SHORT COMMUNICATIONdoi:10.1016/j.ymthe.2005.02.032

Promoter Dependence of Plasmid–PluronicsTargeted a Galactosidase A Expression in

Skeletal Muscle of Fabry Mice

Matthieu D. Lavigne,1 Marita Pohlschmidt,2 Javier F. Novo,2 Bernard Higgins,1

Valery Alakhov,3 Hanns Lochmuller,4 Hitoshi Sakuraba,5 Geoffrey Goldspink,2

Kay MacDermot,6 and Dariusz C. Gorecki1,*

1Institute of Biomedical and Biomolecular Sciences, School of Pharmacy and Biomedical Sciences, University of Portsmouth, St. Michael’s Building,

White Swan Road, Portsmouth PO1 2DT, UK2Department of Anatomy and Developmental Biology, Royal Free and University College Medical School, London NW3 2 PF, UK

3Supratek Pharma, Inc., Laval, Canada QC H9S 1A94Molecular Myology Laboratory, Friedrich-Baur-Institute, Department of Neurology, Ludwig-Maximilians-University of Munich, Munich 81377, Germany

5Department of Clinical Genetics, The Tokyo Metropolitan Institute of Medical Science,

Tokyo Metropolitan Organization for Medical Research, Tokyo 113, Japan6North West Thames Regional Genetics Service, Kennedy-Galton Centre, Harrow HA1 3UJ, UK

*To whom correspondence and reprint requests should be addressed. Fax: +44 023 92 843 565. E-mail: darek.gorecki@port.ac.uk.

Available online 22 June 2005

MOLECULAR

Copyright C Th

1525-0016/$30

Key Words: a-galactosidase A, CMV promoter, Fabry disease gene therapy, immune response,immunosuppression, MCK promoter, plasmid vector, Pluronic SP1017

Anderson–Fabry disease is an X-linked lysosomal storagedisorder (LSD) caused by a-galactosidase A (AGA) defi-ciency [1]. There is evidence that LSDs could be correctedby gene transfer and expression and enzyme secretionfrom a subset of cells or a specific tissue [2–4]. Such genetherapy has several advantages over an alternative enzymereplacement approach [5,6], as it offers long-term ther-apeutic effect, eliminates risks associated with repeatedparenteral administrations, and is less expensive. Wedescribe here a nonviral AGA gene delivery and expres-sion/secretion from skeletal muscle in AGA knockout mice(animal model of Fabry disease) [7]. We studied thecombination of plasmid vectors with the SP1017 Pluronicblock copolymer, a nonionic carrier capable of increasingthe level and duration of expression of genes injected intomuscle [8]. Single intramuscular administration of nakedplasmid DNA encoding AGA resulted in enzyme secretioninto the bloodstream and enzyme reuptake by distantorgans. However, when plasmids were used in combina-tion with SP1017 to enhance gene expression, a highlyspecific dependence on the promoter type emerged.SP1017 increased only the CMV-driven expression ofAGA and had no effect on the muscle-specific musclecreatine kinase (MCK) promoter-controlled AGA expres-sion. There was a drastic and rapid decrease in AGA activitywhen plasmid that contains AGA under the transcrip-tional control of the CMV promoter was used. It wascaused by immune responses against AGA recognized as aneoantigen. The decline in AGA activity could be delayed

THERAPY Vol. 12, No. 5, November 2005

e American Society of Gene Therapy

.00

by putting AGA under the control of the MCK promoter orprevented by transient immunosuppression, but combi-nation with SP1017 did not alter the specific anti-AGAresponses. This promoter-specific effect of Pluronics ongene expression has implications for the future design andapplications of polymeric adjuvants.

