Unique conjugation mechanism in mycelial streptomycetes: a DNA-binding ATPase translocates...

Unique conjugation mechanism in mycelialstreptomycetes: a DNA-binding ATPase translocatesunprocessed plasmid DNA at the hyphal tip

Jens Reuther, Cordula Gekeler, Yvonne Tiffert,Wolfgang Wohlleben and Günther Muth*Mikrobiologie/Biotechnologie, Mikrobiologisches Institut,Fakultaet für Biologie, Eberhard Karls UniversitaetTuebingen, Auf der Morgenstelle 28, 72076 Tuebingen,Germany.

Summary

A single plasmid-encoded protein, the septal DNAtranslocator TraB, is sufficient to promote conjugalplasmid transfer in mycelial streptomycetes. Toanalyse the molecular mechanism of conjugation theclosely related TraB proteins from plasmids pSG5 ofStreptomyces ghanaensis and pSVH1 of Streptomy-ces venezuelae were characterized. TraB of pSG5 wasexpressed as a fusion protein with eGFP and found tobe localized at the hyphal tips of Streptomyces liv-idans by fluorescence microscopy, which stronglyindicates that conjugation takes place at the tips ofthe mating mycelium. The TraB protein of pSVH1 washeterologously expressed in S. lividans with anN-terminal strep-tagII and purified as a soluble proteinto near homogeneity. The purified protein was shownto hydrolyse ATP and to bind to a 50 bp non-codingpSVH1 sequence containing a 14 bp direct repeat.The protein–DNA complex was too large to enter anagarose gel, indicating that multimers of TraB werebound to the DNA. Denaturation of the protein–DNAcomplex released unprocessed plasmid DNA demon-strating that the TraB protein does not possessnicking activity. Our experimental data provide evi-dence that conjugal DNA transfer in streptomycetesis mediated by the septal DNA translocator TraB,an plasmid-encoded ATPase that interacts non-covalently with DNA and translocates an unproc-essed double-stranded DNA molecule at the hyphaltip into the recipient.

Introduction

Actinomycetes, Gram-positive mycelial soil bacteria thatundergo a complex morphological differentiation, are themost important producers of antibiotics (Hopwood et al.,1995). As the biosynthetic gene clusters contain similarresistance determinants to those found in pathogenic bac-teria, actinomycetes are regarded as the natural source ofantibiotic resistance genes (D’Costa et al., 2006). Simul-taneously with the evolution of antibiotic biosyntheticpathways, resistance genes were presumably developedto protect the producing organism from the toxic action ofits own antibiotic. The resistance determinants subse-quently found in pathogenic bacteria may have resultedfrom horizontal gene transfer (Grohmann et al., 2003).

Mycelial streptomycetes possess a conjugation system,distinct from DNA transfer systems of unicellular Gram-positive and Gram-negative bacteria. Conjugative Strep-tomyces plasmids are transferred to a plasmid-freerecipient with an efficiency up to 100% (Kieser et al.,1982; Kataoka et al., 1991). During plasmid transfer chro-mosomal markers are mobilized at a frequency of 0.1–1%(Hopwood et al., 1985). Genetic experiments with theintegrative pSAM2 plasmid indicated the transfer ofdouble-stranded pSAM2 DNA during Streptomyces con-jugation (Possoz et al., 2001). A single plasmid-encodedprotein (TraB) is required for the conjugal transfer of cir-cular plasmids. While plasmid transfer requires in additionto traB a small non-coding sequence (clt) of unclearmolecular function (Pettis and Cohen, 1994; Servín-González, 1996), chromosomal markers are efficientlymobilized by the integration of the traB homologue kilAfrom pIJ101 into the chromosome of Streptomyces liv-idans (Pettis and Cohen, 1994). Because traB of mostStreptomyces plasmids represents a Kill function, it isunder transcriptional control of the GntR-type regulatorTraR (Kor) (Kieser et al., 1982; Kendall and Cohen, 1987;Hagège et al., 1993; Kataoka et al., 1994; Maas et al.,1998). TraB is a membrane-associated protein (Kosonoet al., 1996; Pettis and Cohen, 1996) and belongs to theseptal DNA translocator proteins of the FtsK/SpoIIIEfamily, which catalyse the transfer of chromosomal DNAbetween two cellular compartments. Thereby they act asATP-dependent motor proteins pumping double-stranded

Accepted 26 May, 2006. *For correspondence. E-mail [email protected]; Tel. (+49) 70712974637; Fax (+49)7071295979.

Molecular Microbiology (2006) 61(2), 436–446 doi:10.1111/j.1365-2958.2006.05258.xFirst published online 15 June 2006

© 2006 The AuthorsJournal compilation © 2006 Blackwell Publishing Ltd

DNA through a closing septum (Wu et al., 1995; Ausselet al., 2002). The mode of interaction between the TraBprotein and the translocated plasmid DNA is completelyunknown.

To understand the molecular mechanism of this uniqueconjugation system, clearly different from any other trans-fer system described so far, we have characterized thetransfer proteins from pSG5 and pSVH1 (Wohlleben et al.,1985; Muth et al., 1988). The Streptomyces ghanaensisplasmid pSG5 and the Streptomyces venezuelae plasmidpSVH1 encode highly homologous (72% identity) traBgenes. Whereas traB of pSVH1 has a Kill function(Reuther et al., 2006), unregulated expression of pSG5traB retarded morphological differentiation only tempo-rarily (Maas et al., 1998). In this report we provideevidence that the septal DNA translocator TraB is asequence-specific DNA-binding protein that localizes atthe hyphal tip of Streptomyces mycelium and translocatesunprocessed double-stranded plasmid DNA by ATPhydrolysis.

Results

Heterologous expression of traB in S. lividans andpurification of TraB

To characterize the TraB protein biochemically weintended to purify TraB of pSVH1 using different expres-sion systems. N-terminal or C-terminal fusions to themaltose-binding protein MalE, the glutathion-S-transferase or His6-tag did not allow native purification ofan active protein from Escherichia coli or S. lividans (datanot shown). Appropriate expression of TraB was achieved

in S. lividans (Fig. 1A) after N-terminal fusion to the strep-tagII (WSHPQFEK; Voss and Skerra, 1997) using thethiostrepton-inducible promoter tipA (Murakami et al.,1989). By immunoblotting with strep-tagII-specific anti-bodies most of the strepII–TraB fusion protein wasdetected as a membrane-associated protein that couldbe solubilized with 1 M NaCl (data not shown). Minoramounts were also found in the cytoplasmatic fraction.One crucial parameter during protein purification wasthe addition of b-mercaptoethanol (5 mM). Withoutb-mercaptoethanol the purified TraB exhibited no enzymeactivity (see below).

