Post on 11-May-2023
Citation: Zhou, Z.; Liu, Q.; Zhang, G.;
Mohammed, D.; Amadou, S.; Tan, G.;
Zhang, X. HOXA11-AS1 Promotes
PD-L1-Mediated Immune Escape and
Metastasis of Hypopharyngeal
Carcinoma by Facilitating PTBP1 and
FOSL1 Association. Cancers 2022, 14,
3694. https://doi.org/10.3390/
cancers14153694
Academic Editors: Crystal N.
Marconett and Linlin Guo
Received: 14 June 2022
Accepted: 25 July 2022
Published: 29 July 2022
Publisher’s Note: MDPI stays neutral
with regard to jurisdictional claims in
published maps and institutional affil-
iations.
Copyright: © 2022 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
cancers
Article
HOXA11-AS1 Promotes PD-L1-Mediated Immune Escape andMetastasis of Hypopharyngeal Carcinoma by FacilitatingPTBP1 and FOSL1 AssociationZheng Zhou 1, Qian Liu 1, Gehou Zhang 1, Diab Mohammed 2, Sani Amadou 3, Guolin Tan 1
and Xiaowei Zhang 1,*
1 Department of Otolaryngology Head & Neck, Third Xiangya Hospital, Changsha 410013, China;zz198911252022@163.com (Z.Z.); windyliusong@126.com (Q.L.); z1713866573@163.com (G.Z.);guolintan@csu.edu.cn (G.T.)
2 Department of Otolaryngology Head & Neck, Xiangya Hospital, Changsha 410008, China;Diabsam@hotmail.com
3 Department of ENT, Reference Hospital, Maradi 12481, Niger; hamedsani86@gmail.com* Correspondence: xiaowei-zhang@csu.edu.cn
Simple Summary: The metastasis of hypopharyngeal squamous cell carcinoma (HSCC) is the mainreason for the poor prognosis of patients. Increasing studies have shown that abnormally expressedlncRNAs play crucial roles in HSCC, providing new perspectives for exploring cancer pathogenesisand matastasis. The expressions of HOXA11-AS1 and PD-L1 were found to be closely related tothe overall survival of HSCC patients. Subsequently, the potential target genes, namely PBTP1 andFOSL1, were identified by expression correlation analysis. Finally, HOXA11-AS1/FOSL1/PTBP1/PD-L1 axis was identified to be a novel pathway provided a feasible preliminary basis for the futureapplication of immunotherapy or targeted therapies in HSCC.
Abstract: Background: The metastatic characteristics of hypopharyngeal squamous cell carcinoma(HSCC) lead to many diagnostic and therapeutic challenges, while functional long non-coding RNAs(lncRNAs) can provide effective strategies for its diagnosis and treatment. Methods: RT-qPCR,Western blot, immunohistochemistry, and an immunofluorescence assay were used to detect therelated gene expression. Flow cytometry was used to measure the percentage of CD8+ and CD4+ Tcells. CCK-8 and transwell assays were performed to analyze the role of HOXA11-AS1. The targetedrelationship of the FOSL1/PD-L1 promoter was measured by ChIP and dual-luciferase reporterassays. RNA pulldown and RIP assays were used to measure the interaction between HOXA11-AS1, FOSL1, and PTBP1. A tumor xenograft study was used to analyze HOXA11-AS1 functionin vivo. Results: HOXA11-AS1, PD-L1, and FOSL1 were upregulated in HSCC, and HOXA11-AS1positively correlated with PD-L1. HOXA11-AS1 knockdown upregulated CD8+ T cells through anincrease in IFN-γ concentration while decreasing the proliferation, migration, and invasion of HSCCcells. FOSL1 bound the PD-L1 promoter, increasing gene expression. HOXA11-AS1 enhanced thestability of FOSL1 mRNA by binding to PTBP1. HOXA11-AS1 or PTBP1 overexpression increasedFOSL1 and PD-L1 expression. PD-L1 knockdown arrested the inhibiting function of HOXA11-AS1overexpression on CD8+ T cell content. HOXA11-AS1 knockdown inhibited immune escape andmetastasis through PD-L1 regulation by downregulating FOSL1 in vivo. Conclusion: HOXA11-AS1 promoted PD-L1 expression by upregulating FOSL1 levels through PTBP1, thereby facilitatingimmune escape, proliferation, and metastasis of HSCC cells.
Keywords: hypopharyngeal squamous cell carcinoma; HOXA11-AS1; PD-L1; FOSL1; PTBP1;immune escape
Cancers 2022, 14, 3694. https://doi.org/10.3390/cancers14153694 https://www.mdpi.com/journal/cancers
Cancers 2022, 14, 3694 2 of 21
1. Introduction
Hypopharyngeal squamous cell carcinoma (HSCC) is one of the most frustrating andaggressive malignancies in the hypopharynx, accounting for 3–5% of all head-and-necktumors [1]. There were 84,252 cases of HSCC and 38,599 deaths in 2020 worldwide [2].Patients with HSCC are often in an advanced stage at the time of diagnosis, and the delayeddiagnosis is due to the absence of initial symptoms. Its metastatic characteristics, such assubmucosal spread and cervical lymph node metastasis, and high incidence of recurrenceseriously affect five-year survival rates, which are less than 40% in stage III and IV patients,who show no encouraging improvement with contemporary treatments [3–5]. Therefore,discovering molecular targets for HSCC diagnosis and treatment remains key to achievingclinical improvements.
Programmed death-ligand 1 (PD-L1, also named CD274 or B7-H1), one of the ligandsof PD-1, acts as a coinhibitory molecule in cancer development and is expressed on thesurface of T lymphocytes, facilitating immune escape [6,7]. In cancer, the activity of thePD-1/PD-L1 pathway is responsible for T cell activation, proliferation, and cytotoxic secretion,leading to the degeneration of anti-tumor immune responses [8]. Positive PD-L1 stainingwas found in 58% of cancers, and no survival benefit was observed from PD-L1 levels intumor cells [9]. Growing evidence has shown that PD-L1 upregulation is involved in tumoraggressiveness, being closely related to poor prognosis [10]. For example, Wintterle et al.suggested that PD-L1 modulated CD4+ and CD8+ T cell levels by increasing cytokine (suchas IFN-γ) concentrations, thus showing an immunomodulatory function in glioma cells [11].Similarly, the high expression of PD-L1 facilitated HSCC cell escape from recognition bythe host immune system and accelerated tumor metastasis [12,13], indicating that PD-L1inhibition may have positive effects on HSCC treatment. Indeed, the measurement of PD-L1scoring was considered as a method to evaluate the effect of (neo)adjuvant dual anti-PD-1immune-checkpoint blockade in recurrent, resectable squamous cell carcinoma of the headand neck [14]. However, the specific function of PD-L1 in HSCC requires further investigation.
The transcription factor FOSL1 is involved in promoting metastasis in a variety of can-cers, such as breast cancer [15], clear cell renal cell carcinoma [16], and bladder cancer [17].Although the role of FOSL1 in HSCC remains largely unknown, the TCGA databasepredicted high FOSL1 expression in head-and-neck cancer, with microarray assays alsoindicating its overexpression in HSCC. More importantly, JASPAR prediction identified theFOSL1 binding sequence on the PD-L1 promoter. Therefore, we suspected that exploringtheir interaction may shed light on HSCC immune escape and metastasis. Increasingstudies have shown that abnormally expressed long non-coding RNAs (lncRNAs) playroles as tumor promoters or suppressors, providing new perspectives for exploring cancerpathogenesis [18,19]. The lncRNA UCA1 had been reported to be highly expressed inHSCC, acting as a pro-metastatic gene and a tumor promoter in vitro [20]. This studywas conceived to elucidate the molecular mechanism of homeobox A11 antisense RNA1(HOXA11-AS1) in HSCC. HOXA11-AS1 was suggested to be an oncogene in prostate can-cer [21], non-small cell lung cancer [22], and HSCC. Xu et.al suggested that HOXA11-AS1knockdown repressed the proliferative and migration capacity of FaDu cells [23]. Ourmicroarray analysis indicated that HOXA11-AS1 was upregulated in HSCC. Remarkably,Starbase predicted binding sequences between HOXA11-AS1 or FOSL1 and polypyrimi-dine tract binding protein 1 (PTBP1), which belongs to the family of heterogeneous nuclearribonucleoproteins. PTBP1 acted as a regulator of tumorigenesis, proliferation, metastasis,and apoptosis in multiple cancers [24]. The function of PTBP1 in cancers is regulated by avariety of molecules, such as microRNAs, lncRNAs, and RNA-binding proteins. For exam-ple, the lncRNA LUCAT1/PTBP1 axis was demonstrated to promote tumor progression byregulating the selective splicing and stability of mRNA [25]. However, no studies have dis-cussed the mechanism and role of PTBP1 in HSCC. Here, we speculated that HOXA11-AS1promoted PTBP1 and FOSL1 association and participated in HSCC metastasis.
Cancers 2022, 14, 3694 3 of 21
In this study, we constructed a network linked to the immune escapee and metas-tasis of HSCC by a series of analytic processes. We first evaluated the expression ofHOXA11-AS1 and PD-L1 in HSCC tissues and cells and conducted survival analysis ofHSCC patients. Subsequently, the potential target genes, namely PBTP1 and FOSL1, wereidentified by expression correlation analysis. Finally, a series of molecular biology meth-ods were used to explore the possible upstream regulatory mechanism and downstreamregulatory pathway, and also to verify the biological functions of this novel pathway. TheHOXA11-AS1/FOSL1/PTBP1/PD-L1 axis provided a feasible preliminary basis for thefuture application of immunotherapy or targeted therapies in HSCC.