The targeting vectors used in this study containedhuman a-galactosidase A cDNA under the control of oneof two promoters combined with the rat myosin light-chain 1/3 enhancer [9]: the ubiquitously active humanCMV immediate-early promoter [10] or the mouse MCKpromoter [11] selectively active in muscle cells. After weinjected the CMV-driven AGA construct (designatedpX61) into tibialis anterior (TA) muscles of Fabry mice,AGA activity in injected muscles measured 1 week post-injection was significant (Fig. 1A). Moreover, in animalswith the highest muscle activity, we could detect AGA intheir sera (7.2 F 0.8 nmol/h/ml serum, n = 4) and livers(4.0F 1.8 nmol/h/mg protein, n = 8, compared to 0.8F 0.4nmol/h/mg protein in uninjected mice, n = 2). This liveractivity was equivalent to ~30% of the values found inwild-type livers (13.1 F 6.4 nmol/h/mg protein, n = 2) andtherefore within levels shown previously to be therapeutic[2,3,12–14]. This confirmed that the fully functional AGAenzyme had been expressed and secreted from the skeletalmuscle into the bloodstream and subsequently been takenup and accumulated by liver cells.

At the later time points AGA activity in injected musclesdecreased by approximately 90% per week and at 2–3

985

FIG. 1. AGA enzymatic activity in Fabry mouse muscle following injection of plasmid vectors alone or in combination with Pluronic SP1017. (A) The AGA activity

in muscle extracts (nmol/h/mg of protein) 1 to 5 weeks postinjection with pX61 (black columns) or pX61MCK (white columns). There were significant

differences (P b 0.001) between the pX61 and the pX61MCK levels at 3 and 5 weeks postinjection, as enzyme activity declined drastically when the pX61

construct was used. (B) The comparison of relative enzyme activities (% of values obtained for pX61 at 1 week) in muscle extracts from animals treated with

cyclophosphamide (CY) following injection of pX61. CY treatment prevented the decline in AGA activity; there was no statistically significant difference (P =

0.41) in AGA values between the group analyzed 1 week postinjection and the group treated with CY and analyzed 3 weeks postinjection (n N 5). (C) The AGA

activity in muscle extracts (nmol/h/mg of protein) 1 and 3 weeks postinjection with pX61 (black columns) or pX61MCK (white columns) used in combination

with Pluronic SP1017. There was a significant increase in AGA expression over naked plasmid only when SP1017 was used with pX61 (P b 0.005) and no effect

when Pluronic SP1017 was combined with pX61MCK (P = 0.310). This increase in expression using SP1017 was short in duration; activity decreased drastically

(2 logs) as for naked pX61. All values are presented as means F SEM. Plasmid construct pX61 containing the human AGA cDNA controlled by the human CMV

immediate-early promoter region and the rat myosin light-chain 1/3 enhancer [25] was modified into pX61MCK plasmid, in which the short version (1.35 kb) of

the muscle creatine kinase promoter/enhancer was substituted for the CMV promoter. The 1.35-kb fragment containing the region �1354 to +1 bp of MCK was

PCR-amplified from pAdMCKBecker2 vector [11] using primers GCAGTTACGCGTCTGCTGCGGGTCTCATCGTA and GCAGTTGGGTGACCCCGGAATT-

GAGCTCGGTAC, containing MluI and BstEII restriction sites, respectively, for cloning purposes. High-purity, endotoxin-free plasmid preparations were carried

out using a Qiagen kit as described previously [25,26] and 4-week-old mice were injected with plasmid DNA resuspended in sterile physiological saline (2 mg/

ml). The standard injection had a volume of 25 Al (50 Ag of pDNA); it was administered aseptically into both tibialis anterior muscles in anesthetized (isoflurane)

Fabry mice. Pluronic SP1017 solution (Supratek Pharma, Laval, QC, Canada) was combined with equal volumes of plasmid DNAs and gently mixed to get the

required final concentrations of DNA (20 Ag) and 0.01% w/v of SP1017 in 25 Al saline. The formulation was used immediately for im injection.