Induction of strepII–TraB expression affected morphol-ogy of the S. lividans mycelium dramatically. If expressionof TraB was induced, 300–500 mm-long cylindrical aggre-gates with a diameter of about 30–50 mm were formed inliquid culture (Fig. 2B), instead of the spherical mycelialpellets normally formed by S. lividans (Fig. 2A). A closerinspection showed very long hyphae that did not branchregularly (Fig. 2C). This strongly suggests that growth atthe hyphal tip was favoured in the presence of high con-centrations of strepII–TraB while branching of the myce-lium was impaired.

ATPase activity of strepII–TraB

In the C-terminus of TraB a putative ATPase domain withWalker motifs A and B (Walker et al., 1982) is present(Fig. 1C). To analyse whether the purified protein wasactive and exhibits ATPase activity, a malachite greenassay (Lanzetta et al., 1979) was performed. PurifiedstrepII–TraB protein showed an ATPase activity of

Fig. 1. ATP hydrolysis by purified TraB.A. TraB of pSVH1 was expressed inS. lividans TK64 with an N-terminal strep-tagII(Voss and Skerra, 1997). After French pressdisruption the soluble protein fraction wassubjected to Strep-Tactin Sepharose (IBAGmbH, Göttingen). Elution fractions wereloaded to a 10% SDS page. The arrowindicates the strepII–TraB band. M,high-molecular-weight marker (116 kDa,79 kDa).B. Hydrolysis of ATP was measured by themalachite green assay. �, reaction buffer with2.5 mM ATP; �, strepII–TraB with reactionbuffer and 2.5 mM ATP; �, strepII–TraB withreaction buffer, 2.5 mM ATP and pEB211plasmid DNA.C. Domain structure of TraB from pSVH1. Theamino acid positions of the motifs are given.N, N-terminus; C, C-terminus; TMH, putativetransmembrane helix; FtsK/SpoIIIE, Pfamdomain, conserved in all FtsK/SpoIIIE familyproteins; Walker A/B, conserved ATP-bindingmotifs (Walker et al., 1982).

116 kDa

79 kDa

116 kDa

79 kDa

S. lividans TK64M

5

10

15

20

25

0 5 10 15 20t [min]

AT

P h

yd

roly

sis

[nm

ol

Pi /

µg

Tra

B]

bufferTraBTraB+DNA

5

10

15

20

25

0 5 10 15 20t [min]

AT

P h

yd

roly

sis

[nm

ol

Pi /

µg

Tra

B]

bufferTraBTraB+DNA

116 kDa

79 kDa

116 kDa

79 kDa

S. lividans TK64

strep II–TraB

M

5

10

15

20

25

0 5 10 15 20t [min]

AT

P h

yd

roly

sis

[nm

ol

Pi /

µg

Tra

B]

bufferTraBTraB+DNA

5

10

15

20

25

0 5 10 15 20t [min]

AT

P h

yd

roly

sis

[nm

ol

Pi /

µg

Tra

B]

bufferTraBTraB+DNA

A B

FtsK/SpoIIIE

108-127 240-260 390-576 71 72

Walker A, 434

TMH TMHWalker B, 529

N- -CFtsK/SpoIIIE

108-127 240-260 390-576 71 72

Walker A, 434

TMH TMHWalker B, 529C

Streptomyces conjugation 437

© 2006 The AuthorsJournal compilation © 2006 Blackwell Publishing Ltd, Molecular Microbiology, 61, 436–446

~800 pmol of phosphate per minute per microgram ofprotein (Fig. 1B), whereas heat-inactivated strepII–TraBprotein or purified strepII–GFP protein did not hydrolyseATP (data not shown). As ATPase activity of the septalDNA translocator SpoIIIE from Bacillus subtilis was shownto be DNA dependent (Bath et al., 2000), the effect ofDNA on ATPase activity of TraB was also analysed.pSVH1 plasmid DNA was added to the reaction mixturebut no significant difference was observed. Under theseconditions ATPase activity of strepII–TraB was not DNAdependent.

Specific binding of strepII–TraB to the traB-spd198intergenic region

As TraB is the only plasmid-encoded protein essential forplasmid transfer, the ability of TraB to interact with plasmidDNA was postulated. Therefore, the purified strepII–TraBprotein was used in gel retardation experiments with the

pSVH1 derivative pEB211 (Reuther et al., 2006) to detectDNA-binding activity. pEB211 was incubated with differentamounts of strepII–TraB protein for 15 min at roomtemperature and loaded onto a 1% agarose gel. In thepresence of strepII–TraB (2.5 pmol) the plasmid bandsdisappeared and the gel wells lighted up (Fig. 3A). Obvi-ously the protein–DNA complex was too large to enter theagarose gel. This indicated that multimers of TraB boundto the DNA.

To analyse whether TraB of pSVH1 is able to recognizea specific pSVH1 plasmid sequence, gel retardationexperiments were performed with 2.5 pmol of strepII–TraB protein and plasmid pEB211 digested with differentrestriction enzymes (PstI, NcoI, XhoI). In each sample aspecific restriction fragment was retarded (Fig. 3A). Bycomparison of the retarded fragments it was possible tomap a 937 bp pSVH1 region that bound TraB (Fig. 3B).This region includes the 3�-end of traB, the 5�-end ofspd198 and an intergenic sequence of 229 bp.

A B C

Fig. 2. Effect of strepII–TraB expression on the morphology of S. lividans TK64 in liquid culture. Expression of strepII–TraB in S. lividans TK64(pJR301) was induced by adding thiostrepton (10 mg ml-1). After 12 h incubation at 18°C a sample of the liquid culture was analysed byphase-contrast microscopy. Instead of spherical pellets, long cylindrical aggregates were formed after inducing strepII–TraB expression.A. Control S. lividans TK64 (pGM190), induced.B and C. S. lividans TK64 (pJR301), induced.Bars = 100 mm (A and B) or 50 mm (C).

Fig. 3. Binding of strepII–TraB of pSVH1 to aspecific plasmid region.A. The pSVH1 derivative pEB211 wasdigested with restriction endonucleases PstI,NcoI or XhoI, incubated with 2.5 pmol ofpurified strepII–TraB protein (+) or withoutstrepII–TraB (–) and separated on a 1%agarose gel. Arrows mark DNA fragments thatbind TraB. Note that with undigested plasmidDNA both, the oc- and the ccc-bands(arrows), are shiftedB. Restriction fragments that were specificallyretarded in the gel shift experiments aredrawn on a map of plasmid pEB211. Theshifted fragments overlap in a 937 bpPstI–XhoI restriction fragment (grey bar)downstream of the traB gene. M, 1 kb DNAladder, Fermentas.

