Gene, 25 (1983) 133-143 133 Elsevier

GENE 872

Transcriptional mapping of two yeast genes coding for glyceraldehyde 3-phosphate dehydrogenase isolated by sequence homology with the chicken gene *

(Gene cloning; bacteriophage 2 vector; heterologous probe; S 1 nuclease mapping; transcription initiation and termination)

Anna Maria Musti *, Zendra Zehner, Keith A. Bostian a.,, Bruce M. Paterson and Richard A. Kramer *

Laboratory of Biochemistry, National Cancer Institute, National Institutes of Health, Building 37, Room 4A-21, Bethesda. MD 20205 (U.S.A.) TeL (301) 496-1746, and ~Rosenstiel Basic Medical Sciences Research Center. Brandeis Universit.v. Waltham, MA 02254 (U.S.A.) TeL (617) 647-2456

(Received January 22nd, 1983) (Accepted April 16th, 1983) (L,~st in mail and resubmitted July 15th, 1983)

SUMMARY

Homology between the coding regions of the chicken and yeast glyceraldehyde 3-phosphate dehydrogenase (GAPDH) genes was directly demonstrated by the hybridization of a eDNA clone coding for GAPDH in the chicken with EcoRl-digested yeast DNA. A yeast EcoRl fragment library in bacteriophage ). was screened using the chicken eDNA plasmid as probe, and two recombinant phages were isolated, each one containing a different GAPDH gene. The initiation and termination sites for the GAPDH mRNA were localized for the two different GAPDH genes and compared to those of other yeas" genes. Measurements of the relative mRNA levels for the two genes show that both genes are transcribed at about the same level when yeasts are grown on glucose media.

INTRODUCTION

* Present addresses: (A.M.M.) Universit~ di Napoli, 2A Facolt/t di Medicina e Chirurgia, lstituto di Patologia Generale, Via Sergio Pansini/5-80131, Naples (Italy) Tel. (81) 426635; (K.A.B.) Brown University, Division of Biology and Medicine, Providence, R! 02912 (U.S.A.)Tel. (401) 863-3637; (R.A.K.) Department of Molecular Genetics, Hoffmann-La Roche, Inc., Nutley, NJ 07110 (U.S.A.)Tel. (201) 235-5668, to whom reprint requests and inquiries should be sent at this address.

Abbreviations: bp, base pairs; GAPDH, glyceraldehyde 3-phos- phate dehydrogenase; kb, kilobase pairs; SDS, sodium dodecyl sulfate; SSC and SSPE, see MATERIALS AND METHODS, section d.

Holland et al. (1979) have shown that in the yeast Saccharomyces cerevisiae there are three GAPDH structural genes per haploid genome and that each one is included in a different EcoRl restriction fragment of yeast DNA. They have isolated two of these genes and have shown that they are non- tandemly repeated (Holland and Holland, 1980). The nucleotide sequence data indicate that there is 94~o homology within the coding regions and 70 I°~ homology in the flanking non-coding regions of the two genes. Furthermore, there are no intervening sequences present.

0378-1119/83/$03.00 © 1983 Elsevier Science Publishers

134

We have independently i~olated these two GAPDH genes from a partial EcoRl library of yeast DNA in bacteriophage ,l using a GAPDH cDNA clone prepared from embryonic chicken muscle mRNA as the probe. The ability of the chicken gene to select the yeast genes might be expected since there is strong homology among the primary structures of the GAPDH proteins in pig, lobster, yeast, and Bacillus stearothermophilus (Jones and Harris, 1972), although this does not necessarily predict strong homology at the nucleic acid level.

We have determined the 5' and 3' termini that probably represent transcriptional initiation and termination sites for the two GAPDH isolates by S 1 nuclease mapping and nucleotide sequence analysis. The structural features ofthe nucleotide sequences in the transcription.,d initiation and termination regions are discussed. In addition, we show here that both genes are expressed in yeast grown on glucose as the only carbon source.

MATERIALS AND METHODS

(a) Construction and identification of the chicken GAPDH cDNA clone

The details are to be presented elsewhere (Zehner, Z. and Paterson, B.M., manuscript in preparation). Briefly, a cDNA library was prepared in the Pstl site of pBR322 (Bolivar et al., 1977; Maniatis et al., 1976) using as template po!y(A) + mRNA from dif- ferentiated cultures of embryonic chick muscle (Aviv and Leder, 1972; Paterson and Bishop, 1977; Strohman et al., 1977). The GAPDH clones were screened with a cDNA probe prepared from an RNA fraction extracted from a methyhnercury agarose gel (Bailey and Davidson, 1976; Efstratiadis et al., 1975; Paterson and Roberts, 1981; Paterson and Bishop, 1977; Thayer, 1979) which directed the cell-free synthesis of GAPDH, as judged by product analysis on 2-dimensional gels (Granger and Lazarides, 1979; Laemmli, 1970; Malamud and Drysdale, 1978). Positives were verified as GAPDH clones using the mRNA selection techniques pre- viously described (Paterson and Roberts, 1981; Pelham and Jackson, 1976).

