A novel regulatory element in the dnmt1 gene that responds toco-activation by Rb and c-Jun

Andrew Slacka,1, Marc Pinarda,1, Felipe D. Araujob, Moshe Szyfa,*

aDepartment of Pharmacology and Therapeutics, McGill University, 3655 Drummond Street, Montreal PQ H3G 1Y6V, CanadabDepartment of Biochemistry and McGill Cancer Center, 3655 Drummond Street, Montreal PQ H3G 1Y6V, Canada

Received 18 December 2000; received in revised form 19 February 2001; accepted 6 March 2001

Received by E. Boncinelli

Abstract

Rb, c-Jun and dnmt1 play critical roles in the process of cellular differentiation. We demonstrate that a regulatory region of murine dnmt1

contains an element which is responsible for transactivation by Rb and c-Jun in P19 embryocarcinoma cells which is not observed in Y1

adrenocarcinoma cells. During differentiation of P19 cells, the induction of Rb and c-Jun coincides with an increase of dnmt1 mRNA. Using

linker scanning mutagenesis we identify the element that is responsible for this activation to be a non-canonical AP-1 site. Our data is an

example of how a proto-oncogene activates its downstream effectors by recruiting a tumor suppressor. This interaction of Rb and a proto-

oncogene might play an important role in differentiation. The responsiveness of dnmt1 to this type of signal is consistent with an important

role for regulated expression of dnmt1 during cellular differentiation. q 2001 Published by Elsevier Science B.V. All rights reserved.

Keywords: dnmt1; DNA methylation; Rb; c-Jun; Transactivation

1. Introduction

The retinoblastoma tumor-suppressor protein Rb inhibits

cell proliferation by repressing a subset of genes that are

controlled by the E2F family of transcription factors, which

are involved in progression from the G1 to the S-phase of

the cell cycle. Rb, which is recruited to target promoters by

E2F1, represses transcription by masking the E2F1 transac-

tivation domain and by inhibiting surrounding enhancer

elements, an active repression that controls cell cycle

progression (Weinberg, 1995; Weintraub et al., 1995). Rb

has also been shown to be essential in the differentiation of a

number of cell types (Ookawa et al., 1997; Kobayashi et al.,

1998). c-Jun is a nuclear proto-oncogene that activates tran-

scription of its target genes by forming homodimeric or

heterodimeric AP-1 complexes with the c-fos gene products.

Although c-Jun has been demonstrated to have well-de®ned

roles in cellular proliferation (Johnson et al., 1993) and

transformation (Hartl and Vogt, 1992), other data has also

supported a crucial role for c-Jun in differentiation (de Groot

et al., 1990a).

Original data pointed towards opposite roles for Rb, a

tumor suppressor which arrests mitosis and Jun, a proto-

oncogene with a pro-mitogenic effect (for reviews, see

(Kaelin, 1999; Wisdom, 1999)). Interestingly, however,

recent evidence has demonstrated Rb-mediated enhance-

ment of the transactivation of genes containing AP-1 recog-

nition elements via formation of a Rb-c-Jun protein complex

(Nead et al., 1998; Nishitani et al., 1999). These Rb-c-Jun

complexes were shown to be present in terminally differen-

tiating keratinocytes (Nead et al., 1998). This type of inter-

action might be a paradigm that operates during cellular

differentiation.

Substantial evidence has demonstrated that the DNA 5-

cytosine methyltransferase (dnmt1) is a critical downstream

effector of the Ras oncogenic signaling pathway. Dnmt1 is

transcriptionally up-regulated by the Ras/AP-1 pathway

(MacLeod et al., 1995; Rouleau et al., 1995). K-ras muta-

tions in colon cancer cell lines, colon cancers and adenomas

have been shown to be directly correlated with hypermethy-

lation and silencing of the tumor suppressor gene p16 (Guan

et al., 1999). Ex vivo tumorigenesis of the Y1 adrenal-carci-

noma line, in which K- Ras is ampli®ed, is inhibited by

expressed dnmt1 antisense (MacLeod and Szyf, 1995) and

Gene 268 (2001) 87±96

0378-1119/01/$ - see front matter q 2001 Published by Elsevier Science B.V. All rights reserved.

PII: S0378-1119(01)00427-9

www.elsevier.com/locate/gene

Abbreviations: dnmt1, DNA Methyltransferase; RA, retinoic acid;

EMSA, electrophoretic mobility shift assay, CAT; chloramphenicol acet-

yltransferase, GST; glutathione S-transferase, RB; retinoblastoma suscept-

ibility gene product, LSM; linker scanning mutagenesis, RIPA buffer;

RadioImmunoProtectionAssay buffer

* Corresponding author. Tel.: 11-514-398-7107; fax: 11-514-398-6690.

E-mail address: mszyf@pharma.mcgill.ca (M. Szyf).1 These authors contributed equally to this article.

in vivo Y1 tumor growth is inhibited by systemic adminis-

tration of dnmt1 antisense oligonucleotides (Ramchandani

et al., 1997). Transformation of cells by expression of c-Fos,

which forms heterodimeric complexes with c-Jun to stimu-

late transcription of AP-1 regulated genes, induces dnmt1

expression (Bakin and Curran, 1999). Cellular transforma-

tion induced by c-fos can be reversed by inhibition of dnmt1

(Bakin and Curran, 1999), which is consistent with the

notion that dnmt1 induction is important in cellular trans-

formation. Analysis of both mouse and human dnmt1 tran-

scriptional regulatory regions has identi®ed AP-1

recognition sequences and c-Jun responsive elements down-

stream to its distal promoter (Rouleau et al., 1992; Bigey et

al., 2000). On the other hand, expression of Rb has repres-

sive effects on chimeric human dnmt1 reporter constructs'

transactivation (Bigey et al., 2000).

Similarly to c-Jun, dnmt1 is crucial for cellular differen-

tiation in addition to its pathological role in the process of

cellular transformation. Dnmt1 null mouse embryonic stem

cells die upon induction of differentiation, but their capacity

to differentiate can be functionally rescued by dnmt1 re-

expression (Tucker et al., 1996). DNA methylation has

been shown to be essential in neurite formation, where it

plays a role in cellular differentiation processes that are

distinct from proliferation (Persengiev and Kilpatrick,

1996). We, therefore, addressed the question of whether

dnmt1 can respond to the paradigm of interaction of c-Jun

and Rb observed during differentiation.