XhoI

NcoI

XhoIPstI NcoI NcoIPstI

PstINcoIXhoI

traR spdB3

spd79

spdB2 traB spd198spd40

rep spdA aphII orispd140

- +

pEB211

- +

pEB211

- +

pEB211

- +PstI NcoI XhoI

cccoc

PstIXhoI

NcoI


PstINcoIXhoI

traR spdB3

spd79



- +

pEB211

- +

pEB211

- +

pEB211

- +PstI NcoI XhoI

cccoc

PstIXhoI

NcoI


PstINcoIXhoI

traR spdB3

spd79



- +

pEB211

- +

pEB211

- +

pEB211

- +PstI NcoI XhoI

cccoc

PstIXhoI

NcoI


PstINcoIXhoI

traR spdB3

spd79



- +

pEB211

- +

pEB211

- +

pEB211

- +PstI NcoI XhoI

cccoc

PstI

A

B

438 J. Reuther et al.


BLAST analysis of this sequence did not reveal similarityto other Streptomyces plasmids. However, analysis of thissequence for secondary structures showed the repetition(8¥) of an 8 bp motif GACCCGGA (conserved basesshown in bold), one 14 bp direct repeat and one invertedrepeat structure (15 bp) (Fig. 4A). Such repetitive struc-tures are also found on various other Streptomyces plas-mids immediately downstream of their traB homologue(Fig. 4B).

Purified TraB protein had also an unspecific DNA-binding activity. With increasing amounts of TraB (� 12.5 pmol) or when b-mercaptoethanol was omitted duringpurification, TraB bound to any DNA (data not shown)

independent of its conformation (ccc, oc, linear, ds, ss) ororigin (pDrive-plasmid-DNA, Mp13 single-stranded phageDNA or double-stranded phage lambda DNA).

Binding of TraB to a single 14 bp direct repeat

To narrow down the TraB binding site and to analysewhich of the palindromic sequences are involved in TraBbinding, various DNA fragments of the intergenic regionwere amplified by PCR and cloned into pDrive (Table 1).The plasmids were digested with restriction endonu-cleases ApaLI/PstI, SmaI/ScaI or DrdI/HindIII, alwaysgenerating three DNA fragments. The intermediate-sized

pSVH1 GACCCGGA

pJV1 CCCGCACA

pSLS CCCGCACA

pSN22 CGCACA

pSG5 CCCGGAC

pFP1 CTCTAC

SLP2 CCGCCA

170 bp

CCGCCTGATGATTCCGACCCGGCCGCGACCCGGACAGGCGCCCGGATTGACCCGGAATGCCCCCGGGCG

GACCGGGCCCCGACCCGGACGCCGGAGTGCCCGACCCGGACGCCCGCGTCCGGGTCGGGCCCGGAT

TCGTCCGAGTCGCCCAACTCTCTGACCTGCGCAAACACGGAGCCGTCCGGGCTCCGTCCCGGTCTC

pSVH1 GACCCGGA

pJV1 CCCGCACA

pSLS CCCGCACA

pSN22 CGCACA

pSG5 CCCGGAC

pFP1 CTCTAC

SLP2 CCGCCA

170 bp

CCGCCTGATGATTCCGACCCGGCCGCGACCCGGACAGGCGCCCGGATTGACCCGGAATGCCCCCGGGCG

GACCGGGCCCCGACCCGGACGCCGGAGTGCCCGACCCGGACGCCCGCGTCCGGGTCGGGCCCGGAT

TCGTCCGAGTCGCCCAACTCTCTGACCTGCGCAAACACGGAGCCGTCCGGGCTCCGTCCCGGTCTC

A

B

Fig. 4. Comparison of repeat structures in the strepII–TraB binding region with those of other Streptomyces plasmids.A. Nucleotide sequence of the TraB binding region of pSVH1. Downstream of the traB gene eight imperfect direct repeats (grey arrows)characterized by an 8 bp consensus sequence GACCCGGA (conserved residues in bold), one 14 bp direct repeat and a 15 bp inverted repeatstructure (black arrows) were identified. The translational stop codon TGA of traB is written in bold.B. Schematic drawing of the 170 bp non-coding regions downstream of traB genes of various actinomycetes plasmids that also containcharacteristic repeat structures (black arrows). The nucleotide sequence of the imperfect repeats is given for each plasmid. The horizontalarrow marks the stop codon of traB.

Table 1. Plasmids used in this study.

Plasmid Characteristics Reference

pSG5 Conjugative RCR plasmid from Streptomyces ghanaensis Maas et al. (1998)pSVH1 Conjugative RCR plasmid from Streptomyces venezuelae Reuther et al. (2006)pGM190 Streptomyces-E. coli shuttle vector, tsr, aphII, pSG5 derivative, tipA promoter G. Muth (unpublished)pDrive TA cloning vector, bla, kan, Qiagen, GermanypTST101 E. coli expression vector, bla, malE–egfp fusion J. Altenbuchner (pers. comm.)pYT101 E. coli expression vector, N-terminal Strep-tag Y. Tiffert and J. Reuther (unpublished)pEB211 pSVH1 derivative, pK18 insertion in NheI site Reuther et al. (2006)pJR201 pYT101 derivative, encoding a StepII–traBpSVH1 fusion protein This studypJR301 pGM190 derivative, carrying the stepII–traBpSVH1 fusion gene under control of the tipA

promoterThis study

pJRgfp1 pTST101 derivative, carrying the traBpSG5 –egfp fusion gene This studypJRgfp2 pGM190 derivative, carrying the traBpSG5 –egfp fusion gene under control of the native

traB promoterThis study

pJRgfp0 pGM190 derivative, carrying the egfp gene under control of the pSVH1 traB promoter This studypCG-clt pDrive derivative containing traB-spd198 intergenic region (nt 8116–8353) of pSVH1 This studypCG-clt1 pDrive derivative containing pSVH18116-8247 This studypCG-clt2 pDrive derivative containing pSVH18116-8252 This studypCG-clt3 pDrive derivative containing pSVH18116-8208 This studypCG-clt4 pDrive derivative containing pSVH18219-8248 This study



fragments contained the pSVH1 region analysed for TraBbinding. Agarose gel retardation assays with strepII–TraB(Fig. 5A) identified a 50 bp fragment sufficient to promoteTraB binding. This fragment contained the 8 bp imperfectdirect repeat (3¥) and the 14 bp direct repeat, but lackedthe prominent inverted repeat structure. Fragmentslacking the 14 bp direct repeat (Fig. 5B, dotted lines) werenot bound by strepII–TraB, demonstrating that the 14 bpdirect repeat (or the internal 8 bp direct repeats) wascrucial for the interaction with TraB while most of the 8 bpdirect repeats and the inverted repeat structure were dis-pensable under in vitro conditions.