Cyclophosphamide (150 mg/kg body wt) was administered intraperitoneally on days 2 and 9 postinjection of plasmids. For analysis of the AGA enzymatic

activity, frozen muscle and livers were ground under liquid nitrogen using a drill method [26] and tissue powder was resuspended in 1� Reporter Lysis Buffer

(Promega). The protein concentrations were measured using the bicinchoninic acid kit (Sigma). The enzyme activity in muscle and liver tissue was measured

fluorimetrically as described before [25]. Data were analyzed using analysis of variance for repeated measures. The quoted P values were derived using multiple

comparisons based upon Fisher’s least significant difference.

SHORT COMMUNICATION doi:10.1016/j.ymthe.2005.02.032

weeks after plasmid injection AGA was largely undetect-able (Fig. 1A). Escalated dose of plasmid did not produceincreased expression at any time beyond 1 week post-injection (data not shown). The most likely explanationfor this decline in extraneously expressed enzyme levelswas the destruction of the AGA-expressing cells by

986

immune responses. The knockout Fabry mice completelylack AGA; therefore, the expressed enzyme could act as aneoantigen in these animals. Indeed, the analysis of theanti-human AGA antibody levels in the sera of pX61-injected mice at different time points showed that thetreatment generated strong antibody responses against

MOLECULAR THERAPY Vol. 12, No. 5, November 2005

Copyright C The American Society of Gene Therapy

FIG. 2. Serum levels of anti-hAGA antibodies following

injection of plasmid vectors into Fabry mouse muscles.

Sera of mice injected with pX61 or pX61MCK were

assayed for anti-AGA antibodies at weeks 0, 1, 2, 3,

and 5 postinjection. A significant difference ( P =

0.005) in anti-AGA titers between pX61 and

pX61MCK sera over time could be observed. More-

over, there was a delay in the initiation of the antibody

production in the pX61MCK group (1 to 2 weeks for

pX61 vs 3 weeks for pX61MCK). Levels of hAGA-

specific antibodies were measured using ELISA [27].

Maxisorp plates (Nunc) were coated with highly

purified recombinant human AGA (0.5 Ag/well). Each

sample was measured in duplicate. Bound anti-AGA

Abs were detected using horseradish peroxidase-con-

jugated sheep anti-mouse IgG (1/500; Amersham) and

a substrate mix containing TMB and H2O2 (Sigma).

Titers were defined as the reciprocal of the highest

dilution of serum that produced an OD450 equal to

0.01. Values are presented as means F SEM.

SHORT COMMUNICATIONdoi:10.1016/j.ymthe.2005.02.032

AGA within 2 weeks after injection (Fig. 2). Moreover,immunohistochemical analysis of muscles 2 weeks post-injection showed massive infiltrates of cytotoxic CD8+ Tlymphocytes (CTLs) (Fig. 3B) and macrophages (Fig. 3H).These findings show that in addition to the humoralresponse, a cellular reaction against AGA was present. Themaximum of the humoral and cell-mediated responsescoincided with the decline in AGA activity. The cellulareffector mechanism was quickly moderated; no significantinfiltrates were found at 5 weeks postinjection (Figs. 3Dand 3J), while the levels of anti-AGA antibodies remainedelevated significantly longer (Fig. 2). A short course ofimmunosuppression with cyclophosphamide (CY) pre-vented the decline in AGA activity in injected muscles at 3weeks postinjection (Fig. 1B), further confirming thatimmune responses were responsible for this effect.

The observed rapid decrease in AGA levels could beexplained by the widespread expression pattern triggeredby the CMV promoter used in pX61 vector. Targeting ofpDNA and direct transgene expression in professionalAPCs is known to increase antigen presentation [15]. Itappears that the ubiquitously active CMV promotertriggered AGA transgene expression in antigen-present-ing cells (APC) located in the area surrounding theinjection site. APCs, both dendritic cells (CD11c+) andmacrophages (CD11b+), are abundant in mouse musclebetween 2 and 7 weeks of age [16] (plasmid injection wasperformed at 4 weeks). In addition, recruitment of CTLs

MOLECULAR THERAPY Vol. 12, No. 5, November 2005

Copyright C The American Society of Gene Therapy

was more likely to be initiated when expression of AGAwas targeted to APCs [17].

