................................................. 76

4 RESULTS ......................................................................................................... 76

4.1 Prevalence Rate of Pseudomonas Spp. Isolates ............................................ 76

4.2 Frequency Distribution of Pseudomonas spp within Hospitals .................... 77

4.3 Frequency Distribution of Specimens in Different Sources and Gender wise:.

....................................................................................................................... 77

4.4 Susceptibility Pattern of Pseudomonas Spp to Various Antimicrobial Agents.

....................................................................................................................... 79

4.5 Susceptibility Pattern of Strain in Indoor and Outdoor Patients ................... 81

4.6 Susceptibility Pattern of Pseudomonas spp. to different Agents from 2010-

2014 ....................................................................................................................... 90

4.7 Minimum inhibitory concentrations (MIC) ......................................... 92

4.8 Prevalence of ESBLs ..................................................................................... 93

4.9 ESBL and Non-ESBL producing Pseudomonas spp. ( Hospital-wise). .... 106

4.10 Biofilm Formation ....................................................................................... 107

4.10.1 Detection of Biofilm using Microtiter Plate Biofilm Assay ................ 109

xiv

4.10.2 Dilution of Stain Inoculated in Microtiter Tray Biofilm Assay ........... 112

4.11 Genes Encoding ESBL’s ............................................................................. 112

CHAPTER 5 ........................................................................................................... 114

5 DISCUSSION ................................................................................................. 114

5.1 Conclusions and Recommendations............................................................ 124

REFERENCES ....................................................................................................... 127

Publication from Thesis ......................................................................................... 157

xv

LIST OF TABLES

Table 1-1: Evolution of Functional Classification of β lactamases ............................. 20

Table 1-2: Functional Classification of Group 2b ....................................................... 21

Table 3-1: Specimens and Culture Media for Isolation Of Bacteria. .......................... 54

Table 3-2: Constituents of Blood Agar Base ............................................................... 54

Table 3-3: Constituents of Nutrient Agar .................................................................... 55

Table 3-4: Constituents of CLED ................................................................................ 56

Table 3-5: Constituents of MacConkey Agar .............................................................. 57

Table 3-6: Constituents of Mueller Hinton Agar ......................................................... 57

Table 3-7: Constituents of Tryptic Soya Agar ............................................................. 58

Table 3-8: Identification Chart for Pseudomonas spp. on the basis of Biochemical

Reactions ...................................................................................................................... 60

Table 3-9: Antibiotics and their Specification. ............................................................ 64

Table 3-10: Antibiotic Dilution Scheme Volume of Stock ......................................... 65

Table 3-11: Zone Diameter Interpretive Criteria in mm for Pseudomonas spp. against

different Antimicrobial Agents. (CLSI, 2010 & 2011) ................................................ 67

Table 3-12: MIC’s Break Points for agar Dilution (Interpretive Criteria ug/ml) for

Pseudomonas spp. against different Antimicrobial Agents. (CLSI 2010 & 2011) ..... 68

Table 3-13: List of Antimicrobial Agent Solvents ...................................................... 69

Table 3-14: Isolate Allocation for Biofilm Assay on Micro-Titer Plate. .................... 72

Table 3-15: Primer Sequence and PCR Condition to detect β- lactamase Genes ........ 74

Table 4-1: Prevalence Rate of Pseudomonas spp. Isolates from Different Specimen. 76

Table 4-2: Frequency of Pseudomonas spp in Different Hospitals. ........................... 77

Table 4-3: Gender-wise distribution of Infections caused by Pseudomonas spp among

Different Age Groups. ................................................................................................. 78

Table 4-4: Cumulative Susceptibility Pattern of Pseudomonas spp to various

Antimicrobial Agents. .................................................................................................. 80

xvi

Table 4-5: Comparative Susceptibility Pattern between Hospitalized and Out-door

Patients. ........................................................................................................................ 83

Table 4-6: Comparative Correlation and Significance Analysis of different Drugs

Susceptibility against Pseudomonas Spp in Hospitalized and Outdoor Patients ......... 84

Table 4-7: Year wise Susceptibility Pattern (Sensitivity) of Pseudomonas spp to

different Antibiotics. .................................................................................................... 91

Table 4-8: MIC’s against the Tested Strains (MIC 50 and MIC 90) .............................. 93

Table 4-9: Prevalence ESBL in Clinically Pathogenic Pseudomonas spp. ................. 93

Table 4-10: In vitro % Susceptibility of ESBL and non-ESBL Produced by

Pseudomonas spp ......................................................................................................... 95

Table 4-11: Comparative Correlation and Significant Analysis of different Drugs

against ESBL Producing Pseudomonas Spp................................................................ 96

Table 4-12: Hospital-wise Distribution of ESBL and Non-ESBL Producing

Pseudomonas spp.: ..................................................................................................... 106

Table 4-13: Prevalence of ESBL in different (wards) for the Period 2010- 2014. .... 106

Table 4-14: Univariate and Multivariate Analysis of ESBL and Non ESBL among

Inpatients and Out-door Patients. ............................................................................... 108

Table 4-15: Biofilm Production of Pseudomonas spp. and three Controls using Congo

Red Agar Media. ........................................................................................................ 109

Table 4-16: Biofilm Production of Pseudomonas spp and Controls using Crystal

Violet and Safranin Stained Biofilm Assays ............................................................. 111

xvii

LIST OF FIGURES

Figure 1-1: Mechanism of Drug Resistance ............................................................... 11

Figure 1-2: Showing β- Lactam Ring Destruction by β- lactamases Enzyme ............. 13

Figure 1-3: Structure of β-lactamase Enzyme ............................................................. 14

Figure 1-4: Showing Double Disc Synergy Test ......................................................... 29

Figure 1-5: Development of Biofilm Formation .......................................................... 36

Figure 4-1: Gender-wise Distribution of Male and Female among different age

Groups. ......................................................................................................................... 78

Figure 4-2: Cumulative Susceptibility Pattern of Pseudomonas spp to various

Antimicrobial Agents ................................................................................................... 81

Figure 4-3: Graphical Representation of Statistical CI values of the Susceptibility

Results .......................................................................................................................... 85

Figure 4-4: Graphical Representation of Statistical CI values of the ESBLs Results . 97

Figure 4-5: Genes Encoding ESBL's (TEM, SHV and CTX-M). ............................ 113

xviii

ABSTRACT

The current study was conducted from 2010 to 2014 in Khyber Teaching Hospital,

Peshawar, Pakistan to determine the Susceptibility of Pseudomonas spp. to different

chemotherapeutic agents and prevalence of extended spectrum β-lactamase. The

samples were taken from three main tertiary care hospitals of Peshawar, Pakistan.

During the study period, 3450 specimens including pus, urine, blood and burns etc.

were collected and subjected to culture and sensitivity as per standard protocols.

Samples were isolated and identified on the basis of standard biochemical techniques.

Antimicrobial susceptibility was determined by modified Kirby-Bauer method and

Minimum Inhibitory Concentrations were followed per the guidelines set by CLSI.

The ratio of male to female under the study was 1:1.4. The most productive

antimicrobial agent was class carbapenem (imipenem and meronem) against

Pseudomonas spp. among the β-lactam agents whose susceptibility was 282 (84.43%)

and 304 (91.02%) respectively. The resistance rate was highest for Tetracycline

followed by Penicillin and the isolates were co-resistant to macrolides and

flouroquinolones and a moderate activity was demonstrated to the Cephalosporins. A

total of 232 isolates were recovered from hospitalized and 102 from OPD patients.

Statistically significant values were obtained for 17 out of 20 antibiotics, as there is a

remarkable variation in susceptibility pattern of OPD and Hospitalized isolates. In

class carbapenems: imipenem and meronem showed 81.47%; 91.18% and 88.79%;

96.08% activity rate for indoor and outdoor strains respectively. Only tetracycline had

a diminished rate for both in and out door (5.17% and 21.57%) isolates respectively.

In-patient isolates showed higher rates of resistance to most tested antibiotics,

compared with outpatient isolates.

Overall, there was a moderate decrease in susceptibility rate of Pseudomonas spp. to

the antibiotic analyzed over the last five years of the study. The MIC50 & 90 (µg/ml) of

imipenem against Pseudomonas spp. was <1 and < 4, respectively. While results

obtained by agar dilution method demonstrated the lowest MICs values with

meropenem for Pseudomonas spp. MICs observed for carbapenems as compared to

the other antimicrobials tested were higher.

xix

Initial screening and phenotypic confirmatory test for ESBL detection was carried out

according to the CLSI protocols. Production of ESBLs was observed in 148 (44.32%)

of the isolates and the remaining 186 (55.80%) were non-ESBL producers.

Statistically, a significant difference was found in susceptibility of the Pseudomonas

spp. to carpenems, quinolones and β-lactam/β-lacatamase inhibitors, among the ESBL

producers.

The resistance conferred by ESBL’s producing pseudomonas spp. to cephalosporin’s

(CEC, CAZ, CRO and CFP) was 14.2%, 20.3%, 14.3% and 22.3% respectively,

contrary to the non–ESBL’s, where they were comparably sensitive to 3rd

and 4th

generation cephalosporins. Treatment with third generation cephalosporin

(ceftriaxone) is the only risk factor being associated with ESBL infections.

β-lactamases of these strains analyzed genotypically by PCR with a series of primers

specific for tem, shv and ctx-M genes. 100 samples were selected for PCR to detect

tem, shv and ctx-M genes among the ESBL positive Pseudomonas spp. strains. A high

proportion of isolates were confirmed for ctx-M gene which encodes a total of 48

strains followed by tem 38 and then 14 of them were shv genes.

1

CHAPTER 1

1 INTRODUCTION

1.1 Antibiotics

The term antibiotic usually describes the chemical product that produced by microbes

to destroy or prevent the development of another microorganism. The term

antibacterial implies to the agents synthetically prepared (sulfa drugs) as well as to

those natural antibiotics turn out by microorganisms and can be bactericidal or

bacteriostatic (Neu, 1994). The word antibiotic is Greek in origin, which means

―against life‖. French researcher Paul Vuillemin, in the late 19th

century, who worked

under the supervision of Louis Pasture, described ―antibiotic‖ is a substance isolated a

few years back from Pseudomonas, called pyocyanin which suppressed or even stop

the multiplication of bacterial growth in vitro. However, it was too lethal to be used

for therapeutic purposes. Currently, the term antibiotic of Pual’s is still in use and

nowadays the chemical product or derivatives of certain microorganism that are

inhibiting other organisms are reflected to be antibiotics (Alcamo, 1994).

The research work of the German physician Paul Ehrlich (1854 -1915) is considered

as the start of contemporary era of chemotherapy. Mainly his experimentation was

based on to explore the dyes which may possibly eradicate the pathogen. He found a

dye trypan red in 1904 which had a dynamic activity against the trypanasome, causing

African sleeping sickness. In the upcoming years, Paul Ehrlich and his co-researchers

originated a chemical product, arsphenamine, which was inhibitory to syphillis

spirochetes. In 1927, Gerhard Domagk (who was awarded for this work with Nobel

Prize in 1927), a German researcher found a dye Prontosil Red, which was used

against Staphylococcus & Streptococcus. In those days when the findings of Gerhard

Domagk were published, a year later two French Scientist, Jacques and Therese

proved that dye (Prontosil Red) was altered into another compound sulfanilamide in

vivo which was the vital factor.

Alexander, (1927) was first to discover antibiotic penicillin. Later, Howard Florey and

Norman Heatly isolated penicillin from penicillium and tested against Streptococci &

2

Staphylococci and for the discovery and production of penicillin they were awarded

Nobel Prize in 1945.

The exploration for novel antibiotics was motivated after penicillin’s discovery. In

1944, Selman Walsman discovered streptomycin and by 1953 neomycin, teramycin,

tetracycline and chloramphenicol were isolated, produced by microorganisms

(Prescott, 2003).

The discovery of novel and more powerful drugs and development of

chemotherapeutic agents have changed recent medication and significantly lessened

human pain (Prescott, Harley et al., 2002).

In early 1940’s, antibiotics were emerged and are considered a landmark in medical

field. The rate of morbidity and mortality from bacterial infections had been

intensively reduced in the so-called antibiotic period and greatly accountable for an

increase in average life expectancy of human beings in advance world (Bartlett and

Froggat, 1995).

1.1.1 Mechanism of Action of Antibiotics

Penicillin’s, carbapenems & cephalosporin’s, are the β-lactam antibiotics that inhibits

the growth of bacteria by interfering with bacterial cell wall synthesis at a specific

step. Peptidoglycan a cross-linked polymer, comprised of polysaccharides (N-acetyl

muramic acid and N-acetyl glucosamine) and five amino acids’ polypeptides is linked

to the N-acetylmuramic acid are the components of Cell wall. Β-lactam antibiotics

covalently attached to PBPs at the active site and there by prevent the transpeptidation

by blocking the synthesis of peptidoglycan because the weaker cell wall can not

maintain the integrity of cell and bacterial death occur.

Carbapenems have bactericidal activity against all pathogens except Listeria

monocytogenes which had a bacteriostatic action. Bacterial cell wall synthesis is

blocked by carbapenems similar to other β-lactams. Resistance flows transversely

during modification in PBP and PBL in contrast, where other β-lactams are resistant

to degradation, (Bar and Zarnack, 1970; Katzung, 2007).

3

In Class glycopeptide, Vancomycin inhibit synthesis of cell wall by binding to the

free carboxlic group (-COO-) terminal of the pentapeptide, which interfere with

peptidoglycan backbone elongation, teicoplanin, another polypeptide, prevents the

chain elongation of peptidoglycan by interacting with the DADA (D-alanyl-D-

alanine) end of the muramyl pentapeptide, where it fits into the cleft within the

antibiotic molecule (Neu, 1994).

Qinolones bind to the DNA gyrase complex of and inhibit bacterial topoisomerase II

or DNA gyrase and hence bacteria die. DNA gyrase produces negative twists in DNA,

helping in separation of the strands. Its inhibition blocks all processes involving DNA.

Inhibition of topoisomerase IV may probably be intervening by the division of

replicated chromosomal DNA into the exact progeny. Fluoroquinolones act by

binding topoisomerases IV, another enzyme that helps in the DNA unwinding during

replication (Blondeau, 2004; Katzung, 2007).

Tetracyclines, as the term indicates, comprised of 4 attached rings with a sytem of

conjugated double bonds. Tetracyclines work by fastening to ribosomal subunit (30S),

in that way inhibiting the aminoacyl (tRNA) attaching to the acceptor site on the

ribosome- mRNA complex. This attachment avoids the accumulation of AA (amino

Acids) to synthesize the protein. Variances in the actions of each tetracycline’s are

based on lipid membranes solubility. Tetracycline’s followed the energy dependent

mechanisms to get enter the cytoplasm of Gram positive cocci. On the other hand,

Gram-negative organisms get entered through porins as they are more lipid loving by

diffusion. They can come into GN cells all the way through the porins as well as

through the external lipid membrane, once in the periplasmic space, by protein-

transport scheme the tetracycline are transported over the inner-cytoplasmic

membrane (Neu, 1994; Prescott et al., 1999).

The Macrolides are the member of chemotherapeutic agents which has a macrocyclic

lactone arrangement. Clinicians described erythromycin as a drug of choice as well as

substitute to penicillin in persons who are sensitive to β-lactam drugs. Elongation

chain of the polypeptide is inhibited by the permanent attachment of 50S ribosomal

subunit to macrolides. Protein synthesis is inhibited by blocking the development of

initiation complexes and aminoacyl translocation reactions. Generally, it is considered

bacterio-static, they may be cidal at higher doses (Brisson et al., 1988).

4

Several steps are required for aminoglycosides transport into the bacterial cells. At the

start, an association has been established between the anionic surface and cationic

aminoglycosides at the cell surface.

Aminoglycosides get enter through porin channel of the outer membrane of GNC.

The outer membrane of gram negative bacteria as well as the water filled regions of

GP bacteria of the peptidoglycan wall penetrarted by Aminoglycosides, through non-

porin channels it boosts their uptake so enriched with phosphate. The

aminoglycosides bind to transport molecules that each component is directly

connected to the ETC in the cytoplasmic membrane. Potential difference exists

across the cytoplasmic membrane which facilitates the movement of the drug-

transporter complex. Aerobic pathway exhibits energy for transport which is

anaerobically not available. Subsequently passing the cytoplasmic membrane, they

attached to ribosomes and keeps a low concentration of intra cellular free

aminoglycoside which facilitates the continuous transport of medicine from

membrane to ribosome. At this stage membrane loss its reliability and ultimately

demise of the bacteria occur. Protein synthesis is inhibited by the attachment of

ribosome and this event happen on the ribosomes. For the addition of specific

activated amino acids, mRNA works as a template and transported to the synthesis

region where it binds to the tRNA. Aminoglycosides on R-sites (Ribosomal),

generally at the junction of 30S and 50S subunits of the 70S, on the other hand also

directly binds to these subunits. Inhibition of protein synthesis by aminoglycosides

takes place in three ways:

A) By interfering with ―initiation complex‖ of peptide chain.

B) Introduction of wrong amino acids in to the peptide pattern because

aminoglycosides induce false impression of mRNA, consequentially a non-

purposeful or toxic protein synthesized.

C) They degenerate poly-somes into non-purposeful mono-somes and these events

arise somewhat synchronously and outcomet is irreversible and lethal for cell (Lando

et al., 1973; Neu, 1994; Katzung, 2007).

5

1.1.2 Resistance to Antibiotics

The causative agent of infections, especially bacteria and other microbes, are

unexpectedly supple and may build up several pathways to counteract medicines.

Microorganisms can counter attack the possessions of an antibiotic. Resistance of

bacterium, in excess of one antibiotic is known as Multi Drug Resistant. If the growth

of bacteria is not stopped by highest concentration of antibiotics, they are said to be

resistant to antibiotics (lipponcott, 2004) Globally, advent of antibiotics resistance in

all classes of pathogenic bacteria was a threat to public health (Levy, 2000). Several

bacteria are naturally resistant to antibiotic i.e. Gram negative organisms are resistant

to vancomycin (Lippincott, 2004).

Microbes can use different strategies to combat environmental stresses for the

survival and their response to antibiotic pressure is a consequence of this behaviour.

Resultantly antimicrobial usage causes selection of resistant microorganisms.

Multidrug resistant pathogens originated due to misuse of antibiotics and many

endanger the antibiotic era. Development of new antibiotics has been sluggish despite

of high demand in the recent years. Although, very important molecular targets for

antibiotics have been identified, a delay in the discovery of new targets and

compounds are alarming. Probably we will have to depend on the same battery of

drugs during the next decade. In this scenario of persistently growing resistance,

extensive efforts are needed to keep the efficacy of these drugs groups (Katzung,

2007).

The antibiotic resistance genes were present in the pre-antibiotic era in bacteria to

detoxify antibiotics produced by them. Nucleotides sequence of several antibiotics

resistance genes show regions of homology with the genes for antibiotic production.

Then inappropriate use of antibiotics selects the resistant verities which pass on the

resistant genes to their offspring (Davies, 1996).

In Early days, the researchers were much focused on single-step mutational events of

the bacterial resistance, chromosomal in origin. After discovery of penicillin’s and

even before penicillin G was used for the treatment reported by Oxford Group,

contain an enzyme in Escherichia coli that deactivated penicillin G. Later, in 1944, it

6

was reported that strains of Staphylococcus aureus strains had the ability to deactivate

penicillin G. (Neu, 1994).

When drug companies started mass production of penicillin in 1940’s, within

four year, microorganisms acquired resistance mechanisms (Lewis et al., 1995). The

Japanese researcher reported in 1950’s that some of Shigella dysenteriaes strains had

developed resistant not merely to the sulfa drugs but also to tetracycline’s,

streptomycin and chloramphenicol, which was aroused through a transmissible,

extrachromosomal piece of DNA (plasmid) and not because of chromosomal change

(Neu, 1994).

Resistance mediated by plasmids has been recognized in almost all bacteria. In

resistance mechanism transposonal genes also show important part either integrated

into chromosomes or transported to plasmids but resistance conferred by

chromosomal genes can be transported in the reverse trend thereby binded to

transposons (Neu, 1994).

In the development of plasmid-mediated bacterial resistance, the main discriminatory

factor is antimicrobials. Antibiotics utilization, whether in hospital premises or in an

individual patient, will wipe out antibiotic vulnerable bacteria and allow the

production of bacteria inherently resistant or that have developed extra-chromosomal

resistance. Whereas, epidemiological approach described it as the ability of

microorganism to colonize and attack susceptible host governed by plasmid

resistance, as this stage is transmissible and may be related with other properties

(Neu, 1994).

Antibiotics are used in animals both for therapeutic purpose also for growth

promotion, the basis of which is still not clear (Chopra and Roberts, 2001). Compared

to 20-40% unnecessary use of antibiotics in humans, about 40-80% use of antibiotics

in animals is questionable (Wise et al., 1998). These antibiotics are excreted in

manure which when applied to agriculture land, accumulates there, these antibiotic

resistant bacteria are then disseminated in the environment and can infect humans via

food chain. Avoparcin, a glycopeptides antimicrobial, which was used as growth

promoter in animals, has now been banned in Europe due to selection of vancomycin

resistant enterococci (Avorn et al., 2001).

7

Resistance to antibiotics is a function of time and practice, whether exercised for

prophylaxis purpose or therapeutically. They should be given in a way to pass up

progression of resistance (Finch, 1998). Variation has been observed in the resistance

patterns across the world and differ countries wise, hospital wise with in a locality and

vary from community to community. It is very vital that pattern and trend of

susceptibility of a pathogens of a region and the price of the agents are known. In

Pakistan and other devolping countries resistance to antimicrobial has been increased

to generally used antibiotics (Ahmad and Shakoori, 1997; Khan et al., 1998). The

main contributory factors in emergence and the increase of antibiotic resistance are

self-medication, the unhygienic environments in most of the hospitals and lack of

health facilities (Khushal, 2004).

1.1.3 Mechanism of Bacterial Resistance to Different Antibiotics

Bacteria develop resistance to medicines in so many different ways. Two ( 02)

bacteria may follow dissimilar mechanisms for resistance to hold up the same

chemotherapeutic agent for the same drug. A special type of mechanism is not

restricted to a single class of drugs. Moreover, mutants arise instantly and are not

produced straightaway by exposure to a chemotherapeutic agent (Prescott, 2003).

1.1.4 Resistance based on Altered Receptors for Drug

Certain bacteria produce an alternate target which can be an enzyme or receptors

inhibitory in action and may safeguard themselves. Whereas continuously producing

the susceptible target which leads to the survival of bacteria because, the alternative

enzyme ―by pass‖ evades the effect of antibiotics. Alternative PBP2a which produced

in addition to the regular PBPs by MRSA is an example of this mechanism. PBP2a is

coded by mecA gene and has reduced affinity for the β-lactams, penicillin and

cephalosporin’s due to which synthesis of peptidoglycan continues and cells remain

active. Due to modification of PBPs in enterococci, cephalosporins are unproductive

against them (Hartman, 1981).

1.1.5 Destruction or Inactivation of Drug

The most important mechanism through which bacterial resistance occur is the

development of enzymes ( β-lactamases) by bacteria which hydrolyze cephalosporins,

penicillin and other β-lactams which directs the inactivation of the antimicrobials.

8

These enzymes act against both penicillin’s and cephalosporin’ to some extent and

others are more specifically penicillinases and cephalosporinases

Enzyme β-lactamases are prevalent among numerous bacterial strains and show

variation to inhibit β-lactamase inhibitors, such as CA (clavulanic acid) (Livermore,

1995). Enzyme chloramphenicol trans-acetylase, present in many GP and GN bacteria

due to which they are resistance to chloramphenicol. Acetylated chloramphenicol

loosely attached to the ribosome. Usually non-acetylated chloramphenicol inhibited

the protein synthesis, which is remained uneffected (Ingram and Hassan, 1975).

1.1.6 A Decrease in the Concentration of Drug that Reaches the Receptors

Some antibiotic resistant bacteria protect the target of the antibiotic action by

preventing the drug from entering to the cell or pumping it out much faster than its

flow (rather like a bilge Pump in a boat), or penicillinases (Staph. aureus

penicillinases) (Livermore, 1995).

1.1.7 Faliure to Metabolize the Drug

Bacteriods fragalis an anaerobic bacterium do not metabolize the antibacterials,

which grounds for DNA damage and so, these bacteria are not destroyed by the agent

(Neu, 1994)

Gram negative bacteria have water filled hollow membrane protein (porin) through

which β-lactams antibiotics get entry into the cell. Due to the lack of specific D2 get

porin in resistant Pseudomonas aeruginosa, imipenem, fluoroquinolones and

aminoglycosides can’t cross the membrane of the cell.

1.2 β-Lactam Antibiotics

Bacterial infections are mostly treated with β-Lactam antibiotics which include

different classes such as penicillin, cephalosporins, carbapenems & monobactams.

Overuse of antibiotics mainly to 3rd

generation cephalosporin’s, has been

accompanying with the rise of β-Lactam antibiotics β-lactamases mediated bacterial

resistance, which afterward headed to the development of ESBL producing bacteria.

The resistance mediated by these enzymes to extended spectrum more likely to

9

cephalosporins 3rd

generation and monobactams (CLSI, 2010). They hydrolyse the β-

lactam ring of antibiotic, thus eliminating the drug action.

ESBL’s enzymes have been identified throughout the world in many bacteria

(different genera of Enterobactericeae and Pseudomonas aeruginosa) (Friedman et

al., 2008). Though, these are most common in Klebsiella pneumoniae & E. coli

(Aggarwal et al., 2008). Organisms responsible to produce ESBL’s are often resistant

to many other groups of antibiotics because the plasmid (gene encoding ESBLs) often

contain other resistance. In the beginning, ESBL organisms responsible for production

of ESBL’s were recovered from hospitalized infections but now they are also

prevalent in community (Pitout and Laupland, 2008). The rate of colonization of K.

pneumoniae is far diminishing in healthy ones in the common inhabitants. But it is

increased in hospitalized patients specifically with long care facilities, health care

manipulations e.g. use of catheters (Yusha et al., 2010).

1.2.1 Extended Spectrum β-lactamase

ESBLs are rapidly emerging group of β-lactamase enzymes, having the capability to

hydrolyze and induce resistance to the oxy-imino-cephalosporins (cefotaxime,

ceftazidime, ceftriaxone and cefedime) and monobactams (aztreonam), but not to

cefoxitin and cefotetan and carbapenems, produced by the Gram-negative bacteria

(Lal et al., 2007; Rupp and Fey, 2003 and Peirano and Pitout, 2010).

1.2.2 Emergence of Drug Resistance

Most of the resistance microbes which are now difficult to treat are of genetic origin

and transferable between species and genera of bacteria (Rahman et al., 2004). The

misuse of agents does not attain the anticipated therapeutic results and is

accompanying with the development of resistance. Lack of access, inappropriate

medication, poor adherence and sub standard antimicrobials may play a vital role in

misuse. Prevalence of resistance to newer antibiotics has been increased due the

extensive use of antimicrobials that varies geographically and over the time.

Resistance will be emerged sooner or later in the upcoming decades to every class of

antibiotic (WHO, 2002). Most of the resistant microbes which are now difficult to

treat is of genetic origin and transferable between species and genera of bacteria.

10

1.2.3 Mechanism of Resistance to Antimicrobials

Resistance to drug is a natural trend. The emergence of any anti-microbial agent into

medical practice has been trailed by the finding in the lab of strains of microbes that

are resistant, i.e. able to increase in the presence of drug concentrations higher than

the concentrations inidividuals getting therapeutic dosages. Such resistance may

what's more be a feature linked with the complete species or come into view in strains

of a generally susceptible species by alteration or gene transfer. Resistance genes code

different pathways which permits microorganisms to resist the inhibitory effects of

specific drug. These pathways often present resistance to other agents of the identical

class and occasionally to several different antibacterial classes (WHO, 2002). Gram

negative bacteria use four mechanisms of resistance to survive to the antibiotic

treatment:

1.2.3.1 Efflux of Antibiotics from Bacteria

Efflux pumps play an important part in resistance to antibiotics, with several other

roles in bacteria like uptake of vital nutrients and ions, elimination of metabolic end

products and harmful materials in addition to the communication between cells and

surroundings (Li and Nikaido, 2004).

1.2.3.2 Outer Membrane Permeability

The OM has the property to work as a selective barrier and thus play an important role

in permeability with a major impact on sensitivity of microbes to antimicrobials

which are targeted at intracellular mechanisms. When a highly hydrophobic lipid

bilayer is combined with a pore forming proteins of specific size exclusion property,

at this stage it acts as selective barrier. The OM of Gram negative bacteria is a barrier

to hydrophobic as well as to hydrophilic compounds. Β-lactams are hydrophilic

antibiotics (smaller), utilizes the pore forming proteins (OprD in Pseudomonas and

OmpF in E. coli) to get entered inside the cell, whereas larger hydrophobic antibiotics

and macrolides cross the lipid bilayer through diffusion. Alteration in lipid or proteins

composition of OM barrier indeed highlights its position in antibiotic susceptibility

and thus antibiotic-resistant strains survive (Engelsen et al., 2009).

11

1.2.3.3 Target Modification

This mechanism is governed by changing the bacterial sites of action which are

targeted by drugs and so inhibiting the antibiotic from binding to the site. For

example, fluoroquinolone resistance is attributed to mutations within the drug target

(DNA gyrase and topoisomerase) (Livermore, 2003).

1.2.3.4 Enzymatic Modification of the Antibiotic

Modification of antibiotics enzymatically categorized into two classes:

(i) β-lactamase that degrade antibiotics.

(ii) Others including macrolide and aminoglycoside-modifying proteins that

accomplish chemical changes to make the antibiotic unproductive (Livermore, 2003).

Figure 1-1: Mechanism of Drug Resistance Note: Some of the many mechanisms of resistance are indicated schematically in the above Figure

12

1.2.4 The Achievement and Spread of Antibiotic Resistance in Bacteria

Strains of bacteria causing different infections have developed resistance to the

previously available antibiotics; multiple drug resistant strains are one of them which

had developed resistance to existence drugs. This resistance may be due to a particular

type of cell wall (inherent trait or acquired) of the organism or by the modification of

their individual DNA or acquisition of resistance-conferring DNA from another

source (Toder, 2008).

1.3 β-lactams

Prehistoric people were frightened with the fatalness of infectious diseases caused by

bacteria and therefore, continually were in search of appropriate cure for these

ailments. Numerous means (moldy cheese and bread, preparations of animal and

plant) were utilized to treatment these infections in the old-fashioned medication with

extensive coverage and nowadays it is accepted that they have some unidentified

antibacterial agent (Toder et al., 2008). In 1928 Alexander Fleming detected that

culture plate on which Staphylococci were being grown had developed contamination

with a mold of the genus Penicillium and that bacterial growth in the locality of the

mold had been inhibited. He isolated the mold in pure culture and verified that it

produced an antibacterial substance Penicillin (Abraham and Chain, 1940). They have

revealed that certain bacteria produce an enzyme named penicillinase, which abolish

penicillin (Woodruff and Foster, 1945).

After the introduction of penicillin for therapeutic purposes, penicillinase producing

Staphylococcus aureus underway to proliferate in hospitals which leads to the

discovery of penicillinase resistant penicillin to control this problem. Soon after that,

broad spectrum penicillin and 1st generation cephalosporins were came into picture

and they were the drug of choice against microorganisms for 2 decades till emergence

of β-lactamases produced by gram negative bacilli (Medeiros, 1997). To overcome

this problem, six novel drugs of β-lactams were launched by the pharmaceutical

companies namely monobactams, oxyimino, cephamycins, cephalosporins,

carbapenems, and clavam and penicillianic acid sulfone inhibitors within short span of

7-8 years. Even though, novel β-lactamases had arisen progressively after the

induction of new β-lactam agents, their quantity and diversity augmented worryingly

(Chaudhary and Aggarwal, 2004). β-lactam antimicrobials are the most common

13

treatment for gram positive, gram negative and anaerobic bacterial infection (Ambler,

1980; Kotra et al., 2002; Holten and Onusko, 2000).

The family β-lactams comprised of four major groups of antibacterial agents:

cephalosporins, monobactums, penicillins and carbapenems (Kotra et al., 2002),

hydrolyzed by β-lactamases with β-lactam ring in their structure. These groups are

differentiated based on rings i.e. Thiazolidine ring for penicillin, Cephem core

(nucleus) for cephalosporin, none for monobactum, Paired ring structure for

carbapenem (Levinson, 2010). They act on bacteria by two mechanisms: at first, they

incorporate in cell wall of the bacteria and prevent the action of trans-peptidase, liable

for completion of cell wall. Moreover, by binding to PBPs that usually destroys cell

wall hydrolases, therefore releasing these hydrolases which are responsible for lyses

of the bacterial cell wall. To avoid these mechanisms of action, deactivating enzymes

are produced by resistant bacteria (Samaha and Araj, 2003).

Figure 1-2: Showing β- Lactam Ring Destruction by β- lactamases Enzyme

Note: A β-lactamase enzyme can destroy the β-lactam ring of penicillins through hydrolysis, and without a β-lactam ring,

penicillins are ineffective against the bacteria

1.4 β- lactamase Enzymes

Bacterial cell wall is composed of repeating units of NAG (N-acetyl glucosamine) and

NAM (N-acetyl muramic acid) in polymeric chain form of peptidoglycan.