TraB binding without DNA processing

To analyse whether interaction of TraB with the bindingsite involves processing of the pSVH1 DNA resulting inrelaxation of the supercoiled plasmid DNA, we performedmodified agarose bandshift assays. strepII–TraB wasincubated with ccc-DNA of plasmid pCG-clt in the pres-ence of 2.5 mM MgCl2 which might be critical to detectrelaxase activity. After 15 min incubation, the protein DNAcomplex was destroyed by either heat treatment (15 min80°C), phenol/chloroform extraction or addition of 1%SDS and the samples were loaded to a 1% agarose gel.As controls, untreated pCG-clt-DNA and pCG-clt incu-

bated with inactivated strepII–TraB (15 min 80°C or 1%SDS treatment) were run on the same gel. Comparison ofthe released pCG-clt-DNA with the untreated controlshowed that pCG-clt was not nicked and its conformationwas not changed during binding of strepII–TraB (data notshown). This demonstrated that TraB does not processthe DNA while interacting with its binding site.

Localization of TraB at the hyphal tip

In order to analyse which compartment of the Streptomy-ces mycelium is involved in conjugation, localizationexperiments with a TraB–eGFP fusion protein werecarried out. As traB of pSVH1 represents a Kill function(Reuther et al., 2006) and expression of strepII–TraBaffected morphology of S. lividans (Fig. 2), the closelyrelated TraB protein (72% identity) of the S. ghanaensisplasmid pSG5 was used in these studies. Unregulatedexpression of pSG5–TraB is tolerated by S. lividans(Maas et al., 1998). eGFP was fused to the C-terminus ofTraB to avoid interference with a predicted membraneanchor region at the N-terminus of TraB. The fusion genewas cloned under control of the native pSG5 traB pro-moter into the shuttle plasmid pGM190, a pK18 derivativecarrying the minimal replicon of pSG5. S. lividans trans-formants were grown on agar plates for 1 day. Fluores-

CCCGGGCGGACCGGGCCCCGACCCGGACGCCGGAGTGCCCGACCCGGACGCCCGCGTC

++ + + +-- - - -pCGclt pCGclt1 pCGclt2 pCGclt3 pCGclt4

ApaLI/PstI

- -+ +pCGclt pCGclt

SmaI/ScaI DrdI/HindIIIApaLI/PstI

SmaI DrdItraB spd198

ApaLI/PstISmaI/ScaIDrdI/HindIIIApaLI/PstIApaLI/PstIApaLI/PstIApaLI/PstI

pGCclt

pGCclt1pGCclt2pGCclt3pGCclt4

pGCcltpGCclt

traB

A

B

Fig. 5. Specific interaction of strepII–TraB with a 50 bp fragment containing a 14 bp direct repeat sequence.A. Fragments were amplified by PCR, cloned into pDrive and restricted with ApaLI/PstI, SmaI/ScaI or DrdI/HindIII to generate three DNAfragments, the middle-sized containing the pSVH1 region analysed for TraB binding. DNA (1 mg) was incubated with (+) and without (–)strepII–TraB (2.5 pmol) for 15 min at 24°C and separated by agarose gel electrophoresis. All fragments containing the 14 bp direct repeatstructure were specifically shifted by strepII–TraB. Arrows indicate the DNA fragments which bind strepII–TraB. M, 1 kb DNA ladder,Fermentas.B. The schematic drawing shows the extend of the DNA fragments, the repeat structures (grey arrows: 8 bp repeat, black arrow: 14 bprepeat), relevant restriction sites and the nucleotide sequence of the minimal TraB binding site. Solid lines indicate fragments that wereshifted, while the dotted lines mark DNA fragments that did not bind strepII–TraB.



cence microscopy of the mycelium revealed eGFPfluorescence spots in most cases at the tips of the myce-lium (Fig. 6), suggesting that conjugation takes place atthe hyphal tips. If egfp alone was expressed under controlof the pSG5 traB promoter, a diffuse fluorescence evenlydistributed in the mycelium was observed.

Discussion

Conjugal DNA transfer in streptomycetes is mediated by asingle protein (TraB) belonging to the septal DNA translo-

cator proteins (Kieser et al., 1982; Pettis and Cohen, 1996;Grohmann et al., 2003). FtsK and SpoIIIE, the best-studiedproteins of this group, attach as membrane-anchored pro-teins to the closing division septum and translocate double-stranded chromosomal DNA into the daughtercompartments during cell division and endospore forma-tion (Begg et al., 1995; Wu et al., 1995; Errington et al.,2001; Aussel et al., 2002). Up to now, purification of aseptal DNA translocator protein was hampered by its tox-icity and only N-terminal truncated derivates of FtsK andSpoIIIE were successfully purified (Bath et al., 2000;

TraB-eGFP

A B

TraB-eGFP

eGFP

C

Fig. 6. Localization of a pSG5 TraB–eGFP fusion protein at the hyphal tips of S. lividans. TraB–egfp was expressed under control of thenative pSG5 traB promoter (pJRgfp2). A sterile coverslip was inserted at a 45° angle into LB agar and S. lividans (pJRgfp2) spores wereinoculated along the acute angle between the glass and the agar surface. Coverslips with attached mycelium were removed after 1–2 days ofincubation at 30°C and mounted on poly L-lysine-coated slides. The majority of the mycelial fragments showed TraB–eGFP fluorescence(arrows) only at the tips of the mycelium. In contrast, fluorescence of unfused eGFP protein (pJRgfp0) was evenly distributed in the hyphae(lower row).A. Phase contrast.B. eGFP fluorescence.C. Overlay of both images.Magnification 1000¥.



Aussel et al., 2002; Pease et al., 2005). The TraB proteinsof most Streptomyces plasmids represent Kill functions(Stein et al., 1989; Hagège et al., 1993; Hopwood andKieser, 1993). For KilAof pIJ101 it has been shown that theN-terminal half, containing the membrane anchor, wassufficient for killing (Kieser et al., 1982).