(b) Yeast DNA libraries

Two different EcoRl yeast librc, des were screened: (1) a ~. Charon 4A-yeast library from strain A364A (Woolford and Rosbash, 1981) provided by L. Hereford and (2) a ~ Charon 4-yeast library from strain S288C that was constructed by Kramer and Andersen (1980).

(c) Plaque filter hybridizations

Plaque filter replicas were prepared as described by Benton and Davis (1977). Hybridization reactions were carried out as described below for gel blots.

(d) Gel blotting and hybridization

After electrophoresis in agarose gels the DNA restriction fragments were transferred to nitrocel- lulose fdters by the procedure of Southern (1975). When the chicken cDNA probe was used the hybridization solution was 5 x SSPE (1 x SSPE - 0.18 M NaCI, 0.01 M Na" phosphate, 0.001 M EDTA, pH 7.0), 0.5~ SDS, I mg/ml denatured salmon DNA, and the hybridization was carried out for 48 h at 45°C. After hybridization, blots were washed in 2 x SSC (1 ~: SSC = 0.15 M NaCI, 0.015 M Na3 .citrate) at 45°C. When pp6y recombinant plasmid, containing the yeast GAPDH gene, was used as probe, the temperature of hybridi- zation was 65°C and the time was 20-24 h. The filters were then washed in 0.1 x S$C 0.1 ~o SDS m 52°C.

Total yeast RNA (5 #g) was denatured with glyoxal (McMaster and Carmichael, 1977), sepa- rated by electrophoresis on an agarose gel and trans- ferred to nitrocellulose (Thomas, 1980). The filter was then hybridized with pp6y probe as described for DNA blots.

(e) Heteroduplex anaJysis

Heteroduplex molecules between phage 6y and 17y DNAs were prepared from 0.1 ~g of each phage DNA using the formamide technique of Westmore- land et al. (1969) as described by Davis et al. (1971). The heteroduplex reaction was then spread in 35 % formamide and examined in a Philips EM400.

135

(f) Cell growth and RNA preparation

Total cellular RNA was prepared from mid- logarithmic phase cells (2-5 x 10 7 cells,'ml) of strain P28-24C (apho3-1) grown in SMD medium (Bostian

a b

- 12K

- 5.8K

- 4.5K

2 . 2 K !

et al., 1980) at 30 ° C, after cell disruption with glass beads, by standard H20-saturated phenol extraction (Hopper Lt al., 1977). RNAs selected by hybridi- zation (Alwine et al., 1979) to the GAPDH clones w,:re translated in a wheat-germ ce!!-free system and cell-free products were analyzed for GAPDH syn- thesis by immunoprecipitation and SDS-polyacryl- amide gel an~ysis (Hopper et al., 1978; Roberts and Paterson, 1973; Studier, 1973).

(g) DNA labeling

Nick translation was performed as described (Rigby et al., 1977) using [~-32p]dATP and [ 732p ]dCTP (Amersham or New England Nuclear). DNA 5' ends were labeled by T4 polynucleotide kinase (Maxam and Gilbert, 1980) and [)~-32p]ATP (Amersham or New England Nuclear). DNA 3' ends were labeled by AMV reverse transcriptase (Maxam and Gilbert, i980) with [~-32p]dCTP and [ ~.32p]dTTP (Amersham; > 3000 Ci/mmoi).

(b) Mapping of mRNA termini

S I mapping using either 5'- or 3'-ladaeled DNA was performed as described by Berk and Sharp (1977). The elongation of a DNA primer on mRNA by reverse transcriptase was carried out as described by Hagenbtlchle et al. (1979). The products were separated on the 8 °, o polyacrylamide, 7 M urea gels used for sequence analysis.

(i) DNA sequence analysis

The nucleotide sequence of 5'-labeled DNA frag- ments was performed by the chemical modification procedure of Maxam and Gilbert (1980). Cleavage products were separated on 8°0 polyacrylamide, 7 M urea gels (33 cm 10ng x 0.5 mm thick).