2. Materials and Methods2.1. Patients
A total of 40 samples of HSCC and matched peri-carcinomatous specimens were ob-tained from patients with HSCC at the Third Xiangya Hospital of Central South Universityfrom January 2016 to June 2020. All samples were stored at −80 ◦C until analysis. Thestudy was approved by the Ethics Committee of the Third Xiangya Hospital of CentralSouth University, and all subjects signed written informed consent (IRB code: 2020-S031).The criteria for inclusion: (1) pathological diagnosis of HSCC in the resected specimens;(2) no history of radiotherapy or chemotherapy; (3) age of 18 years or older; (4) the patient’swritten informed consent. Exclusion criteria: (1) history of surgical resection of any part ofthe upper gastrointestinal tract; (2) younger than 18 years of age; (3) current pregnancy.
2.2. Cell Culture and Transfection
Human pharyngeal carcinoma cells (FaDu and Detroit 562) and human nasopharyn-geal epithelial cells (NP69) were obtained from the American Type Culture Collection(Manassas, VA, USA). Cells were cultured in Dulbecco’s modified Eagle medium (ThermoFisher Scientific, Inc. Waltham, MA, USA) supplemented with 10% fetal calf serum (Invitro-gen, Carlsbad, CA, USA), 100 U/mL penicillin, and 100 µg/mL streptomycin (Invitrogen)at 37 ◦C in a humidified incubator under 5% CO2.
Short hairpin RNAs (shRNAs) knocking down HOXA11-AS1, PD-L1, and PTBP1 andlentiviral plasmids overexpressing HOXA11-AS1 and PTBP1 were synthesized by RiboBio(Guangzhou, China). All plasmids and their combinations were transduced into FaDu orDetroit 562 cells using Lipofectamine 3000 (Invitrogen).
2.3. RNA Extraction and Quantitative Real-Time PCR (qRT-PCR) Assay
Total RNA from tissues or cells was extracted using TRIzol reagent (Invitrogen),and its concentration was measured using a NanoDrop Spectrophotometer (Thermo).The RevertAid First Strand cDNA Synthesis kit (Thermo) was used for reverse transcrip-tion. An ABI qRT-PCR 7900 system (Thermo) was employed to perform PCR reactions.Gene expression was normalized to GAPDH. Primers were synthesized by RiboBio andwere: 5′-CGGCTAACAAGGAGATTTGG-3′ (sense) and 5′-AGGCTCAGGGATGGTAGTCC-3′ (antisense) for HOXA11-AS; 5′-GTGGCATCCAAGATACAAACTCAA-3′ (sense) and5′-TCCTTCCTCTTGTCACGCTCA-3′ (antisense) for PD-L1; 5′-CAGTGGATGGTACA-GCCTCA-3′ (sense) and 5′-CTGCAGCCCAGATTTCTCAT-3′ (antisense) for FOSL1;5′-CTCAAGGCGTTCCTTCTGCTTC-3′ (sense) and 5′-GGAGGAGTGGGTGTCGCTGT-3′
(antisense) for GAPDH.
2.4. Western Blot
Protein extraction was carried out with a lysis buffer (Beyotime Institute of Biotech-nology, Haimen, China). Proteins were quantified by an acid-based Protein Assay Kit(Thermo), followed by separation with 10% sodium dodecyl-sulfate polyacrylamide gelelectrophoresis (SDS-PAGE) and transfer to polyvinylidene difluoride membranes (Milli-pore, Bedford, MA, USA). Afterward, 5% skim milk was used to block (2 h) the non-specificbinding sites of membranes. Membranes were subsequently incubated with indicated
Cancers 2022, 14, 3694 4 of 21
primary antibodies overnight against PD-L1 (1:1000, ab213524, Abcam, Cambridge, UK),FOSL1 (1:1000, ab252421, Abcam), or PTBP1 (1:5000, ab134950, Abcam), followed by in-cubation with horseradish peroxidase-conjugated secondary antibody (1:5000, ab205718,Abcam). Membranes were washed with PBS three times, and signals were visualized byan ECL reagent (Millipore, Bedford, MA, USA). Protein expression was analyzed usingImageJ software 6.0 (National Institutes of Health, Bethesda, MD, USA). GAPDH (1:2000,ab8245, Abcam) and β-actin (1:5000, ab6276, Abcam) acted as internal controls.
2.5. Immunohistochemistry (IHC)
HSCC tumor tissues were fixed in 4% paraformaldehyde for 24 h, then routinelyembedded in paraffin and sectioned into 4 µm sections. Sections were deparaffinized,hydrated, and immersed in blocking solution (prepared using Triton X-100) in the darkfor 1 h. After incubating with anti-PD-L1 (1:500, ab228415, Abcam) overnight, sectionswere incubated with horseradish peroxidase-labeled secondary antibody (1:5000, ab205718,Abcam) for 30 min. After developing with a diaminobenzidine substrate, sections werecounterstained with hematoxylin. Images were visualized using a Nikon ECLIPSE Timicroscope system and processed with Nikon software (Version 5.02).
2.6. CCK-8 Assay
Cells were seeded into culture plates and incubated for indicated times, followed bytreatment with 10 µL CCK-8 solution. Absorbance was detected at 450 nm by a MultiskanTM
GO microplate spectrophotometer (Thermo).
2.7. Colony Formation Assay
After trypsinization, HSCC cells (1× 105) and PBMCs were cocultured in 6-well platesfor 2 weeks under a humidified atmosphere. Colonies were fixed with 4% paraformalde-hyde and then stained with 0.1% crystal violet. A microscope was used to calculate thenumber of colonies.
2.8. Wound Healing Assay
Briefly, treated cells in 6-well plates were cultured at 37 ◦C until 100% confluence,followed by scratching a straight wound on the surface of the cell layer using a sterilepipette. Next, debris on the cell surface was removed by washing with PBS twice, and cellswere incubated for 24 h. We obtained photographs of migrating cells 0 h and 24 h afterscratching using a microscope.
2.9. Transwell Assay
Cell invasion capability was measured by Transwell chambers with an 8 µm pore size(Corning, Tewksbury, MA, USA) coated with Matrigel. Briefly, 1 × 105 cells in 100 µL ofserum-free RPMI 1640 medium were placed into the upper chamber, and 500 µL of mediumcontaining 10% FBS was added into the lower chamber. Cells were dyed in 0.5% crystalviolet after 48 h culture at 37 ◦C with 5% CO2. Cells remaining in the upper chamber wereremoved. Following washing with PBS and drying, images were taken under a microscope(Olympus, Tokyo, Japan).
2.10. Co-Culture of Human PBMCs and HSCC Cells
FaDu and Detroit 562 cells with or without PD-L1 antibody (2 µg/mL, Abcam) treat-ment were selected for co-culture experiments. Human peripheral blood mononuclear cells(PBMCs) were isolated by Ficoll-Hypaque gradient centrifugation. For co-culture, FaDuand Detroit 562 cells were plated into 24-well plates in Modified Eagle Medium (DMEM)with a density of 1 × 105 cells/well, and PBMCs were placed in culture insert (0.4 µm poresize, Corning, New York, NY, USA) in DMEM at a concentration of 4 × 105 cells/well.
Cancers 2022, 14, 3694 5 of 21
2.11. Flow Cytometry
Co-cultured cells were stained with anti-CD3 (317320, BioLegend, San Diego, CA,USA), anti-CD4 (357402, BioLegend), and anti-CD8 (344702, BioLegend), and then assessedusing a BD FACSAria III flow cytometer (BD Biosciences, San Jose, CA, USA). Data wereanalyzed with FlowJo V10 software (TreeStar Inc., Ashland, OR, USA).
2.12. Enzyme-Linked Immunosorbent Assay (ELISA)
Interferon-γ (IFN-γ) concentration in cell-free supernatant from co-cultured cells wasassessed by a human ELISA kit according to the manufacturer’s instructions (Multisciences,Hangzhou, China).
2.13. Immunofluorescence Assay
Transfected cells were fixed with 4% formaldehyde for 20 min at room temperature.After 1 h of incubation with non-fat dry milk diluted in 5% Tris-buffered saline with Tween-20 (pH 8.3), cells were incubated with the primary antibody PD-L1 (1:200, ab228415, Abcam)overnight at 4 ◦C, and then, the corresponding secondary antibody (1:1000, ab150077,Abcam) at 37 ◦C for 1 h. Next, DAPI was used to stain cell nuclei, and a confocal laserscanning microscope was used to analyze immunofluorescence images.
2.14. Fractionation of Nuclear/Cytoplasmic RNA
Nuclear/cytoplasmic fractionation was performed using a PARIS Kit (Life Technolo-gies, Carlsbad, CA, USA). Briefly, cells were washed with PBS, followed by centrifugationand lysis in 1 mL of lysis buffer. Cytoplasmic RNA was subsequently obtained from thesupernatant, and the remaining nuclear pellet was washed three times with hypotonic lysisbuffer to extract nuclear RNA.
2.15. Chromatin Immunoprecipitation (ChIP) Assay
The two binding sites (BS1: TGTGTCAT; BS2: AAATCACTGAGCAGCAAGCTGA) be-tween FOSL1 and PD-L1 were predicted using the JASPAR website (http://jaspar.genereg.net/ accessed on 1 July 2021). A kit from Millipore was used to perform the ChIP assay.Briefly, cells were cross-linked with 1% formaldehyde for 10 min, then lysed and sonicatedto obtain chromatin fragments of 500 bp average size. Subsequently, 1% of the supernatantwas collected to serve as input control. Chromatin diluted in the ChIP solution was im-munoprecipitated with a DNMT3A antibody or IgG at 4 ◦C overnight with rotation. Afterreversing the cross-links, immune complexes were purified and analyzed by PCR.