Having previously demonstrated the AP-1 responsiveness

of a regulatory region of the murine dnmt1 via consensus

AP-1 elements (Rouleau et al., 1992), we have now exam-

ined a second downstream regulatory region. This region

can also direct transcriptional activation of a reporter

gene, but contains no known consensus elements for binding

of transcription factors. We tested the hypothesis that this

region might be responsible for transcriptional responsive-

ness of dnmt1 during differentiation. We used P19 embryo-

carcinoma cells that originate from an ES cell-induced

tumor (McBurney, 1993) and are a widely used system for

the study of cellular differentiation. The P19 cell line is ideal

for testing our hypothesis for a number of reasons. P19 cells

can be induced to differentiate into a neuroectoderm-like

lineage in the presence of retinoic acid (RA) (McBurney,

1993). They also express low levels of Rb protein prior to

differentiation, which increases after RA stimulation (Slack

et al., 1993) and they normally express a low level of c-jun

which rise sharply after RA stimulation and differentiation

(de Groot et al., 1990b). The Y1 adrenal-carcinoma line,

which expresses c-jun abundantly, was used as a control

for the transformed cell paradigm of c-jun regulation. In

this paper, we show a transcriptional activation of this

region by overexpression of Rb and c-Jun in the P19 cell

line. Using systematic mutation analysis of this regulatory

region, we identi®ed an element bearing homology to a non-

canonical AP-1 recognition sequence, which is essential for

this transcriptional activation. We demonstrate a depen-

dence of this element on the presence of Rb and c-Jun.

These data show that a transcriptional repressor Rb,

normally responsible for cell cycle suppression, can be

recruited by a known proto-oncogene, c-Jun, in order to

transactivate dnmt1 via a speci®c genetic regulatory

element.

2. Materials and methods

2.1. Plasmid construction

The plasmid SKmet has been previously described along

with pMetCAT and pBglIICAT (Rouleau et al., 1992). The

mutant PCR products described below (Rouleau et al.,

1992) were subcloned into the pCR 2 vector using the TA

cloning kite (Invitrogen). The mutated product was then

excised from the pCR 2 construct by Hind III/Xba I (Boeh-

ringer) digestion and reinserted into pMetCAT cut with

Hind III and Xba I, thus replacing the wild-type sequence

with a mutated version. The resulting 31 different mutant

pMetCAT LSM constructs were numbered 1±31 (1 being

the most 5 0 mutated construct and 31 the most 3 0). Each pCR

2 LSM construct was sequenced (Pharmacia) to ascertain

that the mutation protocol had been successful, and was

resequenced after insertion into pMetCAT. Three individual

preparations of each pMetCAT LSM construct were subse-

quently used for CAT assays. The Jun construct RSV c-Jun

was obtained from Dr M. Karin (Binetruy et al., 1991). The

pLLRbRNL pRb expression vector was obtained from the

American Type Culture Collection (ATCC# 65002).

2.2. CAT assays

An equal number (1 £ 105) of either Pl9 or Y1 cells were

plated per well onto 6-well plates (Falcon) 24 h prior to

transfection. Two-hundred microlitres of calcium phosphate

precipitate containing 5 mg of plasmid DNA were added to

each well containing 1.5 ml of the appropriate medium. The

medium was replaced with fresh medium 24 h following

transfection and the cells were harvested by scraping 48 h

after transfection. CAT activity was assayed as described

previously (Rouleau et al., 1992).

2.3. Linker-scanning mutagenesis

Four-step PCR linker scanning mutagenesis was

performed as previously described with the following modi-

®cations (Li et al., 1993). First, 31 mutated oligonucleotides

were chosen to span a 204 bp area between a Bgl II site and

an Eco RI site (Fig. 2). These oligonucleotides bear eight

bases complimentary to the dnmt1 sequence followed by six

non complimentary, mutated bases (G! T; C! A) and ten

more complimentary bases. They were arranged to span the

region from 5 0 to 3 0 moving by a 6 bp window. The 3 0

amplimer included an XbaI site and the following sequence

(5 0 TATCTAGAGGCTCCCGTTGGCGGGACA 3 0 2319±

A. Slack et al. / Gene 268 (2001) 87±9688

2301) (numbering according to GenBank accession number

M84387) downstream from the 3 0 most LSM oligo. The

mutated fragments were ampli®ed in a PCR reaction using

the SKmet plasmid (Rouleau et al., 1992) as a template. The

resulting ladder of ampli®ed mutated products was then

subjected to a single stranded ampli®cation using the 3 0

oligo. The single stranded, mutated products were then

isolated from a low melting point agarose (Boehringer

Mannheim) gel and used as 3 0 primers in a third PCR reac-

tion of the SKmet plasmid. The sequence of the 5 0 amplimer

is (5 0 ACAGCACCCCTCTTGTCTAAGCTA 3 0 1786±

1809) upstream from the most 5 0 LSM oligo and it includes

a Hind III site. The mutated products, were further ampli®ed

by a fourth PCR reaction using the 5 0 amplimer as in the 3rd

ampli®cation and the 3 0 amplimer used in the ®rst ampli®-

cation reaction. All PCR reactions were performed using

Taq polymerase from Promega.

2.4. Transcription factor analysis

For transcription factor analysis of the regulatory region

described, the TRANSFAC database (http://transfac.gbf-

braunschweig.de/TRANSFAC/Transcription Factor db.

ResearchGroup. Bioinformatics) was accessed.

2.5. RNAse protection assay

RNA was prepared from exponentially growing cells

using RNAzol (TelTest). RNAse protection assays were

performed as described (Rouleau et al., 1992) using a 0.7

kb HindIII-BamHI fragment as a riboprobe. This probe is a

genomic fragment bearing exons 3 and 4 of the murine

dnmt1. It protects a cluster of bands of ranging from 112

and 100 nt length as previously described (Rouleau et al.,

1992). The signal obtained for dnmt1 was normalized

against the signal obtained by RNAse protection in the

same tube with a 32P labeled riboprobe complementary to

18s RNA (Ambion).