14

Transamidation reaction is catalyzed by the enzyme transamidase in the last step of

the cell wall biosynthesis (Woste, 2010). The crosslinking process is exceptionally

sensitive to β- lactam drugs. Cell Wall Transamidase is a PBP-1. Binding to PBP-1

leads to cell lysis, but attachment to PBP-2 (a transpeptidase) produces elliptical cells,

which can’t multiply (Woster, 2010). Before the advent of penicillin, β-lactamases

were extant in bacteria (Woodruff and Foster, 1945), and genes responsible for these

antique enzymes were positioned on the chromosome of bacteria (Hanson et al., 1999;

Yusha et al., 2010). Moreover, β-lactamase enzymes are inducible and expressed in

low capacities. Plasmid-encoded β--lactamase was first reported in GNR by the

Greeks in 1965 (Datta and Kontomichalou, 1965). Severity of Infectious diseases is

caused by β- lactamase producing bacteria due to its increased population. (Shobha, et

al., 2007; Andrews, 2009). Presently, there are more than 500 different β- lactamases

have been naturally established (CLSI, 2010). These versatile enzymes (β-

lactamases) are present in both GP and GN bacteria (Holten and Onusko, 2000). Β-

lactamase producing Gram positive bacteria release the enzyme into the surroundings

medium. But Gram negative bacteria release the enzyme into the periplasmic space.

So, this is called group protection for Gram positive bacteria and individual protection

for GNR (Samaha and Araj, 2003).

Figure 1-3: Structure of β-lactamase Enzyme

15

Members of the family commonly express plasmid-encoded β-lactamases (e.g., TEM-1, TEM-2, and SHV-1). which confer

resistance to penicillins but not to expanded-spectrum cephalosporins.

1.4.1 Extended Spectrum Cephalosporin’s (ESCs)

The 1st

generation cephalosporins are active primarily against Gram-positive cocci

(GPC). Similer to penicillin; new cephalosporins were synthesized with extension in

spectrum against gram negative rods. These novel drugs were exclusively categorized

into 2nd

, 3rd

and 4th

generations, with each generation having extended spectrum

against certain gram negative rods e.g. Ceftazidime, cefotaxime, ceftriaxone and

cefepime (Levinson, 2010).

1.4.2 Extended Spectrum β- lactamases (ESBLs)

Extended spectrum β-lactamases (ESBL) are group of enzymes that hydrolyze and

induce resistance to oxymino-cephalosporins (ceftriaxone, ceftazidime, cefepime and

cefotaxime) and monobactams (aztreonam) (Peirano and Pitout, 2010). β-lactamases

are amongst the most diversified group of resistant enzymes made up of globular

proteins (alpha-helices and β- pleated sheets). Even though with a significant amount

of amino acids sequence variabilities (Perez et al., 2007). Β-lactamases share a

common overall topology;

1. Are capable of inactivating extended spectrum cephalosporin and monobactam

2. Are inhibited by β-lactases inhibitors, such as clavulanic acid, carbapenem

sulbactum and tozabactum (CLSI, 2010).

These new enzymes were given the name ESBLs that reflect the fact that they were

the older β- lactamases and had a new capability to hydrolyze a widerrange of β-

lactam drugs (Jacoby et al., 1988)

1.4.3 Mechanism of Action

a) β-lactamase enzymes produced by bacteria followed a common pathway of

bacterial resistance by break down of the structural β-lactam ring of penicillin

resembling agents (Chaudhary and Aggarwal, 2004; Paterson and Yu, 1999).

b) By the point mutation, configuration is changed around the active site of

Temoneira (tem) and Sulfahydryl Variables (shv) enzymes, that specify resistance to

16

ampicillin and had a new capability of hydrolyzing broader spectrum of β-lactam

drugs (Philippon, 1898).

c) Therapeutically antibiotics can considerably speed up the selection stress for

diversification and distsemination of mutant extended spectrum β- lactamase

(Farkosh, 2007).

d) ESBL’s have serine present at their active site that attck the amide linkage of β-

lactam ring of antibiotics causing their hydrolysis (Chaudhary and Aggarwal, 2004).

ESBLs producing bacteria are differ from other super bugs, because these enzymes

are not limited to a specific kind of bacteria i.e. Methiciliin resistant Staphylococcus

aureus (MRSA) refers specifically to methicillin-resistant strains of Staphylococcus

aureus. Multi-drug resiatant (MDR) organisms that have been encounter by:

Staphylococcus aureus, Vancomycin-resistant MRSA-Methicillin/oxacillin resistant

enterococci ESBLs (Toder, 2008).

1.4.4 Synthesis and Mode of Transfer

Β-lactamases are synthesized both by chromosomal (Pseudomonas aeruginosa) based

mechanism, or induced by plasmid mediation as in Escherchia coli (Livermore, 1995;

Rayamajhi et al., 2008; Rupp and Pau, 2003). Proliferation of bacterial resistance is

mostly governed by plasmids (Peirano and Pitout, 2010). Β- lactamases encoding

genes are frequently positioned on large plasmid (80kbp) which is also responsible

encoding genes for resistance to other antimicrobials i.e. aminoglycosides,

tetracycline, sulfonamides, tri-methoprim and chloramphenicol which can effortlessly

be moved between isolates (Sasirekha et al., 2010; Perez, 2007).

1.5 Evolution and Epidemiology

Prevalence of MDR genes encoding by the different strains are increasing day by day

prevalent (Hanson et al., 1999). TEM-1 was firstly reported in 1960’s in Gram

negative bacterium which was the pioneer plasmid mediated β-lactamase (Turner,

2005). In 1983, Knothe and his co-workers reported an isolate from a Germany

named shv-2 a mutant of shv -1 of K. pneumoniae strain which was capable to

hydrolyze oxy-imino-cephalosporins (Knothe et al., 1983). shv -2 gene was

transferrable among bacteria after two years (Kliebe et al., 1985). In French hospitals,

17

nosocomial infections were attributed to Enterobacteriaceae carrying mutant of tem

gene derivate which was look like SHV-2 in action (Brun-Buisson et al., 1987).

Livermore, introduced the term extended broad- spectrum β--lactamases (Livermore,

2008). These enzymes are considered to have an extended activity in contrast to

broad-spectrum. So, broad spectrum lost its integrity and replaced by extended

spectrum β-lactamases.

ESBLs are originated from TEM, SHV and OXA enzyme families of broad-spectrum

β- lactamases these are different by one amino acid from its prototype enzyme by a

few point mutations and confer an extended spectrum activity (Hawkey, 2008). These

replacements are responsible for phenotypic cluster of the enzymes around its active

site and modify its configuration, letting entrance to oxyimino-β-lactam substrates. As

the active site of the enzyme opens to β-lactam substrates which in turn rises the

enzyme’s vulnerability to inhibitors of β-lactamase, for example clavulanic acid.

ESBL phenotypes are produced on a Single substitution of amino acid at locations

104, 164, 238, and 240 however, multiple substitutions do occur in case of ESBLs

with the broadest spectrum (Bradford 2001).

The use of infection control measures, differential stress and already prevalent

resistant genes are responsible for speedy development and proliferation of resistance

(Rupp and Paul, 2003).

In CTX M, each of the amino acid change contributes to resistance. Substitution at

position 102 greatly increases the rate of ceftazidime resistance. On the other hand,

substitution at location 236 mostly resistance to cefotaxime by itself (Rahman et al.,

2004). Occurrence and distribution of ESBLs changes country-wise as well as from

hospital to hospital (Ali, 2009). At the beginning, ESBL producing strains were

mostly recovered from hospital acquired infections but nowadays, they are reported

from the community as well (Helfand and Bonomo, 2005.). The use of novel

expanded-spectrum β-lactams created a nonstop stress and stimulated the

development of newer TEM and SHV progenies (Pin heiro et al., 2008). Mostly

ESBL’S are the derivatives of TEM or SHV enzymes and they have so various types

like TEM, SHV, CTX-M, OXA and AmpC, most frequently recovered from E. coli

and K. pneumoniae (Sharma et al., 2010) and studies exhibited that novels are being

developed each week. The rapid emergence of the ESBL-production among

18

Enterobacteriaceae has already had serious clinical implications. ESBLs of the CTX-

M type were rare until the end of the 1980s, but Japan, Argentina and Germany

reported almost concomitantly findings of this ESBL type. Predominance of CTX-M

β-lactamases may be due to the selective pressure of increased use of 3rd

generation

cephalosporins (ceftriaxone) (Samaha-Kfoury;Araj, 2003 and Pin heiro et al., 2008).

The genes encoding CTX-Ms have been mobilised from Klyuviera spp. by several

genetic events and mechanisms (Perez et al., 2007). With the emergence of the

CTXM, there has been a marked shift in the epidemiology of ESBLs (Coque et al.,

2006). The high proportion of gene CTX-Ms has not merely been exhibited in

hospitals however also in the the public, from nursing homes and long-term facilities.

Gene (CTX-M-15) is mainly observed ESBL-enzyme in Europe (Pitout and

Laupland, 2008.).

CTX-M types ESBLs typically hydrolyze Cefixime (CEF) and Ceftriaxone (CRO)

more powerfully as compared to Ceftazidime. Although, Ceftazidime significantly

hydrolyze by point mutations around the active site belonging to the CTX-M- 1 and

CTX-M-9 groups (Pitout, 2010), OXA type ESBLs have been isolated from P.

aerugenosa (Girlich et al., 2004). ESBLs should be differentiated from other β-

lactamases capable of hydrolyzing extended spectrum Cephalosporins e.g. AmpC and

Carbapenemases (Class B) or serine carbapenemases (Class A and D) (Jacoby, 2009;

Poirel et al., 2007).

Epidemiology of ESBLs genes are rapidly changing and shows marked

geographic differences in frequency of genotypes of CTX-M β-lactamases (Coque et

al., 2008). Unusual ESBLs and Klebsiella pneumoniae express ESBLs (Rupp and

Paul, 2003) also reported in the early days of ESBL inception in Germany. The

achievement of the gene (CTX-Ms) over the usual TEMs and SHVs is connected in a

mannerer by which CTX-M are multiplied and harboured. By mean of MGE ( mobile

genetic elements) resistance genes spread within the same starin and amongst the

19

bacteria of different traits (Coque et al., 2008). The occurrence of ESBLs in modern

Europe is lower in Asia and South America but higher than in the USA but (Girlich et

al., 2004). In Turkey, prevalence rate of ESBL’s producers among the bacteria

causing UTI’s in community was 21% during 2004 and 2005 (Coque et al., 2008).

Asia probably has a long history of occurance of ESBLs producing bacteria

(Kim et al., 2007). In last two decades of 20th

century, there was no comprehansive

data on the occurrence of ESBLs from this region. Several periodic studies on ESBLs

particularly of the SHV-2 type reported in 1988 from China were reported. (Rupp et

al., 2003). Phenotypes of ESBL were described under the SENTRY programme

during 1998 to 2002 for 3 hubs’ in Taiwan, having 13.5% and 5.6% prevalence rate of

K. pneumoniae and E. coli respectively (Turner et al., 2005. The configuration of

genes encoding ESBL isolates in Japan were different from that of the neighboring

countries, while commonly effective types, e.g., CTX-M-14, have freshly become

more prevalent (Hirakata et al., 2005).

Taking into consideration the density of population of Asian countries, they represent

the largest reservoirs of gene encoding CTX-M ESBL in the world. Native Emergent

CTX-M genotypes are spreading rapidly throughout the world due tourism and trade.

(Hawkey et al., 2008). Prevalence of ESBLs varies from country to country, hospital

to hospital even in very closely related regions.

High prevalence rates of ESBL have been observed both in India and Pakistan

since 1990s (Grover et al., 2006; Mathai et al., 2002). Numerous studies were

reported from India during 2002 to 2008 with ESBL prevelance rate of E. coli

between 46.5% to 60.9% (Sharma et al., 2007; Mathai et al., 2002; Varaiya et al.,

2008 and Shivaprokasha et al., 2007).

In India, gene (CTX-M -15) was reported to be 70% during 2010 whereas in

2006 ESBLs prevalence was 73% and E. coli and Klebsiella accounted 70 and 60%

respectively, in which TEM (56%) and SHV (60%) were detected (Sharma, 2010).

While E. coli (61.1% ) and Klebsiella (40.6% ) reported in the same year (Sasirekha

2010), while in Iran (2010), 96% ESBLs were observed of which SHV (26%), CTX-

M(24.5%), TEM(18%) and PER was 7.5%, in Korea, E. coli and Klebsiella were

17.7% and 26.5% respectively. In India,

20

1.6 Classification of ESBL’s

ESBLs were classified and characterized on the basis of enzymatic diversity after the

discovery in late 1960’s. Initially these categorizations were based on biochemical

and enzymatic characteristics while laterly it was based on molecular characterization

of enzyme (Bush et al., 1995).

Table 1-1: Evolution of Functional Classification of β lactamases

Basis of classification of β lactamases Author Year

Used cephalosporins versus penicillin as substrates Sawai et al., 1968

Five main groups (Ia-d-II-III- IV and V ) of Expanded

substrate profile

Richmond and Sykes

1973

Differentiation of the plasmid mediated β lactamases

by IF (isoelectric focusing)

Sykes and Matthew 1976

Addition of cefuroxime to the hydrolyzing β lactamase

category.

Mitsuhachi and Inoue 1981

Expanded further the substrate profile, added the

reaction with EDTA, correlated between functional

and molecular classification

Bush, 1989

Expanded the Bush scheme and used biochemical

properties, molecular structure, and nucleotide

sequence.

Bush et al., 1995

1.7 Functional Classification

1.7.1 Group 1

Group one is comprised of Cephalosporinases, which are not inhibited by (CA)

clavulanic acid and were placed in Molecular Class C.

1.7.2 Group 2

This group includes enzyme penicillinases and cephalosporinases, both are are

subdued by CA (clavulanic acid) representing molecular classes (A and D), the

21

prototypes of SHV and TEM genes. This group was subdivided into class 2a and 2b

based on variation in derived β lactamases of TEM and SHV.

Table 1-2: Functional Classification of Group 2b

GROUP 2a Penicillinase, Molecular Class A

GROUP 2b Broad-Spectrum, Molecular Class A

GROUP 2be Extended-Spectrum, Molecular Class A

GROUP 2br Inhibitor-Resistant, Molecular Class A (Diminished Inhibition by

Clavulanic Acid)

GROUP 2c Carbenicillinase, Molecular Class A

GROUP 2d Cloxacilanase, Molecular Class. (A or D)

GROUP. 2e Cephalosporinase (Molecular Class A)

GROUP 2f Carbapenamase, Molecular Class A

1. Subgroup 2a: This group represents penicillinases.

2. S Subgroup 2b: This group can deactivate penicillins and cephalosporins;

they are broad-spectrum β-lactamases. it was further divided into subgroups:

a. Subgroup 2be: As the letter e indicates this subgroup comprised of ESBLs

that can hydrolase 3rd

generation cephalosporins.

b. Subgroup 2br: Letter r stands for reduced attachment to clavulanic acid and

sulbactam known as inhibitor-resistant of enzyme derived from TEM.

Though, they are sensitive to antimicrobial agent tazobactam

3. Subgroup 2c: They have inhibitory action against carbenicillin more than

benzylpenicillin and somehow effective against cloxacillin.

4. Subgroup 2d: These enzymes inactivate cloxacillin more than

benzylpenicillin with moderate action against carbpenicillin and poorly

inhibited by clavulanic acid. ―OXACILLINASE" deactivate

oxazolylpenicillins like oxacilli, cloxacilli, dicloxacillin. And placed in

molecular class A rather than D.

5. Subgroup 2e: Cephalosporinases hydrolyses monobactams, and are inhibited

by clavulanic acid.

22

6. Subgroup 2f: Addition of this subgroup was based on amino acid serine in

carbapenemases contrary to carbapenemases which have zinc.

1.7.3 Group 3

These enzymes represent metalloenzyme based on zinc action and corresponding to

the molecular class B. These can hydrolyze penicillins, cephalosporins, and

carbapenems.

1.7.4 Group 4

Enzymes of this group comprise of penicillinases which are not inhibited by

clavulanic acid and they don’t have any molecular class.

1.8 Molecular Classification of β-lactamases

The β-lactamases are classified on molecular level based on amino acid sequences and

nucleotide. Uptill now four classes were documented (A-B-C and D), associating with

the functional classification. Serine based mechanism needed fot the Classes A, C,

and D, on the other hand class B or metallic β lactamases associated with the action of

zinc.

1.8.1 ESBLs Encoding Genes

TEM and SHV varieties were considered as more prevalent enzymes at the beginning

era (Pitout et al., 2010; Shobha et al., 2007; Florijn et al., 2002). TEM-2 & SHV-2

ESBL are resultant of parental TEM-1 and SHV-1 by point mutation. TEM-1 and

SHV-2 are non ESBL, but CTX-M enzymes are not derived from non ESBL and

consequently all CTX-M enzymes are ESBLs (Al-Agamy et al., 2009). Currently,

CTX-M enzymes the most prevalent β- lactamase are being discovered throughout the

world (Xu et al., 2005). TEM-1 and SHV-1 mutants are encoded by ESBLs are

located on plasmids which are easily transmittable to other bacteria (Jemima and

Verghese, 2008).

1.8.2 TEM and SHV β-lactamases

TEM-1 is more prevalent come across β-lactamase in Gram-negative bacteria. Other

TEM-type β-lactamases are also reported in K. pneumonia and E. coli and isolated

from other species like Gram-negative Pseudomonas spp. of bacteria with high

prevalence.

23

TEM is derived from a patient named Temoniera, from whom the strain was

recovered in Greece. (Turner, 2005). Enzyme TEM -1 enzyme was first described in

1965, recovered from E. coli strain and now prevalent ESBL in Enterobacteriaceae

(Fonze et al., 1995)

Up till now more than 195 TEM-type enzymes have been isolated due to

conformational changes based upon different combinations, TEM-2, was the first

derived variant reported, a substitution of a single amino acid lysine with glutamine at

39 position, differ it from TEM- (Rupp et al., 2003). TEM and SHV are transferred by

both plasmid and chromosome (Sharma, 2010). TEM -3 most common in France

(Livermore, 1995). TEM-10, TEM-12, TEM-3 and in USA the prevalent type of

enzyme was TEM -26 (Farkosh, 2007). Structurally both SHV-1 and TEM-1 resemble

each other and 68 % of AA are shared by SHV-1 with TEM-1.

SHV stands for Sulf hydril variable (Turner, 2005). The SHV-1 is accountable for 20

% of plasmid induced AMP resistance in K. pneumoniae. The conformational changes

in the sequence of amino acids at position 238 or 238 and 240 around the active site,

leads to ESBLs variants and currently more than 60 SHV varieties are discovered.

These enzymes are found more predominantly in developed regions like Europe,

United States and are found throughout world. The common isolated enzymes are

SHV-5 and SHV-12 (Farkosh, 2007). SHV variants are important worldwide

(Rahman et al., 2004). Epidemics of nosocomial infection are caused by SHV-5 type

among the ß-lactamases in several countries (Jmima and Verghes, 2008).

1.8.3 CTX-M β-lactamases

β-lactamase CTX-M (stands for cefotaxime, first isolated in Munich, Germany).

Initially Japanese researchers are the one who documented these enzymes in 1986 and

named TOHO-1 and was changed later to CTX-M (Matsumoto, 1988). Mostly

Extended-spectrum β-lactamases induced acquired resistance to β-lactams antibiotics

and all drugs of β- lactam origins are inhibited excluding carbapenems and

cephamycins, which are inhibitory to clavulanic acid. An abrupt change has been

reported which show a powerful rise of CTX-M enzymes instead of TEM and SHV

variants in Europe (Coque et al., 2008; Livermore and Canton, 2007).

However, E. coli producing CTX-M β-lactamases caused UTI, which have raised as a

causative agent of community-based urinary tract infections internationally (Gutkind

24

and Cátedra, 2001) and were entitled as CTX-M due to their superior action against

3rd

generation cephalosporin i.e. cefotaxime than other oxyimino-β-lactam substrates

(ceftazidime, ceftriaxone, or cefepime) (Pitout et al., 2008). The CTX-M enzymes are

some how not related to TEM or SHV β-lactamases and resemble only 40% to these

two enzymes. The conformational changes at 102 position primarily develops

resistance to ceftazidime, while modification at position 236 increases resistance to

cefotaxime, and have a slight effect to ceftazidime (Rahman et al., 2004).

Based upon amino acid sequence CTX-M was categorized into 5 groups i.e.

CTX-M-25, CTX-M-9, CTX-M-8, CTX-M-2 and CTX-M-1 although more than 80

variants have been reported for CTX-M (Smet et al., 2010 and Al-Agamy et al.,

2009).

Nosocomial infection is harbored by ESBLs in hospitals, surveillance of

infections would propose that enzyme CTX-M emerged in the environment and

spread to the society (Perez et al., 2007). The organisms producing CTX-M are

different from SHV and TEM resulting ESBLs on the basis of epidemiology (Pitout et

al., 2008). Some enzymes are more commonly reported than others according to

Epidemiological reports, predominant enzyme type varies with country and that

diverse CTX-M types often exist within a single country (Ensor et al., 2006).

CTX-M enzymes (14 and 27) have been reported most oftenly in Asia during 1990 to

2000. Prevalence of CTX-M-15 in Asia stay relatively limited outside of those studies

from the indo-pak (Hawkey, 2008).

1.9 Inhibitor-Resistant β-lactamases

Even though the IRB (inhibitor-resistant β-lactamases) are not ESBLs, they are

frequently conferred with ESBLs as they are also plagiaristic of the classical types of

TEM or SHV enzymes. These enzymes were at first given the designation IRT

(inhibitor-resistant TEM β-lactamase); on the other hand, all have consequently been

designated as TEM with numerics. Nineteen distinct IRT ( inhibitor-resistant TEM β-

lactamases) were identified and they were primarily have been isolated in France and

other parts of Europe.

25

1.10 Organism Responsible for ESBL

ESBLs are most commonly isolated from E. coli and K. pneumoniae but prevalent in

other Enterobacteriaceae specially Enterobacter, Proteus, Pseudomonas, Morganella

morganii (Shobha, 2007; Sasirekha et al., 2010; Peirano et al., 2010).

1.10.1 Risk Groups

Patients at high-risk for ESBL include:

Patients with Neutropenia

Transplantation receiver

Premature babies

Aged individuals

Extensive/lengthened use of antibiotic

Post-GIT surgery

1.10.2 Consider Screening all Admissions to High Risk Units.

Higly vulnerable departments include:

ICU’s

Oncology and Hematology departement

Transplantation units

Lenthened / CCF (chronic care facility) (Peirano et al., 2010; Farkosh, 2007).

Use of Ext.Spectrum antibiotics exercises a choosy pressure for rise of ESBL

producing GNR (Gram negative rods) (Farkosh, 2007).

1.11 ESBL Carriage

Patients having ESBL should have a well established policies with flagged

records of treatment. After re-admission regard as test for ESBL. Samples were often

taken from those sites where microorganisms harboured mostly (perianal/rectal and

urine)(Champs et al., 1989).

Those patients with constant ESBL carriage (e.g. 3 successive +ive samples

taken weekly along with ESBL-associated risk factor) do not need persisitent follow

up for screening during re-admission. However, alter report of associated risk factor ,

26

then consider the re-screening and it should be followed for each patient. Consider

the following factors: usage of antibiotics (Continued), expected persistent

interferences or planned removal of safety measures (Friedman et al., 2004; Shobha et

al., 2007). During discharge the antibiotics should be up to dated according to carrier

as with any antimicrobial-resistant microbe (Friedman et al., 2004).

1.12 Reservoir

Asymptomatic behavior is shown by most colonized patients and may be a cause of

transmission to others (Friedman et al. 2004). The bowel is a well-off setting for

genetic swap between commensal Enterobacteriaceae (Ensor et al., 2006).

1.13 Transmission

CTX-M gene mobilizes 10x more frequently than SHV & TEM gene (CLSI, 2010).

The epidemiology on molecular level of ESBL occurrence specifies that the

mechanism of multiplication may be clonal strain propagation, clonal plasmid

dissemination and selection among polyclonal strains or both (Perez et al., 2007). The

distinctive techniques of spread take accounts of clonal distribution of an ESBL

developing species or the propagation of a plasmid mediated ESBL gene (Coque et

al., 2008). Patient’s bowel and skin are often at risk of infection due to the stress of

selective antibiotic that leads to colonization.(Ensor et al., 2007). Epidemics linked

with surgeries (catheter and contamination of medical equipment’s) has been

reported (Pitout et al., 2008). Propagation subsequently come into view to occur

largely through healthcare personnel. Patient colonization, ecological contagion and

hand transmission are the factors which harbored endemic strains in healthcare system

for years (Friedman et al., 2004).

Patient to patient transfer of microorganisms via the hands of healthcare workers is

thought to be the main mode of transmission for ESBLs, although some ESBL

outbreaks have been attributed to contaminated medical devices (e.g. ultrasound gel).

Thus, hand hygiene should be the most effective preventive measure (Friedman et al.,

2004).

27

1.14 Preventions

Hand hygiene is an easy and useful way to control infection and unhygienic hands can

put out microbes which may ground infection. Hand rinse with sanitizers is effectual

(Friedman et al., 2004). In addition to other precautionary measures such as

restriction of antibiotics, surrounding cleaning, use of gloves and aprons and hand

hygiene have been revealed to be valuable to prevent transmission of outbreaks. No

extra safety measures are requisite in out-patient or home-care surroundings

(Friedman et al., 2004).

1.15 Patient Placement

Patient should be placed in a single room with quarantine. However, in outbreak

situation cohorting of identified cases are allowed. During non availability of single

room facility, If sharing a room with a non-ESBL patient is needed; certain factors

may be considered:

Make sure that non-ESBL one does not have any of the risk factors i.e. indwelling

devices, neutropenia and transplantation history, etc with a good hygiene carried out

(Friedman et al., 2004). Monitoring and control of usage of extended spectrum

cephalosporins and regular surveillance of antibiotic resistance patterns as well as

efforts to decrease use as empirical therapy is indicated (Rupp et al., 2003).

1.16 Laboratory Procedures

ESBL’s can be identified by different diagnostic tools. Phenotypic approach that use

non-molecular procedures, which identify the ability of these enzymes to hydrolyze

different cephalosporins and molecular methods, the genetic approach that use gene

accountable for ESBL production. Routinely phenotypic methods are adopted in most

of the Clinical diagnostic laboratories. Different confirmatory test is conducted to

identify ESBL production but the easiest one is the standard susceptibility method

which is in daily routine in diagnostic laboratory and detection depend upon the

synergistic activity of clavulanic acid and the indicator cephalosporins used in the

initial screening. Somehow disc diffusion method used routinely has been reported

dissatisfactory results in the detection of ESBL production (Tenover et al., 1999;

Paterson et al., 1999).

28

The contemporary series of CLSI, (2010) recommendations to identify ESBL's in

Pseudomonas take in primary screening method with any two of the following β-

lactam antibiotics: cefpodoxime, ceftazidime, aztreonam, cefotaxime, or ceftriaxone.

Isolates exhibiting a MIC > 1µg/ml should be confirmed phenotypically using

ceftazidime plus ceftazidime/clavulanic acid and cefotaxime plus

cefotaxime/clavulanic acid.

1.17 Screening Test for ESBLs

1.17.1 Disc Diffusion Method

The CLSIs procedures were followed and according to which if strains

displaying zone of inhibition ≤ 22 mm in diameter with Ceftazidime (30 µg), ≤ 25

mm with Ceftriaxone (30 µg), ≤ 27 mm with Cefotaxime (30 µg), ≤ 27 mm with

Aztreonam (30 µg) and ≤ 22 mm with Cefpodoxime (10 µg), was identified as

potential ESBL producers and short listed for confirmation of ESBL production.

Newly, chromogenic media is considered specifically for screening and identification

of ESBLs production (Black et al., 2005).

1.17.2 Minimum Inhibitory Concentration (MIC)

Commonly agar dilution and Broth dilution method were used. Both methods

have some advantages and disadvantages e.g. by using an inoculum replicating

apparatus, many strains (25-36), may be tested at a time by agar dilution method.

Microbial concentration can be detected more easily as compared to broth dilution

method.

In agar dilution method for organism blood and blood product can be easily

mixed, which cannot reliably be done in broth dilution method. The disadvantage of

agar dilution method is that it is time consuming and labour intensive task of

preparing the plates and inoculums (CLSI, 2010).

1.17.3 Confirmatory Tests for ESBLs

The synergistic test is the oldest method for phenotypic confirmation of ESBLs

producing organisms, first proposed in 1980 (Jarlier et al., 1988). A ceftazidim 30 µg

disc and amoxycillin/clavulanic acid 20/10 µg apart at a distance of 25 -30 mm, center

to center. After overnight incubation in aerobically at 370 C, and results of ESBL

29

production is interpreted by measuring an increase in the zone of inhibition around the

ceftazidim disc by the clavulanate.

Figure 1-4: Showing Double Disc Synergy Test

Note: Ceftazidime 30 µg, Augmentin 20+10 µg, Cefotaxime 30 µg

The disc on the left is cefotaxime (30mg): the disc in the center is coamoxyclav

(20+10 mg): the disc on the right is ceftazidime (30 mg). Note the expansion of the

zones around the cefotaxime and ceftazidime discs adjacent to the co-amoxyclav.

1.17.4 Modified Double Disc Diffusion Test

Mueller Hinton agar media use for inoculation with standardized inoculum (0.5

McFarland) sterile cotton swab applied. Augmentin (20 µg amoxycillin and 10 µg

clavulinic acid) disc were positioned in the center of the plate and test discs of 3rd

generation cephalosporin’s (Ceftazidime 30 µg, Ceftriaxone 30µg, Cefotaxime 30 µg

and Aztreonam 30 µg) discs were placed at 15 mm distance from the Augmentin disc.

The plate incubated overnight at 37oC. ESBL production is considered positive if the

30

zone of inhibition around the test discs increased towards the augmentin disc or

neither disc be inhibitory in action unaccompanied but bacterial growth is withdrawn

where the two drugs diffuse together. Augmentation of the zones of β-lactam-

containing discs towards the clavulanic acid disc is an indicator of ESBL production.

1.17.4.1 Disc Replacement Method for ESBL Confirmation

Two amoxyclave (AMC 30 µg) discs have been placed on Mueller Hinton agar

inoculated with the bacterial isolates. After 1 hour at room temperature, the discs were

removed and replaced with Ceftazidime (30 µg) and Ceftriaxone (30 µg). Each

cephalosporin disc was placed independent of the initial Augmentin discs and the

plates were incubated at 370C for 18-24 hours then read for evidence of ESBL

production. Positive disc replacement method indicated by an increase in inhibition

zone of 5 mm and above between the inhibition zones formed by the augmentin-

replaced cephalosporin discs and those placed independently.

1.17.4.2 Phenotypic Confirmatory Test with Combination Disc

This method includes the use of a third-generation cephalosporin antibiotic disc alone

and in grouping with clavulanic acid. Two combinations are commonly used used,

firstly a disc of ceftazidime (30µg) alone and a disc of ceftazidime + clavulanic acid

(30 µg/10 µg) and secondly cefotaxime (30.0µg) unaccompanied and a disc of

cefotaxime+CA (30.0µg/10.0µg) are applied. The disc are positioned at distance of 25

mm away from each other (center to center), on a flood culture of the strain on MHA (

Mueller Hinton Agar ) plate and overnightly incubated at 37°C. Zone differences are

measured in diameters with and without clavulanic acid. When there is an increase of

≥ 5 mm in inhibition zone diameter around combination disc of ceftazidime +

clavulanic acid versus the inhibition zone diameter around Ceftazidime disc alone, it

confirms ESBL production.

1.17.5 ESBL Vitek Cards

Conventional Vitek cards are very much reliable reporting ESBL producing

organisms in Laboratories as vulnerable to cephalosporins when MICs are ≤ 8 µg/ml

and these cards utilize cefotaxime and ceftazidime, alone (at 0.5 µg/ml), or in

combination with clavulanic acid (0.4 µg/ml). Inoculation of the cards is same to that

did for of normal Vitek cards (bio Merieux Vitek, Hazelton, Missouri).

31

Investigation of all wells is achieved automatically, once the growth control well

touched the threshold line (4 to 15 hr of incubation). A programmed reduction in the

growth of the cefotaxime or ceftazidime wells containing clavulinic acid, matched

with the level of growth in the well with the cephalosporin alone, designates a

positive result. Sensitivity and specificity of the method surpass 90%.

1.17.6 BD Phonex Programmed Microbiology System

Introduction of automated microbiology systems by Bacton Dickison Biosciences

(Sparks, Md) which identify bacteria and as well as check susceptibility in a short

incubation system, known as BD Phoenix. This method uses response of the growth

to the drugs of third generation alone and in combination with clavulinic acid, to

identify the production of ESBLs. Results are usually available within 6 hours. The

test organism has been identified by Sanguinetli et al., (2003).

1.17.7 The E test Method (Epsilon test)

These are impregnated strips (plastic drug) having a concentration gradient of

cephalosporins (ceftazidime, cefotaxime and cefepime with concentration of 0. 5 – 32

and 0.25 – 16 µg/ml respectively) manufactured by AB Bio-disk, Solna, (Sweden)

and BioStat, Stockport, (UK) plus a steady concentration of CA (4 µg/ml). If MIC

ratio is ≥ 8, it is interpreted as ESBL production (Health Protection Agency, 2005),

Accurate but expensive and are recommended as a confirmatory test by the BSAC for

ESBL analysis (Rupp et al., 2003). Florigin et al, 2002 found that E- test was more

sensitive than the disc diffusion test.

Phenotypic ESBL confirmation tests for routine are based on in-vitro inhibition of

ESBL by clavulinic acid (CA). These tests are tailored to identify ESBLs in Klebsiella

spp. but are uniformly valid to other Enterobactriaceae with a slight or no

chromosomal β- lactamase activity, such as E. coli and Proteus mirabilis. False

negative result can be obtained e.g. Strains that co-produce an inducible chromosomal

or plasmid mediated AmpC β- lactamase. Because AmpC enzymes may be stimulated

by CA and may than attack the cephalosporins, disguising synergy taking place from

inhibition of the ESBL (Pfaller et al., 2006). Also, false positive results are obtained

using inhibitor based ESBL detection: Mainly in Klebsiella oxytoca isolates,

hyperproducing the chromosomal β-lactamase (Wiegand et al., 2007).