This is the first study reporting the expression and puri-fication of a full-length protein of the septal DNA translo-cator family. We succeeded in the expression of TraB inS. lividans with an N-terminal strep-tagII (Voss andSkerra, 1997). Membrane association of strepII–TraBsuggested that the N-terminal tag did not interfere with thecorrect localization of TraB. Induction of strepII–TraBexpression severely affected colony morphology ofS. lividans and long cylindrical aggregates instead ofspherical pellets were formed. As GFP fusion experimentslocalized TraB to the hyphal tips, it can be speculated thatthe presence of TraB at the hyphal tip directs tip growthbut interferes with the regular branching of the myceliumresulting in the outgrow of unusual long, only rarelybranched hyphae.

All conjugation systems require a short non-codingplasmid sequence for DNA translocation. The oriTsequence of unicellular bacteria contains the nicking sitewhere the transfer relaxase initiates synthesis of thesingle-stranded molecule, which is transferred to therecipient with the relaxase covalently attached (Willetsand Wilkins, 1984; Zechner et al., 2000). Also transfer ofcircular plasmids in Streptomyces involves a cis-actingnon-coding sequence (clt) (Pettis and Cohen, 1994;Servín-González, 1996). The molecular function of clt isnot understood, but it seems to be different from a clas-sical oriT region. In a primer extension analysis with anE. coli crude extract containing heterologously expressedTraB of pIJ101 no evidence for site-specific nicking in theclt region of pIJ101 was obtained (Ducote et al., 2000).Also, no conjugation-dependent deletion of pIJ101 clt lociin tandem orientation was observed (Ducote and Pettis,2005), as it was described for oriT regions from Gram-negative bacteria (Brasch and Meyer, 1987).

In this study we analysed the interaction of TraB withpSVH1 plasmid DNA. With purified strepII–TraB protein ofplasmid pSVH1 we could show for the first time that theseptal DNA translocator TraB binds to a specific plasmidregion. This region has all features characteristic for Strep-tomyces clt regions. It shows striking structural similarity toclt loci containing direct and indirect repeats (Ducote et al.,2000; Franco et al., 2003) and it localizes to the sameposition immediately downstream of traB, as reported forthe pJV1 clt locus (Servín-González, 1996). The traBdownstream regions of most Streptomyces plasmidscontain putative clt loci carrying similar repeat structures(Servín-González, 1996; Franco et al., 2003). From theevolutionary point of view this plasmid organization is

favourable. The traB gene and the clt locus might representa minimal transfer module which can easily be exchangedbetween different plasmids. Such a modular architecturewas previously reported for Streptomyces RCR plasmids(Servín-González, 1993; Reuther et al., 2006).

Our data support the suggestion of Ducote and Pettis(2005) that clt is not nicked during conjugal transfer. Fromsequence similarity the TraB proteins are not predicted tohave a relaxase activity that could process the DNA at theclt locus. Binding of the purified strepII–TraB protein topSVH1 derivatives did not nick the DNA. Inactivation ofthe strepII–TraB–plasmid-DNA complex by heat treatmentor addition of SDS released unprocessed plasmid DNAfrom the complex. This is in agreement with the report ofPossoz et al. (2001) who showed by the sensitivity ofpSAM2 transfer to SalI restriction which cleaves onlydouble-stranded DNA but not single-stranded DNA thatconjugal transfer in Streptomyces involves unprocesseddouble-stranded DNA.

In higher protein concentrations or if clt was absent,TraB exhibited also unspecific DNA-binding activity. Thiscan be expected because TraB also mobilizes chromo-somal DNA with high efficiency. Mobilization of chromo-somal markers during Streptomyces conjugation mightnot involve a physical interaction of the plasmid with thechromosome. Beside the linear plasmids and the integra-tive plasmids that arise by excision of chromosomalsequences, no plasmid integration could be demonstrated(Grohmann et al., 2003). As the clt locus is not processed,it can be speculated that TraB recognizes with less effi-ciency chromosomal DNA and translocates the DNAwithout any physical interaction with the plasmid.

If Streptomyces hyphae mate, the DNA has to pass twocell wall layers and two membranes. As the only plasmid-encoded protein required for DNA transfer is TraB, eitherTraB must confer all activities to translocate the DNA overthese barriers, or other proteins encoded by the Strepto-myces chromosome must be involved in the conjugationprocess. Unlike the majority of other bacteria Streptomy-ces mycelium elongates by apical tip growth. This impliesthat the peptidoglycan layer is continuously reorganizedat the hyphal tip during normal growth to allow insertion ofnew murein units. Therefore, plasmid-encoded lytic trans-glycosylases, as encoded by conjugative plasmids ofGram-negative (Koraimann, 2003) and low G+C Gram-positive (Grohmann et al., 2003) bacteria might not beneeded during Streptomyces conjugation. A TraB–eGFPfusion protein was localized to these hyphal tips indicatingthat conjugative DNA transfer occurs at the hyphal tip.Although we cannot exclude at the moment that the TraB–eGFP fusion protein does not fully represent the localiza-tion pattern of the native TraB protein, we never observedan artificial localization of other eGFP fusion proteins(Mazza et al., 2006) at the hyphal tips. The presence of



TraB protein at the tips of mating hyphae could mediate apartial fusion. For the septal DNA translocator SpoIIIE amembrane-fusing activity during Bacillus sporulation hasbeen described (Sharp and Pogliano, 2003; Liu et al.,2006).

Apparently, nature has evolved at least two differentconjugal gene transfer systems. The one, widely distrib-uted in Gram-negative bacteria, was derived from twodistinct cellular machineries (LLosa et al., 2002). A ‘rollingcircle’ replication system, involving a DNA relaxase thatgenerates a single-stranded DNA molecule starting fromthe oriT (Pansegrau et al., 1988; 1993; Zechner et al.,1997; 2000) and a type IV secretion system (T4SS) for thetranslocation of the single-stranded plasmid molecule(Christie, 2001; LLosa and O’Callaghan, 2004). Both pro-cesses are linked by the so-called coupling protein (Gomis-Ruth et al., 2001), a hexameric molecular motor proteinthat probably pumps the linear single-stranded plasmidwith the relaxase covalently attached to its 5�-end.

A different way of conjugative gene transfer was estab-lished in mycelial actinomycetes. Here, a system whichwas developed to ensure proper chromosome segrega-tion during cell division was remodelled to transfer specificplasmid DNA. The plasmid-encoded septal DNA translo-cator TraB interacts non-covalently with DNA and trans-locates an unprocessed double-stranded DNA moleculeinto the recipient.