2.6. Electrophoretic mobility shift assays

Nuclear extracts were prepared from P19 cell line as

described previously (Rouleau et al., 1992). For detection

of AP-1 binding activity, an oligonucleotide homologous to

the non-canonical AP-1 binding element of dnmt1

(5 0CTATGCGTGCCTGACCTGTATTTA 3 0) and an AP-1

consensus oligonucleotide (5 0CGCTTGATGAGTCAGC-

CGGAA 3 0) were annealed with complementary antisense

oligonucleotides, labeled by polynucleotide kinase and puri-

®ed by NAP columns (Pharmacia). Identical or mismatch

(5 0CTATGCGTCGTATGCCTGTATTTA 3 0) excess cold

dnmt1 or AP-1 consensus oligonucleotides were incubated

in EMSA for competition analysis. GST and GST Rb fusion

proteins were prepared according to manufacturers direc-

tions using glutathione sepharose puri®cation (Gibco). 2.5

mg of each GST protein was added to reactions where indi-

cated. 0.1 footprinting unit recombinant c-Jun (Gibco) was

added to reactions where indicated. In experiments using

nuclear extracts, 20 mg were added to the binding reactions.

All EMSA reactions contained 1.0 £ 105 cpm 32P-labeled

probe in 4% glycerol, 1 mM MgCl2, 0.5 mM EDTA, 0.5

mM DTT, 50 mM NaCl, 10 mM TrisCl (pH 7.5) and 0.1 mg/

ml E. coli DNA and were incubated for 30 min at room

temperature. The reaction products were electrophoresed

on a 5% non-denaturing acrylamide gel at 48C. Gels were

then dried and autoradiographed. The GST Rb expression

vector was a kind gift of Dr William Kaelin. c-jun 2/2 and 1/

1 mouse embryonic ®broblast cell lines were a kind gift of

Dr Randall Johnson.

2.7. Western blot analysis and immunoprecipitations

RIPA extracts were prepared from P19 cell lines, electro-

phoresed on SDS-PAGE and blotted onto nitrocellulose.

Membranes were reacted with antibodies raised against Rb

(Santa Cruz, #sc50, c15), c-Jun and PCNA (Santa Cruz

#sc56, PC10) as directed by the manufacturers. Immunopre-

cipations were performed according to manufacturers direc-

tions using an agarose conjugated Rb antibody (Santa Cruz,

#sc102 IF-8), a c-Jun antibody (Santa Cruz, #sc822, KM1)

and an agarose conjugated mouse IgG (Santa Cruz, #sc2343).

2.8. P19 cell culture and differentiation

P19 cells were differentiated as previously described

(Slack et al., 1993) using 1 mM retinoic acid and harvested

at various time points after induction for preparation of

RNA and protein extracts.

3. Results

3.1. Rb-c-Jun co-activation of a dnmt1 regulatory region in

Pl9 cells

Murine and human AP-1 consensus upstream regulatory

elements that confer responsiveness to the Ras/AP1 path-

way and the pBglIICAT plasmid have been previously

described (MacLeod et al., 1995; Rouleau et al., 1995;

Bigey et al., 2000). A second regulatory region in the

murine gene that has promoter activity in CAT assays and

corresponds to a minor downstream transcription initiation

site was previously identi®ed downstream to the AP1

response elements (Rouleau et al., 1995) (Fig. 1A for

map). This downstream region is not responsive to c-Jun

alone (Rouleau et al., 1995) and directs a low level of

CAT activity in P19 cells in the absence of either the

dnmt1 AP1 element or a non-cognate enhancer such as the

SV40 enhancer (5±10% of the SV40 or its own enhancer)

(Rouleau et al., 1992). We determined whether this region

(BglIICAT, Fig. 1B) might have other regulatory functions

by testing the responsiveness of the BglIICAT reporter

construct to either Rb, Jun or the combination of Rb and

c-Jun. As shown in Fig. 1, the BglIICAT construct responds

A. Slack et al. / Gene 268 (2001) 87±96 89

to synergistic co-activation by Rb and c-Jun resulting in a

,20-fold increase in activity over that observed with c-Jun

alone (Fig. 1C) (CAT assay values are presented for

comparison in Table 1). In Y1 cells, which already have

very high AP-1 activity, Rb co-expression has no effect on

the activity of the promoter (data not shown). We reasoned

that this region might respond to the paradigm of transacti-

vation observed in other differentiating systems, whereby

Rb and c-Jun act in synergy rather than in opposition.

3.2. Identi®cation of an element homologous to a non-

consensus AP-1 sequence that affects promoter activity in

P19 but not Y1 cells

Since no recognizable element existed between the BglII

and EcoRI sites delimiting the novel regulatory region, we

decided to indiscriminately mutate the entire area in order to

identify the Rb-c-Jun responsive region. Using a PCR based

linker scanning mutagenesis method, a 6 bp window was

mutated every 6 bp, from position 1829 to 2015 (base pair

numbering according to GenBank accession number

M84387, (Rouleau et al., 1992)) (Fig. 2). As described in

Section 2, the mutation in each window is a C! A or

G! T transversion of six of the 18 bases in each oligonu-

cleotide. Thirty-one of these LSM (for linker scanning

mutagenesis) oligonucleotides, numbered from 5 0 to 3 0,e.g. LSM 1 is most 5 0 and LSM 31 is most 3 0, were used

to span 186 bp. They were incorporated into the sequence of

the downstream regulatory region by a four step PCR tech-

nique described above and were introduced into the pMet-

CAT construct as described in the Section 2 and in Fig. 2.

The 31 pMetCAT mutants were assayed for their ability

to promote CAT activity in comparison with wild type

pMetCAT in P19 and Y1 cells to identify the elements

that are critical for expression speci®cally in P19 cells.

Three different preparations of each mutant pMetCAT

were transiently transfected into both cell lines and assayed

for CAT activity. The results, shown in Fig. 3, demonstrate

that, while many of the mutants have reduced activity in

both cell lines, the mutation of LSM construct four

profoundly affects pMetCAT activity in P19 cells (Fig.