2.16. Dual-Luciferase Reporter Assay
The PD-L1 promoter fragment containing two binding sites (wild-type BS1 and mutantBS2, or mutant BS1 and wild-type BS2) was subcloned into a pGL3-basic vector (Promega,Madison, WI, USA), obtaining recombinant plasmids mut-BS2 and mut-BS1. FOSL1 cDNAwas PCR-amplified and inserted into the pcDNA3.1 vector (Promega), with an emptyvector (EV) used as control. In addition, 293T cells were co-transfected with a pGL3luciferase construct (mutant BS1 or mutant BS2) for FOSL1 expression or empty plasmids.The luciferase signal of indicated transfected cells was estimated using a Dual-LuciferaseReporter Assay System (Promega) 48 h after transfection.
2.17. mRNA Stability Analysis
HOXA11-AS1- or PTBP1-silenced cells were treated with 5µg/mL actinomycin D(MedChemExpress, Monmouth Junction, NJ, USA). Total RNA was extracted at indicatedtimes, and HOXA11-AS1 or FOSL1 mRNA was measured and normalized to GAPDHlevels using RT-qPCR.
Cancers 2022, 14, 3694 6 of 21
2.18. RNA Pulldown
Biotin-labeled HOXA11-AS1 and FOSL1 mRNA or their antisense RNA were tran-scribed with the Biotin RNA Labeling Mix and T7/SP6 RNA polymerase (Roche Diagnos-tics, Indianapolis, IN, USA), followed by RNase-free DNase I (Roche) treatment. Afterpurification with the RNeasy Mini Kit (Roche), biotin-labeled RNAs were mixed withextracted FaDu and Detroit 562 cell nuclear proteins and then incubated with streptavidinagarose beads at room temperature for 1 h. Protein bands were visualized by silver stainingfollowed by Western blot.
2.19. RNA Immunoprecipitation (RIP) Assay
A RIP assay was conducted using a Magna RIPTM RNA-Binding Protein Immunopre-cipitation Kit (Millipore). Cells were lysed with RIP lysis buffer and then immunoprecipi-tated with immunoglobulin G antibody (anti-IgG) and argonaute 2 antibody (anti-Ago2)coated on magnetic beads overnight, followed by a PBS wash. Part of the cell lysate(“Input”) was used as a negative control. The co-precipitated RNA was extracted usingTRIzolTM (Ambion Inc., ThermoFisher Scientific, Waltham, MA, USA), and RT-qPCR wasused to analyze the purified RNA.
2.20. In Vivo Xenograft Experiments
The 48 NOD-SCID mice (male, 18–22 g, 6 weeks of age) used in this study were pur-chased from Hunan slake Jingda Co., Ltd. (Changsha, China). FaDu or Detroit 562 cellsstably expressing shHOXA11-AS1-1, shHOXA11-AS1-2, or shNC were injected subcuta-neously into the right flank of mice (n = 4) to perform the tumorigenesis assay. Next, eachxenograft tumor model was assigned into 2 groups (n = 4) and was injected intraperitoneallywith PBS or PBMC for killing the xenograft effectively. Human immunocyte mixtures con-taining PBMCs (4× 106/per mouse) and activated T cells (1× 106/per mouse) or PBS wereinjected into the mice when the tumor volume was more than 100 mm3 by tail intravenousinjection once a week for three times. Tumor volumes were calculated every 5 days bythe equation: volume (mm3) = 0.5 × (Width)2 × (Length). At 30 days after injection, micewere euthanized to obtain tumors. Tumor tissue sections were stained with hematoxylinand eosin (HE) or ki67 to analyze the pathology or proliferation of tumor tissue. IHCstaining was performed to measure PD-L1 levels. Tumor regression rate = (tumor volumein NOD-SCID mice after PBMC treatment/tumor volume in NOD-SCID mice after PBStreatment) × 100%.
For the metastasis assay, FaDu or Detroit 562 cells stably expressing shHOXA11-AS1-1,shHOXA11-AS1-2, and shNC were injected into the mouse tail vein (n = 4). Four weeksafter injection, mice were sacrificed, and lung lobes were harvested and placed in 10%neutral-buffered formalin fixative overnight and embedded in paraffin. Then, sectionswere stained with HE for pathological assessment. Metastasis foci within mice lungsand visible lung metastatic nodules were observed and counted using a light microscope(Olympus Corporation, Tokyo, Japan). All animal experiments were approved by theAnimal Ethics Committee of the Third Xiangya Hospital of Central South University (IRBcode: 2020-S031).
2.21. Statistical Analysis
Data are provided as mean and standard deviation (SD). The Student’s t-test wasused to compare the difference between two groups for continuous variables. One-wayanalysis of variance (ANOVA) followed by Tukey’s post hoc test was used for multiplecomparisons. Kaplan–Meier with log-rank methods was used in survival analysis, andPearson’s correlation was evaluated. All analyses were performed using GraphPad Prism6 (GraphPad Software,Version 8.2.0 Inc., La Jolla, CA, USA); p < 0.05 was consideredstatistically significant.
Cancers 2022, 14, 3694 7 of 21
3. Results3.1. HOXA11-AS1 and PD-L1 Were Highly Expressed in HSCC, and HOXA11-AS1 PositivelyCorrelated with PD-L1
This study evaluated HOXA11-AS1 and PD-L1 levels in HSCC and peri-carcinomatoustissues. As shown in Figure 1A,B, HOXA11-AS1 and PD-L1 were highly expressed in HSCCtissues. HSCC patients with lower levels of HOXA11-AS1 or PD-L1 had increased survivalrates compared with those with higher levels of HOXA11-AS1 or PD-L1 (Figure 1C,Dand Tables S1–S3). Then, a positive correlation between HOXA11-AS1 and PD-L1 wasconfirmed (Figure 1E). To further verify the upregulation of PD-L1 in HSCC tissues, IHCstaining was adopted to measure PD-L1 levels in tumor tissues. As shown in Figure 1F,PD-L1 was overexpressed. Moreover, we detected increased expression of HOXA11-AS1and PD-L1 in HSCC cell lines Detroit 562 and FaDu, compared to NP69, a normal humannasopharyngeal epithelial cell line. (Figure 1G,H).
Cancers 2022, 14, x 7 of 22
6 (GraphPad Software,Version 8.2.0 Inc., La Jolla, CA, USA); p < 0.05 was considered sta-
tistically significant.
3. Results
3.1. HOXA11-AS1 and PD-L1 Were Highly Expressed in HSCC, and HOXA11-AS1 Positively
Correlated with PD-L1
This study evaluated HOXA11-AS1 and PD-L1 levels in HSCC and peri-carcinoma-
tous tissues. As shown in Figure 1A,B, HOXA11-AS1 and PD-L1 were highly expressed
in HSCC tissues. HSCC patients with lower levels of HOXA11-AS1 or PD-L1 had in-
creased survival rates compared with those with higher levels of HOXA11-AS1 or PD-L1
(Figure 1C,D and Tables S1–S3). Then, a positive correlation between HOXA11-AS1 and
PD-L1 was confirmed (Figure 1E). To further verify the upregulation of PD-L1 in HSCC
tissues, IHC staining was adopted to measure PD-L1 levels in tumor tissues. As shown in
Figure 1F, PD-L1 was overexpressed. Moreover, we detected increased expression of
HOXA11-AS1 and PD-L1 in HSCC cell lines Detroit 562 and FaDu, compared to NP69, a
normal human nasopharyngeal epithelial cell line. (Figure 1G,H).
Figure 1. HOXA11-AS1 and PD-L1 were upregulated in HSCC, and HOXA11-AS1 positively corre-
lated with PD-L1. (A,B) HOXA11-AS1 and PD-L1 expression in 40 HSCC tissues and matched peri-
carcinomatous tissues measured by RT-qPCR. (C,D) Kaplan–Meier overall survival curve stratified
by HOXA11-AS1 and PD-L1 expression. GraphPad was utilized to calculate the Kaplan–Meier plots,
and 40 HSCC patients were included. The high/low expression of HOXA11-AS1 was defined by the
median of its expression level, with higher than the median as high expression and lower than the
median as low expression. Survival analysis was used. (E) The correlation between HOXA11-AS1
and PD-L1 expression was analyzed by Pearson’s correlation coefficient, n = 40. (F) PD-L1 expres-
sion in HSCC tissues was measured by immunohistochemical staining. (G,H) HOXA11-AS1 mRNA
expression and PD-L1 protein levels in NP69 and HSCC cells (FaDu and Detroit 562 cells) detected
by RT-qPCR and Western blot, respectively; n = 4. * p < 0.05, ** p < 0.01, *** p < 0.001. Original Blots
see Supplementary File Figure S1.
Figure 1. HOXA11-AS1 and PD-L1 were upregulated in HSCC, and HOXA11-AS1 positively cor-related with PD-L1. (A,B) HOXA11-AS1 and PD-L1 expression in 40 HSCC tissues and matchedperi-carcinomatous tissues measured by RT-qPCR. (C,D) Kaplan–Meier overall survival curve strati-fied by HOXA11-AS1 and PD-L1 expression. GraphPad was utilized to calculate the Kaplan–Meierplots, and 40 HSCC patients were included. The high/low expression of HOXA11-AS1 was definedby the median of its expression level, with higher than the median as high expression and lower thanthe median as low expression. Survival analysis was used. (E) The correlation between HOXA11-AS1and PD-L1 expression was analyzed by Pearson’s correlation coefficient, n = 40. (F) PD-L1 expressionin HSCC tissues was measured by immunohistochemical staining. (G,H) HOXA11-AS1 mRNAexpression and PD-L1 protein levels in NP69 and HSCC cells (FaDu and Detroit 562 cells) detectedby RT-qPCR and Western blot, respectively; n = 4. * p < 0.05, ** p < 0.01, *** p < 0.001. Original Blotssee Supplementary File Figure S1.