In an attempt to prolong the expression of AGA, wemodified the pX61 vector by replacing the CMV pro-moter with a short version (1.35 kb) of the MCKpromoter (vector designated pX61MCK) to restrict theexpression to muscle cells [11]. Indeed, we found that at2–3 weeks postinjection the levels of AGA were stillsignificantly high in pX61MCK-injected muscles andthere was no significant decrease in enzyme activity afterthis critical (2–3 weeks) period (Fig. 1A). From 2 to 5weeks postinjection, the AGA activity detected in musclesinjected with pX61MCK was always significantly higherthan for pX61 vector (Fig. 1A) ( P V 0.006 for 3 and 5weeks). When we observed a decrease in AGA activity itwas significantly later than with pX61 (between 3 and 5weeks postinjection) (Fig. 1A). It was also associated withthe start of the humoral response against AGA; however,the titer of anti-AGA antibodies was significantly lowerand the onset of production delayed ( P = 0.005) (Fig. 2).Moreover, in a clear contrast to the massive infiltrationobserved 2 weeks after injection of pX61 (see above)immunohistochemical analysis showed no significantinfiltrates of CTLs (Figs. 3A and 3C) or macrophages(Figs. 3G and 3I) at any time postinjection of pX61MCKplasmid within the period studied here.

It turned out that the MCK-driven expression of AGA,in keeping with the MCK inability to target antigen

987

FIG. 3. Analysis of CD8+ lymphocyte and macrophage infiltrates following injection of plasmid vectors into Fabry mouse muscles. Plasmid vectors (A, C, E, G, I, K)

pX61MCK and (B, D, F, H, J, L) pX61 were injected into TA muscles of 4-week-old Fabry mice and muscle sections were taken 2 weeks postinjection. (A–F)

Immunolocalization of CD8+ T cells. Red fluorescence signal corresponds to CD8+ expression on cytotoxic T lymphocytes infiltrating injected muscle; nuclear

counterstaining (YOPRO-1) is shown in green. (I–N) Immunolocalization of macrophages. Purple staining denotes macrophage-specific staining; nuclear

counterstaining (methyl green) is in blue-green. (G, H, O, and P) Serum-only negative controls. Note the significant number of CD8+ cells and macrophages

infiltrating muscle fibers injected with pX61 at 2 weeks postinjection compared to no staining in muscle injected with pX61MCK at any time point or with pX61

at 5 weeks postinjection. For detection of CD8+ T cells rat anti-mouse CD8 antibody (Serotec; YTS 169.4) was used (1/500 in 10% goat serum) with chicken anti-

rat IgG conjugated with Alexa Fluor 647 (1/200 in 2% goat serum) secondary detection and YOPRO-1 (both from Molecular Probes) cell nucleus

counterstaining. Samples were analyzed using an LSM 510 confocal microscope (Zeiss), with excitation at 650 and 488 nm and emission at 668 and 510 nm for

Alexa and YOPRO-1, respectively. For detection of macrophages, rat anti-mouse F4/80 biotinylated antibody (Serotec; MCA 497B) was used (1/100 in 10% goat

serum) with immunohistochemical visualization (VECTAstain and VIP kits; Vector Laboratories). In both cases negative controls were incubated with 10% goat

serum only.

SHORT COMMUNICATION doi:10.1016/j.ymthe.2005.02.032

expression to APCs, resulted in delayed induction ofimmune responses against this protein. In addition, itwas limited to the humoral response only, the type that isfar less destructive for therapeutic applications. It hasbeen shown previously that antibodies raised against thetransgene have often not caused any significant problemsin terms of safety or stability of expression [18]. Althoughour finding of immunization even with the MCK-driventransgene is contrary to some other data [19], it iscompatible with the known mechanisms of antigenrecognition by the immune system. AGA secreted fromskeletal muscle could be taken up, processed, andpresented by professional APCs and ultimately triggerthe effector phase of the response [20].