Experimental procedures

Strains, plasmids, culture conditions

For propagation of plasmids and heterologous gene expres-sion E. coli XL1blue (Bullock et al., 2000) and S. lividansTK64 (Hopwood et al., 1983) were used. E. coli andS. lividans strains were cultivated as described by Sambrooket al. (1989) and Kieser et al. (2000). Plasmids and primersused in this study are listed in Tables 1 and 2 respectively.

Cloning, expression and purification of strepII–TraB

The traB gene was amplified by PCR with the primerstraBvh1upBg and traBvh1revH (Table 2) using plasmid

pEB211 (Table 1) as template. The DNA fragment was clonedinto the expression plasmid pYT101 (Y. Tiffert and J. Reuther,unpubl. results) via BglII and HindIII restriction sites incorpo-rated in the primers. The resulting plasmid (pJR201) encodesan N-terminal strepII–TraB fusion protein. For expression inStreptomyces, the strepII–traB gene was cloned as a NdeI/HindIII fragment into the shuttle plasmid pGM190 undercontrol of the thiostrepton inducible promoter tipA (Murakamiet al., 1989) resulting in plasmid pJR301. To induce proteinexpression, 50 ml of pre-culture of S. lividans TK64 (pJR301)in S-medium supplemented with kanamycin 50 mg ml-1 wastransferred to 200 ml of S-medium containing 10 mg ml-1

thiostrepton and incubated on a rotary shaker (180 r.p.m.) at18°C. After 24 h of growth the culture was harvested bycentrifugation. The cells were pelleted and resuspended inpurification buffer (100 mM Tris-HCl pH 8; 200 mM NaCl;5 mM b-mercaptoethanol). After French press, the crudeextract was obtained by centrifugation at 10 000 g for 10 min.The strepII–TraB fusion protein was purified from the clearedlysate using StrepTactin-Sepharose (IBA, Göttingen,Germany) according to the manufacturer’s instructions. Froma 1 l S. lividans culture about 2 mg of strepII–TraB proteinwas obtained.

Preparation of membrane fractions

All steps were performed at 4°C. S. lividans cell pellets wereresuspended in 25 mM Tris-HCl pH 7.5 with 100 mM NaCland the CompleteTM protease inhibitor cocktail (Roche),DNase (10 mg ml-1) and lysozyme (10 mg ml-1) were addedbefore the cells were broken in a French press. Membraneswere spun down (100 000 g, 30 min) and membrane-associated proteins were extracted by resuspending thepellet in extraction buffer (25 mM Tris-HCl pH 7.5, 20% glyc-erol) with 1 M NaCl and stirring for 2 h. Following centrifuga-tion (100 000 g, 30 min), integral membrane proteins wereextracted by resuspending the pellet in Triton X-100 extrac-tion buffer (25 mM Tris-HCl pH 7.5, 20% glycerol, 1 M NaCl,2% Triton X-100) and stirring for 12 h. Unsolubilized mem-brane debris was removed by centrifugation (100 000 g,30 min) and the supernatant containing the solubilized mem-brane proteins was stored at -20°C.

ATPase assays

ATPase activity was analysed using the malachite greenmethod as described by Lanzetta et al. (1979). ATP hydroly-sis was determined by measuring the release of inorganicphosphate with acidic ammonium molybdate and malachitegreen. The assay was performed in 150 ml of reaction buffercontaining 50 mM Tris-HCl pH 8, 100 mM NaCl, 5 mM MgCl2,5 mM b-mercaptoethanol and 10% glycerol. The reaction wasstarted after 1 min pre-incubation of the protein sample inreaction buffer by the addition of ATP to a final concentrationof 2.5 mM. The mixture was incubated at 30°C for 20 min.After 0, 5, 10 and 20 min, 30 ml of samples were taken andthe reaction was terminated by adding 200 ml of the ammo-nium molybdate/malachite green reagent and 30 ml of 34%sodium citrate solution. After 20 min at room temperature theabsorbance at 660 nm was measured in a microtitre plate

Table 2. Oligonucleotide primersa used in this study.

Primer Sequence

traBvh1upBg AGATCTACCGAGCACCTCACCGAGtraBvh1revH AAGCTTTCAGGCGGTAAGCCCGAAtraBeGFPE GGAATTCTCTCCGCGACCGGGtraBeGFPBg AGATCTGGAGGCGGTCAGGCCCCACclt8219up: CCGGAGTGCCCGACCCclt8252low: CGGACGCGGGCGTCCGclt8276low ACTCGGACGAATCCGG

a. Underlined nucleotides indicate restriction sites incorporcted intoprimers.



reader. A standard curve with KH2PO4 was used to determinethe amount of released phosphate.

Agarose gel shift assay

DNA (0.5–1 mg) was mixed with different amounts (2.5–15 pmol) of TraB protein and reaction buffer (100 mM Tris-ClpH 8; 200 mM NaCl; 5 mM b-mercaptoethanol). For gel shiftassays with restriction endonuclease cleaved plasmid DNAheat-inactivated digestion mixtures of pEB211 and appropri-ate subclones (Table 1) were used. After incubation at 24°Cfor 15 min, gel loading solution (10 mM Tris-HCl pH 7.6,0.03% bromophenol blue, 0.03% xylene cyanol FF, 60% glyc-erol and 60 mM EDTA) was added and the mixture wassubjected to a 1% agarose gel. Separated bands were visu-alized by ethidium bromide staining.

Nicking activity of TraB was analysed by incubatingpCG-clt DNA (Table 1) with 5 pmol of strepII–TraB proteinin 100 mM Tris, 200 mM NaCl, 2.5 mM MgCl2, 5 mMb-mercaptoethanol. After 15 min at room temperature, theDNA–strepII–TraB complex was inactivated by heat treat-ment (15 min 80°C) or addition of 1% SDS and the sampleswere loaded with respective controls to a 1% agarose gel andanalysed for relaxation of the ccc-DNA.

Construction of a traB–gfp fusion gene

The traB gene and its native promoter was amplified frompSG5-DNA by PCR with the primers traBeGFPE andtraBeGFPBg. The amplified DNA fragment was cloned intoEcoRI/BamHI-digested plasmid pTST101 upstream of theegfp gene via EcoRI and BglII sites (underlined in Table 2)incorporated in the primers. The resulting plasmid pJRgfp1encodes a TraB–eGFP fusion protein under control of thenative traB promoter. For detection of the TraB–eGFP fusionprotein in S. lividans, the expression cassette was cloned intothe shuttle plasmid pGM190 via EcoRI and HindIII sitesresulting in plasmid pJRgfp2.