Fig. I. Homology between the coding region of the chicken and yeast GAPDH genes. Yeast DNA (2/~g per lane) from a diploid strain, + D4 (latae a) and a haploid strain (lane b) was digested with EcoRl and transferred from a 1 ~o agarose gel to a nitro- cellulose filter. The two strains show essentially the same pattern of hybridization when the chicken GAPDH clone was used as a probe. The sizes in kb(K) of bands that hybridized were determined with markers of bacteriophage 2 DNA digested with EcoRi and Hindlll (not shown).

RESULTS

(a) Homology between a chicken cDNA clone and the GAPDH gene of yeast

To investigate the homology between the coding region ofthe GAPDH gene in chk,,,;n and yeast, the

cDNA plasmid containing part of the chicken GAPDH coding region (Zehner, Z. and Paterson, B.M., manuscript in preparation) was used as a hybridization probe with an EcoRl digest of yeast DNA. Conditions of low stringency were used in both the hybridization and filter washes (MATERIALS AND METHODS, section d). Fig. 1 shows the pattern of hybridization. Three major bands are detectable and correspond to the 12 kb, 5.8 kb, and 4.5 kb that Holland et al. (1979) have shown to contain the three copies of the GAPDH gene in the yeast genome. The 2.2-kb EcoRl fragment is present at varying levels (not shown) and its origin has not been deter- mined at present.

(b) Isolation of two GAPDH genes from the yeast genome

The chicken GAPDH clone was used to screen the partial EcoRl library of yeast DNA. In the initial

A B C D

screening one recombinant phage, 6y, hybridized to the GAPDH probe. When the chicken GAPDH probe was used against restriction endonuclease digested phage 6y DNA, a 12-kb EcoRl fragment and a 2.2-kb HindIII fragment hybridized with the probe (Fig. 2A). The 2.2-kb Hindlll fragment was purified from an agarose gel and subcloned into the HindIll site of the plasmid pBR322 (Bolivar et al., 197"/). The resulting recombinant plasmid, pp6y, was used to probe total yeast DNA digested either with EcoRI or HindIIl. Hybridization selection of yeast mRNA and analysis of the translation prod,,cts by immunoprecipitation confLrmed pp6y contained se- quences homologous to yeast GAPDH (not shown). The pattern of hybridization (Fig. 2B) revealed the same 12-kb and 2.2-kb fragments obtained using the chicken cDNA probe with restriction enzyme digests of phage 6y. Therefore, pp6y was used as probe to rescreen the yeast library. A second phage, 17y, was isolated and characterized by restriction endo- nuclease digestion and gel blot analysis. The results

1 2 1 2

- 1 2 K -

136

5 . 8 K -

- 8 K

4 . 5 K -

- 2 . 2 K

- 5 . 8 K - 5 . 8 K

- 2 . 2 K

1 2 1 2 i

- 1 2 K

~ ~i~!~!i !<i~i< ii!!~i~ ~ i!i~ !~ ii ~ ii~!~ii~ ii~ !!~ ~!:!~i ii~!~ i i~i~i ~,~ ~ ,~ < < ~, ~! ~' 7 ' /

il !i/~i̧ i̧̧ i!~ii i%1!/ii , i / % i ̧ /<<~ ~ . 7 / / i ¸ <~/

- 8 K

- 2 . 2 K

Fig. 2. Gel blot analysis of two yeast GAPDH genes. (A) DNA from phage 6)' was digested with either EcoRl (lane 1)or Hindlll (lane 2), separated on a i o:, agarose gel and transferred to a nitrocellulose filter. The filter was then used for hybridization with the chicken GAPDH probe. (B) Similarly, total yeast DNA was dighted with either EcoRl (lane !) or HindIll (lane 2) and blotted from a gel onto a nitrocellulose filter that was then used for hybridization with the plasmid pp6y as a probe. (C) EcoR! digested DNA from phages 6y (lane 1) and 17y (lane 2) was blotted from a gel and hybridized with ppby probe. (D) H/ndIll digested DNA from phages 6y (lane I) and 17y (lane 2) was hybridized to pp6y probe.

A F

, , , , , , , ,J ?