32

1.17.8 Genotypic Detection

Phenotypic techniques are not capable to make a distinction between the specific

enzymes accountable for ESBL development of genes TEM, , CTX-M and SHV

types. Some researcher and reference laboratories use these methods for the isolation

of the specific gene accountable to produce the ESBL that have an extra capacity to

identify low level resistance. Moreover, molecular methods also have the capability to

be done in a straight line on medical specimens without culture, with consequent

decrease the time of recognition.

The detection of whether a specific ESBL present in a clinical specimens is associated

to enzymes (TEM and SHV ) is a complex procedure because point mutations in the

region of the active sites of TEM and SHV sequences have directed the AA

modification that raise the spectrum of activity of the patent enzymes, such as in

TEM-1, TEM-2, and SHV-1 (Farkosh, 2007). The molecular method commonly used

is the PCR amplification of the TEM and SHV genes with oligonucleotide primers,

followed by sequencing.

Molecular methods that do not utilize sequencing had developed to set apart ESBLs

and include Polymerase Chain Reaction (PCR) with Restriction Fragment Length

Ploymorphism (RFLPs), PCR with single strand CPL (conformational polymorphism

ligase) chain reaction, limit site insertion PCR and Rt-PCR. Amplification is

proressed by sequencing( nucleotide) remains the gold standard for the recognition of

of TEM or SHV ESBL genes by specific point mutation. This is not always

uncomplicated and price effective as the clinical specimens often have several copies

of these genes. Sequencing is the only method for identifying CTX-M genes, which is

labor-intensive, time-consuming and expensive. Xu and his colleagues report the

development of a rapid and accurate multiplex PCR assay for simultaneous

amplification of all CTX-M genes and differentiation of the five clusters (Xu, et al.,

2005).

1.18 Treatment

Antibiotic selection has been become an issue in the therapy of ESBL’s production,

mostly in patients with grave infections such as bacteremia. The reason is that ESBL

producing bacteria are frequently multi resistant to a variety of antibiotics, and CTX-

M producing isolates are co-resistant to the fluoroquinolones. Antibiotics are used on

33

a regular basis for empirical therapy of severe community-onset infections, such as

the third-generation cephalosporins (e.g. cefotaxime and ceftriaxone), are often not

helpful in opposition to ESBL-producing bacteria. This multiple-drug resistance has

foremost inferences for the selection of satisfactory empirical therapy schedule.

Empirical therapy is approved at the time when an infection is clinically diagnosed.

Whereas, the results of cultures and antimicrobial susceptibility sketch are expected in

infections caused by ESBL producing bacteria. A key challenge when selecting an

empirical schedule is to decide an agent that has sufficient activity against the

infecting organism(s). Pragmatic antibiotic choices should be individualized based on

institutional antibiograms.

1.18.1 β-lactam /β-lactamases Inhibitors

As ESBL producing Psedomonas spps are often susceptible in-vitro to combinations

of β-lactam / β-lactamase inhibitor. It is rational to presume that these arrangements

would also be clinically useful. But here we must know that AmpC enzymes are

normally resists.

1.18.2 Carbanepems

Imipenem and meropenem are the drugs of choice for treating the ESBL producing

bacteria (Samaha-Kfoury and Araj, 2003).

1.18.3 Quinolones

If there is in-vitro susceptiblity to CIP (ciprofloxacin), an acceptable clinical response

can be accomplished by the use of quinolones (Samaha-Kfoury and Araj, 2003).

1.18.4 Aminoglycosides

As like quinolones, aminoglycosides are valuable treatment against these pathogens

which produce ESBL. Susceptibility to amikacin appears to be conserved, in

comparison to tobramycin and gentamicin, thus explaining its utilization as empiric

therapy (Samaha-Kfoury and Araj, 2003).

1.18.5 Tigecycline

Tigecycline, first in class glycycline and an analogue of the semisynthetic antibiotic

minocycline, is a potent, broad spectrum antibiotic that acts by inhibition of protein

translation in bacteria by binding to the 30S ribosomal subunit and blocking the entry

34

of amino-acyl to RNA molecules into the A site of the ribosome (Amaya et al., 2009).

CLSI criteria are not yet developed to read the susceptibility measurement of

tigecycline. In-vitro data supports the concept that tigecycline can be measured an

substitute to carbapenems for cure of infections due to Enterobacteriaceae producing

ESBL. Though, clinical trials with tigecycline are still in developing stage (Rupp and

Fey, 2003).

1.18.6 Colistin

Although, it is some time ago considered to be a lethal antibiotic, clinicians have now

twisted to colistin as a choice of drug for the treatment of infections harboured by

MDR gram negative bacteria to which colistin, a cationic compound is active. The

cell membrane of bacteria is the target site of colistin. Where, the poly-cationic

peptide ring interacts with the lipid A of lipo-polysaccharides, allowing penetration

through the outer membrane by displacing Ca+2

and Mg+2

. Insertion between the

phospholipids of the cytoplasmic membrane leads to loss of membrane integrity and

to bacterial cell death (Amaya et al., 2009).

1.19 Pseudomonas Spp.

Genus Pseudomonas is an important member of the family Pseudomonaceae and

order Pseudomonadales; the bacteria are in a straight or sometime in marginally bent

form in shape, characteristically aerobic in nature and flagellated (polar) (Prescott et

al., 2002). Most of the hospitals borne infections are caused by Pseudomonas spp. and

severity of infections may be aggravated as a result of weakened or suppressed

immune system, like in neutropenic or cancer patients (Pagani et al., 2004). Previous

studies documented that Pseudomonas is rank 3rd

to cause UTI’s (Obritsch et al.,

2005). Dermatitis, Otitis, conjunctivitis, GIT, soft tissue and bone and joint infections

are often caused by Pseudomonas spp. (Pier and Ramphal, 2005).

As it is a devious pathogen therefore, mostly burn infections are harbored by this

pathogen (Van Elder, 2003). Pseudomonas strains (22 to 73%) have been isolated

from wound of burn patients reported in numerous studies (Komolafe et al.,

2003;Revathi et al., 1998 and Rastegar et al., 1998 ). Pseudomonas is the causative

agent led to death in burn individuals (Tredget et al., 2004). High rate of mortality in

burns infections are often originated from nosocomial acquired resistant P.

aeruginosa (Armour et al., 2007 and Aloush et al., 2006). P. aeruginosa creat

35

resistance based on modification of the target site, enzymatic breakdown and

impermeability of outer membrane (Hankook, 1998; Mesaros et al., 2007). ESBL

production is the main cause of resistance to β–lacatm documented in different studies

(Patarson and Bonom, 2005), ESBL have no outcome against cephamycins,

carbapenems and other related compounds but induce hydrolysis in oxyimino β-

lactams (Philippom et al., 1989).

In sub-continent, 22-36 % prevalence of ESBL production in Pseudomonas spp. has

been reported by various researchers (Ali et al., 2003; Singh et al., 2003) and the two-

drug synergetic activity is most effective in treatment of the Pseudomonal infections,

by using penicillin in combination with aminoglycosides and carbapenems or anti

Pseudomonal penicillin alone (Walkty et al., 2008)

Nevertheless, the resistance is growing to chemotherapeutic agents in Pseudomonas

spp. predominantly in ciprofloxacin (karlowsky et al., 2003). Several studies have

been recognized as an increase rate of resistance to penicillin, cephalosporins and

aminoglycosides in Pseudomonas (Shahid and Malik 2005; Gad el-domminy et al.,

2008).

1.20 Biofilm Formation

A biofilm is the adhesion of the aggregation of cells on a surface of any group of

microorganisms, the sticky cells are most likely implanted in the matrix of

extracellular polymeric substance (EPS) produced by itself. The EPS of biofilm which

is also referred to as slime, is a polymeric accumulation normally comprised of

extracellular DNA, proteins and polysaccharides. Hospitals and industries are the

areas where biofilm formation can be prevalent and may be formed on hospital

devices like catheter and in living bodies (Hall, 2004; Lear, 2012).

Biofilm Formation starts with the adherence of microbe to the surface; initially the

adhesion of colonies is reversible weak bonding via intermolecular forces. If these

cells are not detached instantly from the cell surface, then they might be attached

more undyingly using cell sticking to structures ( pili). Hydro-phobicity is the main

character to identify biofilm formation of the bacteria as thay are with augmented

hydro-phobicity and have condensed repugnance between the bacterium and the EM

(Donlan, 2002).


http://en.wikipedia.org/wiki/Polymer

http://en.wikipedia.org/wiki/DNA

http://en.wikipedia.org/wiki/Protein

http://en.wikipedia.org/wiki/Polysaccharide

http://en.wikipedia.org/wiki/Pilus

36

Motile bacteria are considered to recognize the surface and make cell aggregation

easily than immotile bacteria. After the colonization, biofilm grows in mass through

multiplications of cells. Bacterial biofilms are surrounded by polysaccharide. These

structures (matrices) may also hold matter from near by setting i.e minerals, blood

components, such as fibrin and RBC and soil particles (Donlan, 2002).The final

stage of biofilm formation is dispersion in which it is established where it may onlu

alter its shape and size only.

1.20.1 Development of Biofilm

There are five phases of biofilm development:

1. Preliminary binding:

2. Permanent attachment:

3. First stage of Development (I):

4. Second stage Development (II):

5. Diffusion:

Figure 1-5: Development of Biofilm Formation

Note: Five stages are involved in the development of biofilm: (1) Initial attachment, (2) Irreversible attachment, (3) Maturation I,

(4) Maturation II, and (5) Dispersion. Each stage of development in the diagram is paired with a photomicrograph of a

developing P. aeruginosa biofilm. All photomicrographs are shown to same scale.

http://en.wikipedia.org/wiki/Polysaccharide

37

1.20.2 Extracellular Matrix

The extracellular polymeric substance secreted a matrix that protect and intact

biofilm. These matrices are not only composed of polysaccharides but some protein

and nucleic acids also contributed towards its formation. Both hydrophobic and

hydrophilic EPS play an important role in the formation of biofilm (Stoodley, 1994).

The properties of biofilm bacteria and free living are significantly different from each

other as the protected and dense settings of biofilm allows tehm to facilitate and

interact in different ways. Biofilm structure is stabilized by Lateral gene transfer

(Molin, 2003). The structural component of several biofilm forming microbes are

extra cellular DNA and break down of the Extra cellular DNA enzymatically can

deteriorate the structure of biofilm, by releasing cells from the surface to which they

are in contact (Jakabovics, 2013).

On the other hand, biofilm formation by Pseudomonas aeruginosa are not largely

resistance to the drugs just like the stationary-phase planktonic cells, but on

exponential phase means on log phase they do matter a lot and show greater resistance

and biofilms may be due to the presence of persisted cells (Spoering, 2011).

Numerous different bacteria form biofilms like gram-negative bacteria E. coli or

Pseudomonas aeruginosa) (Abee, 2011).

1.20.3 Biofilms and Infectious Diseases

About 80 % of all infectious diseases are caused by Biofilms formation in the human

body. Infections development governed by biofilms had been associated with general

complications such as vaginosis, UTIs, catheter infections, otitis and plaque

formation, (Roger, 2008) gingivitis, coating contact lenses (Imamura, 2008) and not

as much but more fatal complication i.e., infections of permanent indwelling devices ,

cystic fibrosis and endocarditis (Parsek, 2003). Impairment of topical antibacterial

action as well that of cutaneous wound healings are due to the biofilm formation and

treating infected skin wounds are complicated much more than the ordinary cells

(Davis, 2008).

Biofilms can also be developed on the exterior of implanted equipments such as IU

devices, PCV (prosthetic cardiac valves) and catheters. Novel techniques are being


http://en.wikipedia.org/wiki/Lateral_gene_transfer

http://en.wikipedia.org/wiki/Pseudomonas_aeruginosa

http://en.wikipedia.org/wiki/Persister_cell

http://en.wikipedia.org/wiki/Escherichia_coli

http://en.wikipedia.org/wiki/Pseudomonas_aeruginosa

http://en.wikipedia.org/wiki/Urinary_tract_infections

38

implied to distinguishthe bacterial cells harbouring in living organism (tissues with

allergy-inflammations) (leevy, 2006).

1.21 Aims and Objectives

The main objectives of the study are as under:

1. Isolation, identification and preservation of Pseudomonas.

2. Development of antibiotics susceptibility patterns of these bacteria by disc

diffusion method and MIC method.

3. Detection of ESBLs in the clinical isolates of Pseudomonas.

4. Molecular characterization of ESBLs.

5. This study will offer strategy to clinicians in recommending different antibiotics

group in the non-existence of C/S information when apply empirical therapy.

39

CHAPTER 2

2 LITERATURE REVIEW

Peirovifar et al., (2014) recognized the prevalence of ESBL producing pathogens in

neonatal sepsis and its impact on clinical outcome. The study was carried out from

Jan 2012 to Jan 2013 on all neonates who had sepsis. One hundred three neonates

with 257 ± 23 days of development age were included in this research and 54% of

them were male.The most common strains isolated were Acinetobacter spp,

Pseudomonas Spp. and K. pneumoniae. The frequency of β-lactamase production in

Pseudomonas aeruginosa was 53.3%. Among 38 expired Neonates 34 were β-

lactamase producers. High prevalence of β-lactamase was observed. ESBL production

was identified for common isolated organisms in neonatal sepsis. ESBL production

rate was 95.5% and 86.7% in Klebsiella pneumoniae by combined disk test (CDT)

and double disk synergy test (DDST) method, respectively. Which were positive for

ESBL production in 78.6% and 64.3% of E. coli isolates, respectively.

From India Vinodhini et al., (2014) considered 275 gram negative for ESBLs

detection using double disk synergic and Phenotypic confirmatory tests.

Commercially existing combinations of 4 types of beta-lactamase inhibitors

(Ampicillin/Sulbactam, Piperacillin/tazobactam, Amoxycillin/Clavulanic acid and

Ticarcillin/Clavulanic acid) were used for antibiotic susceptibility. Among 351

samples Klebsiella spp (73), Salmonella spp (58), E. coli (53), P. aeruginosa (37),

Enterobacter spp (31) and Proteus spp (26) were reported and out of which ESBLs

positive samples were 151.

The suscepitablity of P/T (88.74%) was found beast among the all samples while A/C

(84.76%) and A/S (83.44%) were also at their best postion after P/T. On the other

hand author reported poor activity of T/C (71.52%) in contrast to the other three

antibiotic combinations against all the samples. Substantial activity against Klebsiella

spp (92.30%) and P. aeruginosa (90.47%) was revealed by A/C whereas significant

inhibitory activity against Klebsiella spp (96.15%), E. coli (92.68%), P. aeruginosa

(90.47%) shown by P/T. Activity against P. aeruginosa (90.38%) and Klebsiella spp

(90.38%) was given by A/S.

40

Singh et al., (2014) determined the distribution of bacterial pathogens causing

nosocomial infections and their anti-biogram, a surveillance data from January to

December 2011 was collected. A total of 1800 specimens were collected comprising

766 urine samples followed by blood (428) and pus (216), Pus, blood, urine, sputum,

etc. were taken from hospitalized patients with a stay for more than a week. Gram

negative bacilli were isolated, identified, and subjected to antibiotic sensitivity test.

A total 1800 samples were included, maximum growth was found in the pus samples

(70%). ESBL production was also high in the pus samples (90%). These ESBL

positive organisms were further subjected to antibiotic sensitivity tests and huge

amounts of resistance was noted to the conventional drugs including the higher end

agents like Carbapenems. Considering this, newer drugs like Tigecycline, Colistin,

and Polymyxin B were also tested. Barring Tigecycline, none showed favorable

results. A noteworthy finding was the sensitivity of the urinary ESBL isolates to

Nitrofurantoin.

Ahmad et al., (2014) evaluated 250 HVS specimens isolated from GTI’s of female

respondents with age 18- 55 years. The isolates were screened and identified by using

different techniques i.e., microscopy, morphological, biochemical identification, API

system and sensitivity was checked by Vitek- 2 system.

Seventy three GNR were isolated from pregnant and non- pregnant women, (27.4%)

and (72.6%) respectively. Double disc diffusion test was used to screen all the isolates

for production of enzyme (extended spectrum β- lactamases). Out of 73 isolates, 45

(61.6%) were positive for ESBL, the distribution of ESBL among pregnant was 9 and

non- pregnant 36. All GNR’s produced AmpC β- lactamase (resistant gene) by using

DAT (Disc antagonism test). Of these 73 isolates, 6.8% produces AmpC β- lactamase.

Imipenem-EDTA combined disc method was employed for the detection of metallo β-

lactamase which were 25 (34.2%), among pregnant and non- pregnant, 25% (5),

37.7% (20) respectively and results exposed that more than one type of β- lactamase

enzymes are mainly produced by the isolates i.e., in E. coli, 71.4% accounted for ES-

β-lactamases and 45.2% M-β- lactamase production.

Ahmed et al., (2013) observed the occurrence of ESBL producing K. pneumonia. One

hundred thirty eight nosocomial infections suspected Egyptian patients were screened

41

for susceptibility pattern and genes (bla SHV and bla CTX-M) detection in K.

pneumonia.

Double disc synergy test (DDST) was used for confirmation ESBL production, while

phenotypic identification and multiplex PCR for detection of bla SHV and bla CTX-

M genes. The frequency of ESBL was 21%. In this study Antimicrobial susceptibility

pattern revealed that 6.7% was resistant to MEM and CIP,10% to (IPM/CLN) and

CN, 13.3% to (TZP), 20% to ERT and (SCF), 40% resistant to FEP, 46.7% resistant

to DO, CEF, CRO and LFX, 60% resistant to AK, 63.3% resistant to CFM and CAZ,

70% resistant to (AMC) and 90% of isolates resistant to (SXT), while Ten % were

positive for bla SHV and 53.3% bla CTX-M genes.

Al agmy et al., (2013) worked on 21 isolates of K. pneumoniae for detection of

resistance genes of ESC’s (extended-spectrum cephalosporins). These isolates were

phenotypically screened for ESBLs and PABLs and determination of MIC and DDT.

Genes were identified by DNA sequencing and PCR. Mobility of bla genes was

sought out by Matting out assay. K. pneumonia (6 isolates) were non-sensitive to ESC

while ESBL (5) carried out blaCTX-M-15 gene and PABL (1) having blaCMY-2 and

blaSHV were positive to this organism. Three of the isolates were the association of

CTX-M-15 and SHV-1 and two isolates of CTX-M-15 and SHV-12 respectively.

TEM-1 was found to be linked with both SHV and CTX-M-15 (2 isolates). Both

genes (CTX-M-15 and CMY-2) linked with class 1 enzyme (integrase) were placed

on conjugative plasmid. Due to the presence of CMY-2 ,CTX-M-15 and SHV-12

genes in K. pneumonia found resistant to ESC. CMY-2 and SHV-12 β-lactamase was

first time reported in this study in Cairo.

Mahmoud et al., (2013) investigated the prevalence of MDR P. aeruginosa and

ESBLs production in 287 indoor patients from Egyptian major hospital. Antibiotic

pattern of P. aeruginosa strains was checked for MDR and ESBLs production after

confirmation of bacterial prevalence. Among Fifty-seven isolates 9 % were MDR

while only 9.5% ESBLs producers’ strains were collected from hospital borne

infected patients. Both Multiple Drug Resistance and ESBL isolates were recoverd

from burn patients followed by UTI’s and then respiratory tract. Prevalence of MDR

was 52% and ESBL’s 45.6%. Both imipenem and Amikacin were active

chemotherapeutic agents. The most prevalent antibiotype (2) included 12 MDR

42

isolates, 9 clinical and 3 environmental isolates having same patterns. 61.5% of

ESBLs isolates harbor plasmids. Five groups have been demonstrated among our P.

aeruginosa isolates. Each had the same antibiotype and plasmid profile

Farrell et al., (2013) studied on a novel antimicrobial agent (Ceftolozane/tazobactam)

which had a good activity against P.aeruginosa and other common GN organism.

Susceptibility were evaluated by broth micro-dilution method to

Enterobacteriaceae and P. aeruginosa isolates, in which 15.7% were MDR and 8.9%

XDR to P. aeruginosa isolates. On the other hand, 8.4% were MDR and 1.2% XDR

to Enterobacteriaceae repectively. The most active drug was Ceftolozane/tazobactam

with 0.5/2 μg/ml (MIC50/90), to P. aeruginosa and exhibited better activity toXDR

(175 ) isolates 4/16 μg/ml (MIC50/90) and MDR (310) isolates with 2/8 μg/ml

(MIC50/90) while against Enterobacteriaceae,it demonstrated an excellent potency

with the concentration range 0.25/1 μg/ml (MIC50/90) and kept activity in the range of

4/>32 μg/ml (MIC50/90) against 601 Multi Drug Resistant samples however not to 86

strains of XDR that has >32 μg/ml (MIC50,) activity. The effectivenes was reduced

against ESBL-phenotype Klebsiella pneumoniae isolates was 32/>32 μg/ml (MIC50/90)

and a high frequency 39.8% to MEM co-resistance was reported in this starin

(phenotype).

Chaudhary et al., (2013) worked on extended-spectrum β-lactamase (ESBL)

producing pathogens and observed a steady increase in the frequency of pathogenic

bacteria producing ESBL Coupled with the increasing prevalence rates and their

association with high frequency of mortality and morbidity.

The clinical specimens from 2500 patients suffering from various infections were

collected and subjected to ESBLs screening. Prevalence level of ESBL producers was

53% in 1325 positive isolates. The most predominant ESBL producer was

Escherichia coli (64.2%) followed by Klebsiella pneumoniae (60.1%), Pseudomonas

aeruginosa (37.4%) and Acinetobacter baumannii (17.1%). ESBL producers

indicated the highest percentage of resistance to amoxicillin/clavulanic acid (64-79%)

followed by piperacillin/tazobactam (47-59%). A high incidence of resistance among

ESBL producers was observed against carbapenems such as imipenem/cilastatin (23-

36%) and meropenem (26-34%). However, most of the ESBLs producing pathogens

43

were highly susceptible to tigecycline, colistin and Elores (ceftriaxone+sulbactam

with adjuvant EDTA).

Brink et al., (2012) conducted a study to evaluate the occurrence of GNR and

comparison of their profile of resistance strains taken from the ICU’s of 8 Turkish

hospitals during 1996. The organisms were isolated from respiratory tract (38.8%)

and UTI’s (30.9%) patients. Amongst the isolated strains, Pseudomonas spp. (26.8%)

was the most common pathogen isolated. Imipenem was considered to be the drug of

choice otherwise all antibiotics showed high resistance (50%) rate to CIP, CFM and

Ak. CAZ; CLA, PIP; TZB have a par-low action against the strains of ESBL produce,

signifying that low activity of tazobactam was due to the increase frequency of

ESBL’s resistant strains.

Dugal & Purohit (2013) evaluated the frequency and resistant pattern of bacterial

isolates collected from patients having UTI and ESBL producers were identified. Of

the 112 screened samples E. coli (80%) was the most prevalent pathogens followed by

Klebsiella spp (16.07%). Fifty Nine percent of the isolates were obtained from

females. ESBLs were found in 27.6% of isolates in which mostly recovered from E.

coli isolates. The most common ESBL (51.6%) was CTX-M. Carbapenemase enzyme

was produced by 12.9% of ESBL and AmpC β-lactamase was also determined. ESBL

isolates demonstrated about 70 % resistance to FEP, AMP, AMP/SB and CIP.

Rewatkar et al., (2013) identified the Biofilm formation process, a total of sixty

clinical samples of S. aureus and P.aeruginosa were used. These strains were

identified by standard operating microbiological techniques. Kirby-Bauer disc

diffusion method was employed for antibiotic susceptibility pattern of biofilm

producing bacteria. Biofilm formation was detected by TM and CRA method. 54

isolates produced a high biofilm formation detected by Congo red agar method while

50 isolates exhibited strong biofilm formation by TM method and ten were non-

biofilm producer. Higher resistance was reported to biofilm producing bacteria in

comparison to non-biofilm producers according to the antibiotic susceptibility method

As Haque et al., (2012) characterized the bacterial pathogens in patients having gram

negative septicaemia. Further, evaluated the antimicrobial resistance and underlying

44

molecular mechanisms. A total of 70 cases of GNR sepsis were included in this

perspective study.

Antimicrobial susceptibility pattern and ESBL testing was performed by standard disc

diffusion method. PCR amplification was performed to identify blaCTX-M, blaSHV

and blaTEM type ESBLs. Conjugation experiments were performed to show resistant

marker transfer. The most prevalent isolates were Escherichia coli 58.6%, Klebsiella

Spp. 32.9% and Pseudomonas 8.6%, resistant to most of the antimicrobials including

cefazolin, ceftriaxone, cefuroxime, ampicillin and co-trimoxazole but sensitive to

imipenem and meropenem. ESBL and MBL production was seen 7.3% and 12.2% in

E. coli isolates respectively. Three isolates were found to have blaCTX-M-15 and two

of them also showed blaTEM-1 type enzyme, whereas, none of them was blaSHV

positive. Conjugation experiments using J-53 cells confirmed these resistant markers

as plasmid mediated

Kalantar et al., (2012) determined the incidence of Pseudomonas aeruginosa

infections among burn patients at Tohid Hospital, Iran. Of 145 hospitalized

individuals of the burn unit were suspected and 176 P. aeruginosa positive clinical

specimens were obtained. Antimicrobial susceptibility testing was adopted to find

extended spectrum β-lactamase producing P. aeruginosa using guidelines of the CLSI

with Double Drug Synergy (DDS) testing. PCR technique was used to screen the

isolates of the said specie for Gene Pseudomonas Extended Resistance (PER-1) and

Oxacillin (OXA-10) of ESBL’s. The mean age, surface area of the body and period of

hospital stay among the patients were: 29 years, 37.7%, and 10 days, respectively. P.

aeruginosa was detected in 100 isolates. The most common antibiotics were 3rd

generation cephalosporins i.e., cefotaxime, ceftriaxone and macrolide (ciprofloxacin).

In P. aeruginosa perceived isolates 28 were ESBLs positive. PER result indicated that

among the ESBL’s 48% and 52% were PER-1 and OXA-10 producers, respectively.

The bacteriological spectrum and susceptibility pattern of Pseudomonas species,

Acinetobacter spp. and Klebsiella species were evaluated in Saudi Arabia from June

2011 to May 2012 by Khan et al., (2012). Pseudomonas spp were 29% resistant to

Imipenem. Susceptibility among Gram negative bacteria was diminished in the ICU

45

with a high incidence and recommends that more active guidelines are required to

govern the spread of resistant organisms and extended spectrum β--lactamase (ESBL).

Lin et al., (2012) identified the clonal distribution by PFGE (pulsed-field gel

electrophoresis) and reliability of phenotypic detection of ESBLs was evaluated

among resistant isolates of P. aeruginosa against expanded-spectrum cephalosporins.

The antimicrobial susceptibility of 57 P. aeruginosa isolates from blood specimens

was examined.

ESBL phenotypes were determined by using cloxacillin-containing double disc

synergy test (DDST). The existence of 11 β-lactamase genes was detected by PCR.

Out of 57 isolates, 35 (61.4%) were PCR-positive for β-lactamase genes. 12 out of

35 isolates were PCR-positive for combination of ampC and ESBL genes, including

TEM, GES, SHV, VEB and OXA-I genes. The sensitivity and specificity of

cloxacillin-containing DDST were 84.1% and 54.5%, respectively. 09 clusters were

classified among 35 PCR-positive isolates by PFGE.

Pathak et al., (2012) defined the magnitude and profile of resistance of isolates to

ensure empirical therapy. The susceptibility was checked through disc diffusion

scheme. From 2568 patients, 716 pathogenic isolates were recovered;

included Staphylococcus aureus (n = 221; 31%), Escherichia coli (n = 149;

21%), Pseudomonas aeruginosa (n = 127; 18%), and Klebsiella pneumoniae (n =

107; 15%). GNR were predominant as 62%. The isolated pathogens Common

diagnoses included abscesses (56%), urinary tract infections (14%), blood stream

infections (10%), pneumonia (10%), and vaginal infections (10%). Maximum

resistance had been shown in β-lactams and fluoroquinolones, excluding for

piperacillin-tazobactam and imipenem.

Cross sectional study conducted by Muvunyi et al., (2011) find out the susceptibility

patterns of clinically pathogenic microbes causing Urinary tract infections (UTI’s) to

both hospitalized and non-hospitalized patients.

Ciprofloxacin resistant strain were evaluated and analyzed for ESBL-production.

Significant growth was yielded for 196 specimens. The most effective drug in UTI’s

was Fosfomycin-trometamol and imipinem antibiotics. The association of ESBL and

ciprofloxacin significantly existed.

46

Roshan et al., (2011) found out the susceptibility profile of ESBL producing Gram

negative strain from different clinical samples. The frequency of susceptibility pattern

of strains was evaluated. Out of the 308 ESBL produced isolates 99% were

susceptible to carbapenems, 84% to tazobactam/piperacillin, 81% to

sulbactam/cefoperazone, 12% to fluoroquinolones, 13% to cotrimoxazole, 59% to

amikacin and 18% to gentamicin. Among the urinary isolates 49% were susceptible to

Nitrofurontoin and only 5% to Pipemidic acid.

Umadevi et al., (2011) found the frequency and anti-biogram pattern of ESBL

producing GNR and used 3rd-generation cephalosporins. During February 2008 and

January 2009, 213 samples were collected and tested for ESBL production using

combination disc and double-disc approximation techniques.

ESBL producers, among E.coli (132), K. pneumoniae (54) and Pseudomonas (27)

strains were 81%, 74%, and 14%, correspondingly. E. coli exhibited least

susceptibility to AMC (7%) followed by CIP (9%), CN (9%), AK (68%), TZP (84%)

and IPM (100%). In the same way, the ESBL produced by K. pneumoniae

demonstrated a better susceptibility pattern to IPM (98%) then TZP (68%), AK(40%),

CN (15%), CIP (15%) and AMC (5%). ESBL produced by E. coli 87% and K.

pneumoniae 88% respectively exhibited MDR to CIP, CN and AMC. TZP and IPM

were found to be the most effective and unswerving drug for the ailment of infections

caused by ESBL producing pathogens.

Wadi, (2011) evaluated the susceptibility in gram-negative pathogens isolated from

ICU patients based on CDC-NHSN criteria. Patients and plan of medicine were

subsequently reviewed by two qualified physicians. Among 173 pathogens, E. coli

was most common strain and produced ESBL in (62.7%) strains followed by

Klebsiella, (58.6%), ESBL rates were 30.7%. Meropenem showed a better activity

than imipenem against Pseudomonas Spp, but SPR had better action than individual

carbapenems. The change in susceptibility patterns among ESBL-producers in

comparison to non-ESBL producers species indicated that carbapenems were more

active than the other classes of antibiotics and frequency of resistant ESBL to both

carbapenems were 5.6%; in Intensive Care Units (ICUs) and hospitals that suffer from

high frequency of ESBL-producers. Piperacillin/tazobactam (PIP/TAZ) showed

significant difference (p < 0.0001) between ESBL and non-ESBL producers.

47

Bali et al., (2010) screened ninety four (94) isolates for the detection of ESBL

production using the DDST and further typed for the genes bla (TEM, SHV, CTX-M

and OXA). Sixty five (69.14%) isolates were ESBLs positive which were evaluated

for Plasmid DNAs. About 7.69% of the positive ESBL did not show plasmid DNA.

Two additional strains were ESBL positive by PCR technique. The most prevalent

genotype was blaTEM (73.43%) then followed by blaSHV and blaCTX-M which

were 21.87% and 17.18% respectively. ESBL found in hospital isolates of K.

pneumoniae, E.coli, A.baumannii and P.aeruginosa are increasing day by day. As

these isolates turn out to be resistant to existing antibiotics and pass on the gene to

other strains, the rapid recognition of these strains are of medical importance.

Humayun and Iqbal, (2010) screened 515 strains of P.aeruginosa recovered from

different clinical samples for antibiotic resistant patterns. PCR test was used to know

the prevalence of ESBLs that were encoded by their specific genes. Seven different

antibiotics were checked for the Susceptibility using disc diffusion method. Isolates

conferred resistance to any of the two classes of antibiotics among the cephalosporins

were analyzed by PCR for the occurrence of ESBL and MBL gene. Out of the 515

samples, 45.63% were regarded as ESBL positive and 16.89% MBL positive and

14.36% had both ESBL and MBL co- existence. The rate of TEM gene was 45.10%,

followed by AMP-C 28.93% and SHV-type gene accounted for 26 % of specimens.

Among the MBLs, the rate of recurrence of NDM-1, IMP-1 and VIM-1 distribution

were 24.13%,, 28.73%, and 47.12% correspondingly. The pattern of susceptibility to

ESBL producers of P. aeruginosa to various antibiotics were as follows: 84.3%, to

TZP 83.8% to doripenem,74.1% to combination of CTX+EDTA+sulbactam; 66.5% to

IPM, 54.7% to meropenem and 44.8% susceptible to ceftazidime and 28.5% to FEP

Strains exhibiting both MBL and ESBL+MBL genes were resistant to nearly all drugs

apart from combination drug which was susceptibile to 97.3 and 95.1% respectively

and doripenem to11.3 and 19.5%.

Kokare et al., (2009) explained that biofilm formation of the microbial cells

irretrievably linked with a surface and generally enclosed in polysaccharide matrix. It

is composed mostly of microbial-cells and EPS (extracellular polymeric substance).

Extracellular polymeric matrix plays a variety of roles in structure and function of

different biofilm area. Sticking together to the surface offered a significant reward

such as shelter to anti-microbial, acquisition of novel genetic traits and availability of

48

the nutrient and metabolic co-operability. Anthony van Leeuwenhoek discovered

biofilm. The development of biofilm occurs in 3 steps and accounts for contamination

of food, decline of water quality and chronic bacterial infection.

The advent of resistant genes and haphazard usage of antibiotics contribute to the

propagation of resistant pathogens were reported by Resende, (2009). The microbes

were recognized biochemically and confirmed by using Analytical Profile Intex (API

20E) (Bio Merieux). A total 67 isolates were characterized as E. coli and 14.92%

accounted for K. pneumoniae followed P. aeruginosa 4.47% and then others.