Our data suggested that plasmid vectors could beeffective in targeting the AGA gene into skeletal muscle.However, two problems became apparent: first, expressedAGA was immunogenic in the knockout mice. Never-theless, in a clinical setting, immunogenicity of AGA maypose a lesser problem as a significant proportion of

988

patients have residual enzymatic activity or synthesizenonfunctional enzyme, which would decrease the risk ofimmunization [5,6,18,21,22]. The second problem (tosome extent linked with the previous one) was theinsufficiently high level and short duration of AGAexpression.

Pluronic block copolymer (SP1017) has been shown tobe a particularly good enhancer for naked pDNA injectedinto muscle [8]. Therefore we formulated plasmid con-structs pX61 and pX61MCK with SP1017 and injectedthem into TA muscles of Fabry mice, as before. The AGAactivity measured 1 week postinjection of pX61 wassignificantly greater (five fold; P = 0.004) when pDNAwas combined with SP1017 (Fig. 1C). Addition of SP1017did not prevent the drop in AGA activity ( P = 0.000)observed 3 weeks after injection of this construct (Fig.1C). Analyses of anti-AGA antibody levels and muscleinfiltrates (data not shown) confirmed that, like for thenaked plasmid, immune responses were responsible forthis decrease. Therefore SP1017 can significantly increase

MOLECULAR THERAPY Vol. 12, No. 5, November 2005

Copyright C The American Society of Gene Therapy

SHORT COMMUNICATIONdoi:10.1016/j.ymthe.2005.02.032

gene expression following intramuscular injection; how-ever, it has no effect on the time of onset or the intensityof resulting immune reactions against the transgeneacting as neoantigen. Pluronic block copolymer doesnot appear to alter the targeting and expression patternsof CMV-driven plasmids.

Surprisingly, in stark contrast to the strong enhancingeffect of SP1017 on pX61, there was no increase in thelevels of AGA expression at any time postinjection whenwe used the MCK-driven construct (Fig. 1C). This was notcaused by increased immune reactions following genetargeting with SP1017: like with the naked pX61MCK,the antibody responses in SP1017/pX61MCK-injectedanimals were very low and no significant cellularinfiltrates in injected muscle were found (data notshown).

This raises an interesting question regarding themechanisms by which Pluronic SP1017 enhances geneexpression. SP1017 does not condense pDNA (data notshown) and it is not even clear if it forms complexes withDNA. It has been shown before that SP1017 significantlyaugmented pDNA distribution throughout the injectedmuscle and may increase its bioavailability [23]. It wasalso suggested that this polymer might increase cellularuptake of plasmids, increase membrane permeability, andpromote escape from endosomes [8]. It emerges from ourdata that the effects of Pluronics depend strongly on thetype of promoter used; only plasmids driven by theubiquitous CMV promoter were responsive to SP1017enhancement, while the plasmid driven by the muscle-specific promoter was not. This suggests that SP1017 mayact as an exogenous, synthetic response modifier/enhancer of CMV promoter-driven expression. As sug-gested by some earlier data [24] it appears that NFnBbinding sites (present in the CMV promoter) could beinvolved in trans-activation of the transcription bySP1017. While, in the light of stronger immunogenicityof transgenes expressed under the CMV promoter, thisfinding could be exploited for the development of DNAvaccines, it is not useful in applications requiring long-term transgene expression. It is of importance to inves-tigate whether other muscle-specific promoters respon-sive to amphiphilic polymer enhancement could beidentified or engineered. It is also interesting to studythe mechanism of such a specific enhancement bySP1017, as it could find other applications in regulationof gene expression. Finally, our data indicate that anyanalyses of polymeric vectors/enhancers need to takeinto consideration the possibility of similar promoter-dependent effects.