Cancers 2022, 14, 3694 8 of 21
3.2. HOXA11-AS1 Knockdown Suppressed PD-L1 Expression and Immune Escape, Proliferation,and Metastasis of HSCC Cells
To explore the cellular role of HOXA11-AS1, two independent plasmids were usedto deplete HOXA11-AS1, with increased specificity and helping eliminate off-target effectsfrom the use of a single plasmid in FaDu and Detroit 562 cell lines. HOXA11-AS1 was effi-ciently silenced by transfecting with shHOXA11-AS1-1 and shHOXA11-AS1-2 (Figure 2A).Since HOXA11-AS1 was positively associated with PD-L1, we measured PD-L1 levels aftersilencing HOXA11-AS1 and observed its downregulation (Figure 2B,C). The dysregulation ofPD-L1, which could regulate the proliferation and cytotoxicity of T cells, had been reportedto be a cogent mechanism for potentially immunogenic tumors to escape from host immuneresponses [10,26]. Thus, HOXA11-AS1-silenced cells were co-cultured with PBMCs to evalu-ate whether the reduction in PD-L1 induced by HOXA11-AS1 knockdown could affect theconcentration of CD8+ and CD4+ T cells in vitro. As shown in Figure 2D–E, the knockdownof HOXA11-AS1 or anti-PD-L1 treatment could increase CD8+ T cell percentages whiledecreasing CD4+ T cells in PBMCs. As expected, HOXA11-AS1 knockdown and PD-L1antibody addition together further upregulated CD8+ T cell contents while downregulatingCD4+ T cell contents, suggesting the activation of T lymphocytes. Furthermore, the knock-down of HOXA11-AS1 or anti-PD-L1 treatment increased the concentration of IFN-γ, andHOXA11-AS1 silencing and PD-L1 antibody addition further promoted IFN-γ secretionby PBMCs (Figure 2F), further supporting our conclusion that HOXA11-AS1 facilitatesimmune escape in HSCC cells. Next, we analyzed the effects of HOXA11-AS1 knockdownon the proliferation and metastasis of HSCC cells using CCK-8 and colony formationassays. The results from the CCK-8 assay suggested that cell viability was reduced afterHOXA11-AS1 silencing (Figure 2G). Using a colony formation assay, we demonstratedthat HOXA11-AS1 silencing inhibited the colony formation (Figure 2H). Similarly, thecapabilities of cell migration and invasion were evaluated by wound healing and transwellassay, respectively. The results indicated that the capabilities of cell migration (Figure 2I)and invasion (Figure 2J) were repressed after HOXA11-AS1 knockdown. Taken together,HOXA11-AS1 promoted cell proliferation, metastasis, and immune escape by regulatingPD-L1 in vitro.
3.3. FOSL1 was Highly Expressed in HSCC Cells and Positively Regulated PD-L1 Expression byBinding the PD-L1 Promoter
The TCGA database predicted that FOSL1 was significantly expressed in head-and-neck cancers. Therefore, we explored its expression and potential pathway in HSCCcells. Using qRT-PCR, we found that FOSL1 was significantly elevated in HSCC tumorsamples (Figure 3A). Moreover, we found that HSCC patients with high expression ofFOSL1 exhibited a worse survival rate than those with low FOSL1 expression (Figure 3B).FOSL1 was also overexpressed in FaDu and Detroit 562 cells (Figure 3C). Then, FOSL1was successfully depleted by two plasmids, inducing the downregulation of PD-L1 in vitro(Figure 3D). We speculated that there may be a targeting relationship between FOSL1 andPD-L1. We found two binding sites between FOSL1 and the PD-L1 promoter, namely, BS1(−1420 to −1413 bp upstream of transcription start site (TSS)) and BS2 (−1864 to −1843 bpupstream of TSS). Their sequences are illustrated in Figure 3E. Subsequently, we foundthat FOSL1 only bound BS1 on the PD-L1 promoter and not BS2 (Figure 3F), as verified inFigure 3G. Compared to mutant BS1, FOSL1 was significantly bound to mutant BS2. Thesefindings demonstrated that FOSL1 transcriptionally regulated PD-L1 levels in HSCC cells.
Cancers 2022, 14, 3694 10 of 21Cancers 2022, 14, x 10 of 22
Figure 2. HOXA11-AS1 knockdown suppressed PD-L1 expression and immune escape, prolifera-
tion, and metastasis of HSCC cells. FaDu and Detroit cells were transfected with two specific
shRNAs, shHOXA11-AS1-1 and shHOXA11-AS1-2. (A) Transfection efficiencies were measured by
RT-qPCR. (B,C) PD-L1 levels were detected after silencing HOXA11-AS1 by Western blot and im-
munofluorescence. Anti-PD-L1 antibodies restored the cytotoxic effect of T lymphocytes. Treated
FaDu and Detroit cells were pretreated with or without anti-PD-L1 antibodies for 1 h and co-cul-
tured with PBMCs for 72 h(Representative images (400×) are shown, bars = 100 µm.), then (D)
the percentage of CD8+ and (E) CD4+ T cells was analyzed by flow cytometry, and (F) the concentra-
tion of IFN-γ was measured by enzyme-linked immunosorbent assay (ELISA). Viability, colony for-
mation, migration, and invasion of FaDu and Detroit cells were measured by (G) CCK-8, (H) colony
formation, (I) wound healing, and (J) transwell assays after knockdown of HOXA11-AS1. Repre-
sentative images (200×) are shown. * p < 0.05, ** p < 0.01, *** p < 0.001. Original Blots see Supple-
mentary File Figure S1.
3.3. FOSL1 was Highly Expressed in HSCC Cells and Positively Regulated PD-L1 Expression
by Binding the PD-L1 Promoter
The TCGA database predicted that FOSL1 was significantly expressed in head-and-
neck cancers. Therefore, we explored its expression and potential pathway in HSCC cells.
Using qRT-PCR, we found that FOSL1 was significantly elevated in HSCC tumor samples
(Figure 3A). Moreover, we found that HSCC patients with high expression of FOSL1 ex-
hibited a worse survival rate than those with low FOSL1 expression (Figure 3B). FOSL1
was also overexpressed in FaDu and Detroit 562 cells (Figure 3C). Then, FOSL1 was suc-
cessfully depleted by two plasmids, inducing the downregulation of PD-L1 in vitro (Fig-
ure 3D). We speculated that there may be a targeting relationship between FOSL1 and PD-
L1. We found two binding sites between FOSL1 and the PD-L1 promoter, namely, BS1
Figure 2. HOXA11-AS1 knockdown suppressed PD-L1 expression and immune escape, proliferation,and metastasis of HSCC cells. FaDu and Detroit cells were transfected with two specific shRNAs,shHOXA11-AS1-1 and shHOXA11-AS1-2. (A) Transfection efficiencies were measured by RT-qPCR.(B,C) PD-L1 levels were detected after silencing HOXA11-AS1 by Western blot and immunofluo-rescence. Anti-PD-L1 antibodies restored the cytotoxic effect of T lymphocytes. Treated FaDu andDetroit cells were pretreated with or without anti-PD-L1 antibodies for 1 h and co-cultured withPBMCs for 72 h (Representative images (400×) are shown, bars = 100 µm.), then (D) the percentage ofCD8+ and (E) CD4+ T cells was analyzed by flow cytometry, and (F) the concentration of IFN-γ wasmeasured by enzyme-linked immunosorbent assay (ELISA). Viability, colony formation, migration,and invasion of FaDu and Detroit cells were measured by (G) CCK-8, (H) colony formation, (I) woundhealing, and (J) transwell assays after knockdown of HOXA11-AS1. Representative images (200×)are shown. * p < 0.05, ** p < 0.01, *** p < 0.001. Original Blots see Supplementary File Figure S1.
3.4. HOXA11-AS1 Enhanced FOSL1 mRNA Stability by Binding PTBP1
Since HOXA11-AS1 and FOSL1 both contributed to the expression of PD-L1, wefocused on exploring their regulation. We firstly observed that FOSL1 levels decreased aftersilencing of HOXA11-AS1 (Figure 4A,B). To better investigate the function of HOXA11-AS1,we analyzed specific cellular fractions and found that HOXA11-AS1 was mainly distributedto the cytoplasm (Figure 4C), indicating that it may facilitate the expression of downstreamgenes at a post-transcriptional level. Therefore, we measured whether the FOSL1 mRNAstability was regulated by HOXA11-AS1. After actinomycin D treatment, we found thatHOXA11-AS1 knockdown shortened the half-life of FOSL1 mRNA (Figure 4D), suggestingthat HOXA11-AS1 stabilized it. Subsequently, Starbase predicted that both HOXA11-AS1
Cancers 2022, 14, 3694 11 of 21
and FOSL1 could bind PTBP1, indicating that PTBP1 may be involved in the regulationof FOSL1 as a specific protein partner of HOXA11-AS1. RNA pulldown and RIP assayswere carried out to confirm this speculation. As shown in Figure 4E,F, PTBP1 bound tothe sense of HOXA11-AS1 and FOSL1 mRNA, and the abundance of PTBP1 binding toHOXA11-AS1 and FOSL1 mRNA was much higher than that of the IgG group, identifyingthat PTBP1 could act as a binding protein of HOXA11-AS1 and FOSL1. Furthermore, PTBP1silencing induced the low expression of HOXA11-AS1 and FOSL1 in FaDu and Detroit562 cells (Figure 4G), as well as shortening the half-life of HOXA11-AS1 and FOSL1 mRNA(Figure 4H–I). These findings indicated a targeting relationship between HOXA11-AS1 andPTBP1 and validated the enhancement effect of HOXA11-AS1 on the interaction betweenPTBP1 and FOSL1 mRNA.