Phase-contrast and fluorescence microscopy

For visualization of Streptomyces mycelium, cultures wereset up by inserting a sterile coverslip at a 45° angle into LB orR2YE agar and inoculating spores along the acute anglebetween the glass and the agar surface. Coverslips withattached mycelium were removed after 1–2 days of incuba-tion at 30°C and mounted in 50% glycerol in phosphate-buffered saline on poly L-lysine-coated slides. Samples wereobserved with an Olympus System Microscope BX60equipped with appropriate filter sets and pictures taken withan Olympus F-view II camera.

Acknowledgements

This research was supported by the Landesstiftung Baden-Württemberg GmbH ‘Kompetenznetzwerk Resistenz’. Wethank Eriko Takano and Bertholt Gust for helpful commentson the manuscript and Augustina Franco for excellent tech-nical assistance.

References

Aussel, L., Barre, F.-X., Aroyo, M., Stasiak, A., Stasiak, A.Z.,and Sherratt, D.J. (2002) FtsK is a DNA motor protein thatactivates chromosome dimer resolution by switching thecatalytic state of the XerC and XerD recombinases. Cell108: 195–205.

Bath, J., Wu, L.J., Errington, J., and Wang, J.C. (2000) Roleof Bacillus subtilis SpoIIIE in DNA transport across themother cell-prespore division septum. Science 290: 995–997.

Begg, K.J., Dewar, S.J., and Donachie, W.D. (1995) A newEscherichia coli cell division gene, ftsK. J Bacteriol 177:6211–6222.

Brasch, M.A., and Meyer, R.J. (1987) A 38 base-pairsegment of DNA is required in cis for conjugative mobiliza-tion of broad host-range plasmid R1162. J Mol Biol 198:361–369.

Bullock, W.O., Fernandez, J.M., and Short, M.J. (2000)X-L1blue, a high efficiency plasmid transforming recAEscherichia coli strain with beta galactosidase selection.Biotechniques 5: 376–378.

Christie, P.J. (2001) Type IV secretion: intercellular transferof macromolecules by systems ancestrally related to con-jugation machines. Mol Microbiol 40: 294–305.

D’Costa, V.M., McGrann, K.M., Hughes, D.W., and Wright,G.D. (2006) Sampling the antibiotic resistome. Science311: 374–377.

Ducote, M.J., and Pettis, G.S. (2005) An in vivo assay forconjugation-mediated recombination yields novel resultsfor Streptomyces plasmid pIJ101. Plasmid 55: 242–248.

Ducote, M.J., Prakash, S., and Pettis, G.S. (2000) Minimaland contributing sequence determinants of the cis-actinglocus of transfer (clt) of streptomycete plasmid pIJ101occur within an intrinsically curved plasmid region. J Bac-teriol 182: 6834–6841.

Errington, J., Bath, J., and Wu, L.J. (2001) DNA transport inbacteria. Nat Rev Mol Cell Biol 2: 538–545.

Franco, B., González-Cerón, G., and Servín-González, L.(2003) Direct repeat sequences are essential for functionof the cis-acting locus of transfer (clt) of Streptomycesphaeochromogenes plasmid pJV1. Plasmid 50: 242–247.

Gomis-Ruth, F.X., Moncalian, G., Perez-Luque, R., Gonza-lez, A., Cabezon, E., de la Cruz, F., and Coll, M. (2001) Thebacterial conjugation protein TrwB resembles ring heli-cases and F1-ATPase. Nature 409: 637–641.

Grohmann, E., Muth, G., and Espinosa, M. (2003) Conjuga-tive plasmid transfer in gram-positive bacteria. MicrobiolMol Biol Rev 67: 277–301.

Hagège, J., Pernodet, J.-L., Sezonov, G., Gerbaud, C., Fried-mann, A., and Guérineau, M. (1993) Transfer functions ofthe conjugative integrating element pSAM2 from Strepto-myces ambofaciens: characterization of a kil-kor systemassociated with transfer. J Bacteriol 175: 5529–5538.

Hopwood, D.A., and Kieser, T. (1993) Conjugative plasmidsof Streptomyces. In Bacterial Conjugation. Clewell, D.B.(ed.). New York: Plenum Press, pp. 293–311.

Hopwood, D.A., Kieser, T., Wright, H.M., and Bibb, M.J.(1983) Plasmids, recombination and chromosomemapping in Streptomyces lividans 66. J Gen Microbiol 129:2257–2269.



Hopwood, D.A., Lydiate, D.J., Malpartida, F., and Wright,H.M. (1985) Conjugative sex plasmids of Streptomyces.Basic Life Sci 30: 615–634.

Hopwood, D.A., Chater, K.F., and Bibb, M.J. (1995) Geneticsof antibiotic production in Streptomyces coelicolor A3(2), amodel streptomycete. Biotechnology 28: 65–102.

Kataoka, M., Seki, T., and Yoshida, T. (1991) Regulation andfunction of the Streptomyces plasmid pSN22 genesinvolved in pock formation and inviability. J Bacteriol 173:7975–7981.

Kataoka, M., Kosono, S., Seki, T., and Yoshida, T. (1994)Regulation of the transfer genes of Streptomyces plasmidpSN22: in vivo and in vitro study of the interaction of TraRwith promoter regions. J Bacteriol 176: 7291–7298.

Kendall, K.J., and Cohen, S.N. (1987) Plasmid transfer inStreptomyces lividans: identification of a kil-kor systemassociated with the transfer region of pIJ101. J Bacteriol169: 4177–4183.

Kieser, T., Hopwood, D.A., Wright, H.M., and Thompson, C.J.(1982) pIJ101, a multi-copy broad host-range Streptomy-ces plasmid: functional analysis and development of DNAcloning vectors. Mol Gen Genet 185: 223–238.

Kieser, T., Bibb, M.J., Buttner, M.J., Chater, K.F., andHopwood, D.A. (2000) Practical Streptomyces Genetics.Norwich: The John Innes Foundation.

Koraimann, G. (2003) Lytic transglycosylases in macromo-lecular transport systems of Gram-negative bacteria. CellMol Life Sci 60: 2371–2388.

Kosono, S., Kataoka, M., Seki, T., and Yoshida, T. (1996) TheTraB protein, which mediates the intermycelial transfer ofthe Streptomyces plasmid pSN22, has functional NTP-binding motifs and is localized to the cytoplasmicmembrane. Mol Microbiol 19: 397–405.