3A) in comparison to Y1 cells (Fig. 3C). Mutation 4 spans

a region bearing a non canonical AP1 site (5 0

CCTGACCTGTA 3 0) as determined by transcription factor

database analysis (TRANSFAC, (Wingender et al., 2000)),

similar to the consensus AP-1 sequence (TGAG/CTCA). The

reduction of reporter activity by four orders of magnitude

due to this mutation, even in the presence of a potent

upstream AP-1 enhancer, suggests that this element must

play an exquisite role in transactivation from this region

speci®cally in P19 cells. Database analysis also revealed a

non-canonical Spl site, which appears to be within an impor-

tant region (mutations 9 and 10), but a homologous oligo-

nucleotide did not bind recombinant Sp1 in subsequent

A. Slack et al. / Gene 268 (2001) 87±9690

Fig. 1. Rb and c-Jun cooperate to activate a transcription regulatory region

in dnmt1 in P19 cells. A physical map of the dnmt1 gene (Rouleau et al.,

1992; Margot et al., 2000) is shown with the previously de®ned and newly

characterized regulatory regions indicated in the exploded diagram below.

Exons are indicated as boxes, including sex-speci®c exons (Mertineit et al.,

1998). Upstream AP-1 consensus elements of the previously de®ned regu-

latory region are indicated by ®lled ovals and the Rb-c-Jun responsive

element of the newly characterized regulatory region is indicated by an

open oval. The BglIICat construct shown in (B) (which lacks the upstream

AP-1-responsive enhancer region contained in the parent pMetCat

construct, see Fig. 2) was assayed for activity in the P19 cell line as

shown in (C). Error bars indicate standard deviations from triplicate deter-

minations. Rb and/or c-jun expression constructs were cotransfected as

indicated below the X-axis. Transcription start sites downstream to the

newly characterized region have been described for both mouse and

human promoters (Rouleau et al., 1992; Bigey et al., 2000).

Table 1

CAT activities (3H dpm) for BglII CAT reporter assay in P19 cellsa

Vector alone Rb c-Jun Rb 1 c-Jun

BglIICAT 2880 5065 3745 56537

a Raw data values of mean counts obtained for the BglII CAT reporter

assay (represented graphically as Fig. 1C) are presented.

experiments (data not shown). We focused on the role of the

putative AP-1 binding region and tested whether it mediates

the response to synergistic activation of this region by Rb

and c-Jun in P19 cells.

3.3. A non-canonical AP-1 element mediates synergistic

pRb and c-Jun activation of transcription

We hypothesized that a mutation in the non-canonical

AP-1 element would abrogate the synergistic transactivation

of pMetCAT by pRb and c-Jun. The wild-type pMet CAT

and LSM mutant 4 pMetCAT reporter constructs were then

tested in the P19 cell line in the presence or absence of Rb

and/or c-Jun as in Fig. 1. Reporter constructs were cotrans-

fected into P19 cells with or without pRb and/or c-Jun

expression vectors and CAT activity directed by these

constructs was measured 48 h after transfection. As shown

in Fig. 3B, the wild type construct activity is induced almost

,30-fold in the presence of both Rb and c-Jun, with respect

to the induction observed with c-Jun alone. In contrast, the

mutant is induced only 1.5-fold with coexpression of Rb and

c-Jun as compared with c-Jun alone. This analysis reveals

A. Slack et al. / Gene 268 (2001) 87±96 91

Fig. 2. Systematic mutation of the dnmt1 transcriptional regulatory region. pMetCat reporter constructs bearing a transcription regulatory 5 0 genomic region of

dnmt1 as previously described (Rouleau et al., 1995) were systematically mutated in 6 bp windows as described in Section 2 to generate 31 separate mutant

pMetCat constructs. AP-1 consensus sites are indicated by ®lled ovals, the Rb-c-Jun responsive region is indicated by an open oval and exons are indicated as

open boxes. The mutated region is bounded by a BglII site which lies upstream of the third exon and an EcoRI site within the third exon. The expanded

sequence shows the wild type sequence with the different mutations underlined below. Six-basepair mutated windows are numbered according to the LSM

oligonucleotide used to generate them.

that the observed coactivation of reporter activity by Rb and

c-Jun remains intact even in the presence of the strong

upstream AP-1 enhancer element. This coactivation is

completely abolished, however, by the mutation of element

4 which contains the non-canonical AP-1 binding sequence.

As expected, c-Jun alone still induced activity of the mutant

LSM 4 construct (which still bears the upstream AP-1

consensus element) 5-fold over basal activity. This data

indicates that c-Jun and pRb cannot bypass this mutation

and activate the region in the absence of the non-consensus

AP-1 element. However, since the mutation also signi®-

cantly reduces basal transcription, it is unclear whether it

is also required for basal transcription or for induced activ-

ity. Since some basal levels of Rb and c-Jun are present even

in non-induced P19 cells, it is possible that even the basal

activity of this region is dependent on the presence of pRb

and c-Jun in P19 cells. In summary, our data shows that the

non-canonical AP-1 site is essential and functional within

the context of the entire regulatory region and that it is

required for the synergistic activation of pMetCAT by c-

Jun and Rb.

3.4. An AP-1 consensus sequence competes the DNA-

protein complex formed by the non canonical AP-1 element

in nuclear extracts prepared from differentiated P19 cells

expressing c-Jun and Rb

We then addressed the question of whether the non cano-

nical AP-1 element interacts with nuclear proteins in P19

cells to form an AP-1 complex. Since we had shown that the

activity of this element is dependent on the presence of c-

Jun and Rb, we used differentiated P19 cells that were

previously shown to express high levels of both proteins.

The electro mobility shift assay (EMSA) shown in Fig. 4A

demonstrates that the non-canonical AP-1 element forms a

DNA-protein complex that is competed by a consensus AP-

1 element. Similarly, the consensus AP-1 oligonucleotide

forms a complex that is competed away by the non canoni-

cal AP-1 element. This experiment shows that the non cano-

nical AP-1 element can form an AP-1 complex in nuclear

extracts.