Hundred percent resistances was shown by Aztreonam against the E. coli strains, 40%

to class penicillin, 20% to fluoroquinolones and 10% to gentamicin. Pseudomonas

spp. isolates, were completely resistant to β-lactam and β-lactam inhibitor (ampicillin-

sulbactam), whereas the resistance to gentamicin was placed in the midway.

Generally, low resistance frequency had been observed to the isolates.

Guembe et al., (2008) isolated the clinical samples causing intra-abdominal infections

under the global surveillance monitoring programme of antimicrobial Resistance

Trends (SMART) and find out the pattern of susceptibility of antimicrobial Gram

negative aerobic rods isolates. Five hundred and ten patients were chosen for the

study from whom 572 GNR (facultative and aerobic) were isolated during the period

of study. Community acquired isolates comprised 45% and remaining isolates were

nosocomial. Susceptibility pattern ranged from 96.5 %-100 % to carbapenem class,

while β-lactam and β-lactam inhibitors was 87.7%-94.3% susceptible. 3rd

generation

cephalosporin’s was 85.1%-94.3%, 89.5%-100% and 4th

generation cepefime was

76.3%-84.8%. Among the aminoglycoside 93.8%-100% susceptibility was observed

to amikacin. Susceptibility rates of β-lactamases decreases than that of non - β-

lactamases producers and CA accounts for 16% ESBL. Susceptibility profile to

ertapenem and imipenem, 28.2 %, 58.9% respectively, to β- actam/β- lactam

inhibitors (piperacillin-tazobactam,) it was 82%, to cephalosporins i.e., ceftazidime,

cefepime, (84.6 %, 76.9 %). and to ciprofloxacin and amikacin it was 71.8% and 82%

respectively.

49

Heffernan et al., (2007) presented the resistance of ESBLs to 3rd

and 4th

generation

cephalosporins, in addition to the former generations. In 2006, E. coli accounted for

0.7% (57/8707) and Klebsiella 4.2% (31/746) were ESBL producers. Thirty eight

resistant strains to cefoxitin were isolated and thereby possible PMAB (Plasmid

mediated AmpC Β- Lactamases) producers. Fifty five (55) E. coli and (28) K.

pneumonia strains accounted for 84 ESBL producing isolates. Genotypes CTX-M,

SHV and TEM were found 96.4%, 2.4% and 1.2% respectively in 84 ESBLs isolates

CTX-M ESBLs were further characterized into CTX-M-15 and CTX-M-14 and they

account for 77.8% and 13.6% respectively and the gene CTX-M-14 was just isolated

from E. coli. A novel ESBL was isolated and given the designation CTX-M-68.

Amongst the ESBL genotypes there had no significant linkage, whether these strains

were isolated from hospital or community acquired infections.

Hocquet et al., (2007) systematically screened out 120 bacteremic isolates of P.

aeruginosa for resistance mechanisms against fluoroquinolones, aminoglycosides and

β-lactams. Genotyping performed by Pulsed field gel electrophoresis (PFGE) revealed

that ninety seven were characterized by a single isolate clonally associated. Majority

P. aeruginosa strains were found to have significant resistance to one or more drug.

MexXY-OprM and MexAB-OprM efflux system has been produced by 36% of the

strains. Study showed that P. aeruginosa was accumulated resistance mechanisms

(intrinsic and exogenous) by not losing its integrity to produce severe infections of

blood-stream.

Kim et al., (2005) identified sixty two clinical isolates to be plasmid-mediated AmpC

β-lactamase and extended spectrum β-lactamase producers by DDST, PCR and gene

sequencing in 443 clinical isolates of Klebsiella spp and E.coli. Among these two

strains, the most commonly detected ESBL gene was blaCTX-M (3, 9, 14 and 15) and

blaSHV-12. Whereas, 4 types of plasmid-mediated AmpC β-lactamases i.e.,DHA-

1,ACT-1 and CMY-1 and 2 were also screened out. High level of resistance to

antimicrobial agents (streptomycin, tetracycline, kanamycin, gentamicin, tobramycin

and sulfisoxazole) was associated with the production of ESBL in comparison to non-

ESBL producing specimens.

50

Ryoo et al., (2005) assessed the frequency and genotypes of extended-spectrum β-

lactamases (Ambler class A). During February–July 2003, E.coli and K. pneumoniae

isolates were collected. Agar dilution and disc diffusion methods were employed for

the determination of susceptibility pattern and double disc synergy test for production

of ESBL. Genes of class A β-lactamases were identified by PCR amplification and

direct sequencing. Out of total 239 isolates, 23.0% of K. pneumoniae and 9.3% of E.

coli isolates were ESBL positive by double-disc synergy test. CTX-M-15 and CTX-

M-3 genes were the most frequent types of ESBLs of Ambler class A in clinical

isolates of E. coli isolates. Whereas, in clinical isolates of K. pneumonia two genes

SHV-12 and CTX-M-3 were reported. Two of the isolates produced both GES-3 and

SHV-12.

Tasli et al., (2005) investigated the genes TEM- and SHV responsible for production

of ESBLs in sixty three clinical specimens of Enterobacteriaceae and were screened

by; PCR, RFLP-PCR, isoelectric focusing, DNA sequencing and transfer

experiments. ESBLs isolates were subjected to PCR which showed that the trans-

conjugant strains had genes SHV, TEM accounts for 74.3% and 52.7% respectively,

while the combination of TEM and SHV genes was 32.4%. In trans-conjugants,

derived SHV was detected in 45 of the ESBL isolates by using PCR/NheI restriction

examination. TEM- and SHV-derived were identified by DNA sequencing in 18

chosen transconjugants. The genes SHV-2, 5 and 12 were found in 05, 07, and 05

samples, respectively. SHV-12 was first time reported in Turkey during this study.

Günseren et al., (1999) determine the prevalence of GN pathogens collected from

intensive care units of (08) hospitals in Turkey and compare their antimicrobial

susceptibility pattern to various antibiotics. Only aerobic GN bacterial strains were

collected from ICUs during the study period (1996). Using Etest, susceptibility

pattern to various antibiotics i.e., cefodizime, cefotaxime,cefuroxime, CAZ, CAZ/CA,

CTX, FEP, TZP, AMC, CN, AK, IPM, and CIP were evaluated. Five hundred forty

seven patients were subjected to screening and 748 specimens were collected from

them. Mostly specimens were isolated from respiratory tract 38.8% followed by

urinary tracts 30.9%. Among the isolated gram negative strains, the common isolated

pathogen was Pseudomonas spp. (26.8%) then followed by Klebsiella spp. (26.2%).

Majority of the antibiotics were highly resistance to the isolated strains. The most

51

active drug against the pathogens was Imipenem. Even though, frequency of

resistance surpassed 50%, CIP, FEP and AK were found to be somewhat useful. The

most important mechanism of resistance to β-lactam agents was the production of

Extended-spectrum β-lactamase enzyme. In contrast, less activity was shown by the

combination of agents, piperacillin-tazobactam, ceftazidime/clavulanate against

pathogenss that produce ESBLs.

52

CHAPTER 3

3 MATERIALS AND METHODS

This cross sectional study was carried out at Pathology Department (Microbiology

section) Khyber Teaching hospital, Department of Biochemistry Hazara University,

Mansehra and Institute of Biotechnology and Genetic Engineering, University of

Agriculture Peshawar from 2010 to 2014. During the study period 3450 samples were

collected from (03) three main tertiary care hospitals of Peshawar city viz; Lady

Reading Hospital (LRH), Hayatabad Medical Complex (HMC) and Khyber Teaching

Hospital (KTH). These hospitals provide the health care facilities to people of entire

Khyber Pakhtunkhwa Province. These screened samples only 334 yielded growth of

Pseudomonas spp. as these specimens were collected from suspected outdoor patients

(OPD) and indoor and were identified on the basis of standard operating procedures

(SOPs) given in District Laboratory Practice in Tropical Countries (Cheesbrough,

2000) and in text book of Microbiology (Prescott et al., 1999).

The specimens collected were comprised of pus (wounds, burns, ear, throat swabs and

high vaginal swabs), urine and blood from indoor patients (Gynae, Surgery, Medicine,

and burns units) and outdoor patients.

The designed study comprised of the following steps:

1. Samples collection.

2. Isolation and identification of pathogenic bacteria from the specimens.

3. Maintenance and preservation of culture strains.

4. Antimicrobial susceptibility testing method

5. Screening test for ESBLs.

6. Detection of biofilm formation phenotypically.

7. Detection of ESBLs. Genes (TEM, SHV and CTX-M) by PCR.

8. Gel electrophoresis.

3.1 Collection of Samples (Bacterial Isolates).

Samples which were cultured and processed at Pathology Department of Khyber

Teaching Hospital were collected as follows:

53

3.1.1 Collection of Pus

Sterile cotton swab sticks were used to collect pus from open lesions and aseptic

techniques were applied to aspirate pus or wound swab from abscess, burns and

wound infections, either by swab or disposable syringe while pus from ear, throat, and

High Vaginal Swabs were collected with the help of sterile cotton swab sticks.

Extraordinary care was taken to avoid infectivity with commensal organisms from the

skin (Cheesbrough, 2000).

3.1.2 Collection of Blood

Blood samples were collected in Brain Heart Infusion (BHI) media which was

commercially available in screw capped sterile bottles (5ml blood was added to 45 ml

BHI to give final volume to 50 ml having concentration 1:10).

3.1.3 Collection of Urine Specimen

A sterile, dry bottle/container was given to the patients and asks for specimen (10-20

ml). The midstream urine passed by the patients at early in the morning was collected

for examination. The patients were advised to follow the protocols suggested by

(Cheesbrough, 2000).

3.2 Inoculation of Specimens (Pathogenic Bacteria)

For isolation of bacteria, the specimens were routinely cultured on CLED, blood and

MacConkey agar. These agar plates were routinely cultured aerobically at 370C and

they were examined for growth after overnight incubation. The grown colonies were

isolated and recognized on the basis of relevant biochemical tests and characters such

as staining characters, motility, colony morphology, pigment production as per

standard laboratory protocols of identification.

54

Table 3-1: Specimens and Culture Media for Isolation Of Bacteria.

S.No. Specimens Media Manufacurer’s

1 Pus and HVS MacConkey, blood and chocolate

agar

Oxoid/British Drug houses

(BDH)/Aldrich

2 Urine MacConkey, blood and CLED Oxoid/BDH/Aldrich

3 Blood MacConkey, blood Oxoid/BDH/Aldrich

3.3 Composition of Reagents/Culture Media and their Preparation

The prepared culture media and reagents were of Sigma Aldrich, Merck, BDH

and Oxoid companies and their composition are as under:

3.3.1 Blood Agar Base (Facklam, 1980)

Preparation

Forty gram of agar was dissolved in distilled water (950 mL) and then sterilize by

autoclaving at 121°C temperature for 15 minutes at 15 psi pressure and then de-

fibrinated blood was added about 7% by proportion at around 40-45 °C temperature.

Table 3-2: Constituents of Blood Agar Base

Ingredients Concentrations(Gram/L)

Agar 15.0

Meat extract 10.0

NaCl 5.0

Tryptone 10.0

Final pH 7.3 ± 0.2

55

3.3.2 Nutrient Agar (Brit. Pharma)

It is a general purpose culture medium, however often used for less fastidious

pathogens. Its composition is as under:

Table 3-3: Constituents of Nutrient Agar

Constituents Concentrations (Gram/L)

NaCl 5.0

Peptone 5.0

Yeast extract 2.0

Meat extract 1.0

Final pH 7.4 ± 0.2

Directions

Twenty eight gram of powder was completely dissolve in 1000mL of distilled water

and then autoclaved at 15 pounds/inch2 pressure and 121°C for 15 minutes.

3.3.3 Cystine Lactose Electrolyte Deficient (CLED) Agar

The CLED was used for the screening of urinary tract pathogens. Thirty six (36)

grams of powder was dissolved in 1000mL of distilled water, thoroughly mixed all

the ingredients and then sterilize by autoclaving at 121°C and 15-pound pressure for

15 minutes.

56

Table 3-4: Constituents of CLED

Ingredients Concentrations (Gram/L)

Bromothymol Blue 0.02

L Cysteine 0.128

Meat extract 1.0

Meat extract / lab-lemco powder 3.0

Tryptone 4.0

Peptone 4.0

Lactose 10.0

Agar 15.0

Adjust Final pH 7.4 ± 0.2

3.3.4 MacConkey Agar (Eur. Phar, 2002)

According the manufacturer’s instructions, this differential medium was prepared.

Aseptic solid agar was dissolved by placing it in water bath at a temperature range of

44 to 46ºC. After that the liquefied medium 10-12ml was poured into the petri-plates.

For solidification, Petri Dishes were placed on a smooth surface. Then sample was

inoculated with the help of micropipette on solidified agar. The sample was mixed

thoroughly by tilting and rotating the plates in opposite directions. Laminar flow hood

was used to maintain aseptic environment. Eight (08) Petri-plates were prepared from

one dilution of agar and were incubated at 37ºC for 1 day.

57

Table 3-5: Constituents of MacConkey Agar


Crystal violet 0.001

Neutral red 0.03

Bile Salts #3 1.5

Sodium chloride 5

Lactose 10

Agar 15

Peptone 20

Adjust Final pH to 7.

3.3.5 Mueller Hinton Agar (MHA)(CLSI, 2006)

Thirty eight (38) g of MHA was dissolved in 1000 ml of distilled water. 10 -15 ml of

the liquefied agar was poured in plates by adjusting the final pH to 7.3 ± 0.1 at room

temperature, after autoclaving and then placed the plates for solidification in aseptic

environment (laminar flow hood). Inoculation was done by streaking the loop on

MHA agar. Dishes were placed in an incubator for 1 day at 37ºC and then checked for

bacterial growth.

Table 3-6: Constituents of Mueller Hinton Agar


Beef Extract 2

Starch 1.5

Acid hydrolysate of casein 17.5

Agar 17

Adjust Final pH to 7.3 ± 0.1 at room temperature.

58

3.3.6 Tryptic Soya Agar

Forty (40) g of powder agar was taken in 1000 ml of de-ionized water and then

thoroughly dissolved. The liquefied agar was sterilized by autoclaving for 15 minutes

at a temperature of 121°C.

Table 3-7: Constituents of Tryptic Soya Agar


Glucose 2.5

Di-basic K-phosphate 2.5

Papaic Digest of Soybean Meal 3.0

NaCl 5

Pancreatic Digest of Casein 17.0

Adjust, Final pH to 7.3 ± 0.2 at 25°C

3.4 Isolation and Identification of Bacteria

The specimens recovered from the suspected subjects were inoculated on CLED

nutrient, blood and MacConkey agars by mean of inoculating wire loop. GN strains

were isolated on the basis of morphological as well as bio-chemical characters

(motility, colony characteristics, sugar fermentation reactions, oxidase reaction, citrate

utilization, gas production and indole). For sugar fermentation and production of H2S

gas TSI medium was used. These micro-organisms were non-lactose fermenters and

give bluish transparent colonies smaller than E. coli on CLED agar and greenish color

colonies on MacConkey and which were Gram stained at the beginning.

3.4.1 Grams Staining

A drop (40ul) of 0.9% NaCl was placed on the center of a transparent slide and single

colony was taken by mean of aseptic wire loop to formulate a slim emulsion.

Emulsion was uniformly spread over the slide to make a thin film. Fixation of smear

was done by passing it over the flame, thricely. Initially, thin film was covered with

59

crystal violet stain for 1 minute. Then, it was washed with distilled water and again

covered with iodine solution for 30 seconds to 1 minute. Again, washed and cover

with acetone for de-colorization. The back side of the thin film slide was clean and

placed for dryness in the air. Then, counter stained with safranin reagent. The samples

were then subjected to microscopy to be examined compared with positive and

negative controls (Cheesbrough, 2006).

3.4.2 Preservation and Maintenance of Bacterial Isolates.

For short-term preservation isolates were sub-cultured routinely on nutrient agar petri-

plates weekly and placed at a temperature of 4 ºC. While for mid-term (upto 1 month)

storage, strains were preserved on TSA slants at 4ºC. For long-term storage,

specimens were preserved in -70 ºC freezer. The samples were preserved in 15 %

glycerol or 5-10 % Dimethyl Sulfo oxide (DMSO) in tryptic soya broth (TSB) to

nullify the damage of bacterial cells due to the formation of water crystals at ultra-low

temperature.

The samples were incubated overnight for growth on TSA. Transfer the growth

aseptically from the petri-plates to cryo-vials and then, freezed. From the frozen stock

culture, a single colony was streaked out and incubated overnight which reduced the

stress on the bacteria. Special measures were taken, as few strains were taken out at a

time by not freezing and thawing using ice bag. Plates were checked next for pure

colonies, mixed and weak growth were sub cultured weekly on TSA and maintained

at 4 ºC in the interim period. Grown organisms were preserved in suitable media for

18 hours in slant of a nutrient agar at 2-8 ºC, this preserved culture was used for

routine laboratory work for two (02) weeks. For long-term storage, isolates were

preserved in BHI broth with glycerol (10-20%) and to avoid any significant loss of

viability the stains were frozen at -20 to - 70 ºC until further study (Cheesbrough,

2006).

60

Table 3-8: Identification Chart for Pseudomonas spp. on the basis of Biochemical

Reactions

Biochemicals Reactions (results)

Lactose NLF

Citrate +

Oxidase +

Urease ±

Indole _

TSI slant Alkaline

TSI butt Alkaline

3.4.3 Biochemical Identification

The isolates were subjected to the following bio-chemical tests for characterization

and identification.

Test for Indole Production

Kovac’s reagent (4-dimethyl-amino-benzaldehyde-iso-amyl-alcohol,

hydrochloric acid) was used for indole production. Some bacteria have the capacity to

degrade amino acid tryptophan to indole. In this test, bacterial strains were cultured in

broth (peptone) that has tryptophan. Kovac’s reagent was added to the broth after

inoculation and over nightly incubated at 350C. Appearance of red colour ring on the

surface of broth within 5-10 minutes is the indication of positive result (Cheesbrough,

2006).

Citrate Utilization Test

The differentiation of Intestinal bacteria and other microorganisms was

carried out using SCA medium, which utilize citrate. A little amount of inoculums

were taken by mean of a straight wire and then specimen was inoculated on the

surface of slant. Citrate utilization is followed by alkaline reaction e.g. change of

color from light green to blue (Baily and Scott, 2006).

61

Spot Oxidase Test (Cytochrome Oxidase)

Spot oxidase procedure was adopted to recognize the organisms, which

produce the enzyme oxidase. Freshly prepared oxidase reagent was employed on the

strip of filter paper which was already soaked with 1% w/v aqueous tetra-methyl-p-

phenylene-diamine-dihydrochloride solution. A fragment of culture from the primary

dish was straight away rubbed on it with a help of tooth pick (sterile). positive

reaction was indicated by the development of deep purple blue color within 5-10

seconds (Baily and Scott, 2006).

Urease Test

Enterobacteriaceae is differentiated by the production of urease enzyme. The

culture medium which contains urea was used to identify the organism. Phenol red

was used as an indicator. Urea will be hydrolyzed by the urease producing enzyme to

NH3 and CO2. As NH3 is released into the medium, it becomes alkaline as revealed by

the change in color of phenol red.

TSI (Triple Sugar Iron Fermentation Test)

The three sugars (lactose, glucose, and sucrose) and FeSO4 are the most

important components of TSI (Warren, 2004). The concentration of Glucose to other

two sugar was 1:10.

Interpretation of Results

LF ( Lactose fermentation) changes the color of indicator (phenol red) of both

butt and slant to yellow, During fermentation process, a very little amount of glucose

was fermented and slant was oxidized to CO2 and H2O and appeared red (neutral or

alkaline),while butt which is oxygen deficient turn yellow. On the other hand, butt and

the slant will be red, If sugars are not fermented and the change of color was the

production of NH3 from the oxidative de-amination of AAs. Appearance of black

colour is the indication H2S production.

Motility Test

Motility of the bacteria was checked using motility test medium was used.

0.5% Semi-solid media was used for to detect the movement of the organism.

Inoculation was carried out by stabbing the bacterial strain with the help of a straight

wire hauling the inoculums just one time perpendicularly into the midpoint of the agar

62

butt. Turbidity throughout the medium is the indication of motility starting from stab

line, after overnight incubation (Baily and Scott 2006).

3.5 Antimicrobial Susceptibility Protocol (Method)

1. Antimicrobial Susceptibility Testing Method: Antibiotic susceptibility

patterns of identified isolates were studied. Routinely used different groups of

antibiotics were subjected to determine the antibiotic susceptibility pattern by using

Disc Diffusion technique (Bauer et al., 1966). Details of the antibiotics are shown in

(Table 3-9).

2. Minimum Inhibitory Concentration (MICs): Minimum inhibitory

concentrations were found out for different groups of the representative antibiotics.

3.5.1 Disc Diffusion Method by Kirby-Bauer Sensitivity Testing

Each bacterial strain was subjected to the disc diffusion test. In this technique,

impregnated discs with a specified concentration of antibiotic were employed on the

surface of MHA which was inoculated with test strains. Molecules of the Antibiotic

diffuse out from the disc into the medium, producing animatedly varying gradient of

antibiotic concentrations, although the pathogen initiates division and steps forward

towards the grave mass and antibiotic tends to inhibit growth. Agar was prepared per

the instructions given overleaf by the manufacturers and autoclaved at 15 psi pressure

and 121ºC for 15 minutes. Media was poured in to 150/90 mm diameter sterile petri-

plates with deepness of four (04) mm. To ensure even distribution of the inoculums,

surface was inoculated uniformly by cotton-swab in all possible directions rotating the

petri-plate and incubated at 37 ºC over nightly to verify sterility.

Inoculum and Inoculation

Preparation of inoculums: TSB was made by taking 4-5ml of medium and

then poured it into the screw-capped tubes and autoclaved at 15 Pound per Square

inch (psi) pressure and 121ºC temperature for 15 minutes to avoid contimination. The

media was refrigerated and kept in an incubator for 24 hours at 35 ºC prior to

inoculation.

Inoculum density was standardized to a final concentration of 1-2×108

colony

forming unit (CFU)/ml as described in CLSI and placed in an incubator for 2-6 hours

at 35ºC to check sterility. For the growth, a loop was used to touch the top of the three

63

to five colonies morphologically same from an agar plate were transferred into 4-5 ml

suspension (broth) and incubated at 35ºC until it achieves or exceeds the turbidity of

0.5 McFarland standards (absorbency at 625nm is 0.08 – 0.10 lambda). According to

0.5 McFarland standards, sterile saline was added to adjust turbidity of broth cultures.

Bacterial suspension was taken by soaking a sterile cotton swab; then swabbing the

Inoculum back and forth in all directions to flooded the whole area of the MHA plate

to ensure even distribution of inoculum.

Application of Discs

The plates were allowed to dry before applying discs, within 15 minutes discs

of given potencies were applied on inoculated plates with the help of forcep. 12

different antibiotics discs were applied on 150 mm or 5 discs on 90 mm plate, Discs

were positioned at 30 mm apart and not closer than 24mm, so that overlapping of

inhibition is minimized. Then plates were placed in incubator at 37ºC for 16-18 hour

in an upside down (agar side up). After incubation, dishes were checked and zones of

inhibition were measured. Antimicrobial discs used against Pseudomonas spp. are

listed below in table 3-9 (CLSI 2010).

Interpretation

Annually published CLSI M100 S series documents of zone interpretive criteria of the

discs’ diffusion were used that categorizes the zone diameters on the basis of varying

susceptibility. Organisms were categorized into three possible categories i.e.,

susceptible, intermediate and resistant to the antibiotics.

3.5.2 Determination of Minimal Inhibitory Concentration (MIC)

The agar dilution method was adopted for the evaluation of MICs; requisite to hold

back the growth of a micro-organism by an antimicrobial agents. As with the broth

dilution susceptibility tests, the agar dilution offers a quantitative result in the form of

MIC. Serial two-fold dilutions of antibiotics were made and incorporated into the agar

(molten) around 50 ºC.

64

Table 3-9: Antibiotics and their Specification.

S.

No

ANTIBIOTIC

GROUP

COMMON

NAME

ANTIMICROBIAL

AGENT

COD

E

DISC

STRENGTH

µg

1

Penicillin

Augmentin Amoxicillin//Clavulannic

Acid AMC. 30

Tazocin Pipracillin//Tazobactum TZP. 100/10

Amoxil. Amoxicillin AML. 10

2 Cephalosporin

Sulzone. Cefoperazone//Sulbactam SCF 75/30

Ceftaz/fortum Ceftazidime. CAZ. 30

Ceclor. Cefaclor CEC. 30

Claforan Cefotaxime CFM 30

Oxidil/rochiphin Ceftriaxone CRO 30

Maxipime Cefepime FEP 30

3 Quinolones

Enoxabid Enoxacin LFX 5

Novidate/ciproxi

n Ciprofloxacin CIP 5

Gatiquin Gatifloxacin GTX 5

Sparaxin Sparfloxacin SPX 5

Avelox Moxifloxacin. MXF. 5

4 Macrolides

Erythrocine. Erythromycin E. 15

Klaracid. Clarithromycin CLR. 15

5 Carbapenems

Meronem. Meropenem. MEM 10

Tienem Imipenem. IPM. 10

6

Aminoglycosid

s

Gentacin. Gentamycin CN 10

Amikin Amikacin AK 30

7 Tetracycline Vibramicine Doxycycline DO 30

Antimicrobial Powder

Active pharmaceutical ingredients (API’s) were supplied by the supplier of Sigma –

Aldrich (Germany) and oxoid (England) companies along with their details such as

strength and expiration. API’s were dispensed into aliquots and preserved in sealed

sterilized plastic-bags at -20ºC. Containers were allowed to warm at 25ºC prior to

opening, In order to stay away the process of condensation of water on the powder.

Potency

As the antibiotics employed for agar dilution were not 100% pure, therefore

assay strength of each lot of the antibiotics utilised were checked and standardized

solution were formulated by taking appropriate weighs of API’s with help of

following formula:

Weight (mg) = 1000/(Assay-potency (µg/mg) x Volume (ml) x Concentration (μg/ml)

65

Where, stands for weight of antibiotic in mg to be dissolved in volume V (ml).

P = potency given by the manufacturer (μg/mg)

V = volume required (ml)

C = final concentration of solution (multiples of 1000) (mg/l)

Preparing Concentration for Testing

a stock solution was Prepared of concentration of 10,000 (μg/ml) or 1,000

(μg/ml) for each drug to be tested.

Water was used as a solvent for most of the antibiotics however antibiotics

specifics solvents were also used listed in (Table 3-13)

Stock solution can be used for 6 months at room temperature without any

significant loss with exception of imipenem and clavulanate (shelf life).

Table 3-10: Antibiotic Dilution Scheme Volume of Stock

Strength of stock

solutions

To be added to 1L of agar in

ml Final concentration in Agar μg/ml

10,000 μg/ml

25.6 256

12.8 128

6.4 64

3.2 32

1.6 16

1,000 μg/ml

8 8

4 4

2 2

1 1

100 μg/ml 5 0.5

1.0 0.1

Pouring the Plates

1. Petri plates were labeled for each concentration of tested antibiotics.

2. The agar plates were prepared according to the manufacturer’s

instructions.

66

3. Media was cooled (between 45 to 50 ºC).

4. Suitable supplements were added to the media.

5. pH b/w 7.2-7.4 was adjusted at room temperature.

6. Antibiotic was added to the liquid agar.

7. The flask was swirled to mix the contents thoroughly.

8. Pouring of media into petri plates

9. Petri-plates were allowed to solidify at room temperature.

10. Control plates were also prepared which was only agar based, without

antibiotics and stored at 2-8 ºC fort-nightly culture and seneitivity.

3.5.3 Testing Isolates using Agar Dilution Method

Initial preparation

All concentrations of agar dilution plates and control plates were removed from

refrigerator to allow them to come to room temperature i.e surface of the agar become

dry. This can be achieved by slightly opening the lids of each plate and allow them to

remain on the table for 1-2 hours. A grid was prepared for each isolate and QC

organism. Round type of petri dishes were used for each of the concentration.

Preparation of Inoculum and Inoculation of Agar Dilution Plates

1ml of MHB was inoculated with an inoculum of 104 CFU per spot on the agar, with a

portion of 3-5 colonies of the organism which were morphologically the same and

incubated at 35C for 2-6 hours until it reached a turbidity that is equivalent or greater

than 0.5 McFarland standards. After incubation turbidity of the culture was adjusted

with sterile saline to 108

CFU/ml and then inoculum was adjusted with the saline to

104 CFU/ml. Then, 0.7 ml of the inoculum was transferred to each well of the plate.

Replicator consisted of block of wells was used at this point for transfer of organism,

containing metal pins with 3mm diameter and transfer 1-2 ul of inoculum on the agar

plate creating a 5-8 mm spot with a final concentration of inoculum on the agar

surface of 104

CFU/ml.

The plates were spotted with inoculums and were kept a side for dryness at 25 ºC,

then incubated at 35 ºC. As MIC’s is the minimum concentration of the drug

inhibiting the entire observable growth to be judged via magnifying glass. The

concentration at which plates exhibited no growth from inoculum spotting was

regarded as Minimal inhibitory concentration of the applied anti-microbial agents.

67

Table 3-11: Zone Diameter Interpretive Criteria in mm for Pseudomonas spp.

against different Antimicrobial Agents. (CLSI, 2010 & 2011)

Antimicrobial agents Discs

contents/potency

Susceptibility

(S)

Intermediate

(I)

Resistance

(R)

Amoxicillin 10 ≥ 22 17-21 ≤ 16

Amoxicillin+ClavulannicAcid 30 ≥ 22 17-21 ≤ 16

Pipracillin+tazobactum 100/10 ≥ 21 15-20 ≤ 14

Cefoperazone + Sulbactam 75/30 ≥ 19 16-18 ≤ 15

Ceftazidime 30 ≥ 18 15-17 ≤ 14

Cefaclor 30 ≥ 22 17-21 ≤ 16

Ceftriaxone 30 ≥ 18 15-17 ≤ 14

Cefepime 30 ≥ 18 15-17 ≤ 14

Levofloxacin 5 ≥ 17 14-16 ≤ 13

Ciprofloxacine 5 ≥ 21 16-20 ≤ 15

Enoxacine 10 ≥ 18 15-17 ≤ 14

Moxifloxacin 5 ≥ 19 16-18 ≤ 15

Gatiflaoxacin 5 ≥ 21 15-20 ≤ 14

Erythromycine 15 ≥ 23 14-22 ≤ 13

Clarithromycine 15 ≥ 18 14-17 ≤ 13

Meropenem 10 ≥ 19 16-18 ≤ 15

Imipenem 10 ≥ 19 16-18 ≤ 15

Gentamycine 10 ≥ 15 13-14 ≤ 12

Amikacine 30 ≥ 17 15-16 ≤ 14

Doxycycline 30 ≥ 21 16-20 ≤ 15

68

Table 3-12: MIC’s Break Points for agar Dilution (Interpretive Criteria ug/ml)

for Pseudomonas spp. against different Antimicrobial Agents. (CLSI 2010 &

2011)

Antimicrobial agents Susceptibility

(S)

Intermediate

(I)

Resistance

(R)

Amoxicillin ≤2 4 ≥8

Amoxicillin+ClavulannicAcid ≤ 4/2 4/2- 8/4 ≥16/8

Pipracillin+tazobactum ≤16/4 32/4 – 64/4 ≥128/4

Cefoperazone + Sulbactam ≤16/4 16/4-32/8 ≥64/16

Ceftazidime ≤8 16 ≥32

Cefaclor ≤32 32 -64 ≥128

Ceftriaxone ≤16 32 ≥64

Cefepime ≤8 16 ≥32

Levofloxacin ≤2 4 ≥8

Ciprofloxacine ≤1 2 ≥4

Enoxacine ≤2 4 ≥8

Moxifloxacin ≤0.5 1 ≥2

Gatiflaoxacin ≤16 32-64 ≥128

Erythromycine ≤0.5 1 ≥2

Clarithromycine ≤2 4 ≥8

Meropenem ≤2 4 ≥8

Imipenem ≤2 4 ≥8

Gentamycine ≤4 8 ≥16

Amikacine ≤4 8 ≥16

Doxycycline ≤4 8 ≥16

69

Table 3-13: List of Antimicrobial Agent Solvents

Antimicrobial Agent Solvents Diluent

Amoxicillin, Clavulannic

Acid

Phosphate buffer, pH 6.0,0.1 mol/l Same as solvent

Cephalosporins, Ofloxacin Phosphate buffer, pH 6.0, 0.1 mol/l Sterile distilled water

Carbapenem Phosphate buffer, pH 7.2,0.01

mol/l

Same as solvent

Macrolides 95 % ethanol Sterile distilled water

All the antibiotics not listed in the table were prepared with sterile distilled water.

3.6 Phenotypic Detection of ESBL

For the detection of ESBL the Isolates were screened phenotypically by the procedure

as described and recommended by CLSI guide lines to assess the prevalence of ESBL

in pseudomonas spp. Isolates stored at -20 ºC were refreshed on tryptic soya agar

medium for ESBL production by using disc Diffusion method.

3.6.1 Inoculum and Inoculation

For inoculum preparation, Tryptic Soya broth (CM129-OXOID) was made by

pouring 4-5ml of broth medium in screw capped tubes and sterilized by autoclaving at

121ºC for 15 minutes at 15 psi. The media was cooled and kept in an incubator for 24

hours at 35 ºC prior to inoculation.

In the CLSI procedure the inoculum density must be standardized to a final

concentration of 1-2×108

CFU/ml and placed in an incubator for 2-6 hoursat 35ºC to

check sterility. For the growth method, a loop is used to touch the top of the three to

five colonies morphologically same from an agar plate into 4-5 ml suspension (broth)

and incubated at 35ºC until it achieves or exceeds the turbidity of 0.5 McFarland

standard (absorbency at 625nm is 0.08 – 0.10 lambda). The turbidity of broths culture

were adjusted according to 0.5 McFarland standard by adding sterile saline against a

white back ground with contrasting black lines. A sterile cotton swab was soaked in

bacterial suspension; Inoculum was flooded on the entire surface of Mueller–Hinton

agar by swabbing back and forth across the agar in all directions to give a uniform

distribution of inoculum.