12K

3' PT)2'22RI 5'

"- L 8.OK-1 -1

. . J

] 6Y

o , 17Y

t EcoRI ) Hindlll

Sstl

~Sall GAPDH coding region

137

B

Fig. 3. Heteroduplcx analysis of recombinant phages 6y and 17y carrying GAPDH genes. (A)The indicated restriction sites and the GAPDH coding regions as deduced from the blotting analysis and previous results (Holland and Holland, 1980) are shown. Wavy lines indicate phage DNA and straight lines yeast DNA. Sizes of DNA fragments are given in kb (K). (B) An example of the heteroduplexes formed between the two phages is shown. The arrow (top, center) indicates the duplex region of homology between the GAPDH genes. The regions of homology at the ends represent the 2 vector arms.

shown in Fig. 2 (2C and 2D) demonstrate that a 5.8-kb EcoRI fragment and an 8.0-kb Hindlll frag- ment in phage 17y hybridize strongly with pp6y. The restriction =naps of phages 6y and 17y utilizing four different enzymes are shown in Fig. 3. The 3.2-kb EcoRI-Sall fragment of phage 17y, containing most ofthe hybridizing GAPDH sequence, was subcloned into pBR322. The resulting plasmid was designated ppl7y.

(c) Heteroduplex analysis

The sequence homology between phages 6y and 17y was further examined by heteroduplex analysis (Fig. 3). Heteroduplexes were formed in presence of 30% formamide. The orientation of the GAPDH sequences was the same in both phage, since a region of homology existed between the two inserts. All

heteroduplex molecules demonstrated two sipgle stranded bubbles separated by a duplex region of homology (Fig. 3B) that is about 1.2-kb long as measured relative to a size standard. The size of the homologous region is in agreement with the size of the message as determined by blot hybridization analysis (Fig. 4). Thus, the homologous regions in the two GAPDH genes do not appear to extend si~aaificantly outside the GAPDH coding region.

(d) Localization of the 5' and 3' termini

The Hinfl restriction maps for the inserts in the plasmids pp6y and pp 17y are shown in Fig. 5. DNA sequence analysis demonstrated (data not shown) that the 480-bp long Hin fl fragment of plasmid pp6y (fragment A) included the 5'-end region of the GAPDH gene. Similarly, the 2.0-kb-long Hin fl frag-

138

a b

1 5 2 5 -

1 0 8 5 -

9 9 5 - -

- - 1 2 0 0

Fig. 4. Size of GAPDH mRNA. Total yeast RNA (lane b) was denatured with glyoxal (McMaster and Carmichad, 1977), separated on a i.4% agarose gel and transferred to a nitro- cellulose filter (Thomas, 1980). The filter was then hybridized with probe from pp6y DNA. The size markers (also denatured with glyoxal) are end-labeled SV40 DNA cut with either Avail

or Hinfl (lane a). Sizes ofDNA f ra~en t s are specified in bp on the margins.

ment of ppl7y (fragment B) was shown to contain the 5' end of the second GAPDH gene that is included within the 5.8-kb EcoRl fragment (Holland and Holland, 1980). Plasmid pp6y and pp 17y DNAs were digested with Hinfl, the 5' ends labeled with 32p, and fragments A and B, respectively, were puri- fied by acrylamide gel electrophoresis. The 5'-end labeled fragments were used as probes to map the 5'-terminal portion of their corresponding mRNAs by S1 nuclease mapping (Berk and Sharp, 1977).

Since the 5' end of one strand of the Hin fl fragment maps well outside the expected GAPDH RNA 5'-end site, it was not necessary to subcut or separate strands. The S 1 resistant DNA/RNA hybrid mole- cules were resolved on 8 % polyacrylamide, 7 M urea gels (Fig. 5). The two distinct S l-resistant fragments found with each gene suggested the existence of two adjacent 5' termini (Fig. 5A, lanes 2 and 3; Fig. 5B, lanes 2 and 3). It is possible that the two fragments for each gene were the result of the S 1 nuclease "nibbling" one nucleotide into the RNA-DNA duplex. However, when varying amounts of S I nuclease were used, the two bands appeared in about the same ratios shown here. In addition, extension by reverse transcriptase of a 55-bp-long Taql-HinfI DNA fragment primer from np6y on yeast mRNA confirmed this result (Fig. 5B). A direct comparison of the positions of the double bands obtained in the S I analyses and primer extension studies with the DNA sequence for each gene indicates that the 5' ends of the genes, corresponding to pp6y and pp 17y, are located at positions -37 or -38 and -47 or - 48, respectively, upstream from the ATG (Fig. 5), with an uncertainty of +_ I bp due to the slightly different mobility of the S 1 and sequencing frag- ments. Position -37 and -38 in pp6y are an A residue and C residue, respectively, whereas posi- tions -47 and -48 in pplTy are both A residues.