Concluding, Pluronic block copolymer SP1017enhancement of plasmid-derived gene expression showsa striking promoter specificity. Identification of anappropriate combination of muscle-specific regulatoryelements and polymeric enhancers could lead to strongand stable expression and secretion of functional AGA

MOLECULAR THERAPY Vol. 12, No. 5, November 2005

Copyright C The American Society of Gene Therapy

from skeletal muscle. Compared to viral approaches,effective plasmid gene targeting into muscle could besafer, simpler to produce, and less expensive to admin-ister. We confirmed that the AGA transgene could havedifferent immunostimulatory potentials depending onthe vector, promoter, and route of administration used.Muscle-specific regulatory elements did not eliminate therisk of immunization entirely, but did allow for longerexpression. Restriction of the transcription of a therapeu-tic gene to a particular cell type is also of importance forsafety reasons, as this allows a better control of theexpression and limits the toxicity.

ACKNOWLEDGMENTS

This work was supported in part by grants from the Fabry Support Group, UK;

the Wellcome Trust; and the Deutsche Forschungsgemeinschaft and the

Duchenne Parents Project of Germany (Action Benni & Co.) to H.L. H.L. is a

member of the German Network on Muscular Dystrophies (01GM0302) funded

by the German Ministry of Education and Research (Bonn, Germany). M.D.L.

receives a Ph.D. studentship from the University of Portsmouth. The authors

thank Ashok Kulkarni, National Institute of Dental and Craniofacial Research,

National Institutes of Health (Bethesda, MD, USA) for a colony of Fabry mice;

Jeanette Beveridge for technical assistance; and Chun-Fu Lien for helpful

suggestions and C. Alexander for critical comments on the manuscript.

RECEIVED FOR PUBLICATION JANUARY 21, 2005; ACCEPTED FEBRUARY 15,

2005.

REFERENCES1. MacDermot, K. D., Holmes, A., and Miners, A. H. (2001). Anderson–Fabry disease:

clinical manifestations and impact of disease in a cohort of 98 hemizygous males.

J. Med. Genet. 38: 750 – 760.

2. Ohshima, T., et al. (1999). Aging accentuates and bone marrow transplantation

ameliorates metabolic defects in Fabry disease mice. Proc. Natl. Acad. Sci. USA 96:

6423 – 6427.

3. Ziegler, R. J., et al. (1999). Correction of enzymatic and lysosomal storage defects in

Fabry mice by adenovirus-mediated gene transfer. Hum. Gene Ther. 10: 1667 – 1682.

4. Xu, F., et al. (2004). Glycogen storage in multiple muscles of old GSD-II mice can be

rapidly cleared after a single intravenous injection with a modified adenoviral vector

expressing hGAA. J. Gene. Med. 7: 171 – 178.

5. Ioannou, Y. A., Zeidner, K. M., Gordon, R. E., and Desnick, R. J. (2001). Fabry disease:

preclinical studies demonstrate the effectiveness of alpha-galactosidase A replacement

in enzyme-deficient mice. Am. J. Hum. Genet. 68: 14 – 25.

6. Eng, C. M., et al. (2001). Safety and efficacy of recombinant human alpha-

galactosidase A—replacement therapy in Fabry’s disease. N. Engl. J. Med. 345: 9 – 16.

7. Ohshima, T., et al. (1997). a-Galactosidase A deficient mice: a model of Fabry disease.

Proc. Natl. Acad. Sci. USA 94: 2540 – 2544.

8. Lemieux, P., et al. (2000). A combination of poloxamers increases gene expression of

plasmid DNA in skeletal muscle. Gene Ther. 7: 986 – 991.

9. Donoghue, M., Ernst, H., Wentworth, B., Nadal-Ginard, B., and Rosenthal, N. (1988).

A muscle-specific enhancer is located at the 3V end of the myosin light-chain 1/3 gene

locus. Genes Dev. 2: 1779 – 1790.

10. Hennighausen, L., and Fleckenstein, B. (1986). Nuclear factor 1 interacts with five DNA

elements in the promoter region of the human cytomegalovirus major immediate early

gene. EMBO J. 5: 1367 – 1371.

11. Larochelle, N., et al. (1997). Efficient muscle-specific transgene expression after

adenovirus-mediated gene transfer in mice using a 1.35 kb muscle creatine kinase

promoter/enhancer. Gene Ther. 4: 465 – 472.