70

3.6.2 Screening of Isolates for ESBLs

3.6.2.1 Synergy Disc Diffusion Method

In the initial screening of ESBLs production, disc Diffusion method was used.

Discs of cefotaxime (CTX 30ug), ceftazidime (CAZ 30ug), ceftriaxone (CRO 30ug)

and Aztreonam (AZM 30ug) were positioned at a space of 25-30 mm apart from

AMC. Amoxicillin+CA (AMC =20/10 ug) was positioned in the center of the

inoculated plates containing Muller Hinton agar according to the CLSI

recommendations.

After overnight incubation, ZOI around the 3rd

generation (3G) cephalosporins

discs and ATM were exhibited. Extended zones that of one or more of the 3G

cephalosporins and aztreonam on the side nearest to the amoxicillin+clavulanic

showed by organism was ESBL. E. coli ATCC 25922 was used as a negative control.

3.6.2.2 ESBLs Phenotypic Confirmatory Test

Combination disc synergy test (CDST) was carried for phenotypic

confirmation of ESBLs for all the ESBL producing isolates as per CLSI, 2010

recommendations, as well as initially sensitive to third Generation Cephalosporin’s

(Tenover et al., 1999; Paterson and Yu, 1999).

3.6.2.3 Combination Disc Synergy Test (CDST)

In the phenol-typic confirmatory test by CDST, the strains were inoculated on

MHA and discs of CAZ (30ug) and CTX (30ug) alone and a disc in combination with

CA (30/10ug) were placed on the inoculated agar for each isolate. Both the discs were

positioned 25 mm at a distance centre to center, on a flood culture of the test petri-

plates and over nightly incubated at 37ºC. An increase in zone of inhibition ≥ 5 mm

for either antibacterial drug tested in combination with clavulinic acid versus its zone

when tested alone was designated as ESBL positive. E. coli (ATCC25922) was used

negative while Klebsiella pneumonia (ATCC700603) as positive control strains.

3.7 Detection of Biofilm Formation

Biofilm formation was phenotypically evaluated on Congo Red Agar (CRA)

plates and slime producer Pseudomonas spp were checked for biofilm formation. The

results were incorporated after every 24 hours, consecutively for three days (incubated

at 37 °C)

71

Interpretation of results:

Pink/red colonies showed No formation of biofilm

Darkening of colonies indicated Weak biofilm formation.

Dry black colonies Biofilm formation (Arciola et al., 2001).

Composition of CRA (0.8g CRA, 36g aq. Saccharose, 47g BHI and 1L distilled

water)

3.7.1 Biofilm Assay

Each isolate was screened for biofilm assay to find out biofilm formation.

Each strain was inoculated into 10 ml TSB and incubated overnight in a shaker (spin

100 rpm) at 37 C. U shaped 96 well (round bottom) sterile micro-titer plates were

used for each bio-film assay and inoculated at a 1/40 dilution.

Two hundred (200ul) was inoculated into each well; 5ul TSB (containing 108

cell/10ml), 95ul sterile TSB with 0.25 % Glucose (Cucarella et al., 2001). Four

controls were run along with the samples, incubated microtitre plate at 37 C for 24

hours. Cultures were discarded from each well and wash the plates thrice with 200ul

PBS. Well were air dried and then stained crystal violet/safranin. Absorbance of the

each well of the plate was finding out by safranin staining method and crystal violet

staining method.

3.7.2 Crystal Violet Staining

Contents of the wells were fixed with methanol and incubate at 25 C for 15

minutes and then discarded the contents of the well and were air dried. Well were

stained with 200µl of the 2 % crystal violet solution (2g crystal violet, 20 ml ethanol

(95%) and 80 ml ammonium oxalate) for 5 minutes and washed with tap water. Plates

were air dried before finding absorbance at 570nm using ELISA plate reader. 160µl

of glacial acetic acid (33%) was used to dissolve the contents of the well and then OD

was recorded (Stepanovic, 2000).

72

3.7.3 Safranin Staining

Each well of the microtitre plate was stained with 200ml of 1% safrann

solution then wells were washed with 200ml distilled water after 2-3 minutes and then

air dried before recording absorbance at 490nm using ELISA plate reader. Results

were interpreted as given below.

Incubation time for both staining methods was 48 h at 30ºC. Effect of dilution

factor on the biofilm development across the micro-titer plate were setup 1:40, 1:100,

1:200, 1:300, 1:400, 1:600 and 1:1000.

Interpretation of the Results

Absorbance of the samples (ODs) and average absorbance of the negative

control (ODc) was the basis for interpretation of results:

The samples were categorized as

Strong bio-film formation (4xODc < ODs), > 2

Moderate bio-film formation (2xODc < ODi ≤ 4xODc), 1-2

Weak bio-film formation (ODc < ODi ≤ 2xODc), >0.5<1

Non producer of bio-film (ODi < ODc). <0.5

Table 3-14: Isolate Allocation for Biofilm Assay on Micro-Titer Plate.

A B C D E F G H

1 NEG POS MH 3 MH7 MH8 MH10 MH11 MH13

2 MH14 MH18 MH22 MH28 MH34 MH42 MH56 MH69

3 MH 70 MH82 MH85 MH91 MH97 MH107 MH118 MH122










73

3.8 Molecular Analysis Detecting β-lactamase Genes TEM, SHV and CTX-M

1. DNA extraction from bacterial strains.

2. DNA Amplification by Tc (thermal cycler).

3. Gel electrophoresis.

3.8.1 Extraction of DNA from Bacterial Isolate.

Alkaline lysis method was used to isolated Plasmid DNA from clinical

specimens (Mack and Stürenburg, 2003). All clinical bacterial isolates were

developed for 12 hours on nutrient agar petri-plates. A single colony of each strain

was inoculated into 5-ml of Luria-Bertanii broth (LB) and incubated for 20 hours at

37º C. Cells from 1.5-ml of the overnight culture was yielded by centrifugation at

12,000 rpm for 5 minutes. 1.5 ml from LB media containing cells was taken in

Eppendrof tube, then 100 µl TNE buffer was added. The mixture was centrifuged for

1 min at 10000 rpm and supernatant was discarded. Again 100 µl NaOH (50 mM)

was added to pellet. After heating at 40ºC in water bath for 1 min, then 60 µl of IM

Tris HCl (pH 6.7) was added, vortexed and centrifuged at 10000 rpm for1 min. Then

supernatant was used as template (1µl) (Medici et al., 2003).

3.8.2 Amplification of DNA

For detection β- lactamase genes of the family TEM, SHV, CTX-M, PCR

technique was carried out.

Optimization of reaction protocol

Preparation of dNTP’s (Deoxy Ribonucleotide tri-phosphate)

13.5 µl of all four dNTP’s i.e. A , T, C and G were added to 986.5 µl of PCR

H2O to make the final volume to 1000 µl and stored at -20 °C. 20 µl was used for all

PCR reaction. Final mix contains 0.625mM of each dNTP/1 µl mix.

Preparation of Reaction Mixture

Amplification by PCR; To 50 µl of master mix containing 2.5 µl of dNTP’s

mixture (2.5mM of each) 1 µl of template DNA was added, 0.5 µl of Taq polymerase

(250 IU), 10X PCR buffer 5 µl (Ex Taq), 1 µl of each primer stock solution

(50pmol/l), and remaining volume was fulfilled by nuclease free water.

74

Table 3-15: Primer Sequence and PCR Condition to detect β- lactamase Genes

Target

Genes

PCR primer

5’-3”

Amplicon

size Reference

TEM F-ATGAGTATTCAACATTTCCGTG

R-TTACCAATGCTTAATCAGTGAG

840-bp

fragment,

(Sidjabat et

al., (2009)

SHV

primers

R-ATTTGTCGCTTCTTTACTCGC

F- TTTATGGCGTTACCTTTGACC

1051-bp

fragment

(Sidjabat et

al., (2009)

CTX-M

primers

F-TTTGCGATGTGCAGTACCAGTAA

R-CGATATCGTTGGTGGTGCCATA

544-bp

fragment

(Sidjabat et

al., (2009)

Amplification

The prepared PCR tubes with master mixture were placed in the eppendrof

thermal cycler. Amplification was carried out according to the following thermal and

cycling condition:

For TEM, SHV gene

Initial denaturation at 94ºC for 3 minute

Denaturation at 94ºC for 30 sec

Annealing at 50ºC for 30sec 35 cycles

Extension at 72ºC for 2 min

Final extension at 72ºC for 10 minutes

For CTX-M gene

Initial denaturation at 94ºC for 7 minute

Denaturation at 94ºC for 50 sec

Annealing at 50ºC for 40sec 30 cycles

Extension at 72ºC for 1 min

Final extension at 72ºC for 5 minutes

75

3.8.3 Gel Electrophoresis

The samples were subjected to gel electrophoresis for analysis subsequently to

PCR run. Agarose gel (1.5 %) was prepared in TAE and tank was filled with this gel

2.5 to 3mm over the the gel slab. PCR product was mixed with the loading buffer

(2ul) before running on the gel and 12 ul from each of the tube was dispensed into the

the single well previously made. Gel was run in electrophoresis tank at a 100v

potential difference; a marker of 1kb (fermantas) was run alongside the pcr product.

After running the gel, it was subjected to staining for 15 minutes with ethidium

bromide (1ug/ml) and then band were visualized under UV light in the gel

documentation system.

76

CHAPTER 4

4 RESULTS

The study was conducted on Pseudomonas spp. isolates of various clinical specimens

collected from the three main tertiary care hospitals of Peshawar city viz; Khyber

Teaching Hospital, Lady Reading Hospital, and Hayatabad Medical Complex,

Peshawar of indoor and out-door patients. These isolates were characterized for their

antibiogram, MIC’s, production of ESBLs and presence of tem, shv, and ctx-M genes

in microbiology section of Pathology Department at Khyber Teaching Hospital

(KTH), Department of Biochemistry, Hazara University, Mansehra and Institute Of

Biotechnology and Genetic Engineering (IBGE), University of Agriculture Peshawar

from 2010 to 2014 during which 3450 samples were collected from the three main

tertiary care hospitals of Peshawar city. Pseudomonas spp obtained from different

sources are listed below in (Table 4-1).

4.1 Prevalence Rate of Pseudomonas Spp. Isolates

The Pseudomonas spp were isolated from urinary tract (n 67; 20.05%), blood;

(n 16; 4.79%), others (HVS, respiratory tract and ear swab); (n 32; 9.58%), wounds

and abscesses; (n 162; 48.50%). These individual isolates were further screened for

different analysis to achieve and verify the claimed objectives of this study.

Table 4-1: Prevalence Rate of Pseudomonas spp. Isolates from Different

Specimen.

Sources Numbers n Frequency (%)

Urine 67 20.05

Pus 162 48.50

Blood 16 4.79

Burns 57 17.06

HVS, Ear swabs and Throat swabs (others) 32 9.58

Total isolated Pseudomonas spp 334

77

4.2 Frequency Distribution of Pseudomonas spp within Hospitals

A total of 334 isolates were recovered from the three tertiary care hospitals

included in the study from capital city of KPK i.e Peshawer. Out of these isolates

maximum were taken from KTH 191(57.18%), followed by LRH 79 (23.65%) and

then HMC 64 (19.16%). These indoor (n 232; 69.46%) and out-door (n 102; 30.54%)

isolates were idividualy screened for different test keeping in view the aims of this

study (Table 4-2)

Table 4-2: Frequency of Pseudomonas spp in Different Hospitals.

Hospital No. of isolates % frequency Out-door

patients

Hospitalized

Patients

KTH 191 57.18 59 132

LRH 79 23.65 28 51

HMC 64 19.16 15 49

Total 334 100 102 232

4.3 Frequency Distribution of Specimens in Different Sources and Gender

wise:

A total of 334 Pseudomonas spp. isolates were obtained from various clinical

specimens of indoor and OPD patients having some pathological complaints.

Specimens were taken from different sources; pus, urine, blood and others (HVS,

throat and ear swabs). The ratio of male to female patients under the study was 1:1.4

with a mean age of 25.9 ± 9.15 years as mentioned in the Table 4-3.

78

Table 4-3: Gender-wise distribution of Infections caused by Pseudomonas spp

among Different Age Groups.

Figure 4-1: Gender-wise Distribution of Male and Female among different age

Groups.

Note: The number of female was found higher except age group 31-40 years

Age group Male Female

0-10 19 27

11--20 14 23

21-30 25 47

31-40 27 17

S41-50 17 31

51-60 29 35

61 and above 8 15

Total 139 195

79

4.4 Susceptibility Pattern of Pseudomonas Spp to Various Antimicrobial

Agents.

Among the β-lactams, the most productive antimicrobial agent was class

carbapenem against Pseudomonas spp. Carbapenem includes imipenem and meronem

with a susceptibility pattern of 282 (84.43%) and 304 (91.02%) respectively. The

cumulative susceptibility patterns of Pseudomonas spp to different antibiotics are

given in the Table 4-4 with details.

In β-lactam agents, the frequency of susceptibility to cephalosporin 2nd

generation (Cefaclor) n 71; 21.26%, 3rd

generation (cefatazidime and ceftriaxone) n

111;33.23% and n 121;36.23%, respectively while while the 4th

generation cefepime

(n 162;48.5%) showed a higher activity among cephalosporin group.

Susceptibility observed to combination of β-lactams and β-lactamase inhibitors

was 82 (24.5%) to amoxicillin+clavulonic acid, 169 (60.78%) to

pipracillin+tazobactum and 231 (69.16%) to cefoperazone+sulbactum. Amongst the

non β-lactamase inhibitors, susceptibility to gentamycin and amikacin was n 62;

19.6% and n 216; 66.0% from group aminoglycosides subsequently.

In floroquinolones, maximum activity was shown by sparfloxacin and

moxifloxacin 186 (55.7%) and 206 (61.7%) respectively followed by ciprofloxacin

which had 168 (50.3%) inhibition rate, among the floroquinolones a gentle activity

was shown by enoxacin. Erythromycin had 64 (19.16%) and clarithromycin had

sensitivity of 142 (42.51%) in the macrolides group of antibiotics. While in

tetracycline class of antibiotic, 10.18% (34) strains were sensitive to doxycycline.

Even so, none of the antibiotic was found complete resistant to the Pseudomonas spp.

The resistance rate was highest for Tetracycline followed by Penicillin and the

isolates were co-resistant to macrolides and flour-quinolones and a mixedup activity

was demonstrated to the Cephalosporin 2nd

3rd

and 4th

Generation. Lower resistance

was recorded for carbapenems as shown in the Table No. 4-4.

80

Table 4-4: Cumulative Susceptibility Pattern of Pseudomonas spp to various

Antimicrobial Agents.

Antimicrobial

agents CODES

Sen

siti

ve

(N)

Inte

rmed

iate

(N)

Res

ista

nt

(N)

Sen

siti

ve

%

Inte

rmed

iate

%

Res

ista

nce

%

Amoxicillin AML 50 39 245 14.97 11.68 73.35

Amoxicillin+

ClavulonicAcid AMC 82 26 226 24.55 7.78 67.66

Pipracillin+

tazobactum TZP 203 55 76 60.78 16.47 22.75

Cefoperazone+

Sulbactam SCF 231 44 59 69.16 13.17 17.66

Cefaclor CEC 71 22 241 21.26 6.59 72.16

Ceftazidime CAZ 111 27 196 33.23 8.08 58.68

Ceftriaxone CRO 121 37 176 36.23 11.08 52.69

Cefepime FEP 162 17 155 48.50 5.09 46.41

Sparfloxacin SPX 186 14 134 55.69 4.19 40.12

Ciprofloxacine CIP 168 19 147 50.30 5.69 44.01

Gatifloxacin GTX 149 84 101 44.61 25.15 30.24

Enoxacine ENX 117 37 180 35.03 11.08 53.89

Moxifloxacin MXF 206 35 93 61.68 10.48 27.84

Erythromycine E 64 22 248 19.16 6.59 74.25

Clarithromycine CLR 142 37 155 42.51 11.08 46.41

Meropenem MEM 304 4 26 91.02 1.20 7.78

Imipenem IPM 282 15 37 84.43 4.49 11.08

Gentamycine CN 62 24 248 18.56 7.19 74.25

Amikacine AK 216 17 101 64.67 5.09 30.24

Doxycycline DO 34 19 281 10.18 5.69 84.13

81

Figure 4-2: Cumulative Susceptibility Pattern of Pseudomonas spp to various

Antimicrobial Agents

4.5 Susceptibility Pattern of Strain in Indoor and Outdoor Patients

Among the 334 Pseudomonas positive isolates, 102 were from outdoor

patients while 232 were recovered from indoor patients. Outdoor isolates showed a

higher frequency of sensitivity to almost all the antibiotics. Statistically, significant

values were obtained for 18 out of 20 antibiotics, as there is a marked variation in

susceptibility pattern of OPD and hospitalized patients. However, the susceptibility of

meronem and imipenem showed a narrow difference for indoor and outdoor patients

(Table 4-6).

Imipenem (88.79%) and Meronem (96.08%) were highly active antibiotics

from the class of carbapenems in indoor isolates, while outdoor isolates were 81.47%

and 91.18% susceptible towards these two antibiotics. 30.39% isolates were

susceptible to cefaclor, 41.18% to ceftazidime, 44% to ceftriaxone, and 59% to

cefepime (4th generation cephalosporin) of β-lactam agents from outdoor isolates,

while 17.2% were susceptible to cefaclor, 29.24% to ceftazidime, 32.76% to

GTX

82

ceftriaxone, and 44% to cefepime for indoor patients. These results showed that the

frequency of susceptibility is higher for outdoor isolates.

Amongst the β-lactams and β-lactamase (combined) inhibitors, cefoperazone-

sulbactam was 65% active, piperacillin-tazobactam was 56.9%, and Augmentin was

19.4% active against indoor isolates of Pseudomonas spp., while the percent activities

of these combined antibiotics against the outdoor isolates of the pathogen were

78.43%, 69.6%, and 36.27% by cefoperazone-sulbactam, piperacillin-tazobactam, and

amoxicillin + clavulanic, respectively. Amoxicillin showed 9.48% (indoor) and 27.45

(outdoor) susceptibility rates to the positive isolates.

Moxifloxacin had a maximum activity among the fluoroquinolones against

outdoor isolated followed by ciprofloxacin, sparfloxacin, gatifloxacin, and then

enoxacin with 70.59%, 58.82%, 56.86%, 52.94%, and 41.18% sensitivity,

respectively. In contrast, the rate of susceptibility of moxifloxacin was 57.76%,

sparfloxacin 55.17%, ciprofloxacin 46.55%, gatifloxacin 40.95%, and enoxacin

32.33% in hospitalized patients.

In aminoglycosides, amikacin (indoor patients = 60.34%, outdoor patients =

74.51%) had a better activity than gentamycin (16.38 and 23.53% indoor and outdoor

patients, resp.). In doxycycline only tetracycline had a diminished rate of activeness

for both indoor and outdoor patients, 5.17% and 21.57% (Table 4-5). Overall

susceptibility rate in the hospital was affected which might be due to increase of use

of antibiotics and nosocomial environment.

Overall susceptibility rate in the hospital was affected might be due to increase

antibiotics/ nosocomial environment.

83

Table 4-5: Comparative Susceptibility Pattern between Hospitalized and Out-

door Patients.

Antimicrobial

agents

Hospitalized

patients n

=232

Outdoor

patients

n=102

Hospitalized

patients n

=232

Outdoor

patients

n=102

S

(N)

R

(N)

S

(N)

R

(N)

S

(%)

R

(%)

S

(%)

R

(%)

AML 22 210 28 74 9.48 90.52 27.45 72.55

AMC 45 187 37 65 19.40 80.60 36.27 63.73

TZP 132 100 71 31 56.90 43.10 69.61 30.39

SCF 151 81 80 22 65.09 34.91 78.43 21.57

CEC 40 192 31 71 17.24 82.76 30.39 69.61

CAZ 69 163 42 60 29.74 70.26 41.18 58.82

CRO 76 156 45 57 32.76 67.24 44.12 55.88

FEP 102 130 60 42 43.97 56.03 58.82 41.18

SPX 128 104 58 44 55.17 44.83 56.86 43.14

CIP 108 124 60 42 46.55 53.45 58.82 41.18

GTX 95 137 54 48 40.95 59.05 52.94 47.06

ENX 75 157 42 60 32.33 67.67 41.18 58.82

MXF 134 98 72 30 57.76 42.24 70.59 29.41

E 35 197 29 73 15.09 84.91 28.43 71.57

CLR 88 144 54 48 37.93 62.07 52.94 47.06

MEM 206 26 98 4 88.79 11.21 96.08 3.92

IPM 189 43 93 9 81.47 18.53 91.18 8.82

CN 38 194 24 78 16.38 83.62 23.53 76.47

AK 140 92 76 26 60.34 39.66 74.51 25.49

DO 12 220 22 80 5.17 94.83 21.57 78.43

Note: S= Sinsitive, R= Resistant, N = Numbers and % = Percentage

84

Table 4-6: Comparative Correlation and Significance Analysis of different Drugs

Susceptibility against Pseudomonas Spp in Hospitalized and Outdoor Patients

Antibiotics Overall

Prevalence

Prevalence in

Exposed

Prevalence in

Unexposed

Odds

Ratio

Chi-

square

p-

value

AML 0.7 0.44 0.74 0.28

(0.15-0.51) 16.58 <0.001

AMC 0.7 0.44 0.74 0.28

(0.15-0.51) 17.97 <0.0001

TZP 0.7 0.65 0.76 0.58

(0.35-0.95) 4.8 <0.03

SCF 0.7 0.65 0.79 0.51

(0.3-0.88) 5.97 <0.02

CEC 0.7 0.56 0.73 0.48

(0.28-0.82) 7.32 <0.006

CAZ 0.7

(0.64-0.74) 0.62 0.73

0.6

(0.37-0.79) 4.175 <0.041

CRO 0.7

(0.64-0.74) 0.63 0.73

0.62

(0.38-1) 3.957 <0.467

FEP 0.7

(0.64-0.74) 0.63 0.76

0.55

(0.34-0.88) 6.262 <0.0123

SPX 0.7

(0.64-0.74) 0.64 0.74

0.622

(0.38-0.99) 4.109 <0.0427

CIP 0.7

(0.64-0.74) 0.64 0.75

0.61

(0.38-0.98) 4.268 <0.0388

GTX 0.7 0.41 0.72 0.62

(0.39-0.98) 3.65 <0.05

ENX 0.7

(0.64-0.74) 0.61 0.74

0.57

(0.35-0.92) 5.246 <0.022

MXF 0.7

(0.64-0.74) 0.65 0.77

0.57

(0.35-0.94) 4.93 <0.03

E 0.7

(0.64-0.74) 0.56 0.72

0.49

(0.28-0.87) 6.074 <0.0137

CLR 0.7

(0.64-0.74) 0.62 0.75

0.54

(0.34-0.87) 6.532 <0.0106

MEM 0.7

(0.64-0.74) 0.68 0.87

0.32

(0.11-0.95) 4.6 <0.032

IPM 0.7

(0.64-0.74) 0.67 0.83

0.42

(0.2-0.91) 5.083 <0.0242

CN 0.7

(0.64-0.74) 0.58 0.72

0.52

(0.3-0.9) 5.477 <0.0193

Ak 0.7

(0.64-0.74) 0.65 0.78

0.52

(0.31-0.87) 6.22 <0.01

DO 0.7

(0.64-0.74) 0.35 0.73

0.2

(0.09-0.42) 20.832 <0.0001

85

Figure 4-3: Graphical Representation of Statistical CI values of the Susceptibility

Results

90

4.6 Susceptibility Pattern of Pseudomonas spp. to different Agents from 2010-

2014

The changes in the susceptibility pattern during the study period from 2010 to

2014 against all types of clinical specimens were checked for various classes of

antibiotics. The sensitivity pattern of combined β-lactams and β-lactamase inhibitors

was 77.8% in 2010 and 70.5% in 2011, while a slight drift has been seen in the last 3

consecutive years which was 66%, 68%, and 61% for 2012-2013 and 2014 against

SCF. AMC showed an average 15% sensitivity rate throughout the study period. The

range was acceptable that is 11.9%–18.5%.

Carbapenem exhibited greater activity over other antimicrobial agents

against Pseudomonas spp. during the course of the study. Within the same class,

Meronem had a better activity than the imipenem over the entire duration; however,

both carbapenems had a range of 92.8% to 89.4% and 85.3% to 92%, respectively.

Among the beta lactams, all generation of cephalosporin used in the study had

consistently diminished rate of sensitivity: cefaclor was 24.1% sensitive in 2010,

while it has fluctuated to 19% in 2014; ceftazidime had an average of 34.14% for the

entire period. However, the 4th generation cephalosporin had shown an increase in

effectiveness rate from 53.7% in 2010 to 56.4% in 2011 and then a sudden decline

(43%) in the next three years.

Relatively a steady decrease has been examined with the following percent of

susceptibility rates to SPX over the study periods 63.8%, 56.4% 54.3%, 53%, and

then 52.4%. Among the fluoroquinolones, sensitivity rate for GTX was found 52%

and 50% in 2010 and 2011, respectively. However, a gradual decrease was noted in

the next three years (42.6%, 40.9%, and 35.7%). CIP frequency range was 45.2% to

57.4%. Also for MXF, isolates showed a reduction in susceptibility ranges from

68.5% in 2010 to 57.1% in 2014.

Erythromycin and clarithromycin were the least reliably active reagents against

the tested Pseudomonas spp. Overall there was a moderate decrease in susceptibility

rate to the antibiotic analyzed over the last five years of the study. Table 4-7 reflects

yearwise susceptibility pattern of isolates against individual antibiotic.

91

The variation in susceptibility between in-patient and out-patient was

statistically significant for almost all tested antibiotics (p<0.05). Indoor-patient

isolates exhibited high frequency of resistance to most tested anti-biotics, in

comparison to out-patient strains. But, the frequency of resistance to anti-biotics were

significantly dissimilar among in-patient and out-patient isolates.

Table 4-7: Year wise Susceptibility Pattern (Sensitivity) of Pseudomonas spp to

different Antibiotics.

Agents 2010

N (%)

2011

N (%)

2012

N (%)

2013

N (%)

2014

N (%)

Total

N (%)

AML 10 (18.5) 14 (17.9) 13 (13.8) 8 (12.1) 5 (11.9) 50 (15.0)

AMC 17 (31.5) 22 (28.2) 18 (19.1) 17 (25.8) 8 (19.0) 82 (24.6)

TZP 35 (64.8) 47 (60.3) 57 (60.6) 40 (60.6) 24 (57.1) 203 (60.8)

SCF 42 (77.8) 55 (70.5) 63 (67.0) 45 (68.2) 26 (61.9) 231 (69.2)

CEC 13 (24.1) 17 (21.8) 19 (20.2) 14 (21.2) 8 (19.0) 71 (21.3)

CAZ 22 (40.7) 27 (34.6) 29 (30.9) 23 (34.8) 10 (23.8) 111 (33.2)

CRO 21 (38.9) 30 (38.5) 33 (35.1) 20 (30.3) 17 (40.5) 121 (36.2)

FEP 29 (53.7) 44 (56.4) 41 (43.6) 29 (43.9) 19 (45.2) 162 (48.5)

SPX 34 (63.0) 44 (56.4) 51 (54.3) 35 (53.0) 22 (52.4) 186 (55.7)

CIP 31 (57.4) 37 (47.4) 47 (50.0) 34 (51.5) 19 (45.2) 168 (50.3)

ENX 21 (38.9) 25 (32.1) 34 (36.2) 24 (36.4) 13 (31.0) 117 (35.0)

GTX 28 (51.9) 39 (50.0) 40 (42.6) 27 (40.9) 15 (35.7) 149 (44.6)

MXF 37 (68.5) 52 (66.7) 55 (58.5) 38 (57.6) 24 (57.1) 206 (61.7)

E 11 (20.4) 14 (17.9) 18 (19.1) 13 (19.7) 8 (19.0) 64 (19.2)

CLR 27 (50.0) 37 (47.4) 38 (40.4) 24 (36.4) 16 (38.1) 142 (42.5)

MEM 49 (90.7) 72 (92.3) 85 (90.4) 60 (90.9) 38 (90.5) 304 (91.0)

IPM 46 (85.2) 67 (85.9) 79 (84.0) 54 (81.8) 36 (85.7) 282 (84.4)

CN 11 (20.4) 15 (19.2) 18 (19.1) 11 (16.7) 7 (16.7) 62 (18.6)

AK 36 (66.7) 49 (62.8) 63 (67.0) 42 (63.6) 26 (61.9) 216 (64.7)

DO 7 (13.0) 9 (11.5) 9 (9.6) 6 (9.1) 3 (7.1) 34 (10.2)

92

4.7 Minimum inhibitory concentrations (MIC)

The results of the in-vitro activities of the antimicrobials tested against

Pseudomonas spp. as depicted in Table 4-8, which reviews the MIC values inhibiting

50% (MIC50), 90% (MIC90) , range of the MICs and % susceptibility pattern of the

strains. Table 4-8 shows the con-cordance between disc zones diameter (mm) and

MICs values for antibiotics. The MIC90 (µg/ml) of imipenem against Pseudomonas

spp. was <1 and < 4, results achieved by agar dilution method verified the lowest

MICs values with MEM for Pseudomonas spp. MICs of MEM were frequently two-

fold lesser than MICs of IPM for the strains tested. MICs observed for carbapenems

as compared to the other antimicrobials tested were higher. The combination of

piperacillin and tazobactam varies and are in the range of 16 MIC’s 50 and > 128 in

case of MIC90 ug/ml) among the combination drug amoxicillin/clavulonic acid had

observed greater MIC 50 as well as MIC90 values; 32 and 64 respectively. Among the

cephalosporins 4th

generation cepifime showed an excellent activity for MIC’s 50 and

MIC’s 90, for others it was >128 and >256 ug/ml for CEC, >64 and >64 for CAZ and

for 3rd

generation it was recorded as >32 and >128. Gentamicin also had a lowest

MIC’s 50 and MIC’s 90 values in the aminoglycosides as compared to amikacin.

Doxycycline was the most ineffective antimicrobial against the microorganism

indicated in the table, which was >128 for MIC50 and >128 for MIC90. The

fluoroquinolones were comparably active agents against the Pseudomonas spp; CIP

had MIC50 value of 2-16 and MIC90 value were in the range of 0.5 to 4.

93

Table 4-8: MIC’s against the Tested Strains (MIC 50 and MIC 90)

Antibiotics % Susceptibility MIC50 (µg/ml) MIC90 (µg/ml)

AML 14.97 32 64

AMC 21.56 16 32

SCF 66.17 4 16

CEC 21.26 128 256

CAZ 34.13 64 64

CRO 36 32 128

FEP 48.5 8 32

CIP 46.71 2 16

GTX 52.40 16 128

MXF 58.08 0.5 2

MEM 91.02 1 4

IPM 87.43 1 8

CN 19.16 16 32

AK 67.07 4 4

DO 10.18 256 512

4.8 Prevalence of ESBLs

In this study, production of ESBLs was observed in 148 (44.32%) of the isolates

and the remaining 186 (55.80%) were non-ESBL producers (Table 4-9).

Table 4-9: Prevalence ESBL in Clinically Pathogenic Pseudomonas spp.

Organism Total isolates

(N)

ESBL Producers

N (%)

Non-ESBL

Producers

N (%)

Pseudomonas spp. 334 148 (44.32) 186 (55.68)

94

4.6.1 In vitro Susceptibility of ESBL and non-ESBL Producing Pseudomonas spp.

A high resistance rate was observed in the ESBL positive isolates as compared

to non ESBL strains as depicted in table 4-10.

A significant difference was found in susceptibility to the carbapenems,

quinolones, and β-lactam/β-lactamase inhibitors, statistically. Resistance of ESBLs to

the other class of antibiotics like penicillin and macrolides was a little a bit higher

than the non-ESBLs but statistically it was not significant.

The resistance conferred by ESBLs producing Pseudomonas spp. to

cephalosporin (CEC, CAZ, CRO, and CFP) was 14.2%, 20.3%, 14.3%, and 22.3%,

respectively, contrary to the non-ESBLs. Both ESBL and non-ESBL producers

isolates were almost resistant to tetracycline. Better susceptibility was experienced

with AK in both ESBL and non-ESBL producers, 50.7% and 75.8% respectively.. On

the other hand, pseudomonal susceptibility against antibiotics from the β-lactams and

β-lactamase inhibitors was observed. Augmentin was 16.2% and 31.2% for ESBL and

non-ESBL producers, respectively. It was 37.2% and 50.5% for ESBLs and non-

ESBLs producing isolate against GTX. Noble activity has been shown for both ESBL

and non-ESBL by the class carbapenems and the considerable activities by SCF,

MXF, and AK, which has a higher activity than cephalosporin. A higher resistance for

AMC, AML, and DO was evaluated in comparison to SPR and SPX of β-lactam

inhibitors and CLR and CIP member of quinolones given in Table 4-10.

ESBL positive bacteria were phenotypically confirmed using two combinations,

ceftazidime alone and with the combination of clavulinic acid (CAZ/CAZ-CLA) and

cefotaxime alone and with the combination of clavulinic acid (CTX/CTX-CLA). Most

of the bacteria showed ESBL positive by both combination (CAZ/CAZ-CLA, and

CTX/CTX-CLA). Both the CAZ/CAZ-CLA and CTX/CTX-CLA methods were

statistically significant.

ESBL: The odd ratio for AMC is given in Table 4-11, which means that the patient

who’s produce ESBL and showing resistant is .556 times less likely than patient

who’s produce ESBL showing susceptible treated by AMC. The confidence interval is

significant, indicates that there is an association between enzyme and AMC.