3.5. The non-canonical AP-1 element forms an AP-1

complex only in cells that express c-jun

Since the activity of the non-canonical element is depen-

dent on the presence of c-Jun, we tested whether the non-

canonical AP-1 binding activity is present in a previously

generated mouse ®broblast cell line which is a homozygous

null for c-jun (Johnson et al., 1993). We performed an elec-

tro-mobility shift analysis (EMSA) for the non-canonical

AP-1 oligonucleotide using nuclear extracts prepared from

either wild type or c-jun- de®cient lines (Johnson et al.,

1993). We ®rst demonstrate that the consensus AP-1 oligo-

nucleotide forms a complex with wild type extracts, as

shown in the left panel of Fig. 4B. We also show in the

same panel that the binding of this complex is competed

by cold excesses of identical match AP-1 consensus and

non-canonical AP-1 oligonucleotides, but not by a

mismatch non-canonical AP-1 oligonucleotide. Using the

non-canonical AP-1 oligonucleotide as a probe, we demon-

strate in the right panel that a distinct complex was formed

with the non-canonical AP-1 element incubated with wild

type extracts, Binding of this complex is speci®cally

competed by the homologous non-canonical AP-1

sequence, but not by a mismatch competitor (Fig. 4B) as

A. Slack et al. / Gene 268 (2001) 87±9692

Fig. 3. A putative AP-1 binding element is essential for reporter activity in

the P19 cell line but not in the Y1 cell line. P19 (A) and Y1 (C) cell lines

were transfected with 10 mg of wild-type and mutant pMetCat reporter

constructs alone and were assayed for activity. Results represent an average

of triplicate transfections and are plotted on a logarithmic scale, with error

bars indicating standard deviations. The X axis indicates the LSM construct

numbers. The position of the non canonical AP-1 site is indicated as a box

underneath each graph. The P19 cell line was co-transfected with 2 mg

mutated and wild-type reporter constructs with and without Rb and/or c-

Jun expression constructs and the results were plotted as fold induction

relative to reporter construct alone (B).

was seen in extracts prepared from differentiated P19 cells

(Fig. 4A). However, the non-canonical AP-1 element from

dnmt1 does not form a complex with nuclear extracts

prepared from c-jun2/2 cells. The difference in the apparent

abundance of the complexes binding to the AP-1 consensus

and non-canonical AP-1 oligonucleotides may re¯ect the

different abundance of factors which bind to these elements

in vivo. This observation supports the hypothesis that the

element that we have identi®ed interacts exclusively with c-

Jun, or an AP-1 complex that is regulated by c-Jun and

therefore absent in c-Jun de®cient cells, since no other bind-

ing activity is observed in the c-jun2/2 lines. Thus both the

binding activity of the element and its ability to activate

expression of pMetCAT are dependent on c-Jun.

3.6. Rb and c-Jun uniquely and cooperatively bind a non-

canonical AP-1 element which is essential for reporter

activity

We tested whether the non canonical AP-1 element

directly interacts with c-Jun and whether this interaction is

dependent on Rb as predicted from the reporter assays

utilizing recombinant c-Jun and Rb in an EMSA assay as

demonstrated in Fig. 4C. As predicted, the consensus AP-1

element binds to recombinant c-Jun and this binding is

augmented in the presence of increasing amounts of Rb as

has been previously described for other AP-1 elements

(Nishitani et al., 1999). The binding of recombinant c-Jun

to the non-canonical AP-1 element is dependent, on the

other hand, on the presence GST-Rb in the reaction mixture.

No complex was formed with c-Jun alone (Fig. 4C). As

expected, GST-Rb alone does not form a complex with

the non-canonical AP-1 element (data not shown). Addition

of GST-Rb and c-Jun resulted in formation of a complex

similar to that seen with the consensus oligonucleotide. The

fact that the ability of this element to form a complex with c-

Jun is dependent on Rb is consistent with the functional

reporter assays shown in Fig. 3.

A. Slack et al. / Gene 268 (2001) 87±96 93

Fig. 4. The putative AP-1 binding element is capable of binding Rb and c-

Jun cooperatively in vitro. (A) Radiolabelled oligonucleotides homologous

to the AP-1 consensus sequence (AP-1) and the non canonical dnmt1 AP-1

binding element (AP-1 n.c.) were incubated with 20 mg of nuclear extracts

prepared from 6 day post-RA differentiated P19 nuclear extracts and were

electrophoresed on non-denaturing gels as described previously. AP-1 and

AP-1 n.c. oligonucleotide binding was reciprocally competed with 2, 5, 50

and 500-fold cold excesses of AP-1 n.c. and AP-1 oligonucleotides. The

positions of the complexes and the free probe are indicated by arrows. (B)

Radiolabelled oligonucleotides homologous to the AP-1 consensus (AP-1)

and non canonical dnmt1 AP-1 binding element (AP-1 n.c.) were incubated

with 20 mg of nuclear extracts prepared from jun1/1 and jun2/2 embryonic

®broblasts and were electrophoresed on non-denaturing gels as described in

Section 2. AP-1 and dnmt 1 oligonucleotide binding was competed with

100-fold cold excess of identical AP-1 consensus (AP-1 match, AP-1 m.),

identical AP-1 non-canonical (AP-1 non-canonical match, AP-1 n.c. m.) or

non-identical AP-1 non-canonical (AP-1 non-canonical mismatch, AP-1

n.c. m.m.) oligonucleotides. The positions of the complexes and the free

probe are indicated by arrows. (C) Radiolabelled oligonucleotides homo-

logous to the AP-1 consensus sequence (AP-1) and the non canonical dnmt1

AP-1 binding element (AP-1 n.c.) were incubated with recombinant c-Jun

with and without GST Rb and GST and electrophoresed on non-denaturing

gels as described previously. The positions of c-Jun and c-Jun-Rb

complexes and the free probe are indicated by arrows. The presence of

Rb enhances the binding but does not supershift the AP-1 complex. This

observation is similar to previously published data where addition of Rb

enhanced but did not supershift the complex formed with AP-1 (Nead et al.,

1998).

