dna rekombinan

download dna rekombinan

of 49

  • date post

    06-Jul-2015
  • Category

    Education

  • view

    354
  • download

    0

Embed Size (px)

description

gjkgbhekj

Transcript of dna rekombinan

  • 1. Bioteknologi Pertanian Lisnawita

2. Mikroba Rekombinan 3. Mikroba rekombinan DNA rekombinan Metode perakitan 4. DNA (Deoxyribonucleic acid) adalah sejenis asam nukleat yang tergolong biomolekul utama penyusun berat kering setiap organisme. peran DNA di dalam sebuah sel adalah sebagai materi genetik. DNA adalah pembawa informasi genetik di dalam suatu sel 5. Kumpulan teknik atau motode yang digunakan untuk mengkombinasikan gen-gen secara buatan Proses : rekombinasi Hasil : rekombinan Teknologi DNA rekombinan 6. Teknologi DNA rekombinan Rekombinasi antara molekul DNA dari organisme hidup yang berbeda : fenomena umum di alam Contoh : Corynebacterium diphtheriae yang diinfeksi oleh virus menghasilkan toksin yang bertanggung jawab terhadap gejala dipteri Perubahan genetik pada bakteri yang disebabkan virus merupakan rekayasa genetik di alam 7. Teknologi DNA rekombinan 8. Teknologi DNA rekombinan 9. Teknologi DNA rekombinan 10. Teknologi DNA rekombinan 11. Duplikasi fenomena alam di laboratorium Mengembangkan metode introduksi berbagai informasi genetik ke dalam suatu organisme Produksi bahan mahal yang tidak mungkin dibuat secara tradisional Teknologi DNA rekombinan 12. Teknologi DNA rekombinan 13. Teknologi DNA rekombinan 14. Teknologi DNA rekombinan PLASMID : 15. Kromoson vs - Plasmid 16. Memotong DNA Menggunakan enzim restriksi yaitu : enzim yang memotong dsDNA (double stranded DNA) pada situs spesifik. 17. Menyambung DNA 18. Tahapan DNA rekombinan 19. Teknologi DNA rekombinan (Kloning gen) 20. Kloning DNA ke plasmid 21. ..Video biotek Steps in Cloning a Gene - YouTube [360p].mp4 22. ..Video biotekRecombinant DNA 2004 Demonstratives, Inc. - YouTube [360p].mp4 23. Seleksi bakteri pembawa DNA rekombinan 24. Performing the Spread Plate method I 1: Choose appropriate nutrient agar plate with the correct antibiotic (and X-gal) if visual screening 2: Using sterile technique transfer a loopful of bacteria from a culture tube onto plate (or 100l of bacterial culture using a pipette) 25. 3: Dip glass hockey stick in 70% ethanol. Holding it DOWNWARDS flame until alcohol is burned off. DO NOT put back into alcohol 4: Remove lid of petri dish. With one hand rotate dish. With other hand move hockey stick lightly over surface to spread the inoculum evenly Performing the Spread Plate method II 70% EtOH Spreader or Hockey Stick Keep flame away from alcohol !! 26. Performing a Plate Streak I 1: Flame metal inoculating loop, let cool momentarily. 2-3: Using sterile technique transfer a loop of bacterial culture or single colony onto loop 4: With one hand remove lid of dish. With other hand lightly brush the loop back and forth on one quadrant of the dish 27. Performing a Plate Streak II 4: Reflame metal inoculating loop, let cool momentarily. 5,6,7: Rotate petri dish 90 Use 1st streak as inoculum for 2nd streak (only pass the loop through the 1st streak once). Repeat once more rotating dish 90 and sterilizing loop again 8 :Incubate o/n at 37C 28. Plate Streak Method This is an example of a good streak for isolation using the "four corners" method. 