95

Wards: The chi square the P- value as shown in Table 4-13 and, which shows that

there is significant association between wards and enzymes.

Table 4-10: In vitro % Susceptibility of ESBL and non-ESBL Produced by

Pseudomonas spp

Pseudomonas

spp isolates

ESBL

Producers

Non-ESBL

Producers

ESBL

Producers

Non-ESBL

Producers

Antimicrobials S

(N)

R

(N)

S

(N)

R

(N)

S

(%)

R

(%)

S

(%)

R

(%)

AML 14 134 36 150 9.5 90.5 19.4 80.6

AMC 24 124 58 128 16.2 83.8 31.2 68.8

TZP 78 70 125 61 52.7 47.3 67.2 32.8

SCF 76 72 155 31 51.4 48.6 83.3 16.7

CEC 21 127 50 136 14.2 85.8 26.9 73.1

CAZ 30 118 81 105 20.3 79.7 43.5 56.5

CRO 22 126 99 87 14.9 85.1 53.2 46.8

FEP 33 115 129 57 22.3 77.7 69.4 30.6

SPX 62 86 124 62 41.9 58.1 66.7 33.3

CIP 55 93 113 73 37.2 62.8 60.8 39.2

ENX 43 105 74 112 29.1 70.9 39.8 60.2

GTX 55 93 94 92 37.2 62.8 50.5 49.5

MXF 80 68 116 70 54.1 45.9 62.4 37.6

E 36 112 28 158 24.3 75.7 15.1 84.9

CLR 66 80 76 110 44.6 54.1 40.9 59.1

MEM 128 20 176 10 86.5 13.5 94.6 5.4

IPM 120 28 172 14 81.1 18.9 92.5 7.5

CN 20 128 42 144 13.5 86.5 22.6 77.4

AK 75 73 141 45 50.7 49.3 75.8 24.2

DO 9 139 25 161 6.1 93.9 13.4 86.6

Note: S= Sinsitive, R= Resistant, N = Numbers and % = Percentag

96

Table 4-11: Comparative Correlation and Significant Analysis of different Drugs

against ESBL Producing Pseudomonas Spp.

An

tib

ioti

cs

Ov

era

ll

Inci

den

c/

Pre

va

len

ce

Pre

va

len

ce

in E

xp

ose

d

Pre

va

len

ce

in

Un

exp

ose

d

Od

ds

Rati

o

Ch

i-

squ

are

p-v

alu

e

AMC 0.44

(0.39-0.5) 0.29 0.49

0.43

(0.25-0.73) 9.175 0.0025

GTX 0.44

(0.39-0.5) 0.27 0.5

0.58

(0.37-0.9) 5.97 <0.01

TZP 0.44

(0.39-0.5) 0.38 0.53

0.54

(0.35-0.85) 7.27 <0.01

AML 0.44

(0.39-0.5) 0.28 0.47

0.44

(0.220.84) 5.587 < 0.018

SCF 0.44

(0.39-0.5) 0.33 0.7 0.21 39.526 <0.0001

CEC 0.44

(0.39-0.5) 0.3 0.48

0.45

(0.26-0.79) 7.192 <0.007

CAZ 0.44

(0.39-0.5) 0.27 0.53

0.33

(0.2-0.54) 19.092 <0.0001

CRO 0.44

(0.39-0.5) 0.1 0.59

0.08

(0.04-0.13) 116.833 <0.0001

FEP 0.44

(0.39-0.5) 0.2 0.67

0.13

(0.08-0.21) 73.069 <0.0001

SPX 0.44

(0.39-0.5) 0.33 0.58

0.36

(0.23-0.56) 20.501 <0.001

CIP 0.44

(0.39-0.5) 0.33 0.56

0.38

(0.024-0.6) 17.416 <0.0001

ENX 0.44

(0.39-0.5) 0.37 0.48

0.62

(39-0.98) 4.17 <0.05

MXF 0.44

(0.39-0.5) 0.41 0.49

0.71

(0.46-1.1) 2.35 <0.13

E 0.44

(0.39-0.5) 0.56 0.42

1.81

(1.05-3.14) 4.573 <0.325

CLR 0.44

(0.39-0.5) 0.46 0.42

1.19

(0.77-1.85) 0.63 <0.43

MEM 0.44

(0.39-0.5) 0.42 0.67

0.36

(0.16-0.8) 6.675 <0.0098

IPM 0.44

(0.39-0.5) 0.41 0.67

0.35

(0.18-0.69) 9.73 <0.0018

CN 0.44

(0.39-0.5) 0.32 0.47

0.54

(0.3-0.96) 4.482 <0.034

Ak 0.44

(0.39-0.5) 0.35 0.62

0.33

(0.21-0.52) 22.782 <0.0001

DO 0.44

(0.39-0.5) 0.26 0.46

0.42

(0.19-0.92) 4.111 <0.0426

97

Figure 4-4: Graphical Representation of Statistical CI values of the ESBLs

Results

106

4.9 ESBL and Non-ESBL producing Pseudomonas spp. ( Hospital-wise).

The overall frequency of isolation of ESBL producing organism at different

hospitalsis depicted in Table 4-12. The distribution of ESBL isolates varied,

considerably in each hospital. The highest incidence was observed at HMC (46.88%),

followed by KTH (45.03%). The Pevalence was comparatively less at LRH (40.51%)

Table 4-12.

Table 4-12: Hospital-wise Distribution of ESBL and Non-ESBL Producing

Pseudomonas spp.:

Hospital Total isolates ESBL Non –ESBL % frequency of

ESBL

KTH 191 86 105 45.03

LRH 79 32 47 40.51

HMC 64 30 34 46.88

Total 334 148 186

Table 4-13: Prevalence of ESBL in different (wards) for the Period 2010- 2014.

Wards Total

isolate ESBL

Non -

ESBL

% frequency

of ESBL

Chi Square

Burns 14 10 4 71.43

9.539

Medical 81 35 46 43.21

Surgical 98 52 46 53.06

Gynae/ENT 24 12 12 50.00

Others 15 3 12 20.00

Total 232 112 120 48.27

All included variables were assessed among in-patients and only 05 variables were

investigated among the out-patients. On uni-variate analysis, previous experience to

107

antimicrobial was linked with ESBL-production among both hospitalized and

community patients. Treatment with 3rd generation cephalosporins, severity of the

disease and medical ward access were in addition related with ESBL infection among

hospitalized patients. On multi-variate analysis, treatment with 3rd generation

cephalosporin (ceftriaxone) is the only risk factor being allied with ESBL infections.

4.10 Biofilm Formation

Pseudomonas spp. to form biofilm was assessed by streaking them on Congo Red

Agar. Based on their appearance on the plate, these isolates were placed in three

categories:

Black dry colonies ………………………Biofilm positive strains

Red/pink colonies………………………Biofilm negative strains

Darkening of colonies…………………Biofilm intermediate strains

The positive control Staph. aureus (NCTC 6571) produced black dry colonies

and was strong biofilm producer. Although results were read at 24, 48 and 72 hours

intervals, but there was no change in observation at these three time intervals. It was

observed that the colour change was clearer as time passed on. Only 6 isolates were

positive for biofilm production, 13 were intermediate and the remaining 26 were

negative at 37 °C on Cango Red Ager. On the same media at 30 °C, three were

positive, 11 were intermediate and 31 were negative for biofilm production (Table 4-

15).

108

Table 4-14: Univariate and Multivariate Analysis of ESBL and Non ESBL

among Inpatients and Out-door Patients.

Out Patients Variables

Gender ESBL

Positive Negative Chi Square Range Chi2

Female 22 38 1.158 .505---2.653

Male 14 28

Antibiotic History Positive Negative

Yes 28 18 9.333 3.594---24.239

No 8 48

Stay in Hospital Positive Negative

Yes 8 16 .893 .340---2.347

No 28 50

Undertaken Surgery Positive Negative

Yes 4 7 1.054 .287---3.872

No 32 59

In Patients Variables

Gender ESBL

Positive Negative Chi Square P-Value

Male 48 58 .802 .478---1.346

Female 64 62

Antibiotic History Positive Negative

Yes 76 69 1.560 .912---2.669

No 36 51

Stay in Hospital Positive Negative

Yes 42 32 1.838 1.057---3.194

No 70 98

3G Taken Positive Negative

Yes 54 13 7.663 3.864---15.197

No 58 107

Undertaken Surgery Positive Negative

Yes 19 39 .424 .227---.792

No 93 81

Wards ESBL Non ESBL Chi Square P-Value

Burns 10 4

9.539 .049

Medical 35 46

Surgery 52 46

Gynes 12 13

Others 3 12

109

Table 4-15: Biofilm Production of Pseudomonas spp. and three Controls using

Congo Red Agar Media.

Conditions

Positive Negative Intermediate

Samples

Number

(codes)

Total

Samples

Samples Number

(codes)

Total

Samples

Samples

Number

(codes)

Total

Samples

CRA 300C

22,56,

97 03

3,7,10,11,14,18,

34,42,69,70,82,

107,118,123,

127,128,131,

139,145,148,

158,159,172,

178,182,183,

187,139,200,

205, 207

31

8,13,28,85,

91,122,135,

138,147,153,

198

11

CRA 370C

14,22,

128,135,

153,

198

06

7,10,13,18,28,34

,42,56,69,70,

85,91,97,118,

127,131,139,

145,148,158,

159,183, 193,

200,205, 207

26

3,8,11,82,

107,122,123,

138,147,172,

178,182,187

13

Interpretation of results on Congo red agar:

Biofilm negative = -, Biofilm positive = +, Biofilm intermediate = ±.

Incubation for 24 hours unless otherwise stated.

4.10.1 Detection of Biofilm using Microtiter Plate Biofilm Assay

Micro-titer trays were used as a more quantitative measure of biofilm production.

Strains were grown in the wells for 24 and 48 hours and subsequently stained, washed

and the optical density read on ELISA plate reader. Each strain was repeated three

times under varying condition (except results for 48 hours which were repeated six

times) the averages can be seen in table 4-16. For all staining methods, the positive

oxford control was strongly adhere after 24 and 48 hour, however the adherence was

reduced at the lower incubation temperature of 300 C, which reflected across the 45

tests strains. The method of staining the culture with safranin or crystal violet then air

drying the wells, produced the inconsistent results when repeated and correlation

between results are not obvious 30 out of 45 safranin stained and 19 out of 45crystal

violet stained and air dried wells, produced different results when compared to crystal

violet dissolved in acetic acid, under the same incubation condition. When the crystal

violet stain was subsequently dissolved in 33% glacial acetic acid the results were

more reproducible. 21out of 45 strains were capable of producing some adherence

110

after 24 hours, albeit weak, whereas 27 strains were produce some adherence at 48

hours although the degree of adherence did not increase. Adherence was reduced to

30 0C and only 09.out of 45 strains adhered under these conditions. 08 strains

produced adherence at 37 0C after 24 hours but no adherence at the same temperature

after 48 hours, see table 4-16.

111

Table 4-16: Biofilm Production of Pseudomonas spp and Controls using Crystal

Violet and Safranin Stained Biofilm Assays

Samples

Crystal Violet

air dried

CH3COOH

and Crystal

Violet

CH3COOH

and Crystal

Violet

CH3COOH

and

Crystal

Violet

Safranin

370C 30

0C 37

0C 30

0C 48h 37

0 C

Pos. Control +2 - +3 +3 +2

Neg. Control - - - - -

MH3 +1 - - +2 +2

MH7 - +1 +2 - +1

MH8 +2 +1 - - +1

MH10 - - - +1 -

MH11 - - +1 +1 +2

MH13 - +1 -

MH14 +1 +1 - +1

MH18 - - - +1 -

MH22 +2 +1 +1 +1 +1

MH28 - - - -

MH34 - - +1 +1 +3

MH42 +1 - +1 - +1

MH56 - +2 +1 -

MH69 +1 - +1 +1

MH70 - - - -+1 -

MH82 +1 - - - +2

MH85 - - - -1 -

MH91 +1 - +1 +1 -

MH97 +1 - - +1

MH107 +3 - +1 - -

MH118 - +1 - +2

MH122 - - +1 -

MH123 +2 - - +1 +1

MH127 - - - +1 -

MH128 +3 +1 +2 +1 +2

MH131 - +1 -

MH135 +1 - +1 +1 +1

MH138 +1 - +1 +1 +1

MH139 - - - - -

MH145 - +1 - - +1

MH147 - - -

MH148 +2 +1 +2 +1 +3

MH153 - - - +1 -

MH158 - - - - -

MH159 - - - +1 +1

MH172 - - - +1 -

MH178 - - -- - -

MH182 +2 - +1 +1 +1

MH183 - - - +1 -

MH187 - - - +1 +3

MH193 - - - +1

MH198 +1 +1 +1 +1 +1

112

MH200 +2 - +1 +1 -

MH205 - - +2

MH207 +1 - +1 +1 +1

Interpretation of results of microtiter plate biofilm assay: non-adherent = -, weakly

adherent =+1, moderately adherent =+2, strongly adherent =+3.

4.10.2 Dilution of Stain Inoculated in Microtiter Tray Biofilm Assay

In addition to the general method for biofilm assay, a new study was done to

determine formation of biofilms in the wells of microtiter plate at a range of dilution

factors of inoculums (1:40, 1:100, 1:200, 1:400, 1:600, 1:800 and 1:1000). Five

strains were selected for this study and OD was read using the crystal violet dissolved

in acetic acid method of staining. It is clear from the results that biofilm formation

was highest at a dilution factor of 1:600, reflected by the highest OD for 5 strains. The

adherence can be noted which remains constant for about all the dilution.

4.11 Genes Encoding ESBL’s

We analyzed β-lactamases of these strains by PCR with a series of primers specific

for TEM, SHV and CTX-M genes. 100 samples were selected for PCR detection of

TEM, SHV and CTX-M genes among the ESBL positive Pseudomonas spp strains. A

high proportion of isolates were confirmed for CTX-M gene which encodes a total of

48 strains followed by TEM 38 and then 14 of them were SHV genes.

113

Figure 4-5: Genes Encoding ESBL's (TEM, SHV and CTX-M).

Note: Lane M shows DNA ladder (100bp); lanes 1, 4, 7, 10 are clinical isolates positive for ESBL’s SHV gene (having 1051bp

band); lanes 4 and 7 clinical isolates of ESBL positive TEM gene (840bp) and lanes 4, 7, 9 clinical isolates of ESBL positive

CTX-M gene (544bp); lanes 2, 3, 5 and 8 are clinical isolates of ESBL negative.

114

CHAPTER 5

5 DISCUSSION

Antibiotics are playing an important part in restricting morbidity and mortality

worldwide. But unfortunately, antibiotic resistance which is a global concern now, has

reached a pandemic proportion fuelled by human need, greediness and carelessness.

the worst consequence is that, the bacterial strains which attain resistance to one or

many first‐line antimicrobials create several challenges to healthcare, including:

higher rates of patient morbidity and mortality, raised drug costs, extended illness

length, and more costly disease control procedures. On the whole conclusion of these

studies of resistant infections is that resistance levels have been alarmingly higher

(David, 2008; Alp, 2004).

Surveillance is a key to the control of antimicrobial resistance. Facts and

figures found by surveillance to direct empirical prescribing of antimicrobial agents,

to identify newly developing resistances for the determination of importance for

research, to evaluate involvement strategies and potential control trials aimed at

dropping the prevalence of resistant pathogens.

Now a days antibiotics have been used extensively and newer antibiotics are

continuously being added for the treatment of various infections. Irrational useage of

β-lactam antibiotics in health care services centers and community have developed a

foremost issue directing towards higher morbidity, mortality and health care services

expenditures. Appropriate utilization of antibiotics is very important for a variety of

grounds. Research is more focused towards development of bacterial resistance

towards newly developed antibiotics. The unsystematic usage of antimicrobial drugs

has created a gigantic brunt on public health by choosing bacterial organisms resistant

to conventional antibiotics, leading to amplification in the case rate of hospital

infections and elevated ratios of morbidity and mortality. Some of the microorganisms

which are chief reasons of infection in human beings, e.g. gram negative bacilli which

contain Enterobacter spp. and Pseudomonas aeruginosa, are able to survive for

longer time spans in environment, so helping in assortment of resistant pathogens

prevalent in environment, and in health care facilities. New bacterial resistance is

115

developed because of gene transfer mechanism which is harbored in nature (Alp et

al., 2004; Ash et al., 2002; Sader et al., 1997).

The global appearance of multi-drug resistance of many bacterial sub-types is a

leading distress, particularly, in Pseudomonas spp. and P. aeruginosa infections

specifically. P. aeruginosa is an opportunistic pathogenic organism, with inborn

resistance to several antibiomicrobials and decontaminators as well as Ceftazidime,

anti-pseudomonal Penicillins, Ciprofloxacin, Aminoglycosides and Carbapenems

(Dundar, 2010). Diseasees caused by P. aeruginosa are often observed in healthy

individuals; however, in previous two (02) decades, the pathogen has developed

identity as the major etiology in patients with compromised immune systems (Wirth,

2009).

Most of the Pseudomonas spp were recovered from burn patients and results

indicates that due to common utilization of antibiotics (i.e. pencillins,

aminoglycosides, cephalosporins and tetracyclines) the resistance increasing

gradually. Resistance to antibiotics has aggravated in Pseudomonas spp throughout

the world (Gad et al., 2008). Pseudomonas is the major reason for hospital born

infections, posing greater intimidations to life-threatening situations. Its inherent

resistance capacity to several antimicrobial agents and its capability to build up

multidrug resistance enforces grim therapeutic problems (Gales, 2001).

In this particular study, a total of 334 Pseudomonas spp were recovered from

different clinical samples of which a greater part of pathogens were cut off from pus,

162 (48.5%) followed by urine 67 (20%), burns 57 (17.06%) and Blood 16 (4.79%)

(Table 4-1).

Various antimicrobial agents such as carbapenems, including meropenem and

imipenem, are the most effective antibiotics (Shahcheraghi, 2010) used for the

treatment of infections caused by Pseudomonas spp; however, higher use of such

drugs has turned out to be in the advancement of resistant carbapenem Pseudomonas

spp (Castanheira, 2004).

In this study, maximum activity was shown by sparfloxacin and moxifloxacin

55.69% and 61.68% respectively, followed by ciprofloxacin which had 50.3%

inhibition rate among the floroquinolone, and a gentle activity shown by enoxacin

which had 35.03%. Resistance to ciprofloxacin is recognized and associated with the

116

increased practice of this drug (Messadi et al., 2008). The frequencies reported in

other studies are contrary from USA, Europe and Latin Aamerica (Karlowsky, 2006;

Fedler, 2006). The increased incidence of Gram-negative bacteria resistance to

ciprofloxacin and levofloxacin (fluroquinolones antibiotics) agrees with the work of

Zhanel et al., (2003) who found increase resistance to fluroquinolones antibiotics.

Fluroquinolones rate of resistance may vary and dependent on origin of bacteria,

demography and indigenous antibiotic policies (Acar and Goldstein, 1997).

Fluoroquinolones are being used more extensively for ailment of burns and wound

infections and more operative against Pseudomonas (Khorasani et al., 2008). Rates of

susceptibility different drugs e.g. carbapinin ranges from 28 to 59%, piperacillin-

tazobactam28.2 %, cephalosporins, 59 to 82%, cefepime, ciprofloxacin and amikacin

are correspondingly, 71.8% and 82%; (Guembe 2008). Resistance to this class of

antibiotics (fluroquinolones) increasing day by day (Singh et al., 2003)

Penicillins inhibit cell wall synthesis and are bactericidal, (Katzung 2004). In this

study, amoxicillins, amoxyclauve were established 15 % and 24.55% susceptibility.

The study conducted in Pakistan reported had a high resistance rate of penicillins 98%

(Khan et al., 2008). It is similar to other studies plotted by (Ullah et al., 2009,

Sasirekhaet et al., 2010). Ampicillin showed a reasonable susceptibility in various

studies (Astal 2004; Gad, et al., 2008). Observations made in bangladesh showed that

as many as 65-92% of commensal species of Enterobacteriaceae and additional

pathogens isolated from urine showed resistant to frequently used antibiotics like

tetracycline, ampicillin and co-trimoxazole (Chowdhury et al,. 1994).

Cephalosporins have been practiced in the treatment of infection based by

Pseudomonas spp. (Cavallo et al., 2000; Gales et al. 2001). In current investigations

cefaclor, ceftazidime, ceftriaxoneand cefipime were found 17.24%, 29.74%, 32.76%

and 43.97% from hospital acquired and 30.39%, 41.18%, 44.12% and 58.82%

susceptible among OPD patients acquired Pseudomonas spp. respectively.

Susceptibility to fourth generation cepifime, reported in india which was 32% and

42% in Bulgaria to Pseudomonas spp. isolates (Chaudhury 2003; Strateva et al. 2007)

and particularly third generation Cephalosporins are used for Gram negative bacterial

handling (Samaha-Kfoury et al., 2003). The results of the third generation are in

similar coorelarion with other investigations done (Revathi et al. 1998; Strateva et al.,

2007). Sasirekha et al., (2010) and Singh and Goyal, (2003) performed similar

117

research in India and reported 16% susceptibility to cefotaxime and 25%, 15%

susceptibility for CRO and CTX respectively. Emerging cephalosporins, also

exhibited good activity against Pseudomonas spp. (Takeda et al., 2007 and Tsuji et

al., 2003) The prevalence of CAZ-resistant P. aeruginosa isolates were 24%, more

than the value recorded for P. aeruginosa hospital borne species of Europe and

Northern America (Jones et al., 1997 and Chen et al., 1995).

Aminoglycosides show much better commotion alongside gram negative

bacilli (Gonzalez and Spencer 1998). In the current findings, among the non β-

lactams, 64.67% microorganism were more sensitive to amikacin, subsequently

18.56% to gentamicin in agreement to studies performed by Sasirekha et al., (2010),

in France a higher susceptibility rate of 86 % of amikacin was reported by (Cavallo et

al., in 2007) and gentamicin has been in practice as they are marked a good treatment

in burn sepsis caused by Pseudomonas spp. (Stone, 1966). Augmented

impermeability and alteration enzymatically are vital mechanisms of resistance to

these drugs aminoglycosides) in Pseudomonas spp. (Poole, 2005). Many studies

reported as amikacin were more sensitive than gentamicin, but in case of over use, it

also develops resistance. Fifty nine percent resistance in India and 55.5% in

Bangladesh were recorded in 2010 against gentamycin (Ullah et al., 2009, Sasirekha

et al., 2010 and Haque et al., 2010). Susceptibility to genatmicin was recorded in

36.11% by Strateva et al. in 2007 and 21.3 % to Pseudomonas spp. by Strateva et al.,

2007). This might be, because of extensive usage of amikacin in Pakistan as

compared to other developed nations. Such variance in different regions might be due

to higher use of CN, caused by selective pressure of aminoglycosides (Miller and

Sabatelli, 1997).

Hospital acquired isolates were more resistant than the community acquired

isolates, it may be due to lack of antibiotic policy, irrational use of 3GCs mainly

ceftriaxone in the hospital (Shova, 2007) and the emergence of antibiotic-resistant

organisms in hospitals in concert with the use of high levels of antibiotics use caused

the emergence of resistant organisms and they might be inherently more virulent than

the organisms are sensitive (CDC, 2002). In general, pathogens in hospital are more

resistant to drugs due excessive use of antibiotics pressure and MDR in Pseudomonas

spp.is increasing worldwide (Strateva et al., 2007).

118

Plasmid encoded β-lactamases like Extended-spectrum β-lactamases present

considerable resistance to aztreonam, narrow and extended-spectrum cephalosporins,

and penicillins. Microorganisms docking ESBLs are also frequently resistant to

aminoglycosides, trimethoprim- sulfamethoxazole, and quinolones. Extended-

spectrum β-lactamases are the produce due to excessive use of third generation

cephalosporins (Paterson & Yu, 1999). Production of ESBL is commonly encoded by

plasmid and is responsible for carrying gene encoded resistance to other antibiotic

classes, that’s why limited options are there in treatment with antibiotics producing

ESBL (Paterson, 2005). Its hard to validate association of the prevalence of

Extended-spectrum β-lactamases, due of variations in current research study

(Friedman et al., 2005).

ESBL’s are widespread all over the world. The prevalence and genotype of

Extended-spectrum β-lactamases from clinical samples differ in relation to the

country and at health care centers from where they were isolated (Kim et al., 2010).

Occurrence and distribution of ESBLs differs from country to country and from

hospital to hospital (Ali, 2009).

Pseudomonads have more adoptability than Enterobacteriaceae in developing

drug resistance by diverse means. The production of ESBLs presents more resistance

at different stages to expanded spectrum Cephalosporins (Castanheira, 2004).

Different genes encode these enzymes and are positioned on either chromosomes or

plasmids (Quinn, 1993). ESBLproducing bacteria might not be detectable by the

conventional disc diffusion susceptibility test, refering to unsuitable use of antibiotics

and treatment disappointments.

ESBLs prevalence in this particular study was recorded as 44.32%, which was

very similar to the studies conducted by (Ali, 2009; Jabeen, 2005; Ullah, 2009) from

pakistan, it was 40% and two other studies in 2009 were 43% and 58.7% ESBLs

producers Studies from India reported as ESBL producers were 60.98%, 51.4% and

53.4% in 2004, 2007 and 2010 respectively (Babypadmini, 2004; Shivaprakasha,

2007; Sasirekha, 2010). Lower rates were recorded by Anjum and Mir in 2009 at

Pakistan which observed 33% and which contrasts an earlier study which showed

20.27% of ESBL production (Aggarwal, 2008) and this incidence is superior to

continental surveys performed in South America (18.1%), Europe (11%),North

America (7.5%) and Asia-Pacific (14.2%) parts (Hawser et al., 2011, Turner, 2005).

119

The high prevalence recorded in this research as compared to developed regions can

be attributed to strict infection control policies and practices prevalent in developed

countries where we see shorter hospital stays, better nursing and quarantined

measures which ultimately reduce the probability of acquiring and dissemination of

ESBL producing strains.

Majority samples in current investigation were collected from the inpatients,

Pseudomonas spp. is more in hospital acquired isolates (Sheryll et al., 2004). ESBLs

were frequently recorded to be a nosocomial issue, cuurently most frequent in

community acquired microorganisms (Helfand and Bonomo, 2005; Heffernan and

Woodhouse, 2006).

In this particular research plan, ESBL producing hospital acquired isolates were more

resistance to third generation cephalosporins than community acquired isolates and it

was from 78%-86%, it was similar with the study done by Babypadmini and

Appalaraju, (2004) who found 84% resistant. Sasirekha and associates, (2010) found

75%-85%, Haque and Salam, (2010) found 72%-100% resistant. This was because of

illogical and extensive use of 3rd

generation cephalosporins equally in the community

and hospital and is considered to be the chief source of mutations in these enzymes

who lead to the surfacing of the ESBLs (Chaudhury and Agrawal, 2004).

Most of the ESBL producing organisms were found to be co resistance to

flouroquinolones, aminoglycosides and co-trimoxazole, which correlates with the

study done by Denholm, (2009) and Jabeen, (2005). Its because of the genes,

encoding these β-lactamases, are often situated at large plasmids which also encode

resistant genes for others antibiotics, together with, sulfonamides tetracycline

chloramphenicol, trimethoprime and aminoglycosides (Perez et al., 2007).

In Ethiopia, third generation cephalosporin specifically ceftriaxone is among

widely utilized classes of antibiotics for in-patients, as experienced during this study,

applying major selective stress for the emerging resistance in pathogenic

microorganisms. On multi-variable analysis, use of 3rd

generation cephalosporins

were marked as the sole risk factors significantly linked with disease because of

ESBL production. These results are similar with previous reseaarches revealing that

unsystematic use of 3rd generation cephalosporins were associated to the choice of

ESBL-producing microorganisms (Lautenbach et al., 2001). Use of cephalosporins is

120

not merely linked with ESBL infection, but also seen to be a threat factor for

colonization with ESBL producing strains (Levy et al., 2010). As a result, the higher

% of ESBL-producing Pseudomonas spp because of selected stress forced by

excessive use of the 3rd

generation cephalosporins in this research. This association

has been best exhibited by inter-ventional study which established decline in the

frequency of ESBL pooling from 8% to 6% due to control use of 3rd-generation

cephalosporins (Bisson et al., 2002). Generally, the association of ESBLwith third-

generation cephalosporins proposed that the most excellent mode to manage these

strains in our settings is to lessen the exercise of these antimicrobials.

ESBLs incidence was considerably higher among isolates from in-patients

than out-patients (P =0.002). Moreover higher frquency of fecal carriage of ESBL-

producing organisms among in-patients 26.1% than among out-patients (15.4%) is

recognized in another place in Saudi Arabia (Kader et al., 2007). This recommends

that noso-comial acquire organisms are more likely to become ESBL producer.

More than 70% of strains isolated from both in-patient and out0patient groups

demonstrated resistance to amoxicillin, DO and E. This may fright the presence of the

classic β-lactamase which was recognized among this isolates earlier to isolation of

ESBL enzymes (Livermore, 1995). Moreover, noticeable resistance to tetracycline

and gentamicin was observed in the inpatient group (17.57 % tetracycline and 18.92

% to CN) and with slight decrease in the outpatient group (18.92% to tetracycline, this

may be explained by the frequent use of both antibiotics in the community as well as

in our hospital.

Third-generation cephalosporin specifically ceftriaxone/cefatizidime are

frequently used in Pakistani hospitals for treatment, as experiential during this study,

exerting predominant selective pressure for the emergence of resistance among

pathogenic microorganisms. On multivariable analysis, it was recognized that the only

threat is the use of third generation cephalosporins which are significantly allied with

infection because of ESBL and theae results are in agreement with other findings

previously undertaken. Exposing the haphazard utilization of third-generation

cephalosporins (Lautenbach et al., 2001).

The study documented by Tenover showed that there is malfunction in the

detection of ESBL production by disc-diffusion as he subjected some samples which

121

were Susceptible to 3GCs and consequently revealed ESBLs production by DDST

54.6% (35/64) (Paterson, 1999; Tenover, 1999).

In this study, we used two combinations with clavulanic acid (CAZ/CAZC and

CTX/CTXC) and found that Pseudomonas spp. revealed higher production of ESBLs

in CAZ/CAZC, and are close proximity to other conducted researches (Rahman,

2004; Thomson, 1991). CAZ/CAZC combination was the lonely method of screening

suggested by George et al., (2006). Single combination may be unsuccessful to detect

ESBLs isolates and therefore might grounds for low occurrence (Rahman et al.,

2004). As a result, laboratories should perform the ESBLs confirmatory test to both

resistant and sensitive strains. The marker of ESBLs i.e Cefotaxime, Ceftazidime and

Ceftriaxone are no longer be recommended. The agent Cefpodoxime demonstrated as

a good tool for screening every kind of ESBLs producers in clinical sample (Black et

al., 2005).

Genotyping of ESBLs would determine categories of each strain on molecular

level that what type of ESBl is there. Epidemiologically, finding of resistance to

antimicrobials on molecular level is reliable and authentic source. Antimicrobial

therapy has played a significant role in the management of human bacterial infections,

but drug resistance that has emerged in ailment of bacterial infections caused by

ESBL enzymes degrades all β-lactam antibiotics and thus bacteria become mult-idrug

resistant and they can be plasmid mediated and chromosomal. Integron carries the

genes that encoded these enzymes and facilitate the diffusion of antimicrobial drug

resistance in hospiatls (Gupta, 2007). Consequently, a quick response is needed to

identify the ESBL s producing organisms that proper antibiotic practice and infection

managing procedures can be employed, (Gupta, 2007).

Extended spectrum β-lactamases were reported in P. aeruginosa in recent

times. Various sub types of β-lactamases have been described in P. aeruginosa such

as TEM and SHV which have been described from different part of the globe

(Amutha et al., 2009). Mutation in the parent genotypes i.e.TEM-1, SHV-1 had

emerged several other genotypes like gene CTX-M (Peirano et al., 2010).

The loss or condensed expression of the OprD porin, pooled with depression

of the chromosomal AmpC β-lactamase gene that leads to resistant mechanisms to

carbapenems in P. aeruginosa due to reduced uptake of the drug (Quinn, 1988); or

122

efflux pump system overexpression (Ziha-Zarifi, 1999). BLs are the swiftly

developing class of enzymes (e.g. TEM, SHV, CTX etc.) produced by these gram-

negative bacteria, which have the aptitude to hydrolyze the wide-ranging antibiotics

containg penicillins, cephamycins, cephalosporins, oxacephamycins and carbapenems

(Poirel, 2000). Some of carbapenem-resistant clinical isolates were found to produce a

new MBL, TEM-1, which efficiently hydrolyzes carbapenems as well as other β-

lactams. Moreover, TEM-1 is notable for its special character, in that it is hardly

obstructed by β-lactamase inhibitors such as tazobactam, sulbactam and clavulanate,

(Ohsuka, 1995). Therefore, strains producing TEM-1 are difficult to control with β-

lactams antibiotic and related drugs in combination. MBLs are generally mutants of

classical TEM genes.

Mechanisms of resistance in Pseudomonas are tremendously varied and at

present no antimicrobial is able to coup the resistant strains singly or synergistically

that permit complete treatment of these infections caused by these organisms in

nosocomial enviornment. Ceftolozane/tazobactam had revealed a good activity uptill

now in comparison to other agents, in the vitro studies against this pooled cluster of

GN pathogens (Sader, 2011; Giske, 2009).

Chronic infections are often as a result of biofilm formation and it has been

noticed that bacteria often adhere to the devices implanted and also damaged tissue

and laid foundation for persistent infections (Costerton, 1999).

The results of biofilm formation and ELISA were enclosed agreement

obtained of CRA method. The results of biofilm assay are not up to the mark as the

biofilm of 45 Strains were not adhere, some results were negative but still they

produce biofilm assay, the exact mechanism of CRA was not known by which they

form black colonies (Freeman et al., 1989).