3.7. Rb and c-jun are induced concurrently with dnmt1 in

P19 cell differentiation

Since Rb and c-Jun are induced during differentiation of

P19 cells (de Groot et al., 1990b; Slack et al., 1993), we

determined whether dnmt1 expression is induced concur-

rently with the accumulation of both c-Jun and Rb during

differentiation. Dnmt1 is expressed at relatively high levels

in non-differentiated P19 cells, in spite of the low levels of

c-Jun and Rb, suggesting that other factors augment dnmt1

expression in non-differentiated P19 cells (Rouleau et al.,

1992). However, early in the differentiation process the

expression of dnmt1 is repressed and is then induced later

in differentiation (Fig. 5C).

Can this induction of dnmt1 during differentiation be

explained by a concomitant rise in Rb and c-Jun? P19

cells were induced to differentiate with retinoic acid (RA)

and the levels of c-Jun and Rb at different time points

following differentiation were determined by a Western

blot analysis (Fig. 5). The results show that Rb levels

increase steadily after exposure to RA, whereas c-Jun levels

show a slight increase during the ®rst days and rise mark-

edly after 6 days of differentiation, as previously described

(de Groot et al., 1990b; Slack et al., 1993) (Fig. 5A). Our

results also indicate, as previously reported (Nead et al.,

1998), an interaction between c-Jun and Rb proteins as

determined by co-immunoprecipitation of c-Jun and Rb in

extracts prepared from differentiated P19 cells (Fig. 5B).

The levels of dnmt1 mRNA were measured by an RNase

protection assay (Fig. 5C) and demonstrate that dnmt1

mRNA increases during the ®rst days of differentiation

and peaks markedly on day 6 when high levels of both c-

Jun and Rb are present in the cell (Fig. 5A). dnmt1 mRNA

levels were shown before to correlate with the proliferative

state (Szyf et al., 1991). However, the peak of dnmt1 on day

6 does not re¯ect an increase in DNA proliferative activity,

since the level of PCNA, a marker of cell proliferation, is

not induced at this time point (Fig. 5A).

Despite the marked increase in c-Jun protein levels

observed during the induction of P19 differentiation, there

is a constant level of AP-1 consensus binding activity (Fig.

5D) though there is a change in the relative abundance of the

different complexes. In contrast, there is a marked induction

in the abundance of the complex which binds the non-cano-

nical AP-1 element during differentiation of P19 cells (Fig.

5D) along with an increase in dnmt1 message levels (Fig.

5C). Since the non canonical AP-1 element is critical for the

functioning of the dnmt1 regulatory region (Fig. 3A), the

increase in binding activity during differentiation to this

element can explain the induction in dnmt1 levels. Our

data is therefore consistent with a cooperative role for Rb

A. Slack et al. / Gene 268 (2001) 87±9694

Fig. 5. Dnmt1 is induced concurrently with Rb and c-Jun in the differen-

tiated P19 cell line. (A) Protein extracts were prepared at various time

points following RA induction of the P19 cell line and Rb, c-Jun and

PCNA proteins were visualized by Western blot using the indicated anti-

bodies. (B) Protein extracts prepared 6 days post-induction were immuno-

precipitated with antibodies directed to Rb, c-Jun and IgG control.

Immunoprecipitated products were visualized by Western blot using a c-

Jun antibody. (C) Total RNA was prepared at various time points following

RA induction of the P19 cell line and dnmt1 message levels were deter-

mined by RNAse protection assay. As a control for total RNA in the reac-

tion, an RNase protection assay was performed with a probe for 18s rRNA

in the same tube and is presented in the lower panel. The positions of 100 bp

and 80 bp size markers are indicated. (D) Radiolabelled oligonucleotides

homologous to the AP-1 consensus sequence (AP-1) and the non canonical

dnmt1 AP-1 binding element (AP-1 n.c.) were incubated with 20 mg of

nuclear extracts prepared from 2 day (predifferentiation, pre) and 6 day

(postdifferentiation, post) post-RA P19 cells and were electrophoresed on

non-denaturing gels as described previously. The positions of the

complexes and the free probe are indicated by arrows.

and c-Jun in the induction of dnmt1 during differentiation of

P19 cells.

4. Discussion

Rb and c-Jun have traditionally been thought to play

opposing roles in cellular growth and proliferation (Kaelin,

1999; Wisdom et al., 1999). Recent data has unraveled a

novel paradigm of gene co-activation by Rb and c-Jun,

nodal regulators of gene expression which have been

believed to be functionally antagonistic, via AP-1 transcrip-

tional elements (Nead et al., 1998; Nishitani et al., 1999).

The required domains for complex formation between Rb

and c-Jun have been mapped to the c-Jun C-terminal region

and the Rb B-pocket domain (Nishitani et al., 1999). This

paradigm, where Rb and c-Jun act cooperatively, may oper-

ate uniquely during cellular differentiation as Rb-Jun

complexes have been shown to be present in terminally

differentiated keratinocytes (Nead et al., 1998). Overexpres-

sion of E7, which can inhibit the activation of c-Jun by Rb,

also diminishes the AP-1 binding activity in keratinocytes

(Nead et al., 1998).

Dnmt1 has been shown by several lines of evidence to be

regulated by the Ras-AP-1 signaling pathway. AP-1 respon-

sive regulatory regions were identi®ed in the murine

(Rouleau et al., 1992) and human (Bigey et al., 2000)

dnmt1 genes. Dnmt1 was also shown to be a downstream

effector of the Ras signaling pathway (MacLeod et al., 1995;

Rouleau et al., 1995). A functional role for dnmt1 in trans-

formation and oncogenesis has been established by data

from several groups (MacLeod and Szyf, 1995; Bakin and

Curran, 1999; Guan et al., 1999). Similarly to Rb and c-Jun,

dnmt1 also has an established role in differentiation,

however, the mechanism which controls its expression

pattern in differentiation is unknown. This study has

revealed a novel regulatory region of dnmt1 which lies

downstream to the originally characterized AP-1 responsive

enhancer element (Rouleau et al., 1992).