29. This is not a great streak plate but it is serviceable, as there are a few isolated colonies. - would have been better if the loop had been flamed between each sector. This is an example of how NOT to streak for isolation. Scribbling is not streaking, and most likely will not result in isolated colonies. 30. After Incubating the plate overnight at 37C- individual colonies of transformed bacteria should be seen Each team will pick two individual colonies (clones) and streak on a new plate (single colony purification) for next week 31. Bacterial colonies transformed with pUC18 blue colonies (contain non-recombinant DNA molecules) White colonies (contain recombinant DNA molecules) 32. ..Video biotek dna cloning - YouTube [360p].mp4 33. Manfaat teknologi DNA rekombinan Dengan mengisolasi dan mempelajari masing- masing gen akan diperoleh pengetahuan tentang fungsi dan mekanisme kontrolnya. teknologi ini memungkinkan diperolehnya produk gen tertentu dalam waktu lebih cepat dan jumlah lebih besar daripada produksi secara konvensional. 34. Deteksi keberadaan DNA sisipan 35. 1. Pre Denaturasi 2. Denaturasi 3. Annealing 4. Ekstensi 5. Post ekstensi (pemantapan) Tahapan-tahapan PCR 36. PCR Animation Please click here. 1st cycle 2nd cycle 3rd cycle Process Denature Anneal Primer Replicate DNA 37. 1 2 54M 8 10 116 7 391 bp M MM 7654 A B 3 238 bp 9 Contoh hasil PCR 38. Hasil penentuan urutan nukleotida DNA sisipan (DNA sekuensing) 39. GR1-Jatim 2 TTGTTGTACGTGCCGTACCTTGCGGCATGTCTGCGCTTGTGTGCTACGTCCGTGGCCGTG 60 GR3-Jatim 3 TTGTTGCACGTGCCGTACCTTGCGGCATGTCTGCGCTTGTGTGCTACGTCCGTGGCCGTG 60 GR2-Jatim 1 TTGTTGTACGTGCCGTACCTTGCGGCATGTTTGCGCTTGTGTGCTACGTCCGTGGCCGTG 60 ****** *********************** ***************************** GR1-Jatim 2 ATGAGACGACGTGTTAGGACCCGTGCCTGGCATTGGCACGTGGTTTAAGACTTGATGAGT 120 GR3-Jatim 3 ATGAGACGACGTGTTAGGACCCGTGCCTGGCATTGGCACGTGGTTTAAGACTTGATGAGT 120 GR2-Jatim 1 ATGAGACGACGTGTTAGGACCCGTGCCTGGCATTGGCACGTGGTTTAAGACTTGATGAGT 120 ************************************************************ GR1-Jatim 2 GCCCGCAGGCACCGCCAGCTTTTTCCCATTTTTATTTATTTTTTATGCAATTCGATTGCT 180 GR3-Jatim 3 GCCCGCAGGCACCGCCAGCTTTTTCCCATTTTTATTTATTTTTTATGCAATTCGATTGCT 180 GR2-Jatim 1 GCCCGCAGGCACCGCCAGCTTTTTCCCATTTTTATTTATTTTTTATGCAATTCGATTGCT 180 ************************************************************ GR1-Jatim 2 AAAATATTCTAGTCTTATCGGTGGATCACTCGGCTCGTGGATCGATGAAGATCGCTAGCC 240 GR3-Jatim 3 AAAATATTCTAGTCTTATCGGTGGATCACTCGGCTCSKGGATCGATGAAGATCGCTAGCC 240 GR2-Jatim 1 AAAATATTCTAGTCTTATCGGTGGATCACTCGGCTCGKGGATCGATGAARATCGCTAGCC 240 ************************************ *********** ********** GR1-Jatim 2 TTCTGCA 247 GR3-Jatim 3 TTCTGCA 247 GR2-Jatim 1 TTCTGCA 247 ******* Hasil pembacaan DNA sekuensing 40. Bidang Hukum Pelaku kejahatan dapat diidentifikasi dengan menggunakan analisis Sidik jari DNA . Misalnya : Kasus perkosaan 41. 0.2% Hybrid Seed 1.4% Food 1.8% Starch 3.7% Alcohol 5.8% Sweeteners 44.7% Animal Feed/Residual 16.8% Exports 25.6% Ending Stocks (Buffer against a bad crop) Avg Annual US Usage Oil is extracted from the germ (embryo) for cooking, Starch in building materials or intravenous solutions, the shell (hull) is used in animal feed Source: National Geographic June 1993 p91-117