Lanzetta, P.A., Alvarez, L.J., Reinach, P.S., and Candia, O.A.(1979) An improved assay for nanomole amounts of inor-ganic phosphate. Anal Biochem 100: 95–97.

Liu, N.J., Dutton, R.J., and Pogliano, K. (2006) Evidence thatthe SpoIIIE DNA translocase participates in membranefusion during cytokinesis and engulfment. Mol Microbiol59: 1097–1113.

LLosa, M., and O’Callaghan, D. (2004) Euroconference onthe biology of type IV secretion processes: bacterial gatesinto the outer world. Mol Microbiol 53: 1–8.

LLosa, M., Gomis-Ruth, F.X., Coll, M., and de la Cruz, F.(2002) Bacterial conjugation: a two-step mechanism forDNA transport. Mol Microbiol 45: 1–8.

Maas, R.M., Gotz, J., Wohlleben, W., and Muth, G. (1998)The conjugative plasmid pSG5 from Streptomyces gha-naensis DSM 2932 differs in its transfer functions fromother Streptomyces rolling-circle-type plasmids. Microbiol-ogy 144: 2809–2817.

Mazza, P., Noens, E.E., Schirner, K., Grantcharova, N.,Mommaas, A.M., Koerten, H.K., et al. (2006) MreB ofStreptomyces coelicolor is not essential for vegetativegrowth but is required for the integrity of aerial hyphae andspores. Mol Microbiol 60: 832–852.

Murakami, T., Holt, T.G., and Thompson, C.J. (1989)Thiostrepton-induced gene expression in Streptomyceslividans. J Bacteriol 171: 1459–1466.

Muth, G., Wohlleben, W., and Pühler, A. (1988) The minimalreplicon of the Streptomyces ghanaensis plasmid pSG5

identified by subcloning and Tn5 mutagenesis. Mol GenGenet 211: 424–429.

Pansegrau, W., Ziegelin, G., and Lanka, E. (1988) Theorigin of conjugative incP plasmid transfer: interactionwith plasmid-encoded products and the nucleotidesequence at the relaxation site. Biochim Biophys Acta951: 365–374.

Pansegrau, W., Schröder, W., and Lanka, E. (1993) Relax-ase (TraI) of IncPa plasmid RP4 catalyzes a site-specificcleaving-joining reaction of single-stranded DNA. Proc NatlAcad Sci USA 90: 2925–2929.

Pease, P.J., Levy, O., Cost, G.J., Gore, J., Ptacin, J.L., Sher-ratt, D., et al. (2005) Sequence-directed DNA translocationby purified FtsK. Science 307: 586–590.

Pettis, G.S., and Cohen, S.N. (1994) Transfer of the pIJ101plasmid in Streptomyces lividans requires a cis-actingfunction dispensable for chromosomal gene transfer. MolMicrobiol 13: 955–964.

Pettis, G.S., and Cohen, S.N. (1996) Plasmid transfer andexpression of the transfer (tra) gene product of plasmidplJ101 are temporally regulated during the Streptomyceslividans life cycle. Mol Microbiol 19: 1127–1135.

Possoz, C., Ribard, C., Gagnat, J., Pernodet, J.L., andGuerineau, M. (2001) The integrative element pSAM2 fromStreptomyces: kinetics and mode of conjugal transfer. MolMicrobiol 42: 159–166.

Reuther, J., Muth, G., and Wohlleben, W. (2006) Modulararchitecture of the conjugative plasmid pSVH1 from Strep-tomyces venezuelae. Plasmid 55: 201–209.

Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989) Molecu-lar Cloning. A Laboratory Manual. Cold Spring Harbor, NY:Cold Spring Harbor Laboratory Press.

Servín-González, L. (1993) Relationship between the repli-cation functions of Streptomyces plasmids pJV1 andpIJ101. Plasmid 30: 131–140.

Servín-González, L. (1996) Identification and properties of anovel clt locus in the Streptomyces phaeochromogenesplasmid pJV1. J Bacteriol 178: 4323–4326.

Sharp, M.D., and Pogliano, K. (2003) The membrane domainof SpoIIIE is required for membrane fusion during Bacillussubtilis sporulation. J Bacteriol 185: 2005–2008.

Stein, D.S., Kendall, K.J., and Cohen, S.N. (1989) Identifica-tion and analysis of transcriptional regulatory signals forthe kil and kor loci of Streptomyces plasmid pIJ101. JBacteriol 171: 5768–5775.

Voss, S., and Skerra, A. (1997) Mutagenesis of a flexible loopin streptavidin leads to higher affinity for the Strep-tag IIpeptide and improved performance in recombinant proteinpurification. Protein Eng 10: 975–982.

Walker, J.E., Saraste, M., Runswick, M.J., and Gay, N.J.(1982) Distantly related sequences in the alpha- and beta-subunits of ATP synthase, myosin, kinases and other ATP-requiring enzymes and a common nucleotide binding fold.EMBO J 1: 945–951.

Willets, N., and Wilkins, B. (1984) Processing of plasmid DNAduring bacterial conjugation. Microbiol Rev 48: 24–41.

Wohlleben, W., Muth, G., Birr, E., and Pühler, A. (1985) Avector system for cloning in Streptomyces and Escherichiacoli. In Biological, Biochemical and Biomedical Aspects ofActinomycetes. Szabo, G., Biro, S., and Goodfellow, M.(eds). Budapest: Akademiai Kiado, pp. 99–101.



Wu, L.J., Lewis, P.J., Allmansberger, R., Hauser, P.M., andErrington, J. (1995) A conjugation-like mechanism for pre-spore chromosome partitioning during sporulation in Bacil-lus subtilis. Genes Dev 9: 1316–1326.

Zechner, E.L., Pruger, H., Grohmann, E., Espinosa, M., andHogenauer, G. (1997) Specific cleavage of chromosomaland plasmid DNA strands in gram-positive and gram-

negative bacteria can be detected with nucleotideresolution. Proc Natl Acad Sci USA 94: 7435–7440.

Zechner, E.L., de la Cruz, F., Eisenbrandt, R., Grahn, A.M.,Koraimann, G., Lanka, E., et al. (2000) Conjugative-DNAtransfer processes. In The Horizontal Gene Pool.Thomas, C.M. (ed.). Harwood: Academic Publishers, pp.87–175.



Unique conjugation mechanism in mycelial streptomycetes: a DNA-binding ATPase translocates...

Documents

Transcript of Unique conjugation mechanism in mycelial streptomycetes: a DNA-binding ATPase translocates...