The question of whether dnmt1 might be responsive to the

type of co-activation described for other AP-1 responsive

promoters (Nead et al., 1998; Nishitani et al., 1999) led us to

examine the possibility that a downstream region of dnmt1

is cooperatively transactivated by Rb and c-Jun. In this

paper, we demonstrate that this novel downstream region

is responsive to co-activation by overexpression of Rb and

c-Jun in the P19 cell line. Systematic mutation analysis of

this region revealed the presence of a non-canonical AP-1

element which is essential for transactivation of this regu-

latory region by Rb and c-Jun, even in the presence of a

strong AP-1 consensus enhancer region. Formation of a

DNA-protein complex with this element is dependent exclu-

sively on the presence of c-Jun in the cell. This non-cano-

nical AP-1 responsive element, can interact with puri®ed

recombinant c-Jun only in the presence of Rb in contrast

to the consensus element.

Although we demonstrate that Rb cooperates with c-Jun

in the transactivation of the dnmt1 promoter and that Rb is

capable of facilitating the binding of c-Jun to the non-cano-

nical AP-1 element, we do not conclusively demonstrate

that Rb is a component of the bound complexes seen in

EMSAs performed with nuclear extracts. Supershift assays

failed to show the presence of Rb in the complex. Similar

failures to show the presence of Rb in putative Rb-c-Jun

complexes has been previously reported (Nead et al.,

1998). It is possible that Rb is required for initiation of

the complex, but that it is not stably bound to it. An alter-

native hypothesis explaining a role for Rb in transcription,

in which Rb transactivates c-Jun by freeing Sp-1 from a

negative regulator, has been described (Chen et al., 1994).

This model might also explain the absence of Rb from the

transcriptional complex whose formation it initiates. Never-

theless, the data presented provides an example of an

element that requires the combination of Rb and c-Jun

signals for its activity.

It is interesting to note that both c-Jun and Rb are induced

in differentiation of Pl9 cells (de Groot et al., 1990b; Slack

et al., 1993) and we have con®rmed these observations in

our own P19 differentiation model. Given that the dnmt1 is

crucial for the ability of embryonal stem cells to differenti-

ate (Li et al., 1992; Tucker et al., 1996), its expression must

be regulated by factors involved in this process. Therefore,

the fact that these factors cooperate to control the novel

dnmt1 regulatory region examined in this study in reporter

assays, may point towards the type of combination of

signals which lead to differentiation in Pl9 cells. Consistent

with this hypothesis, we demonstrate that the peak expres-

sion of Rb and c-Jun proteins in RA-induced differentiation

of the P19 cell line coincides with increased binding to the

non-canonical AP-1 element and an increase in dnmt1

message levels. It should be noted, however, that dnmt1

has multiple regulatory regions, as previously described

(Rouleau et al., 1992; Bigey et al., 2000). Therefore, at

any given time in the life of a cell, different signals will

converge to activate or repress dnmt1. The steady-state

levels of dnmt1 mRNA represent a balance of these different

activities. For example, it is clear that in non-differentiated

P19 cells, other factors are involved in the high activity of

dnmt1 mRNA, perhaps through the upstream housekeeping

CG rich promoter (Bigey et al., 2000). Further experiments

are therefore required to determine the relative contribution

of Rb and c-Jun on the expression of dnmt1 during differ-

entiation. Nevertheless, the identi®cation of this element in

dnmt1 and its dependence upon Rb and c-Jun signals raises

the interesting possibility that this unique regulatory

element is adapted to respond to threshold levels of both

c-Jun and Rb to promote transactivation of dnmt1 in differ-

entiating cell types.

The binding of Rb to various other transcription factors in

guiding processes of differentiation has been previously

documented for the Elf-1 factor, a member of the Ets tran-

scription factor family (Wang et al., 1993) and for NF-IL6

A. Slack et al. / Gene 268 (2001) 87±96 95

(Chen et al., 1996). This function for Rb in cooperating with

other transactivators to promote transcription in cellular

differentiation contrasts with its sequestration and inactiva-

tion of transcription factors such as E2F-1, which are

involved in cell cycle progression. These disparate mechan-

isms may help to explain the distinct functions of Rb in

cellular differentiation and in the cell cycle. The data

presented here point to a novel mechanism which may oper-

ate in differentiation to transactivate dnmt1 via an AP-1 like

element which requires Rb in addition to c-Jun and is

consistent with the dual role of dnmt1 in differentiation

and oncogenesis. Further experiments are required to deci-

pher the functional role of induced dnmt1 mRNA levels

during differentiation.

Acknowledgements

We thank Mrs Johanne Theberge for superb technical

assistance. We also thank Dr Randall Johnson for the c-

jun2/2 ®broblast cell lines. This work was supported by a

grant from the National Cancer Institute of Canada.

References

Bakin, A.V., Curran, T., 1999. Role of DNA 5-methylcytosine transferase

in cell transformation by fos. Science 283, 387±390.

Bigey, P., Ramchandani, S., Theberge, J., Araujo, F.D., Szyf, M., 2000.

Transcriptional regulation of the human DNA Methyltransferase

(dnmt1) gene. Gene 242, 407±418.

Binetruy, B., Smeal, T., Karin, M., 1991. Ha-Ras augments c-Jun activity

and stimulates phosphorylation of its activation domain. Nature 351,

122±127.

Chen, L.I., Nishinaka, T., Kwan, K., Kitabayashi, I., Yokoyama, K., Fu,

Y.H., Grunwald, S., Chiu, R., 1994. The retinoblastoma gene product

RB stimulates Sp1-mediated transcription by liberating Sp1 from a

negative regulator. Mol. Cell. Biol. 14, 4380±4389.

Chen, P.L., Riley, D.J., Chen-Kiang, S., Lee, W.H., 1996. Retinoblastoma

protein directly interacts with and activates the transcription factor NF-

IL6. Proc. Natl. Acad. Sci. USA 93, 465±469.

de Groot, R.P., Kruyt, F.A., van der Saag, P.T., Kruijer, W., 1990a. Ectopic

expression of c-jun leads to differentiation of P19 embryonal carcinoma

cells. EMBO J. 9, 1831±1837.

de Groot, R.P., Schoorlemmer, J., van Genesen, S.T., Kruijer, W., 1990b.