Formation of biofilm encountered several factors in its quantification;

Formation of biofilm unevenly gives reading by ELISA which is not analogous to

biofilm contents of the well. Stepanovic described the biofilm assay, the most reliable

method and therefore the sample stained with crystal violet treated with 33% glacial

acetic acid having consistent readings (Stepanovic, 2000).

Biofilm formation favored by high temperature because incubation

temperature play a vital role in biofilm formation at 37 0

C 9 as compared to 8 isolates

123

at 30 0C it means that the development of biofilm formation of different strains under

varying circumstances are different, Staph. Epidermidis produce strong biofilm at 30

0C (Fitz et al., 2005).

The ability of the strains to develop a high number of biofilm formations at 37

0C due to the adoptability to hospital environment and grow on medical devices this

evidence is supported by (Mc Kenney, 1999) that high numbers are produced in vitro

rather than in-vivo.

Strong adherents were showed by the control strain only, so it means

optimization of the assay is required by the modification of assay methodology. The

results were based on 1/40 dilution of strains (Cucarella, 2001) was a revised

methodology of (Heilmann, 1996). In 2008 Vander Plas use a dilution factor of 1/200

and 1/1000. Therefore, further study was conducted to evaluate the concentration of

biofilm production.

The interpretation of results was based on absorbance, high absorbance was

observed for 1/600 dilution factor rather overall adherence was not altered. The

availability of more nutrients and glucose for bacteria to form biofilm to a lower

inoculum rather than to a bacterium in log phase and a standard growth curve by

increasing the concentration of inoculum may lay foundation for bacteria to move into

a stationary phase or death phase. After 24 hours incubation effects can be pursued,

resume ably bacteria are entering earlier to stationary phase. Subject to the condition

if nutrients are consumed then growth after 48 hours incubation was not justified in a

true sense, making partiality for late adherence strains producing adherence after 24

hours rather than 48 hours. Development of biofilm is followed by dispersion,

supporting the organism to spread; draining nutrient enforced the strains to go into the

final stage by detaching from the cell (Hunt et al., 2004).

Crossways inconsistency in each plate should be reflected, the loose of

adherence during the incubation time (between 24-48 hours). Variation in results will

always be produced during incubation and washing, it means that cross plate

evaluation is a better way rather than inter plate comparison.

It is not a realistic approach that 45 Strains on a 96 wells plate, keeping this in

mind the result were interpreted on the basis of above observations, taking the mean

of 6 replications minimizing the effect of biased results. Glucose is an important

124

compound for the development of the biofilm residing in the hydrated matrix of the

biofilm; the architecture can be seen by electron microscope (Ammendolia, 1999).

Due to this reason 0.25 % glucose was added to TSB (Heilmann et al., 1996).

It may be noted that the strains for the biofilm assay were recovered from -80

0C and cultured on TSA plate as they might be some sort of pressure for a long period.

The old cultured colonies were possibly in a deprived condition to develop biofilm,

consequently established weak adherence to the plate revealed low absorbance.

Positive control exhibited strong adherence, reflecting that the results are valid.

Biofilm associated microorganism reflected various diseases such as

endocarditis and cystic fibrosis and also colonizes to various medical equipment’s that

why it is an epidemiological niche to infectious diseases.

Since no previous data was available about the prevalence of genes responsible for

ESBLs production in Pakistan, it was assumed that this high rate of ESBLs by

phenotypic method may be due to mutation of first two parent gene TEM-1, SHV-1

and newer most prevalent gene CTX-M in the world (Peirano et al., 2010). In the

present study, TEM, SHV and CTX-M genes were found in 48%, 14% and 38% from

phenotypically confirmed ESBLs producers respectively.

Epidemiological study reveals that some enzymes are more regularly

described then others, but major enzyme type differs with country and that diverse

CTX-M types frequently present within a single region (Livermore and Woodford,

2006). In India (2007) both TEM and SHV, TEM, SHV were 67.3%, 20%, 804%

respectively and (2010) it was 56%, 60% for TEM and SHV genes respectively from

phenotypic confirmed ESBLs positive isolates (Lal et al., 2007; Sharma et al., 2010).

CTX-M may be increased due to wide use of third generation cephalosporins,

especially ceftriaxone and it is more resistant to cefotaxime. In the present study

CTX-M was found 48%, among them 57 % and 43 %were from hospital and out door

patients respectively.

5.1 Conclusions and Recommendations

Pathogens were isolated from pus (48.50%), urine (20.05%), Burns

(17.06), blood (4.79%) and miscellaneous sources (9.58%)

Mean age of the patients was 25.9 S. D ±9.15.

125

A higher number of pathogens were recovered from Khyber Teaching

Hospital Peshawar (57.18%).

A higher number of pathogens were recovered from females compared

to male.

Susceptibility was witnessed generally in all isolates of Pseudomonas

spp from clinical samples of a range of sources beside different

antibiotics used for culture sensitivity testing such as cephalosporins

(CEC 21.26%), quinolones (E 19.16 %), aminoglycosides (CN 18.56

%), penicillin (AML 14.97 %), and doxycycline 10.18 %.

β-lactams and β-lactam inhibitors showed good activity against

Pseudomonas spp.

Cefoperazone/Sulbactum demonstrated better action than the fourth-

generation cephalosporin Cefepime alone

Amoxicillin had slightest usefulness as 86.0% isolates were resistant to

this antibiotic.

Cefoperazone/Sulbactum was found to be more effective among

cephalosporins.

Susceptibility of isolates recovered from hospitalized patients was

diminished as compared to out-door pateints.

High level of resistance was found among Quinolones

Drugs carbapenems showed an excellent activity against all the

isolates.

Susceptibility to all the antibiotics were seems to be decreasing with

passage of time.

Prevalence of ESBL was 44.32% in Pseudomonas spp.

A high resistance rate was observed for ESBL producers as compared

to non ESBL producers.

A signinificant difference was found in the susceptibility of

Carbapenems and other drugs to ESBL producers.

126

MIC 50 and MIC 90 were very high to cephalosporins and

fluoroquinolones.

Results of biofilm formation were inconsistent,

People should understand that even though antibiotics are required to

control bacterial infections, they can have broad, adverse effects on

normal flora.

Antibiotics should only be used when they are actually desired and they

should not be administered for viral infections, over which they have no

power.

Patient must not make irrational demands for antibiotics, nor should

doctors recommend them, when not any are pointed out.

Once antibiotics are started, the course should be completed, particularly

in case of chronic infections.

Knowing the pattern of susceptibility of antibiotics will help the health

care professional, which basis for empirical therapy.

127

REFERENCES

Abee, T., Kovács, Á. T., Kuipers, O. P., & Van der Veen, S. (2011). Biofilm

formation and dispersal in Gram-positive bacteria. Current opinion in

biotechnology, 22(2), 172-179.

Abraham, E. P., & Chain, E. (1940). An enzyme from bacteria able to destroy

penicillin. Nature, 146(3713), 837.

Acar, J. F., & Goldstein, F. W. (1997). Trends in bacterial resistance to

fluoroquinolones. Clinical Infectious Diseases, 24(Supplement 1), S67-S73.

Aggarwal, R., Chaudhary, U., & Bala, K. (2008). Detection of extended-spectrum β-

lactamase in Pseudomonas aeruginosa. Indian Journal of Pathology and

Microbiology, 51(2), 222-24.

Agrawal, P., Ghosh, A. N., Kumar, S., Basu, B., & Kapila, K. (2008). Prevalence of

extended-spectrum β-lactamases among Escherichia coli and Klebsiella

pneumoniae isolates in a tertiary care hospital. Indian Journal of Pathology

and Microbiology, 51(1), 139-42.

Ahmad, B., & Shakoori, A. (1997). UTI: Prevalent organisms and their sensitivity

pattern in catheterized patients. PaK J Med Research, 36,136.

Ahmad, S. S., & Ali, F. A. (2014). Detection of ESBL, AmpC and Metallo Beta-

Lactamase mediated resistance in Gram-negative bacteria isolated from

women with genital tract infection. European Scientific Journal, 10(9), 193–

209.

Ahmed, O. I., El-Hady, S. A., Ahmed, T. M., & Ahmed, I. Z. (2013). Detection of bla

SHV and bla CTX-M genes in ESBL producing Klebsiella pneumoniae

isolated from Egyptian patients with suspected nosocomial

infections. Egyptian Journal of Medical Human Genetics, 14(3), 277-283.

128

Al-Agamy, M. H. (2013). Phenotypic and molecular characterization of extended-

spectrum β-lactamases and AmpC β-lactamases in Klebsiella pneumoniae.

Pakistan Journal of Pharmaceutical Sciences, 291–298.

Al-Agamy, M. H., Shible, A. M., & Tawfik, A. F. (2009). Prevelance and molecular

characterization of extended spectrum β-lactamase- producing Klebsiella

Pneumoniae in Riyadh, Saudi-Arabia, Annals of Saudi Medicine, 29(4),253-

257.

Alcamo, E. I. (1994), Fundamentals of Microbiology: Chemotherapeutic Agents and

Antibiotics. Addison-Wesley Publishing Company, Inc; 669–691.

Ali, A. M., Abbasi, S. A., & Ahmed, M. (2009). Frequency of ESβLs Producing

Nosocomial Isolates in a Tertiary Care Hospital in Rawalpindi. Pak Armed

Forces Med J, 12, 23-28.

Al-Jasser, A. M., & Elkhizzi, N. A. (2004). Antimicrobial susceptibility pattern of

clinical isolates of Pseudomonas aeruginosa. Saudi medical journal, 25(6),

780-784.

Aloush, V., Navon-Venezia, S., Seigman-Igra, Y., Cabili, S., & Carmeli, Y. (2006).

Multidrug-resistant Pseudomonas aeruginosa: risk factors and clinical

impact. Antimicrobial agents and chemotherapy, 50(1), 43-48.

Alp, E., Güven, M., Yıldız, O., Aygen, B., Voss, A., & Doganay, M. (2004).

Incidence, risk factors and mortality of nosocomial pneumonia in intensive

care units: a prospective study. Annals of clinical microbiology and

antimicrobials, 3(1), 17.

Amaya, E., Caceres, M., Fang, H., Ramirez, A. T., Palmgren, A. C., Nord, C. E., &

Weintraub, A. (2009). Extended-spectrum β-lactamase-producing Klebsiella

pneumoniae in a Neonatal Intensive Care Unit in León,

Nicaragua. International journal of antimicrobial agents, 33(4), 386-387.

Ambler, R. P. (1980). The structure of β-lactamases, Philos Trans R Soc Lond. B Biol

Sci, 16(289),321-31.

129

Ammendolia, M. G., Di Rosa, R., Montanaro, L., Arciola, C. R., & Baldassarri, L.

(1999). Slime production and expression of the slime-associated antigen by

staphylococcal clinical isolates. Journal of clinical microbiology, 37(10),

3235-3238.

Amutha, R., Murugan, T., & Devi, M. R. (2009). Studies on multidrug resistant

Pseudomonas aeruginosa from pediatric population with special reference to

extended spectrum beta lactamase. Indian Journal of Science and

Technology, 2(11), 11-13.

Andrews, J. (2009), Dectection of extended spectrum β-lactamases (ESBLs) in E.coli

and Klebsiella species, British society for antimicrobial chemotherapy. BSAC,

pp –674.

Anjum, F., & Mir, A. (2010). Susceptibility pattern of Pseudomonas aeruginosa

against various antibiotics. African Journal of Microbiology Research, 4(10),

1005-1012.

Arciola, C. R., Campoccia, D., Baldassarri, L., Donati, M. E., Pirini, V., Gamberini,

S., & Montanaro, L. (2006). Detection of biofilm formation in Staphylococcus

epidermidis from implant infections. Comparison of a PCR‐method that

recognizes the presence of ica genes with two classic phenotypic

methods. Journal of Biomedical Materials Research Part A, 76(2), 425-430.

Armour, A. D., Shankowsky, H. A., Swanson, T., Lee, J., & Tredget, E. E. (2007).

The impact of nosocomially-acquired resistant Pseudomonas aeruginosa

infection in a burn unit. Journal of Trauma and Acute Care Surgery, 63(1),

164-171.

Ash, R. J., Mauck, B., & Morgan, M. (2002). Antibiotic resistance of gram-negative

bacteria in rivers, United States. Emerging infectious diseases, 8(7), 713-716.

Astal, Z. (2004). Susceptibility patterns in Pseudomonas aeruginosa causing

nosocomial infections. Journal of chemotherapy, 16(3), 264-268.

130

Avorn, J., Barrett, J. F., Davey, P. G., McEwen, S. A., O'Brien, T. F., Levy, S. B., ...

& Alliance for the Prudent Use of Antibiotics. (2001). Antibiotic resistance:

synthesis of recommendations by expert policy groups. Boston.

Baily and Scott’s (editors) Betty, A. F., and Daniel, F. S. (2006). Diagnostic

microbiology 12th edition: 327-482. A

Bali, E. B., Accedil, L., & Sultan, N. (2010). Phenotypic and molecular

characterization of SHV, TEM, CTX-M and extended-spectrum-lactamase

produced by Escherichia coli, Acinobacter baumannii and Klebsiella isolates

in a Turkish hospital. African Journal of Microbiology Research, 4(8), 650-

654.

Bär, H., & Zarnack, J. (1970). Molecular-biological bases of the mechanism of action

of penicillins and cephasporins. Die Pharmazie, 25(1), 10-22.

Bartlett, J .G., and Froggatt, J. W. (1995) Antibiotic resistance Arch Otolaryngol head

Neck Surg 121 (4): 392-6.

Bisson, G., Fishman, N. O., Patel, J. B., Edelstein, P. H., & Lautenbach, E. (2002).

Extended-spectrum β-lactamase–producing Escherichia coli and Klebsiella

species: risk factors for colonization and impact of antimicrobial formulary

interventions on colonization prevalence. Infection Control & Hospital

Epidemiology, 23(05), 254-260.

Black, J. A., Thomson, K. S., Buynak, J. D., & Pitout, J. D. (2005). Evaluation of β-

lactamase inhibitors in disk tests for detection of plasmid-mediated AmpC β-

lactamases in well-characterized clinical strains of Klebsiella spp. Journal of

clinical microbiology, 43(8), 4168-4171.

Blondeau, J. M. (2004). Fluoroquinolones: mechanism of action, classification, and

development of resistance. Survey of ophthalmology, 49(2), S73-S78.

Bradford, P. A. (2001). Extended-spectrum β-lactamases in the 21st century:

characterization, epidemiology, and detection of this important resistance

threat. Clinical microbiology reviews, 14(4), 933-951.

131

Brink, A. J., Botha, R. F., Poswa, X., Senekal, M., Badal, R. E., Grolman, D. C., ... &

Joubert, I. (2012). Antimicrobial susceptibility of gram-negative pathogens

isolated from patients with complicated intra-abdominal infections in South

African hospitals (SMART Study 2004–2009): Impact of the new carbapenem

breakpoints. Surgical infections, 13(1), 43-49.

Brisson-Noël, A., Trieu-Cuot, P., & Courvalin, P. (1988). Mechanism of action of

spiramycin and other macrolides. Journal of Antimicrobial

Chemotherapy, 22(Supplement B), 13-23.

Brun-Buisson, C., Philippon, A., Ansquer, M., Legrand, P., Montravers, F., & Duval,

J. (1987). Transferable enzymatic resistance to third-generation

cephalosporins during nosocomial outbreak of multiresistant Klebsiella

pneumoniae. The Lancet, 330(8554), 302-306.

Bush, K. (1998). Metallo-β-lactamases: a class apart. Clinical Infectious

Diseases, 27(Supplement 1), S48-S53.

Bush, K., Jacoby, G. A., and Medeiros, A. A. (1995). Updated Functional

Classification of β-lactamases. Antimicrob Agents Chemother, 39:1211-1233.

Castanheira, M., Toleman, M. A., Jones, R. N., Schmidt, F. J., & Walsh, T. R. (2004).

Molecular characterization of a β-lactamase gene, blaGIM-1, encoding a new

subclass of metallo-β-lactamase. Antimicrobial agents and

chemotherapy, 48(12), 4654-4661.

Cavallo, J. D., Fabre, R., Leblanc, F., Nicolas-Chanoine, M. H., & Thabaut, A.

(2000). Antibiotic susceptibility and mechanisms of β-lactam resistance in

1310 strains of Pseudomonas aeruginosa: a French multicentre study

(1996). Journal of Antimicrobial Chemotherapy, 46(1), 133-136.

Cavallo, J. D., Hocquet, D., Plesiat, P., Fabre, R., & Roussel-Delvallez, M. (2007).

Susceptibility of Pseudomonas aeruginosa to antimicrobials: a 2004 French

multicentre hospital study. Journal of antimicrobial chemotherapy, 59(5),

1021-1024.

132

Chakraborty, D., Basu, S., & Das, S. (2011). Study on some Gram negative multi

drug resistant bacteria and their molecular characterization. Asian. J.

Pharmaceut. and Clin. Res, 4(1), 108-112.

Chaudhary, M., & Payasi, A. (2013). Rising antimicrobial resistance of Pseudomonas

aeruginosa isolated from clinical specimens in India. J Proteomics

Bioinform, 6(1), 005-09.

Chaudhary, M., Kumar, S., & Payasi, A. (2013). Prevalence and antimicrobial

sensitivity of extended spectrum beta-lactamase producing Gram negative

bacteria from clinical settings in India from 2010-2012. Int J Med Med Sci, 46,

1212-1217.

Chaudhary, U., & Aggarwal, R. (2004). Extended spectrum-lactamases (ESBL)-An

emerging threat to clinical therapeutics. Indian Journal of Medical

Microbiology, 22(2), 75-80.

Chaudhury, A. (2003). In vitro activity of cefpirome: A new fourth generation

cephalosporin. Indian journal of medical microbiology, 21(1), 52-5

Cheesbrough, M. (1991). Enteric gram-negative rods and gram negative anaerobes.

In: Medical Laboratory Manual for Tropical Countries, Vol. II. University

press, Cambridge, U.K. 248-273.

Cheesbrough, M. (2000). Bacterial pathogens. In: District Laboratory Practice in

Tropical Countries; II. ELBS London, 157-234.

Chen, H. Y., Yuan, M., & Livermore, D. M. (1995). Mechanisms of resistance to β-

lactam antibiotics amongst Pseudomonas aeruginosa isolates collected in the

UK in 1993. Journal of medical microbiology, 43(4), 300-309.

Chessbrough, M. (1999) District laboratory practice in tropical countries, New york,

USA: Cambridge university.

Chessbrough, M. (2006). District laboratory practice in tropical countries, Newyork,

USA: Cambridge university press. 184- 186.

133

Chopra, I., & Roberts, M. (2001). Tetracycline antibiotics: mode of action,

applications, molecular biology, and epidemiology of bacterial

resistance. Microbiology and molecular biology reviews, 65(2), 232-260.

Chowdhury, M. A., Yamanaka, H., Miyoshi, S., Aziz, K., M., and Shinoda, S. (1994).

Ecology of Vibrio mimicus in aquatic environments, Appl Environ Microbiol,

55(8),2073-2078.

CLSI. (2010) Performance Standards for Antimicrobial Susceptibility Testing,

Twentieth Informational Supplement, CLSI Document M100-S20, Wayne,

PA: Clinical and Laboratory Standards Institute.

CLSI. (2010) Performance Standards for Antimicrobial Susceptibility Testing,

Twentieth Informational Supplement, CLSI Document M100-S20, Wayne,

PA: Clinical and Laboratory Standards Institute.

Coque, T. M., Baquero, F., & Canton, R. (2008). Increasing prevalence of ESBL-

producing Enterobacteriaceae in Europe. Euro surveill, 13(47), 1-11.

Costerton, J. W., Stewart, P. S., & Greenberg, E. P. (1999). Bacterial biofilms: a

common cause of persistent infections. Science, 284(5418), 1318-1322.

Cucarella, C., Solano, C., Valle, J., Amorena, B., Lasa, Í., & Penadés, J. R. (2001).

Bap, a Staphylococcus aureus surface protein involved in biofilm

formation. Journal of bacteriology, 183(9), 2888-2896.

Datta, N., & Kontomichalou, P. (1965). Penicillinase synthesis controlled by

infectious R factors in Enterobacteriaceae. Nature, 208, 239-41.

Davies, J. (1996). Origion and evolution of antibiotic resistance. Microbilo, 12(1):9-

16.

Davis, S. C., Ricotti, C., Cazzaniga, A., Welsh, E., Eaglstein, W. H., and Mertz, P. M.

(2008). Microscopic and physiologic evidence for biofilm-associated wound

colonization in vivo. Wound Repair and Regeneration, 16 (1), 23–29.

134

De Champs, C., Sauvant, M. P., Chanal, C., Sirot, D., Gazuy, N., Malhuret, R Baguet,

J. C., & Sirot, J. (1989). Prospective survey of colonization and infection

caused by expanded-spectrum-beta-lactamase-producing members of the

family Enterobacteriaceae in an intensive care unit. Journal of clinical

microbiology, 27(12), 2887-2890.

De Medici, D., Croci, L., Delibato, E., Di Pasquale, S., Filetici, E., & Toti, L. (2003).

Evaluation of DNA extraction methods for use in combination with SYBR

green I real-time PCR to detect Salmonella enterica serotype enteritidis in

poultry. Applied and Environmental Microbiology, 69(6), 3456-3461.

Denholm, J. T., Huysmans, M., and Spelman, D. (2009). Community acquisition of

ESBL-producing Escherichia coli: a growing concern, Medical Journal

Australia, 190(1), 45-46.

Donlan, R. M. (2002). Biofilms: Microbial Life on Surfaces. Emerging Infectious

Diseases,Vol. 8, No. 9, pp. 881-890.

Donlan, R. M., and Costerton, J. W. (2002) Biofilms: survival mechanisms of

clinically relevant microorganisms.Clin Microbiol Rev, 15(2): 167-193.

Dudley, M. N., Ambrose, P. G., Bhavnani, S. M., Craig, W. A., & Ferraro, M. J.

(2013). Background and Rationale for Revised Clinical and Laboratory

Standards Institute Interpretive Criteria (Breakpoints) for Enterobacteriaceae

and Pseudomonas aeruginosa : I . Cephalosporins and Aztreonam, 56, 1301–

1309.

Dugal, S., & Purohit, H. (2013). Antimicrobial susceptibility profile and detection of

extended spectrum beta-lactamase production by gram negative uropathogens.

Int J Pharm Pharml Sci, 4(5), 435-8.

Dundar, D., Otkun, M. (2010). In-vitro efficacy of synergistic antibiotic combinations

in multidrug resistant Pseudomonas aeruginosa strains. Yonsei Med J, 51,

111–116.

135

Engelsen, D., vander, C., Werf, C., Matute, A. J., Delgado, E., Schurink, C. A., and

Hoepelman, A.I. (2009). Infectious diseases and the use of antibiotics in

outpatients at the emergency department of the University Hospital of León,

Nicaragua, Intional Journal Infectious Dis. 13(3), 349-54.

Ensor, V. M., Shahid, M., Evans, J. T., and Hawkey, P. M. (2006) Occurrence,

prevalence and genetic environment of CTX-M β-lactamases in

Enterobacteriaceae from India hospitals, Jourmal Antimicrobial

Chemotherapy, 58, 1260-1263.

European Pharmacopeia. (2002) Tests for specified microorganisms, Council of

Europe, Strasbourg, 4th ed., Suppl.4.2 2.6.13.

Facklam, R. R., (1980). Manual of Clinical Microbiology, Lennette and others (Eds.),

3rd ed., A.S.M., Washington, D.C.

Farkosh, M. S. (2007). Extended-Spectrum β-lactamase Producing Gram Negative

Bacilli. http://nosoweb.org/infectious diseases/esbl.htm.

Farrell, D. J., Flamm, R. K., Sader, H. S., & Jones, R. N. (2013). Antimicrobial

activity of ceftolozane-tazobactam tested against Enterobacteriaceae and

Pseudomonas aeruginosa with various resistance patterns isolated in U.S.

hospitals (2011-2012). Antimicrobial Agents and Chemotherapy, 57(12),

6305–6310.

Faulkner, L., Cooper, A., Fantino, C., Altmann, D. M., & Sriskandan, S. (2005). The

mechanism of superantigen-mediated toxic shock: not a simple Th1 cytokine

storm. The Journal of Immunology, 175(10), 6870-6877.

Fedler, K. A., Biedenbach, D. J., & Jones, R. N. (2006). Assessment of pathogen

frequency and resistance patterns among pediatric patient isolates: report from

the 2004 SENTRY Antimicrobial Surveillance Program on 3

continents. Diagnostic microbiology and infectious disease, 56(4), 427-436.

Finch, R.G. (1998). Antibiotic resistance. J Antimicrib Chemother. 42(2):125-128

136

Fitzpatrick, F., Humphreys, H., & O'gara, J. P. (2005). Evidence for low temperature

regulation of biofilm formation in Staphylococcus epidermidis. Journal of

medical microbiology, 54(5), 509-510.

Florijn, A., Nijssen, S., Schmitz, F., Verhoef, J., & Fluit, A. (2002). Comparison of E

test and double disk diffusion test for detection of extended spectrum beta-

lactamases. European journal of clinical microbiology & infectious

diseases, 21(3), 241-243.

Fonzé, E., Charlier, P., To'Th, Y., Vermeire, M., Raquet, X., Dubus, A., & Frere, J.

M. (1995). TEM1 β-lactamase structure solved by molecular replacement and

refined structure of the S235A mutant. Acta Crystallographica Section D:

Biological Crystallography, 51(5), 682-694.

Freeman, D. J., Falkiner, F. R., & Keane, C. T. (1989). New method for detecting

slime production by coagulase negative staphylococci. Journal of clinical

pathology, 42(8), 872-874.

Friedman, C., Callery, S., Jeanes, A., Piaskowski, P., Scott, L. (2005). Best Infection

Control Practices for Patients with Extended Spectrum β-Lactamase

Enterobacteriacae, International Infection Control Council.

Gad, G. F., El-Domany, R. A., & Ashour, H. M. (2008). Antimicrobial susceptibility

profile of Pseudomonas aeuginosa isolates in Egypt. J Urol, 180(1), 176-81.

Gales, A. C., Jones, R. N., Turnidge, J., Rennie, R., & Ramphal, R. (2001).

Characterization of Pseudomonas aeruginosa isolates: occurrence rates,

antimicrobial susceptibility patterns, and molecular typing in the global

SENTRY Antimicrobial Surveillance Program, 1997–1999. Clinical Infectious


George, J. A., & Munoz-Price, L. S. (2005). Mechanisms of disease the new-

lactamase. N Engl J Med, 325, 380-91.

137

Gerhardt, P., Murray, R. G. E., Costilow, R. N., Nester, E. W., Wood, W. A., Krieg,

N. R., & Phillips, G. B. (1981). Manual of methods for general bacteriology.

ASM, Washington, D.C.

Girlich, D., Naas, T., & Nordmann, P. (2004). Biochemical characterization of the

naturally occurring oxacillinase OXA-50 of Pseudomonas

aeruginosa. Antimicrobial agents and chemotherapy, 48(6), 2043-2048.

Girlich, D., Naas, T., Leelaporn, A., Poirel, L., Fennewald, M., & Nordmann, P.

(2002). Nosocomial Spread of the Integron-Located veb-1—Like Cassette

Encoding an Extended-Spectrum β-Lactamase in Pseudomonas aeruginosa in

Thailand. Clinical infectious diseases, 34(5), 603-611.

Giske, C. G., Ge, J., & Nordmann, P. (2009). Activity of cephalosporin CXA-101

(FR264205) and comparators against extended-spectrum-β-lactamase-

producing Pseudomonas aeruginosa. Journal of antimicrobial chemotherapy,

dkp193. 64: 430-431

Gonzalez 3rd, L. S., & Spencer, J. P. (1998). Aminoglycosides: a practical

review. American family physician, 58(8), 1811-1820..

Grover, S. S., Sharma, M., Chattopadhya, D., Kapoor, H., Pasha, S. T., & Singh, G.

(2006). Phenotypic and genotypic detection of ESBL mediated cephalosporin

resistance in Klebsiella pneumoniae: emergence of high resistance against

cefepime, the fourth generation cephalosporin. Journal of Infection, 53(4),

279-288.

Guembe, M., Cercenado, E., Alcalá, L., Marín, M., Insa, R., & Bouza, E. (2008).

Evolution of antimicrobial susceptibility patterns of aerobic and facultative

gram-negative bacilli causing intra-abdominal infections: results from the

SMART studies 2003-2007. Revista espanola de quimioterapia: publicacion

oficial de la Sociedad Espanola de Quimioterapia, 21(3), 166-173.

Günseren, F., Mamıkoğlu, L., Öztürk, S., Yücesoy, M., Biberoğlu, K., Yuluğ, N., ... &

Çetin, S. (1999). A surveillance study of antimicrobial resistance of gram-

138

negative bacteria isolated from intensive care units in eight hospitals in

Turkey. Journal of Antimicrobial Chemotherapy, 43(3), 373-378.

Gupta, V. (2007). An update on newer β-lactamases, Indian J. Med. Res. 126(5),417-

427.

Gutkind, G. O., and Cátedra de. (2001). Third-Generation Cephalosporin Resistance

in Shigella sonnei, Argentina, Emerging Infectious Diseases, 7(3),172-7

Hall-Stoodley, L., Costerton, J. W., & Stoodley, P. (2004). Bacterial biofilms: from

the natural environment to infectious diseases. Nature reviews

microbiology, 2(2), 95-108.

Hancock, R. E. (1998). Resistance mechanisms in Pseudomonas aeruginosa and other

nonfermentative gram-negative bacteria. Clinical Infectious


Hanson, N. D., Thomson, K. S., Moland, E. S., Sanders, C. C., Berthold, G., and

Penn, P.G. (1999). Molecular chacterization of a multiply resistant Klebsiella

pneumoniae encoding ESBLs and a plasmid mediated AmpC, Oxford

journals, Journal of Antimicrobial Chemotherapy; 44(3),377-380.

Haque, R., & Salam, M. A. (2010). Detection of ESBL producing nosocomial gram

negative bacteria from a tertiary care hospital in Bangladesh. Pak J Med

Sci, 26(4), 887-891.

Haque, S. F., Ali, S. Z., Mohammed, T. P., & Khan, A. U. (2012). Prevalence of

plasmid mediated blaTEM-1 and blaCTX-M-15 type extended spectrum beta–

lactamases in patients with sepsis. Asian Pacific journal of tropical

medicine, 5(2), 98-102.

Hartman, B. and Tomaz, A. (1981). Altered Penicillin binding protein in methicillin

resistant strains of Staph.Aureus. Antimicro Agents Chemother, 19(5),726-35.

Hawkey, P. M, (2008). Prevalence and clonality of extended-spectrum â-lactamases in

Asia. Clinical Microbiology and Infection, 14,159.165.

139

Hawser, S. P., Bouchillon, S. K. (2009) In-vitro susceptibilities of aerobic and

facultative anaerobic GNB from patients with intra-abdominal infections

world-wide from 2005-2007: results from the SMART study. Int J Antimicrob

agents. 34(6),585-588.

Hawser, S. P., Bouchillon, S. K., Lascols, C., Hackel, M., Hoban, D. J., Badal, R. E.,

and Canton, R. (2011). Susceptibility of European Escherichia coli clinical

isolates from intra-abdominal infections, extended-spectrum β-lactamase

occurrence, resistance distribution, and molecular characterization of

ertapenem-resistant isolates (SMART 2008 – 2009), Clin Microbiol

Infect.:10.1111/j.1469-0691.2011.03550.x

Heffernan, H., Pope, C., & Carter, P. (2007). Identification of extended-spectrum β-

lactamase types, plasmid mediated AmpC β-lactamases and strains among

urinary Escherichia coli and Klebsiella in New Zealand in 2006. Institute of

Environmental Science and Research Limited. 21 (2), 237-38.

Heffernan, H., Woodhouse, R. (2006). Prevalence of extended spectrum β-lactamases

among Escherichia coli and Klebsiella in Newzealand in 2006, Antibiotic

Referance Laboratory.Communicable Disease Group; ESR Porirua.

Heilmann, C., Schweitzer, O. (1996). Molecular basis of intercellular adhesion in the

biofilm forming staph epidermidis. Mol Microbiol 20(5): 1083-91.

Helfand, M. S. and Bonomo, R. A. (2005). Extended spectrum â-lactamases in

Multidrug .Resistant Eschrichia coli: Changing the therapy for Hospital-

Acquired and Community acquired Infections, Oxford Journals, 43(11):1415-

1416.

Hirakata, Y., Matsuda, J., Miyazaki, Y., Kamihira, S., Kawakami, S., Miyazawa, Y.,

... & Turnidge, J. D. (2005). Regional variation in the prevalence of extended-

spectrum β-lactamase–producing clinical isolates in the Asia-Pacific region

(SENTRY 1998–2002). Diagnostic microbiology and infectious

disease, 52(4), 323-329.

140

Hocquet, D., Berthelot, P., Roussel-Delvallez, M., Favre, R., Jeannot, K., Bajolet, O.,

& Husson, M. O. (2007). Pseudomonas aeruginosa may accumulate drug

resistance mechanisms without losing its ability to cause bloodstream

infections. Antimicrobial agents and chemotherapy, 51(10), 3531-3536.

Holten, K. B. (2000). Appropriate prescribing of oral beta-lactam

antibiotics. American family physician, 62(3), 611-20.

Humayun, T., & Iqbal, A. (2010). The Culture and Sensitivity Pattern of Urinary

Tract Infections in Females of Reproductive Age Group. Annals of Pakistan

Institute of Medical Sciences, 8(1), 19–22.

Hunt, S. M., Werner, E. M. (2004). Hypothesis for the role of nutrient starvation in

biofilm detachment. Appl Enviorn Microbiol 70(12): 7418-25.

Imamura, Y., Chandra, J., Mukherjee, P. K., (2008). "Fusarium and Candida albicans

biofilms on soft contact lenses: model development, influence of lens type,

and susceptibility to lens care solutions". Antimicrobial Agents and

Chemotherapy52 (1), 171–82.