Cancers 2022, 14, x 11 of 22
(−1420 to −1413 bp upstream of transcription start site (TSS)) and BS2 (−1864 to −1843 bp
upstream of TSS). Their sequences are illustrated in Figure 3E. Subsequently, we found
that FOSL1 only bound BS1 on the PD-L1 promoter and not BS2 (Figure 3F), as verified in
Figure 3G. Compared to mutant BS1, FOSL1 was significantly bound to mutant BS2. These
findings demonstrated that FOSL1 transcriptionally regulated PD-L1 levels in HSCC cells.
Figure 3. FOSL1 was highly expressed in HSCC cells and positively regulated PD-L1 expression by
binding the PD-L1 promoter. (A) FOSL1 expression in HSCC and peri-carcinomatous samples was
tested by RT-qPCR. (B) Correlation between FOSL1 expression and HSCC patients’ survival rate.
(C) FOSL1 protein levels in HSCC cells measured by Western blot. (D) FaDu and Detroit 562 cells
were transfected with shFOSL1-1 and shFOSL1-2, and the expression of FOSL1 and PD-L1 was de-
tected by Western blot. (E) JASPAR was used to predict the binding sites between FOSL1 and the
promoter of PD-L1. (F,G) ChIP and dual-luciferase reporter assays were used to further validate the
regulatory relationship between FOSL1 and the PD-L1 promoter. * p < 0.05, ** p < 0.01, *** p < 0.001.
Original Blots see Supplementary File Figure S1.
3.4. HOXA11-AS1 Enhanced FOSL1 mRNA Stability by Binding PTBP1
Since HOXA11-AS1 and FOSL1 both contributed to the expression of PD-L1, we fo-
cused on exploring their regulation. We firstly observed that FOSL1 levels decreased after
silencing of HOXA11-AS1 (Figure 4A,B). To better investigate the function of HOXA11-
AS1, we analyzed specific cellular fractions and found that HOXA11-AS1 was mainly dis-
tributed to the cytoplasm (Figure 4C), indicating that it may facilitate the expression of
downstream genes at a post-transcriptional level. Therefore, we measured whether the
FOSL1 mRNA stability was regulated by HOXA11-AS1. After actinomycin D treatment,
we found that HOXA11-AS1 knockdown shortened the half-life of FOSL1 mRNA (Figure
4D), suggesting that HOXA11-AS1 stabilized it. Subsequently, Starbase predicted that
both HOXA11-AS1 and FOSL1 could bind PTBP1, indicating that PTBP1 may be involved
Figure 3. FOSL1 was highly expressed in HSCC cells and positively regulated PD-L1 expression bybinding the PD-L1 promoter. (A) FOSL1 expression in HSCC and peri-carcinomatous samples wastested by RT-qPCR. (B) Correlation between FOSL1 expression and HSCC patients’ survival rate.(C) FOSL1 protein levels in HSCC cells measured by Western blot. (D) FaDu and Detroit 562 cellswere transfected with shFOSL1-1 and shFOSL1-2, and the expression of FOSL1 and PD-L1 wasdetected by Western blot. (E) JASPAR was used to predict the binding sites between FOSL1 and thepromoter of PD-L1. (F,G) ChIP and dual-luciferase reporter assays were used to further validate theregulatory relationship between FOSL1 and the PD-L1 promoter. * p < 0.05, ** p < 0.01, *** p < 0.001.Original Blots see Supplementary File Figure S1.
Cancers 2022, 14, 3694 12 of 21
Cancers 2022, 14, x 12 of 22
in the regulation of FOSL1 as a specific protein partner of HOXA11-AS1. RNA pulldown
and RIP assays were carried out to confirm this speculation. As shown in Figure 4E,F,
PTBP1 bound to the sense of HOXA11-AS1 and FOSL1 mRNA, and the abundance of
PTBP1 binding to HOXA11-AS1 and FOSL1 mRNA was much higher than that of the IgG
group, identifying that PTBP1 could act as a binding protein of HOXA11-AS1 and FOSL1.
Furthermore, PTBP1 silencing induced the low expression of HOXA11-AS1 and FOSL1 in
FaDu and Detroit 562 cells (Figure 4G), as well as shortening the half-life of HOXA11-AS1
and FOSL1 mRNA (Figure 4H–I). These findings indicated a targeting relationship be-
tween HOXA11-AS1 and PTBP1 and validated the enhancement effect of HOXA11-AS1
on the interaction between PTBP1 and FOSL1 mRNA.
Figure 4. HOXA11-AS1 enhanced FOSL1 mRNA stability by binding PTBP1. (A,B) FOSL1 levelswere evaluated after HOXA11-AS1 knockdown using RT-qPCR and Western blot, respectively.(C) The cytoplasm and nucleus of FaDU cells were collected to measure the fraction of HOXA11-AS1.(D) FOSL1 mRNA decay in FaDu and Detroit cells measured after treating with actinomycin D(ACD) after HOXA11-AS1 knockdown. (E) Protein analysis of PTBP1 after RNA pulldown withbiotin-labeled sense or antisense HOXA11-AS1 or FOSL1. (F) RIP assay was performed to measurethe binding abundance of PTBP1 and FOSL1 mRNA or HOXA11-AS1. FaDu and Detroit cells weretransfected with sh-PTBP1, then (G) PTBP1, FOSL1, and HOXA11-AS1 levels were evaluated byRT-qPCR, and (H) FOSL1 and (I) HOXA11-AS1 mRNA decay was measured after ACD treatment.* p < 0.05, ** p < 0.01, *** p < 0.001. Original Blots see Supplementary File Figure S1.
Cancers 2022, 14, 3694 13 of 21
3.5. HOXA11-AS1 Promoted PD-L1 Expression by Upregulating FOSL1 Levels through PTBP1,Thereby Facilitating Cell Immune Escape, Growth, and Metastasis
To further investigate the role of the HOXA11-AS1/PTBP1/FOSL1 axis on the regula-tion of PD-L1 and its biological function in vitro, we firstly stably overexpressed HOXA11-AS1 or PTBP1 by lentiviral transfection. The overexpression of HOXA11-AS1 or PTBP1increased PTBP1, FOSL1, and PD-L1 levels in FaDu and Detroit 562 cells (Figure 5A,B).Then, shRNA against PTBP1 was used to silence PTBP levels. As expected, PTBP1 knock-down decreased the expression of PTBP1, FOSL1, and PD-L1, and more importantly, itpartially reversed the upregulation of FOSL1 and PD-L1 caused by HOXA11-AS1 overex-pression (Figure 5C). Interestingly, PD-L1 knockdown was subsequently used to exert thesame reverse effects on the high expression of PD-L1 caused by HOXA11-AS1 overexpres-sion, while the increased PTBP1 and FOSL1 levels showed no changes (Figure 5D). Thesedata demonstrated that HOXA11-AS1 regulated PD-L1 by facilitating the association ofPTBP1 with FOSL1. Since HOXA11-AS1 promoted PD-L1 levels, proliferation, metastasis,and immune escape in HSCC cells, we investigated the regulation mechanism of PD-L1in HOXA11-AS1-overexpressed cells. As shown in Figure 5E, HOXA11-AS1 overexpres-sion decreased CD8+ T cell percentages while increasing CD4+ T cell percentages. Theknockdown of PD-L1 led to the opposite results and partially reversed the increase inT lymphocytes induced by HOXA11-AS1 overexpression. Moreover, PD-L1 knockdownincreased the concentration of IFN-γ that was reduced by HOXA11-AS1 overexpression(Figure 5F), indicating that HOXA11-AS1 facilitated immune escape in HSCC cells by regu-lating PD-L1. Similarly, HOXA11-AS1 enhancement facilitated cell proliferation, migration,and invasion, while these effects were reversed by PD-L1 knockdown (Figure 5G–J). There-fore, we confirmed the role of the HOXA11-AS1/PD-L1/PTBP1/FOSL1 axis in promotingHSCC progression in vitro.
3.6. HOXA11-AS1 Knockdown Inhibited Immune Escape and Metastasis by Regulating PD-L1and Downregulating FOSL1 In Vivo
To assess the anti-tumor effect of HOXA11-AS1 knockdown in vivo, PBMCs werefirstly injected into NOD-SCID mice to establish a human immune system. Then, FaDuand Detroit 562 cells stably expressing shNC, shHOXA11-AS1-1, or shHOXA11-AS1-2were subcutaneously injected into mice. We observed that, after silencing HOXA11-AS1or treatment with PBMCs, the pathological degree and proliferation of the tumor and theexpressions of PD-L1 and Ki-67 were reduced, while these effects were further enhancedby the knockdown of HOXA11-AS1 and the addition of PBMCs together (Figure 6A,B),indicating the effective anti-tumor role of HOXA11-AS1 deletion in vivo. The resultssuggested that tumors shrank after HOXA11-AS1 knockdown (Figure 6C), indicating thatthe inhibiting effect of T cells on tumor cells could be restored by HOXA11-AS1 knockdown.