12. Abe, A., et al. (2000). Reduction of globotriaosylceramide in Fabry disease mice by

substrate deprivation. J. Clin. Invest. 105: 1563 – 1571.

13. Takahashi, H., et al. (2002). Long-term systemic therapy of Fabry disease in a knockout

mouse by adeno-associated virus-mediated muscle-directed gene transfer. Proc. Natl.

Acad. Sci. USA 99: 13777 – 13782.

14. Park, J., et al. (2003). Long-term correction of globotriaosylceramide storage in Fabry

mice by recombinant adeno-associated virus-mediated gene transfer. Proc. Natl. Acad.

Sci. USA 100: 3450 – 3454.

15. Sbai, H., Schneider, J., Hill, A. V., and Whalen, R. G. (2002). Role of transfection in the

priming of cytotoxic T-cells by DNA-mediated immunization. Vaccine 20: 3137 – 3147.

16. Hartigan-O’Connor, D., Kirk, C. J., Crawford, R., Mule, J. J., and Chamberlain, J. S.

989

SHORT COMMUNICATION doi:10.1016/j.ymthe.2005.02.032

(2001). Immune evasion by muscle-specific gene expression in dystrophic muscle. Mol.

Ther. 4: 525 – 533.

17. Kutzler, M. A., and Weiner, D. B. (2004). Developing DNA vaccines that call to

dendritic cells. J. Clin. Invest. 114: 1241 – 1244.

18. Schiffmann, R., et al. (2000). Infusion of alpha-galactosidase A reduces tissue

globotriaosylceramide storage in patients with Fabry disease. Proc. Natl. Acad. Sci.

USA 97: 365 – 370.

19. Bojak, A., Hammer, D., Wolf, H., and Wagner, R. (2002). Muscle specific versus

ubiquitous expression of Gag based HIV-1 DNA vaccines: a comparative analysis.

Vaccine 20: 1975 – 1979.

20. Villadangos, J. A., and Ploegh, H. L. (2000). Proteolysis in MHC class II antigen

presentation: who’s in charge? Immunity 12: 233 – 239.

21. Yasuda, M., Shabbeer, J., Osawa, M., and Desnick, R. J. (2003). Fabry disease: novel

alpha-galactosidase A 3V-terminal mutations result in multiple transcripts due to

aberrant 3V-end formation. Am. J. Hum. Genet. 73: 162 – 173.

22. Okumiya, T., Ishii, S., Kase, R., Kamei, S., Sakuraba, H., and Suzuki, Y. (1995). Alpha-

990

galactosidase gene mutations in Fabry disease: heterogeneous expressions of mutant

enzyme proteins. Hum. Genet. 95: 557 – 561.

23. Alakhov, V., Klinski, E., Lemieux, P., Pietrzynski, G., and Kabanov, A. V. (2001). Block

copolymeric biotransport carriers as versatile vehicles for drug delivery. Expert Opin.

Biol. Ther. 1: 583 – 602.

24. Kabanov, A. V., Batrakova, E. V., Sriadibhatla, S., Yang, Z., Kelly, D. L., and Alakhov, V.

(2005). Polymer genomics: shifting the gene and drug delivery paradigms. J. Controlled

Release 101: 257 – 259.

25. Novo, F. J., Gorecki, D. C., Goldspink, G., and MacDermot, K. D. (1997). Gene transfer

and expression of human alpha-galactosidase from mouse muscle in vitro and in vivo.

Gene Ther. 4: 488 – 492.

26. Wells, K. E., et al. (1997). Immune responses, not promoter inactivation, are

responsible for decreased long-term expression following plasmid gene transfer into

skeletal muscle. FEBS Lett. 407: 164 – 168.

27. Ferrer, A., Wells, K. E., and Wells, D. J. (2000). Immune responses to dystropin: imp-

lications for gene therapy of Duchenne muscular dystrophy. Gene Ther. 7: 1439 – 1446.

MOLECULAR THERAPY Vol. 12, No. 5, November 2005

Copyright C The American Society of Gene Therapy