Differential expression of jun and fos genes during differentiation of

mouse P19 embryonal carcinoma cells. Nucleic Acids Res. 18, 3195±

3202.

Guan, R.J., Fu, Y., Holt, P.R., Pardee, A.B., 1999. Association of K-ras

mutations with p16 methylation in human colon cancer. Gastroenterol-

ogy 116, 1063±1071.

Hartl, M., Vogt, P.K., 1992. Oncogenic transformation by Jun: role of

transactivation and homodimerization. Cell. Growth Differ. 3, 899±908.

Johnson, R.S., van Lingen, B., Papaioannou, V.E., Spiegelman, B.M., 1993.

A null mutation at the c-jun locus causes embryonic lethality and

retarded cell growth in culture. Genes Dev. 7, 1309±1317.

Kaelin Jr, W.G., 1999. Functions of the retinoblastoma protein. BioEssays

21, 950±958.

Kobayashi, M., Yamauchi, Y., Tanaka, A., 1998. Stable expression of

antisense Rb-1 RNA inhibits terminal differentiation of mouse myoblast

C2 cells. Exp. Cell Res. 239, 40±49.

Li, E., Bestor, T.H., Jaenisch, R., 1992. Targeted mutation of the DNA

methyltransferase gene results in embryonic lethality. Cell 69, 915±926.

Li, E., Beard, C., Jaenisch, R., 1993. Role for DNA methylation in genomic

imprinting [see comments]. Nature 366, 362±365.

MacLeod, A.R., Szyf, M., 1995. Expression of antisense to DNA methyl-

transferase mRNA induces DNA demethylation and inhibits tumorigen-

esis. J. Biol. Chem. 270, 8037±8043.

MacLeod, A.R., Rouleau, J., Szyf, M., 1995. Regulation of DNA methyla-

tion by the Ras signaling pathway. J. Biol. Chem. 270, 11327±11337.

Margot, J.B., Aguirre-Arteta, A.M., Di Giacco, B.V., Pradhan, S., Roberts,

R.J., Cardoso, M.C., Leonhardt, H., 2000. Structure and function of the

mouse DNA methyltransferase gene: Dnmt1 shows a tripartite struc-

ture. J. Mol. Biol. 297, 293±300.

McBurney, M.W., 1993. P19 embryonal carcinoma cells. Int. J. Dev. Biol.

37, 135±140.

Mertineit, C., Yoder, J.A., Taketo, T., Laird, D.W., Trasler, J.M., Bestor,

T.H., 1998. Sex-speci®c exons control DNA methyltransferase in

mammalian germ cells. Development 125, 889±897.

Nead, M.A., Baglia, L.A., Antinore, M.J., Ludlow, J.W., McCance, D.J.,

1998. Rb binds c-Jun and activates transcription. EMBO J. 17, 2342±

2352.

Nishitani, J., Nishinaka, T., Cheng, C.H., Rong, W., Yokoyama, K.K.,

Chiu, R., 1999. Recruitment of the retinoblastoma protein to c-Jun

enhances transcription activity mediated through the AP-1 binding

site. J. Biol. Chem. 274, 5454±5461.

Ookawa, K., Tsuchida, S., Adachi, J., Yokota, J., 1997. Differentiation

induced by RB expression and apoptosis induced by p53 expression

in an osteosarcoma cell line. Oncogene 14, 1389±1396.

Persengiev, S.P., Kilpatrick, D.L., 1996. Nerve growth factor induced

differentiation of neuronal cells requires gene methylation. NeuroRe-

port 8, 227±231.

Ramchandani, S., MacLeod, A.R., Pinard, M., von Hofe, E., Szyf, M.,

1997. Inhibition of tumorigenesis by a cytosine-DNA, methyltransfer-

ase, antisense oligodeoxynucleotide. Proc. Natl. Acad. Sci. USA 94,

684±689.

Rouleau, J., Tanigawa, G., Szyf, M., 1992. The mouse DNA methyltrans-

ferase 5 0-region. A unique housekeeping gene promoter. J. Biol. Chem.

267, 7368±7377.

Rouleau, J., MacLeod, A.R., Szyf, M., 1995. Regulation of the DNA

methyltransferase by the Ras-AP-1 signaling pathway. J. Biol. Chem.

270, 1595±1601.

Slack, R.S., Hamel, P.A., Bladon, T.S., Gill, R.M., McBurney, M.W., 1993.

Regulated expression of the retinoblastoma gene in differentiating

embryonal carcinoma cells. Oncogene 8, 1585±1591.

Szyf, M., Bozovic, V., Tanigawa, G., 1991. Growth regulation of mouse

DNA methyltransferase gene expression. J. Biol. Chem. 266, 10027±

10030.

Tucker, K.L., Talbot, D., Lee, M.A., Leonhardt, H., Jaenisch, R., 1996.

Complementation of methylation de®ciency in embryonic stem cells

by a DNA methyltransferase minigene. Proc. Natl. Acad. Sci. USA

93, 12920±12925.

Wang, C.Y., Petryniak, B., Thompson, C.B., Kaelin, W.G., Leiden, J.M.,

1993. Regulation of the Ets-related transcription factor Elf-1 by binding

to the retinoblastoma protein. Science 260, 1330±1335.

Weinberg, R.A., 1995. The retinoblastoma protein and cell cycle control.

Cell 81, 323±330.

Weintraub, S.J., Chow, K.N., Luo, R.X., Zhang, S.H., He, S., Dean, D.C.,

1995. Mechanism of active transcriptional repression by the retinoblas-

toma protein. Nature 375, 812±815.

Wingender, E., Chen, X., Hehl, R., Karas, H., Liebich, I., Matys, V., Mein-

hardt, T., Pruss, M., Reuter, I., Schacherer, F., 2000. TRANSFAC: an

integrated system for gene expression regulation. Nucleic Acids Res.

28, 316±319.

Wisdom, R., 1999. AP-1: one switch for many signals. Exp. Cell Res. 253,

180±185.

Wisdom, R., Johnson, R.S., Moore, C., 1999. c-Jun regulates cell cycle

progression and apoptosis by distinct mechanisms. EMBO J. 18, 188±

197.

A. Slack et al. / Gene 268 (2001) 87±9696