Furthermore, we observed the decreased volume and weight of tumors after silencingHOXA11-AS1 (Figure 6D–F). Then, PTBP1, FOSL1, and PD-L1 levels decreased in vivoafter HOXA11-AS1 knockdown (Figure 6G). Moreover, tumor metastasis capability wasalso affected by the depletion of HOXA11-AS1. As shown in Figure 6H–I, HOXA11-AS1 knockdown impaired the ability of the tumor to metastasize to the lung. Overall,the depletion of HOXA11-AS1 combined with PD-L1 blocking showed a more effectivefunction in the inhibition of HSCC progression in vivo.
Cancers 2022, 14, 3694 15 of 21Cancers 2022, 14, x 15 of 22
Figure 5. HOXA11-AS1 promoted PD-L1 expression by upregulating FOSL1 levels through PTBP1,
thereby facilitating immune escape, growth, and metastasis of HSCC cells. FaDu and Detroit cells
were transfected with pcDNA3.1-HOXA11-AS1 (HOXA11-AS1), pcDNA3.1-PTBP1 (PTBP1), sh-
PTBP1, sh-PD-L1, or a combination of HOXA11-AS1 + sh-PTBP1 and HOXA11-AS1 + sh-PD-L1: (A)
HOXA11-AS1, FOSL1, and PD-L1 levels were measured in FaDu and Detroit 562 cells treated with
HOXA11-AS1 plasmid. (B) Relative expression of PTBP1, FOSL1, and PD-L1 was evaluated after
overexpressing PTBP1. (C) Relative levels of PTBP1, FOSL1, and PD-L1 in HOXA11-AS1, shPTBP1,
or HOXA11-AS1 + shPTBP1 groups. FaDu and Detroit cells were transfected with HOXA11-AS1,
Figure 5. HOXA11-AS1 promoted PD-L1 expression by upregulating FOSL1 levels through PTBP1,thereby facilitating immune escape, growth, and metastasis of HSCC cells. FaDu and Detroit cells weretransfected with pcDNA3.1-HOXA11-AS1 (HOXA11-AS1), pcDNA3.1-PTBP1 (PTBP1), sh-PTBP1, sh-PD-L1, or a combination of HOXA11-AS1 + sh-PTBP1 and HOXA11-AS1 + sh-PD-L1: (A) HOXA11-AS1,FOSL1, and PD-L1 levels were measured in FaDu and Detroit 562 cells treated with HOXA11-AS1plasmid. (B) Relative expression of PTBP1, FOSL1, and PD-L1 was evaluated after overexpressing PTBP1.
Cancers 2022, 14, 3694 16 of 21
(C) Relative levels of PTBP1, FOSL1, and PD-L1 in HOXA11-AS1, shPTBP1, or HOXA11-AS1 + sh-PTBP1 groups. FaDu and Detroit cells were transfected with HOXA11-AS1, shPD-L1, or a combi-nation of HOXA11-AS1 + shPD-L1: (D) Relative expression of PTBP1, FOSL1, and PD-L1 in cellstransfected with HOXA11-AS1, sh-PD-L1, or HOXA11-AS1 + sh-PD-L1. Then, (E) the percentageof CD8+ and CD4+ T cells and (F) the concentration of IFN-γ were measured by flow cytome-try and ELISA, respectively, and (G–J) the viability, colony formation, migration, and invasion oftreated HSCC cells were analyzed by CCK-8, colony formation, wound healing, and transwell assays.Representative images (200×) are shown. * p < 0.05, ** p < 0.01, *** p < 0.001. Original Blots seeSupplementary File Figure S1.
Cancers 2022, 14, x 17 of 22
Figure 6. Cont.
Cancers 2022, 14, 3694 17 of 21Cancers 2022, 14, x 18 of 22
Figure 6. HOXA11-AS1 knockdown inhibited immune escape and metastasis by regulating PD-L1
and downregulating FOSL1 in vivo. FaDu and Detroit cells stably expressing shNC, shHOXA11-
AS1-1, or shHOXA11-AS1-2 were injected subcutaneously into NOD-SCID mice to establish xeno-
graft models. PBS or PBMCs were intraperitoneally injected into NOD-SCID mice to kill the xeno-
grafts more effectively. (A) HE, Ki67, and IHC staining were used to measure the tumor pathology,
proliferation, and PD-L1 expression of xenografts treated with or without PBMCs or PBC. (B) The
percentage of Ki67 cells was evaluated in xenografts. (C) The cytotoxic effect of treatment with or
without PBMCs or PBS was measured by calculating xenograft volumes in shNC, shHOXA11-AS1-
1, and shHOXA11-AS1-2 xenografts, and results are shown in the bar chart as tumor regression rate.
(D–F) Tumor volume and weight were detected after HOXA11-AS1 knockdown in vivo. (G) RT-
qPCR was used to detect HOXA11-AS levels, and Western blot was used to measure the expression
of PD-L1, FOSL1, and PTBP1 after HOXA11-AS1 knockdown. (H–I) The ability of metastasis to the
lung, tumor pathology, and nodule numbers of lung metastases were measured after of HOXA11-
AS1 knockdown. * p < 0.05, ** p < 0.01, *** p < 0.001. Original Blots see Supplementary File S1.
Furthermore, we observed the decreased volume and weight of tumors after silenc-
ing HOXA11-AS1 (Figure 6D–F). Then, PTBP1, FOSL1, and PD-L1 levels decreased in vivo
after HOXA11-AS1 knockdown (Figure 6G). Moreover, tumor metastasis capability was
also affected by the depletion of HOXA11-AS1. As shown in Figure 6H–I, HOXA11-AS1
knockdown impaired the ability of the tumor to metastasize to the lung. Overall, the de-
pletion of HOXA11-AS1 combined with PD-L1 blocking showed a more effective function
in the inhibition of HSCC progression in vivo.
4. Discussion
One of the most difficult challenges during HSCC treatment is the invasion and me-
tastasis to adjacent structures due to extensive lymphatic drainage [27,28]. Therefore, the
investigation of new therapeutic targets has had a high profile in recent years. LncRNAs
and their related mechanisms have also been extensively explored and are involved in
many processes of cancer development, such as proliferation, differentiation, and metas-
tasis [29–32]. Additionally, since PD-L1 is often reported to be overexpressed in malignant
tumors and, mechanically, it helps cancer cells evade recognition by the host immune sys-
tem, it has also become the focus of oncologic research [33,34]. Previous studies have re-
ported the immunopathogenic effect and cancer-intrinsic function of PD-L1 in HSCC
[13,35]; however, the contribution of PD-L1 to pathogenesis still needs further discussion
Figure 6. HOXA11-AS1 knockdown inhibited immune escape and metastasis by regulating PD-L1and downregulating FOSL1 in vivo. FaDu and Detroit cells stably expressing shNC, shHOXA11-AS1-1, or shHOXA11-AS1-2 were injected subcutaneously into NOD-SCID mice to establish xenograftmodels. PBS or PBMCs were intraperitoneally injected into NOD-SCID mice to kill the xenograftsmore effectively. (A) HE, Ki67, and IHC staining were used to measure the tumor pathology, pro-liferation, and PD-L1 expression of xenografts treated with or without PBMCs or PBC. (B) Thepercentage of Ki67 cells was evaluated in xenografts. (C) The cytotoxic effect of treatment with orwithout PBMCs or PBS was measured by calculating xenograft volumes in shNC, shHOXA11-AS1-1,and shHOXA11-AS1-2 xenografts, and results are shown in the bar chart as tumor regression rate.(D–F) Tumor volume and weight were detected after HOXA11-AS1 knockdown in vivo. (G) RT-qPCRwas used to detect HOXA11-AS levels, and Western blot was used to measure the expression ofPD-L1, FOSL1, and PTBP1 after HOXA11-AS1 knockdown. (H,I) The ability of metastasis to the lung,tumor pathology, and nodule numbers of lung metastases were measured after of HOXA11-AS1knockdown. * p < 0.05, ** p < 0.01, *** p < 0.001. Original Blots see Supplementary File S1.
4. Discussion
One of the most difficult challenges during HSCC treatment is the invasion and metas-tasis to adjacent structures due to extensive lymphatic drainage [27,28]. Therefore, theinvestigation of new therapeutic targets has had a high profile in recent years. LncRNAsand their related mechanisms have also been extensively explored and are involved in manyprocesses of cancer development, such as proliferation, differentiation, and metastasis [29–32].Additionally, since PD-L1 is often reported to be overexpressed in malignant tumors and,mechanically, it helps cancer cells evade recognition by the host immune system, it hasalso become the focus of oncologic research [33,34]. Previous studies have reported theimmunopathogenic effect and cancer-intrinsic function of PD-L1 in HSCC [13,35]; however,the contribution of PD-L1 to pathogenesis still needs further discussion overall. In thisstudy, HOXA11-AS1 knockdown suppressed immune escape and metastasis in HSCC bydownregulating PD-L1 levels and inhibiting the interaction between FOSL1 and PTBP1.