Ingram, J. M., and Hassan, H. M. (1975). The resistance of pseudomonas aeruginosa

to Chloramphenicol. Can J Microbiol, 21(8), 1185-91.

Jabeen, K, Zafar, A, & Hasan, R. (2005). Frequency and sensitivity pattern of

extended spectrum β- lactamase producing isolates in a tertiary care hospital

laboratory of Pakistan, Journal Pakistan Medical Association, 55(10),

436.439.

Jacoby, G. A. (2009). AmpC β-lactamases. Clinical microbiology reviews, 22(1), 161-

182.

Jacoby, G. A., Medeiros, A. A., O'Brien, T. F., Pinto, M. E., & Jiang, H. (1988).

Broad-spectrum, transmissible beta-lactamases. The New England journal of

medicine, 319(11), 723-724.

141

Jakubovics, N. S., Shields, R. C., Rajarajan, N., & Burgess, J. G. (2013). Life after

death: the critical role of extracellular DNA in microbial biofilms. Letters in

applied microbiology, 57(6), 467-475.

Jemima, S. A, & Verghese, S. (2008). Multiplex PCR for blaCTX-M & blaSHV in the

extended spectrum β- lactamase (ESBL) producing gram-negative isolates.

Indian Journal of Medical Research, 128(3),313–317..

Jones, R. N., Pfaller, M. A., Marshall, S. A., Hollis, R. J., & Wilke, W. W. (1997).

Antimicrobial activity of 12 broad-spectrum agents tested against 270

nosocomial blood stream infection isolates caused by non-enteric gram-

negative bacilli: occurrence of resistance, molecular epidemiology, and

screening for metallo-enzymes. Diagnostic microbiology and infectious

disease, 29(3), 187-192.

Joshi, S. (2010). Hospital antibiogram: A necessity. Indian journal of medical

microbiology, 28(4), 277.

Kader, A. A., Kumar, A., & Kamath, K. A. (2007). Fecal carriage of extended-

spectrum β-lactamase–producing Escherichia coli and Klebsiella pneumoniae

in patients and asymptomatic healthy individuals. Infection Control &

Hospital Epidemiology, 28(09), 1114-1116.

Kalantar, E., Taherzadeh, S., Ghadimi, T., Soheili, F., Salimizand, H., &

Hedayatnejad, A. (2012). Pseudomonas aeruginosa, an emerging pathogen

among burn patients in Kurdistan Province, Iran. Southeast Asian Journal of

Tropical Medicine and Public Health, 43(3), 712–717.

Kapil, A. (2013). India needs an implementable antibiotic policy. Indian journal of

medical microbiology, 31(2), 111.

Karlowsky, J. A., & Hoban, D. J. (2006). Flouroquinolones resistant urinary isolates

from North American urinary tract infection Collaborative Alliance

Quinolones resistance study. Antimicrob Agents chemother, 50(6), 2251-4.

142

Karlowsky, J. A., Draghi, D. C., Jones, M. E., Thornsberry, C., Friedland, I. R., &

Sahm, D. F. (2003). Surveillance for antimicrobial susceptibility among

clinical isolates of Pseudomonas aeruginosa and Acinetobacter baumannii

from hospitalized patients in the United States, 1998 to 2001. Antimicrobial

agents and chemotherapy, 47(5), 1681-1688.

Katzung B. G. (2006). Basic & clinical pharmacology 10th Edition; Lange: pp: 724-

916.

Katzung, B.G. (2007). Chemotherapeutic drugs. Basic and clinical Pharmacology.

11th Edition B.J.Katzung. Singapore, The Mc Graw-Hilln Companies.pp: 706-

890.

Katzung, B.G. (2012). Chemotherapeutic drugs. Basic and clinical Pharmacology. 12

Edition. B.J.Katzung. Singapore, The Mc Graw-Hilln Companies.pp 789-840:

Khan, J. A., & Iqbal, Z. (2008) Report: Prevalence and resistance pattern of

Pseudomonas aeruginosa against various antibiotics. Pak J Pharm Sci 21(3),

311-15.

Khan, M. A. (2012). Bacterial spectrum and susceptibility patterns of pathogens in

ICU and IMCU of a secondary care hospital in Kingdom of Saudi

Arabia. International Journal of pathology, 10(2), 64-70.

Khan, O. I., Khan, N. I., Izhar, M., & Khan, J. I. (1998). Changes in pattern of

bacteremia at Shaikh Zayed Medical Complex, Lahore. : Prevalence and

resistance pattern of Pseudomonas aeruginosa against various antibiotics. Pak

J Med Res, 36, 80-2.

Khorasani, G., Salehifar, E., & Eslami, G. (2008). Profile of microorganisms and

antimicrobial resistance at a tertiary care referral burn centre in Iran:

emergence of Citrobacter freundii as a common microorganism. Burns, 34(7),

947-952.

143

Khushal, R. (2004). Prevalence, characterization and development of resistance

pattern in indigenous clinical isolates against cephalosporins. PhD. Thesis:

224.

Kim, J., Lim, Y. M., Rheem, I., Lee, Y., Lee, J. C., Seol, S. Y., ... & Cho, D. T.

(2005). CTX-M and SHV-12 β-lactamases are the most common extended-

spectrum enzymes in clinical isolates of Escherichia coli and Klebsiella

pneumoniae collected from 3 university hospitals within Korea. FEMS

microbiology letters, 245(1), 93-98.

Kim, M. H., Lee, H. J., Park, K. S., & Suh, J. T. (2010). Molecular Characteristics of

Extended Spectrum β-Lactamases in Escherichia coli and Klebsiella

pneumoniae and the Prevalence of qnr in Extended Spectrum β-Lactamase

Isolates in a Tertiary Care Hospital in Korea, Yonsei Med J, 51(5),768-774.

Kim, S., Hu, J., Gautom, R., Kim, J., Lee, B., and Boyle, D. (2007). CTX-M

Extended spectrum β-lactamases, Washington State, Emerging Infectious

Disease, 13(3),513-516.

Kliebe, C., Nies, B. A., Meyer, J. F., Tolxdorff-Neutzling, R. M., and Wiedemann, B.,

(1985), Evolution of plasmid-coded resistance to broad-spectrum

cephalosporins, Antimicrob Agents Chemotherapy, 28(2):302-307.

Knothe, H., Shah, P., Krcmery, V., Antal, M. and Mitsuhashi, S. (1983). Transferable

resistance to cefotaxime, cefoxitin, cefamandole and cefuroxime in clinical

isolates of Klebsiella pneumoniae and Serratia marcescens, Infection,

11(6):315-7.

Kokare, C. R., Chakraborty, S., Khopade, A. N., & Mahadik, K. R. (2009). Biofilm :

Importance and applications, Indian journal of biotechnology, 8,159–168.

Komolafe, O. O., James, J., Kalongolera, L., & Makoka, M. (2003). Bacteriology of

burns at the Queen Elizabeth Central Hospital, Blantyre,

Malawi. Burns, 29(3), 235-238.

144

Kotra, L. P., Samama, J., and Mobashery, S. (2002). β-lactamases and resistance to β-

lactam antibiotics. In: Lewis K, Salyers AA, Taber HW,Wax RG, eds.

Bacterial resistance to antimicrobials, 123-60.

Lal, P., Kapil, A., Das, B. K., and Sood, S. (2007). Occurence of TEM and SHV gene

in extended spectrum β- lactamases (ESBLs) producing Klebsiella spp.isolated

from a tertiary care hospital, Indian Journal Medical, 125;173-178.

Lando, D., Cousin, M. A., & Privat de Garilhe, M. (1973). Misreading, a fundamental

aspect of the mechanism of action of several

aminoglycosides. Biochemistry, 12(22), 4528-4533.

Lari, A. R., Honar, H. B., & Alaghehbandan, R. (1998). Pseudomonas infections in

Tohid Burn Center, Iran. Burns, 24(7), 637-641.

Lautenbach E., Patel J. B., Bilker W. B., Edelstein P. H., & Fishman. N. O. (2001).

Extended-spectrum β-lactamase–producing Escherichia coli and Klebsiella

pneumoniae: risk factors for infection and impact of resistance on outcomes,

Clin Infect Dis, 32: 1162–1171.

Lear, G., & Lewis, G. D. (Eds.). (2012). Microbial biofilms: current research and

applications. Horizon Scientific Press.

Leevy, W. M., Gammon, S. T., Jiang, H., Johnson, J. R., Maxwell, D. J., Jackson, E.

N., ... & Smith, B. D. (2006). Optical imaging of bacterial infection in living

mice using a fluorescent near-infrared molecular probe. Journal of the

American Chemical Society, 128(51), 16476-16477.

Levinson, W. (2010). Review of medical microbiology and immunology. 11th Ed.

New York: Lange, 85-93.

Levy, S. B. (2000). Antibiotic and antiseptic resistance: impact on public health. The

Pediatric infectious disease journal, 19(10), S120-S122.

145

Levy, S. S. S., Mello, M. J. G., Gusmão-Filho, F. A. R., & Correia, J. B. (2010).

Colonisation by extended-spectrum β-lactamase-producing Klebsiella spp. in a

paediatric intensive care unit. Journal of Hospital Infection, 76(1), 66-69.

Lewis, K. (2001). Riddle of biofilm resistance. Antimicrobial agents and

chemotherapy, 45(4), 999-1007.

Lewis, M. A. O., Parkhurst, C. L., Douglas, C. W. I., Martin, M. V., Absi, E. G.,

Bishop, P. A., & Jones, S. A. (1995). Prevalence of penicillin resistant bacteria

in acute suppurative oral infection. Journal of Antimicrobial

Chemotherapy, 35(6), 785-791.

Li, X. Z., & Nikaido, H. (2004). Efflux-mediated drug resistance in

bacteria. Drugs, 64(2), 159-204.

Lin, S. P., Liu, M. F., Lin, C. F., & Shi, Z. Y. (2012). Phenotypic detection and

polymerase chain reaction screening of extended-spectrum β-lactamases

produced by Pseudomonas aeruginosa isolates. Journal of Microbiology,

Immunology and Infection, 45(3), 200-207.

Lipponcott (2004). Pharmacology.

Livermore, D. M. (1995). Beta-lactamases in laboratory and clinical resistance. Clin

Microbial Rev 8: 557, 584.

Livermore, D. M. (2003). Bacterial resistance: origins, epidemiology, and

impact. Clinical infectious diseases, 36(Supplement 1), S11-S23..

Livermore, D. M., & Hawkey, P. M. (2008). CTX-M: changing the face of ESBLs in

the UK. 2005, Defining an extended-spectrum β-lactamase, Clinical

Microbiology Infection, 14(Suppl 5), 21-24

Livermore, D. M., & Woodford, N. (2006). The β-lactamase threat in

Enterobacteriaceae, Pseudomonas and Acinetobacter. Trends in

microbiology, 14(9), 413-420.

146

Livermore, D. M., Canton, R., Gniadkowski, M., Nordmann, P., Rossolini, G. M.,

Arlet, G., ... & Poirel, L. (2007). CTX-M: changing the face of ESBLs in

Europe. Journal of Antimicrobial Chemotherapy, 59(2), 165-174.

Mahmoud, A. B., Zahran, W. A., Hindawi, G. R., Labib, A. Z., & Galal, R. (2013).

Prevalence of multidrug-resistant Pseudomonas aeruginosa in patients with

nosocomial infections at a university hospital in Egypt, with special reference

to typing methods. J Virol Microbiol, 13.

Mathai, D., Rhomberg, P. R., Biedenbach, D. J., Jones, R. N., & India Antimicrobial

Resistance Study Group. (2002). Evaluation of the in vitro activity of six

broad-spectrum β-lactam antimicrobial agents tested against recent clinical

isolates from India: a survey of ten medical center laboratories. Diagnostic

microbiology and infectious disease, 44(4), 367-377.

Mathur, P., Kapil, A., Das, B., & Dhawan, B. (2002). Prevalence of extended

spectrum (beta) lactmase producing gram negative bacteria in a tertiary care

hospital. Indian Journal of Medical Research, 115, 153-157.

Matsumoto, Y. O. S. H. I. M. I., Ikeda, F. U. M. I. A. K. I., Kamimura, T. O. S. H. I.

A. K. I., Yokota, Y. O. S. H. I. K. O., & Mine, Y. A. S. U. H. I. R. O. (1988).

Novel plasmid-mediated beta-lactamase from Escherichia coli that inactivates

oxyimino-cephalosporins. Antimicrobial agents and chemotherapy, 32(8),

1243-1246.

Medeiros, A. A. (1997). Evolution and dissemination of β-lactamases accelerated by

generations of β-lactam antibiotics, Clin Infect Dis,24(1S),19-45.

Medici, D. D., Croci, L., Delibato, E., Pasquale, S. D., Filetici, E., and Toti, L. (2003),

Evaluation of DNA Extraction Methods for Use in Combination with SYBR

Green I Real-Time PCR To Detect Salmonella enterica Serotype Enteritidis in

Poultry, Applied and Environmental Microbiology, vol. 69, no. 6, pp. 3456-

3461.

Mesaros, N., Nordmann, P., Plésiat, P., Roussel-Delvallez, M., Van Eldere, J.,

Glupczynski, Y., ... & Tulkens, P. M. (2007). Pseudomonas aeruginosa:

147

resistance and therapeutic options at the turn of the new millennium. Clinical

microbiology and infection, 13(6), 560-578.

Messadi, A. A., Lamia, T., Kamel, B., Salima, O., Monia, M., & Saida, B. R. (2008).

Association between antibiotic use and changes in susceptibility patterns of

Pseudomonas aeruginosa in an intensive care burn unit: a 5-year study, 2000–

2004. Burns, 34(8), 1098-1102.

Miller, G. H., Sabatelli, F. J., Hare, R. S., Glupczynski, Y., Mackey, P., Shlaes, D., ...

& Shaw, K. J. (1997). The most frequent aminoglycoside resistance

mechanisms—changes with time and geographic area: a reflection of

aminoglycoside usage patterns?. Clinical infectious diseases, 24(Supplement

1), S46-S62.

Molin, S., & Tolker-Nielsen, T. (2003). Gene transfer occurs with enhanced

efficiency in biofilms and induces enhanced stabilisation of the biofilm

structure. Current opinion in biotechnology, 14(3), 255-261.

Muvunyi, C. M., Masaisa, F., Bayingana, C., Mutesa, L., Musemakweri, A., &

Muhirwa, G. (2011). Decreased susceptibility to commonly used antimicrobial

agents in bacterial pathogens isolated from urinary tract infections in Rwanda:

need for new antimicrobial guidelines. The American journal of tropical

medicine and hygiene, 84(6), 923-928.

Neu, H. C. (1994). Principal of antimicrobial use. Human Pharmacology.E.D under

down Missouri, Mosby, 615-772.

Obritsch, M. D., Fish, D. N., MacLaren, R., & Jung, R. (2005). Nosocomial infections

due to multidrug resistant Pseudomonas aeruginosa: epidemiology and

treatment options. Pharmacotherapy: The Journal of Human Pharmacology

and Drug Therapy, 25(10), 1353-1364.

Ohsuka, S., Arakawa, Y., Horii, T., Ito, H., & Ohta, M. (1995). Effect of pH on

activities of novel beta-lactamases and beta-lactamase inhibitors against these

beta-lactamases. Antimicrobial agents and chemotherapy, 39(8), 1856-1858.

148

Pagani, L., Amico, E. D., Migliavacca, R. D, Andrea, M. M., Giacobone, E.,

Amicosante, G., Romero, E., and Rossolini, G. M. (2004). Multiple CTX-M-

Type Extended-Spectrum β-Lactamases in Nosocomial Isolates of

Enterobacteriaceae from a Hospital in Northern Italy, Journal of Clinical

Microbiology, 41(9), 4264-4269.

Parsek, M. R., & Singh, P. K. (2003). Bacterial biofilms: an emerging link to disease

pathogenesis. Annual Reviews in Microbiology, 57(1), 677-701.

Paterson, D. L. (2008). Impact of antibiotic resistance in gram-negative bacilli on

empirical and definitive antibiotic therapy. Clinical infectious

diseases, 47(Supplement 1), S14-S20.

Paterson, D. L., & Bonomo, R. A. (2005). Extended-spectrum β-lactamases: a clinical

update. Clinical microbiology reviews, 18(4), 657-686.

Paterson, D. L., & Victor, L. Y. (1999). Editorial response: extended-spectrum β-

lactamases: a call for improved detection and control. Clinical Infectious

Diseases, 29(6), 1419-1422.

Pathak, A., Marothi, Y., Kekre, V., Mahadik, K., Macaden, R., & Lundborg, C. S.

(2012). High prevalence of extended-spectrum β-lactamase-producing

pathogens: Results of a surveillance study in two hospitals in Ujjain, India.

Infection and Drug Resistance, 5(1),77-9

Peirano, G., & Pitout, J. D. (2010). Molecular epidemiology of Escherichia coli

producing CTX-M β-lactamases: the worldwide emergence of clone ST131

O25: H4. International journal of antimicrobial agents, 35(4), 316-321.

Peirovifar, A., Rezaee, M., & Mostafa, G. M. (2014). Prevalence of Multidrug

Resistant Extended-SpectrumΒ--Lactamase Producing Gram-Negative

Bacteria inNeonatal Sepsis. International Journal of Women’s Health and

Reproduction Sciences, 2(3), 138–145.

Perez, F., Endimiani, A., Hujer, K. M., and Bonomo, R. A. (2007).The continuing

challenge of ESBLs. Current Opinion in Pharmacology, 7(5),459-46.

149

Pfaller, M. A., & Segreti, J. (2006). Overview of the epidemiological profileand

laboratory detection of extended-spectrum β-Lactamases. Clinical Infectious


Philippon, A., Labia, R. and Jacoby, G. (1989). Extended-spectrum ß-Lactamases,

Antimicrob Agents Chemother, 33,1131-6.

Pier, G. B., & Ramphal, R. (2005). Pseudomonas aeruginosa. Principles and practice

of infectious diseases, G Mandell. Philadelphia, Elsevier Chrchill Livingstone

6(2), 2587-2615.

Pitout, J. D. (2010). Infections with extended-spectrum β-lactamase-producing

Enterobacteriaceae. Drugs, 70(3), 313-333.

Pitout, J. D., & Laupland, K. B. (2008). Extended-spectrum β-lactamase-producing

Enterobacteriaceae: an emerging public-health concern. The Lancet infectious

diseases, 8(3), 159-166.

Poirel, L., Naas, T., Nicolas, D., Collet, L., Bellais, S., Cavallo, J. D., & Nordmann, P.

(2000). Characterization of VIM-2, a carbapenem-hydrolyzing metallo-β-

lactamase and its plasmid-and integron-borne gene from a Pseudomonas

aeruginosa clinical isolate in France. Antimicrobial Agents and


Poirel, L., Pitout, J. D., & Nordmann, P. (2007). Carbapenemases: molecular diversity

and clinical consequences. Future Microbiol. 2(5):501-512.

Poole, K. (2005). Aminoglycoside resistance in Pseudomonas

aeruginosa. Antimicrobial agents and Chemotherapy, 49(2), 479-487.

Prescott, L. M., Harley, J. P. and Klein, D. A. (1999) Microbiology, (4th ed.),

Mcgraw-Hill Companies, USA; 683-691.

Prescott, L. M., Harley, J. P. and Klein, D. A. (2002). Microbiology, (5th ed.),

Mcgraw-Hill Companies, USA, : 725-732.

150

Prescott, L. M., Harley, J. P. and Klein, D. A. (2003). Microbiology, (6th ed.),

Mcgraw-Hill Companies, USA.: 807-816.

Quinn, J. P., Studemeister, A. E., DiVincenzo, C. A., & Lerner, S. A. (1988).

Resistance to imipenem in Pseudomonas aeruginosa: clinical experience and

biochemical mechanisms. Review of Infectious Diseases, 10(4), 892-898.

Rahman, M. M., Haq, J. A., Hossain, M. A., Sultana, R., Islam, F., & Islam, A. S.

(2004). Prevalence of extended-spectrum β-lactamase-producing Escherichia

coli and Klebsiella pneumoniae in an urban hospital in Dhaka,

Bangladesh. International journal of antimicrobial agents, 24(5), 508-510.

Resende, A. C. B., Soares, R., de Bastos, A., dos Santos, D. B., Montalvão, E. R., &

do Carmo Filho, J. R. (2009). Detection of antimicrobial-resistant Gram-

negative bacteria in hospital effluents and in the sewage treatment station of

Goiânia Brazil. O Mundo da Saúde, 33(4), 385-391.

Revathi, G., Puri, J., & Jain, B. K. (1998). Bacteriology of burns. Burns, 24(4), 347-

349.

Rewatkar, A. R., & Wadher, B. J. (2013). Staphylococcus aureus and Pseudomonas

aeruginosa- Biofilm formation Methods, Journal of Pharmacy and Biological

Sciences. 8(5), 36–40.

Roshan, M., Ikram, A., Mirza, I. A., Malik, N., Abbasi, S. A., & Alizai, S. A. (2011).

Susceptibility pattern of extended spectrum ß-lactamase producing isolates in

various clinical specimens. Journal of the College of Physicians and Surgeons

Pakistan, 21(6), 342–346.

Rupp, M. E. and Paul, D. (2003). Extended Spectrum β--Lactamase (ESBL).

Producing enterobacteriaceae,.Drug. 63(4):353-356.

Rupp, M. E., & Fey, P. D. (2003). Extended spectrum β-lactamase (ESBL)-producing

Enterobacteriaceae. Drugs, 63(4), 353-365.

151

Rupp, M. E., Fey, P. D., Heilmann, C., & Götz, F. (2001). Characterization of the

importance of Staphylococcus epidermidis autolysin and polysaccharide

intercellular adhesin in the pathogenesis of intravascular catheter-associated

infection in a rat model. Journal of Infectious Diseases, 183(7), 1038-1042.

Ryoo, N. H., Kim, E. C., Hong, S. G., Park, Y. J., Lee, K., Bae, I. K., ... & Jeong, S.

H. (2005). Dissemination of SHV-12 and CTX-M-type extended-spectrum β-

lactamases among clinical isolates of Escherichia coli and Klebsiella

pneumoniae and emergence of GES-3 in Korea. Journal of Antimicrobial


Sader, H. S., Mendes, R. E., Gales, A. C., Jones, R. N., Pfaller, M. A., Zoccoli, C., &

Sampaio, J. (2001). Perfil de sensibilidade a antimicrobianos de bactérias

isoladas do trato respiratório baixo de pacientes com pneumonia internados em

hospitais brasileiros: resultados do Programa SENTRY, 1997 e 1998. J

Pneumol, 27(2), 59-67..

Sader, H. S., Rhomberg, P. R., Farrell, D. J., & Jones, R. N. (2011). Antimicrobial

activity of CXA-101, a novel cephalosporin tested in combination with

tazobactam against Enterobacteriaceae, Pseudomonas aeruginosa and

Bacteroides fragilis strains having various resistance

phenotypes. Antimicrobial agents and chemotherapy. 55, 2390-2394.

Samaha-Kfoury, J. N., & Araj, G. F. (2003). Recent developments in [beta]

lactamases and extended spectrum [beta] lactamases. BMJ: British Medical

Journal, 327(7425), 1209-1213.

Sasirekha, B., Manasa, R., Ramya, P., & Sneha, R. (2010). Frequency and

Antimicrobial Sensitivity Pattern Of Extended Spectrum β-- Lactamases

Producing E.coli And Klebsiella Pneumoniae Isolated in A Tertiary Care

Hospital, Al Ameen journal Medical science. 3(4 ),265-271.

Shahid, M., & Malik, A. (2005). Resistance due to aminoglycoside modifying

enzymes in Pseudomonas aeruginosa isolates from burns patients. Indian

Journal of Medical Research, 122(4), 324.

152

Sharma, J., Sharma, M., & Ray, P. (2010). Detection of TEM & SHV genes in

Escherichia coli & Klebsiella pneumoniae isolates in a tertiary care hospital

from India. Indian J Med, Res. 132:332-336.

Sharma, S. A. V. I. T. R. I., Bhat, G. K., & Shenoy, S. (2007). Virulence factors and

drug resistance in Escherichia coli isolated from extraintestinal

infections. Indian journal of medical microbiology, 25(4), 369-373.

Sheryll, L., Magalit, M. D., Maria, Tarcela, S., Gler, M. D, and Thelma, E, Tupasi, M.

D., (2004). Increasing Antimicrobial Resistance Patterns of Community and

Nosocomial Uropathogens in Makati Medical Center antibiotics, Phil J

Microbiol lnfect Dis. 33(4),143-148.

Shivaprakasha, S., Radhakrishnan, K., Gireesh, A. R., Shamsulkarim, P. M. (2007).

Routin screening for ESBL Production, A necessity of Today. The Inter

Journal of Microbiology. 3(1),387-393.

Shobha, K. L., Gowrish Rao, S., Rao, S., & Sreeja, C. K. (2007). Prevalence of

extended spectrum beta-lactamases in urinary isolates of Escherichia coli,

Klebsiella and Citrobacter species and their antimicrobial susceptibility

pattern in a tertiary care hospital. Indian Journal for the Practising

Doctor, 3(6), 01-2007.

Sidjabat, H. E., Paterson, D. L., Adams-Haduch, J. M., Ewan, L., Pasculle, A. W.,

Muto, C. A., Tian, G. B., and Doi, Y. (2009). Molecular Epidemiology of

CTX-M-Producing Escherichia coli Isolates at a Tertiary Medical Center in

Western Pennsylvania. Antimicrob Agents Chemother. 53(11), 4733–4739.

Singh, N. P., Goyal, R., Manchanda, V., Das, S., Kaur, I., & Talwar, V. (2003).

Changing trends in bacteriology of burns in the burns unit, Delhi,

India. Burns, 29(2), 129-132.

Singh, R. P., Jain, S., Singh, P., & Gupta, N. (2014). Development of antibiotic

resistance in Gram negative bacilli: An eye opener. Medical Journal of Dr. DY

Patil University, 7(3), 332.

153

Smet, A., Van Nieuwerburgh, F., Vandekerckhove, T. T., Martel, A., Deforce, D.,

Butaye, P., & Haesebrouck, F. (2010). Complete nucleotide sequence of CTX-

M-15-plasmids from clinical Escherichia coli isolates: insertional events of

transposons and insertion sequences. PLoS One, 5(6), e11202.

Spoering, A. L., and Lewis, K. (2001). "Biofilms and planktonic cells of

Pseudomonas aeruginosa have similar resistance to killing by antimicrobials".

Journal of Bacteriology183 (23), 6746–51.

Stepanović, S., Vuković, D., Dakić, I., Savić, B., & Švabić-Vlahović, M. (2000). A

modified microtiter-plate test for quantification of staphylococcal biofilm

formation. Journal of microbiological methods, 40(2), 175-179.

Stone, H. H. (1966). Review of Pseudomonas sepsis in thermal burns: verdoglobin

determination and gentamicin therapy. Ann Surg. 163(2),297-305.

Stoodley, DeBeer, D. P., and Lewandowski, Z. (1994). "Liquid Flow in Biofilm

Systems, Appl Environ Microbiol. 60 (8),2711–2716.

Strateva, T., Ouzounova-Raykova, V., Markova, B., Todorova, A., Marteva-Proevska,

Y., Mitov I. (2007). Widespread detection of VEB-1-type extended-spectrum

β-lactamases among nosocomial ceftazidime-resistant Pseudomonas

aeruginosa isolates in Sofia, Bulgaria, J. Chemother. 19,40–145.

Tasli, H., & Bahar, I. H. (2005). Molecular characterization of TEM-and SHV-

derived extended-spectrum beta-lactamases in hospital-based

Enterobacteriaceae in Turkey. Japanese journal of infectious diseases, 58(3),

162-167.

Tenover, F. C., Mohammed, M. J., Gorton, T. S., Dembek, Z. F. (1999). Detection

and reporting of organisms producing extended spectrum β--lactamases:

survey of laboratories in Connecticut, Journal Clinical Microbiology.

37,4065-70.

154

Thomson, K. S., Sanders, C. C., & Washington, J. A. (1991). High-level resistance to

cefotaxime and ceftazidime in Klebsiella pneumoniae isolates from Cleveland,

Ohio. Antimicrobial agents and chemotherapy, 35(5), 1001-1003.

Toder, D. S., Gambello, M. J., and Iglewski. (2008). Bacterial resistance to Antibiotic

in Toders Online Textbook of Bacteriology, Kinneth Toder Unerversity of

Wisconsin- Medison.Department of Bacteriology.

Tredget, E. E., Shankowsky, H. A., et al., (2004). Pseudomonas infections in the

thermally injured patients. Burns.30(1):3-26.

Tredget, E. E., Shankowsky, H. A., Rennie, R., Burrell, R. E., & Logsetty, S. (2004).

Pseudomonas infections in the thermally injured patient. Burns, 30(1), 3-26.

Tsuji, M., Takema, M., Miwa, H., Shimada, J., & Kuwahara, S. (2003). In vivo

antibacterial activity of S-3578, a new broad-spectrum cephalosporin:

methicillin-resistant Staphylococcus aureus and Pseudomonas aeruginosa

experimental infection models. Antimicrobial agents and

chemotherapy, 47(8), 2507-2512.

Turner, P. J. (2005). Extended-Spectrum b -Lactamases, Clinical Infectious Diseases.

2005; 41(4):273–

Turner, P. J. (2005). Extended-spectrum β-lactamases. Clinical Infectious


Ullah, F., Malik, S. A., & Ahmed, J. (2009). Antimicrobial susceptibility pattern and

ESBL prevalence in Klebsiella pneumoniae from urinary tract infections in the

North-West of Pakistan. African Journal of Microbiology Research, 3(11),

676-680.

Umadevi, S., Kandhakumari, G., Joseph, N. M., Kumar, S., Easow, J. M., Stephen, S.,

& Singh, U. K. (2011). Prevalence and antimicrobial susceptibility pattern of

ESBL producing gram negative bacilli, Journal of Clinical and Diagnostic

Research. 5(2), 236–239.

155

Van Der Plas, M. J., Jukema, G. N., Wai, S. W., Dogterom-Ballering, H. C.,

Lagendijk, E. L., van Gulpen, C., ... & Nibbering, P. H. (2008). Maggot

excretions/secretions are differentially effective against biofilms of

Staphylococcus aureus and Pseudomonas aeruginosa. Journal of

Antimicrobial Chemotherapy, 61(1), 117-122.

Van Elder, J. (2003). Multicentre surveillance of Pseudomonas aureginosa

Susceptibility Patterns in nosocomial infections, J Antimicrob Chemother.

51(2),347-352.

Varaiya, A., Dogra, J., Kulkarni, M., Bhalekar, P. (2008), Extende spectrum β-

lactamase (ESBL) Producing Escherichia coli and Klebsiella pneumoniae in

diabetic foot infection, Indian Journal of Medical Microbiology. 51(3):370-

372.

Vinodhini, R., Moorthy, K., Palanivel, P., Punitha, T., Saranya, S., Bhuvaneshwari,

M., & Kanimozhi, C. (2014). Detection and antimicrobial susceptibility

pattern of ESBL producing gram negative bacteria. Asian Journal of

Pharmaceutical and Clinical Research, 7(SUPPL. 1), 243–247.

Wadi, J., Haloub, N., Ahmad, M. Al, Samara, A., & Romman, A. (2011). Prevalence

of meropenem susceptibility among Gram-negative pathogens isolated from

intensive care units in Jordan. The International Arabic Journal of

Antimicrobial Agents, (4), 1–8.

Walkty, A., Decorby, M. (2008). Antimicrobioal suscibtibility of Pseudomonas

aureginosa isolated from patients in Candian ICU as part of the candian

National ICu study. Diag Microbiol Infect Dis. 61(2), 217-221

WHO. (2002). Global Strategy for Containment of Antimicrobial Resistance.

Wiegand, I., Geiss, H. K., Mack, D., Sturenburg, E., and Seifert, H. (2007) Detection

of ESBL among Enterobacteriaceae by use of semiaotomated microbiology

systems and manual detection procedures, J Clin Microbiol, 45,1167-74.

156

Wirth, F. W., Picoli, S. U., Cantarelli, V. V., Gonçalves, A. L., Brust, F. R., Santos, L.

M., & Barreto, M. F. (2009). Metallo-β-lactamase-producing Pseudomonas

aeruginosa in two hospitals from Southern Brazil. Brazilian Journal of

Infectious Diseases, 13(3), 170-172.

Wise, R., Hart, T., Cars, O., Streulens, M., Helmuth, R., Huovinen, P., & Sprenger,

M. (1998). Antimicrobial resistance is a major threat to public health. British

Medical Journal, 317(7159), 609-611.

Woodruff, H. B., & Foster, J. W. (1945). Microbiological aspects of penicillin: VII.

Bacterial penicillinase. Journal of bacteriology, 49(1), 7.

World Health Organization. (1997). Antimicrobial resistance monitoring programme.

WHO Drug Information. 11, 248–9.

Xu, L., Ensor, V., Gossain, S., Nye, K., and Hawkey, P. (2005). Rapid and simple

detection of CTX-M genes by multiplex PCR assay, Journal of Medical

Microbiology, 54,1183-1187.

Yusha, U., Kumurya, M. M., and Suleiman, L. (2010). Prevalence of Extended

spectrum Β-- lactamases among Enterobacteriaceae in Murtala Mohammed

specialist hospital, Kano,N, Journal of Pure and Applied Sciences,

vol.3(1),169- 172.

Zhanel, G. G., Laing, N. M., Nichol, K. A., Palatnick, L. P., Noreddin, A., Hisanaga,

T., ... & NAVRESS Group. (2003). Antibiotic activity against urinary tract

infection (UTI) isolates of vancomycin-resistant enterococci (VRE): results

from the 2002 North American Vancomycin Resistant Enterococci

Susceptibility Study (NAVRESS). Journal of Antimicrobial


157

Publication from Thesis

antimicrobial susceptibility and esbl prevalence in clinical ...

Documents

Transcript of antimicrobial susceptibility and esbl prevalence in clinical ...