In recent years, the function of lncRNAs in HSCC has attracted increasing attention.For instance, lncRNA PEG10 was highly expressed in HSCC, and lncRNA PEG10 overex-pression facilitated cell proliferation and metastasis in vitro [36]. HOXA11-AS was one of
Cancers 2022, 14, 3694 18 of 21
the most overexpressed lncRNAs in HSCC and was positively associated with lymph nodemetastasis [23]. We selected HOXA11-AS1 as our research object since it was upregulatedin HSCC, as suggested by microarray analysis. The high expression of HOXA11-AS1 wasmeasured both in tissues and cells. Functionally, HOXA11-AS1 silencing suppressed cellgrowth, metastasis, and the immune escape of HSCC cells to CD8+ T cells, which was akey inducement for tumor progression. Interestingly, we observed that PD-L1 expressionpositively correlated with HOXA11-AS1. The regulatory relationship between lncRNAsand PD-L1 had been reported in previous tumor-related studies [37,38]. For example,SNHG14 induced the inactivation of CD8+ T cells and the promotion of immune escape ofdiffuse large B cell lymphoma cells by activating PD-L1 [39]. This is consistent with ourfindings that the elimination of HOXA11-AS1 combined with PD-L1 antibody more effec-tively upregulated the content of CD8+ T cells in vitro, suggesting an association betweenHOXA11-AS1 and PD-L1 immune checkpoint for the first time in HSCC.
Exploring the biological targets related to HOXA11-AS1 or PD-L1 can better clarifythe molecular mechanisms of HSCC and contribute to the development of HOXA11-AS1clinical applications. Our findings indicated that FOSL1 bound the PD-L1 promoter andpositively regulated its expression in vitro. FOSL1 was reported to act as an oncogene ina variety of cancers, and the tumor-intrinsic functions of FOSL1 have been widely inves-tigated [40]. For instance, the FOSL1 transcription factor had been demonstrated to be amajor effector of the RAS-ERK1/2 pathway and could increase the metastatic capability oflung cancer by activating epithelial–mesenchymal transition [41]. Our findings revealedother possible functions of FOSL1 in tumors, such as the promoting effect on the immuneescape of tumor cells, by demonstrating an interaction between FOSL1 and PD-L1. PTBP1is an RNA-binding protein that can shuttle from the nucleus to the cytoplasm, performingdifferent functions mainly including mediating localization, translation initiation, andmaintenance of mRNA stability [42,43]. In this study, HOXA11-AS1 was observed to bemostly distributed in the cytoplasm and bound to PTBP1, enhancing the stability of FOSL1mRNA. This indicated that HOXA11-AS1 promoted the association of PTBP1 with FOSL1.Previous studies had suggested a similar function of other lncRNAs. Li et al. indicatedthat the lncRNA ANCR reduced the differentiation ability of human adipose-derived mes-enchymal stem cells to definitive endoderm by enhancing the interaction between PTBP1and ID2 [44]. Functionally, we found that PTBP1 silencing could reverse the upregulationeffect of HOXA11-AS1 overexpression on FOSL1 and PD-L1. More importantly, PD-L1knockdown blocked the inhibiting effect on CD8+ T cells and the promoting effect onHSCC cell growth and metastasis induced by HOXA11-AS1 overexpression. Therefore, weconcluded that HOXA11-AS1 promoted the immune escape and metastasis of HSCC cellsby upregulating PD-L1 and increasing the interaction between PTBP1 and FOSL1. To acertain extent, the role of this novel pathway had also been confirmed in vivo.
Due to the limitations of practical factors, in this study, the quantity of samples is notvery high, and the applications of cell lines are not rich enough. We will conduct morecomprehensive and accurate experiments in the future after more samples are collected andsuitable new cell lines emerge. In any case, HOXA11-AS1 knockdown led to the decline ofPD-L1 and inhibited the proliferation and metastasis of HSCC, which may also be affectedby other factors, which is the key research to be explored in the future.
5. Conclusions
Overall, our findings demonstrated a positive regulatory relationship between HOXA11-AS1 and PD-L1. HOXA11-AS1 knockdown suppressed PD-L1-mediated immune escapeand metastasis by reducing the association between PTBP1 and FOSL1 in HSCC, providinga theoretical basis for HOXA11-AS1 as a potential prognostic marker for HSCC diagnosisand treatment.
Cancers 2022, 14, 3694 19 of 21
Supplementary Materials: The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/cancers14153694/s1. Table S1. Association of HSCC characteristicsand HOXA11-AS1 expression; Table S2. Univariate analysis of prognostic factors of HSCC patients(n = 40). Table S3. Multivariate analysis of independent prognostic factors of HSCC patients (n = 40).Figure S1: original western blot bands in figures.
Author Contributions: Conceptualization, G.T. and X.Z.; methodology, Z.Z.; software, Q.L.; valida-tion, D.M., S.A. and Z.Z.; formal analysis, G.Z.; investigation, D.M.; resources, G.Z.; data curation,S.A.; writing—original draft preparation, X.Z.; writing—review and editing, G.T.; visualization, Z.Z.;supervision, G.T.; project administration, X.Z.; funding acquisition, X.Z. All authors have read andagreed to the published version of the manuscript.
Funding: This work was supported by the Hunan Youth Talents Project (No.2020).
Institutional Review Board Statement: Forty samples of HSCC and matched peri-carcinomatousspecimens were obtained from patients with HSCC who did not receive radiotherapy or chemother-apy at the Third Xiangya Hospital of Central South University from January 2016 to June 2020. Allsamples were stored at −80 ◦C until analysis. The study was approved by the Ethics Committee ofthe Third Xiangya Hospital of Central South University, and all subjects signed written informedconsent. All animal experiments were approved by the Animal Ethics Committee of Third XiangyaHospital of Central South University.
Informed Consent Statement: Informed consent was obtained from study participants.
Data Availability Statement: All data generated or analyzed during this study are included in thispublished article.
Acknowledgments: We would like to give our sincere gratitude to the reviewers for their construc-tive comments.
Conflicts of Interest: The authors have no commercial or other associations that might pose a conflictof interest.
References1. Cooper, J.S.; Porter, K.; Mallin, K.; Hoffman, H.T.; Weber, R.S.; Ang, K.K.; Gay, E.G.; Langer, C.J. National Cancer Database report
on cancer of the head and neck: 10-year update. Head Neck 2009, 31, 748–758. [CrossRef] [PubMed]2. Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN
Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [CrossRef][PubMed]
3. Sewnaik, A.; Hoorweg, J.J.; Knegt, P.P.; Wieringa, M.H.; van der Beek, J.M.; Kerrebijn, J.D. Treatment of hypopharyngealcarcinoma: Analysis of nationwide study in the Netherlands over a 10-year period. Clin. Otolaryngol. 2005, 30, 52–57. [CrossRef][PubMed]
4. Tsou, Y.A.; Lin, M.H.; Hua, C.H.; Tseng, H.C.; Chen, S.W.; Yang, S.N.; Liang, J.A.; Tsai, M.H. Survival outcome by earlychemoradiation therapy salvage or early surgical salvage for the treatment of hypopharyngeal cancer. Otolaryngol. Head NeckSurg. 2007, 137, 711–716. [CrossRef]
5. Wycliffe, N.D.; Grover, R.S.; Kim, P.D.; Simental, A., Jr. Hypopharyngeal cancer. Top. Magn. Reson. Imaging 2007, 18, 243–258.[CrossRef]
6. Topalian, S.L.; Drake, C.G.; Pardoll, D.M. Targeting the PD-1/B7-H1(PD-L1) pathway to activate anti-tumor immunity. Curr.Opin. Immunol. 2012, 24, 207–212. [CrossRef]
7. Zou, W.; Chen, L. Inhibitory B7-family molecules in the tumour microenvironment. Nat. Rev. Immunol. 2008, 8, 467–477.[CrossRef]
8. Han, Y.; Liu, D.; Li, L. PD-1/PD-L1 pathway: Current researches in cancer. Am. J. Cancer Res. 2020, 10, 727–742.9. Lenouvel, D.; Gonzalez-Moles, M.A.; Ruiz-Avila, I.; Chamorro-Santos, C.; Gonzalez-Ruiz, L.; Gonzalez-Ruiz, I.; Ramos-Garcia, P.
Clinicopathological and prognostic significance of PD-L1 in oral cancer: A preliminary retrospective immunohistochemistrystudy. Oral Dis. 2021, 27, 173–182. [CrossRef]
10. Pardoll, D.M. The blockade of immune checkpoints in cancer immunotherapy. Nat. Rev. Cancer 2012, 12, 252–264. [CrossRef]11. Wintterle, S.; Schreiner, B.; Mitsdoerffer, M.; Schneider, D.; Chen, L.; Meyermann, R.; Weller, M.; Wiendl, H. Expression of the
B7-related molecule B7-H1 by glioma cells: A potential mechanism of immune paralysis. Cancer Res. 2003, 63, 7462–7467.12. Hodgson, A.; Slodkowska, E.; Jungbluth, A.; Liu, S.K.; Vesprini, D.; Enepekides, D.; Higgins, K.; Katabi, N.; Xu, B.; Downes, M.R.
PD-L1 Immunohistochemistry Assay Concordance in Urothelial Carcinoma of the Bladder and Hypopharyngeal Squamous CellCarcinoma. Am. J. Surg. Pathol. 2018, 42, 1059–1066. [CrossRef]
Cancers 2022, 14, 3694 20 of 21
13. Cui, P.; Jing, P.; Liu, X.; Xu, W. Prognostic Significance of PD-L1 Expression and Its Tumor-Intrinsic Functions in HypopharyngealSquamous Cell Carcinoma. Cancer Manag. Res. 2020, 12, 5893–5902. [CrossRef]
14. Hanna, G.J.; O’Neill, A.; Shin, K.Y.; Wong, K.; Jo, V.Y.; Quinn, C.T.; Cutler, J.M.; Flynn, M.; Lizotte, P.H.; Annino, D.J., Jr.; et al.Neoadjuvant and Adjuvant Nivolumab and Lirilumab in Patients with Recurrent, Resectable Squamous Cell Carcinoma of theHead and Neck. Clin. Cancer Res. 2022, 28, 468–478. [CrossRef]
15. Desmet, C.J.; Gallenne, T.; Prieur, A.; Reyal, F.; Visser, N.L.; Wittner, B.S.; Smit, M.A.; Geiger, T.R.; Laoukili, J.; Iskit, S.; et al.Identification of a pharmacologically tractable Fra-1/ADORA2B axis promoting breast cancer metastasis. Proc. Natl. Acad. Sci.USA 2013, 110, 5139–5144. [CrossRef]
16. Xu, L.; Hu, H.; Zheng, L.S.; Wang, M.Y.; Mei, Y.; Peng, L.X.; Qiang, Y.Y.; Li, C.Z.; Meng, D.F.; Wang, M.D.; et al. ETV4 is atheranostic target in clear cell renal cell carcinoma that promotes metastasis by activating the pro-metastatic gene FOSL1 in aPI3K-AKT dependent manner. Cancer Lett. 2020, 482, 74–89. [CrossRef]
17. Cui, Y.P.; Xie, M.; Pan, W.X.; Zhang, Z.Y.; Li, W.F. HOXA10 promotes the development of bladder cancer through regulatingFOSL1. Eur. Rev. Med. Pharmacol. Sci. 2020, 24, 2945–2954. [CrossRef]
18. Chan, J.J.; Tay, Y. Noncoding RNA:RNA Regulatory Networks in Cancer. Int. J. Mol. Sci. 2018, 19, 1310. [CrossRef]19. Ren, X. Genome-wide analysis reveals the emerging roles of long non-coding RNAs in cancer. Oncol. Lett. 2020, 19, 588–594.
[CrossRef]20. Qian, Y.; Liu, D.; Cao, S.; Tao, Y.; Wei, D.; Li, W.; Li, G.; Pan, X.; Lei, D. Upregulation of the long noncoding RNA UCA1 affects the
proliferation, invasion, and survival of hypopharyngeal carcinoma. Mol. Cancer 2017, 16, 68. [CrossRef]21. Cheng, Y.; Xiong, H.Y.; Li, Y.M.; Zuo, H.R.; Liu, Y.; Liao, G.L. LncRNA HOXA11-AS promotes cell growth by sponging miR-24-3p
to regulate JPT1 in prostate cancer. Eur. Rev. Med. Pharmacol. Sci. 2021, 25, 4668–4677. [CrossRef]22. Bai, Y.; Lang, L.; Zhao, W.; Niu, R. Long Non-Coding RNA HOXA11-AS Promotes Non-Small Cell Lung Cancer Tumorigenesis
Through microRNA-148a-3p/DNMT1 Regulatory Axis. Onco Targets Ther. 2019, 12, 11195–11206. [CrossRef]23. Xu, J.; Bo, Q.; Zhang, X.; Lei, D.; Wang, J.; Pan, X. lncRNA HOXA11-AS Promotes Proliferation and Migration via Sponging
miR-155 in Hypopharyngeal Squamous Cell Carcinoma. Oncol. Res. 2020, 28, 311–319. [CrossRef]24. Zhu, W.; Zhou, B.L.; Rong, L.J.; Ye, L.; Xu, H.J.; Zhou, Y.; Yan, X.J.; Liu, W.D.; Zhu, B.; Wang, L.; et al. Roles of PTBP1 in alternative
splicing, glycolysis, and oncogensis. J. Zhejiang Univ. Sci. B 2020, 21, 122–136. [CrossRef]25. Huan, L.; Guo, T.; Wu, Y.; Xu, L.; Huang, S.; Xu, Y.; Liang, L.; He, X. Hypoxia induced LUCAT1/PTBP1 axis modulates cancer cell
viability and chemotherapy response. Mol. Cancer 2020, 19, 11. [CrossRef]26. Iwai, Y.; Ishida, M.; Tanaka, Y.; Okazaki, T.; Honjo, T.; Minato, N. Involvement of PD-L1 on tumor cells in the escape from host
immune system and tumor immunotherapy by PD-L1 blockade. Proc. Natl. Acad. Sci. USA 2002, 99, 12293–12297. [CrossRef]27. Wahlberg, P.C.; Andersson, K.E.; Biorklund, A.T.; Moller, T.R. Carcinoma of the hypopharynx: Analysis of incidence and survival
in Sweden over a 30-year period. Head Neck 1998, 20, 714–719. [CrossRef]28. Zhang, X.; Zhang, Y.; Yu, X.; Sun, Y.; Miao, S.; Liu, S.; Li, Z.; Yi, J.; An, C. Different Primary Sites of Hypopharyngeal Cancer Have
Different Lymph Node Metastasis Patterns: A Retrospective Analysis From Multi-Center Data. Front. Oncol. 2021, 11, 727991.[CrossRef]
29. Prensner, J.R.; Chinnaiyan, A.M. The emergence of lncRNAs in cancer biology. Cancer Discov. 2011, 1, 391–407. [CrossRef]30. Gutschner, T.; Diederichs, S. The hallmarks of cancer: A long non-coding RNA point of view. RNA Biol. 2012, 9, 703–719.
[CrossRef]31. Zhou, J.; Li, W.; Jin, T.; Xiang, X.; Li, M.; Wang, J.; Li, G.; Pan, X.; Lei, D. Gene microarray analysis of lncRNA and mRNA
expression profiles in patients with hypopharyngeal squamous cell carcinoma. Int. J. Clin. Exp. Med. 2015, 8, 4862–4882.[PubMed]
32. Zhou, J.; Li, M.; Yu, W.; Li, W.; Wang, J.; Xiang, X.; Li, G.; Pan, X.; Lei, D. AB209630, a long non-coding RNA decreased expressionin hypopharyngeal squamous cell carcinoma, influences proliferation, invasion, metastasis, and survival. Oncotarget 2016, 7,14628–14638. [CrossRef] [PubMed]
33. Pauken, K.E.; Wherry, E.J. Overcoming T cell exhaustion in infection and cancer. Trends Immunol. 2015, 36, 265–276. [CrossRef][PubMed]
34. Dermani, F.K.; Samadi, P.; Rahmani, G.; Kohlan, A.K.; Najafi, R. PD-1/PD-L1 immune checkpoint: Potential target for cancertherapy. J. Cell. Physiol. 2019, 234, 1313–1325. [CrossRef]
35. Hu, C.; Tian, S.; Lin, L.; Zhang, J.; Ding, H. Prognostic and clinicopathological significance of PD-L1 and tumor infiltratinglymphocytes in hypopharyngeal squamous cell carcinoma. Oral Oncol. 2020, 102, 104560. [CrossRef]
36. Zhao, M.; Sun, D.; Li, X.; Xu, Y.; Zhang, H.; Qin, Y.; Xia, M. Overexpression of long noncoding RNA PEG10 promotes proliferation,invasion and metastasis of hypopharyngeal squamous cell carcinoma. Oncol. Lett. 2017, 14, 2919–2925. [CrossRef]
37. Ashrafizadeh, M.; Zarrabi, A.; Hushmandi, K.; Zarrin, V.; Moghadam, E.R.; Zabolian, A.; Tavakol, S.; Samarghandian, S.; Najafi,M. PD-1/PD-L1 axis regulation in cancer therapy: The role of long non-coding RNAs and microRNAs. Life Sci. 2020, 256, 117899.[CrossRef]
38. Mineo, M.; Lyons, S.M.; Zdioruk, M.; von Spreckelsen, N.; Ferrer-Luna, R.; Ito, H.; Alayo, Q.A.; Kharel, P.; Giantini Larsen, A.;Fan, W.Y.; et al. Tumor Interferon Signaling Is Regulated by a lncRNA INCR1 Transcribed from the PD-L1 Locus. Mol. Cell 2020,78, 1207–1223. [CrossRef]
Cancers 2022, 14, 3694 21 of 21
39. Zhao, L.; Liu, Y.; Zhang, J.; Liu, Y.; Qi, Q. LncRNA SNHG14/miR-5590-3p/ZEB1 positive feedback loop promoted diffuse largeB cell lymphoma progression and immune evasion through regulating PD-1/PD-L1 checkpoint. Cell Death Dis. 2019, 10, 731.[CrossRef]
40. Jiang, X.; Xie, H.; Dou, Y.; Yuan, J.; Zeng, D.; Xiao, S. Expression and function of FRA1 protein in tumors. Mol. Biol. Rep. 2020, 47,737–752. [CrossRef]
41. Elangovan, I.M.; Vaz, M.; Tamatam, C.R.; Potteti, H.R.; Reddy, N.M.; Reddy, S.P. FOSL1 Promotes Kras-induced Lung Cancerthrough Amphiregulin and Cell Survival Gene Regulation. Am. J. Respir. Cell Mol. Biol. 2018, 58, 625–635. [CrossRef]
42. Knoch, K.P.; Bergert, H.; Borgonovo, B.; Saeger, H.D.; Altkruger, A.; Verkade, P.; Solimena, M. Polypyrimidine tract-bindingprotein promotes insulin secretory granule biogenesis. Nat. Cell Biol. 2004, 6, 207–214. [CrossRef]
43. Sawicka, K.; Bushell, M.; Spriggs, K.A.; Willis, A.E. Polypyrimidine-tract-binding protein: A multifunctional RNA-bindingprotein. Biochem. Soc. Trans. 2008, 36, 641–647. [CrossRef]
44. Li, J.; Yang, Y.; Fan, J.; Xu, H.; Fan, L.; Li, H.; Zhao, R.C. Long noncoding RNA ANCR inhibits the differentiation of mesenchymalstem cells toward definitive endoderm by facilitating the association of PTBP1 with ID2. Cell Death Dis. 2019, 10, 492. [CrossRef]