Restriction analyses of the two phages, 6y and 17y, revealed a unique Sail site in close proximity to the 3'-end region of each GAPDH gene (Fig. 3). A previously published DNA sequence analysis of these two genes (Holland and Holland, 1980) indicated that a Sail site mapped at a position 30 bp upstream from the translation termination codon TAA for both genes. The EcoRI + Sail digestion patterns of the phages described here were each found to include the predicted fragments previously reported (Holland and Holland, 1980) (Fig. 3); these fragments are denoted A and B in Fig. 6B and contain the unique Sail site witkin the GAPDH coding region near the 3' end of both genes. Frag- ments A and B were purified by polyacrylamide gel electrophoresis, 3'-end labeled at the Sail site and used as probes to map the 3' termini of their respective mRNAs by S 1 analysis. The S 1-resistant RNA/DNA hybrid molecules were resolved on an 8% polyacrylamide, 7 M urea gel (Fig. 6). 1"he 3' terminal region of the mRNA that hybridized with

139

All

237- I

109- qp

8 5 - gI'

El 1 2 3 A G C T

.... 1 2 3 4 A G C T |

i : |'-". l 'Jo- ~ ,P

s o - ~ | .

76--

" ~ ~ , ~.,

~ ~ primer-- ~ a m ~'

~j~ ....,,. ~,~

i m p . . . . .

pp17y

ppGy

GAPDH 1 kb C . 5' ~.'H,,'H/~HHH,.'.~.'., 3' b ' i

pp6V PeR 322.~ . Frag A . ~ PeR .~2._i~ " d,,l ...... - - -

~-" . . . . . 83bp ..~ t,. ~ ,I,--- Primer ~ & TATATAA . . " " . _ ~ . ~ v ~ z , ~ . ~ b 73bp RNA/ONA hybrid

" ' " " " 1 " * ~ [ ~ . ~ ' m t ' ~ z ~ b' 721)0 RNAJDNA hybrid Hinf I ...... -.

Taq I T T T TAGTTTTAAAACACCAAGAACT 6Sall ? ECO RI A A A A A A A C C ~ I ~ I ~ ~ A . . . . . . .

C. 73bp ,. "-" ~'" 30bp--*le--33bp--,jL ' ' . . . . . . . . . . . . ATG ,.,,, 10 bp

~ .. . . . . 6 PBR 322 PBR 322_9 Frag B x 6 6 & &

I "1.0 kb ' pp 17y 5' " . . . . . . . . ~' . . . . ~ . . . . ;~ GAPDH

Fig. 5. Mapping of 5' termini ofGAPDH mRNAs. (A) S I resistant DNA/RNA hybrids of fragment B from pplTy and GAPDH RNA (lanes 2 and 3) were fractionated on an 8,% polyacrylamide, 7 M urea gel along with the sequencing ladder of fragment B. Lant: 1 shows size markers prepared by digestion of SV40 DNA with Hinfl. (B) SI mapping with fragment A from pp6y (lanes 2 and 3) and primer extension on GAPDH mRNA (lane 4) alongside the sequence ladder of fragment A. A shorter exposure for the autoradiography shows two distinct bands for the primer extension. The markers in lane i are from a Hpal digest ofpBR322, tC) Diagrammatic representation of the 5'-end mapping experiments, as described in RESULTS, section d. The sequences shown are the complement of those read from the gels in A and B.

fragment B of 17y gave a protected sequence 170 nucleotides in length (Fig. 6A, lane 3); hybridization with fragment A, on the other hand, gave two pro- tected sequences of 132 and 142 nucleotides in length as well as a very minor component at about 115

nucleotides (Fig. 6A, lane 4). These results demon- strate that transcription from the GAPDH gene. par- tially contained in fragment A, terminates primarily at two points ten nucleotides apart. Termination within fragment B occurs at a single site.

140

A# 1 2 3 4 6

l e 0 - 1 4 7 -

• :/~/:/ii~i:: ̧̧ 110 -

-170(b)

- 1 4 2 ~ ) -132(a')

- 1 7 9

__1~ ,::::::,i - 132

E l

RNA/DNA hybrid a I RNAJONA hybrid o' i

GADPH 5" - . . . . . . f 3"

6y1~ k'b ~ . ~ . . o . . P - - . . . .

~,,,B,~ ~'p a''p~'m ~ ~

~ k ' ~ - - ' 9 9 b p : CATTGATTGTAAG C ' r T C T ~ ( : A TAA

.... 142bp § , . ~ m . . N ~ l 3, RNA 132bp

5' ~ 3' RNA

5' ~ 3' RNA RNA/ONA hybrid b~2~__p p ------ 170bp I

- T-~A 130bp : TI"TG1, z u I v u u a,u u CC'I'TG. .

1 kb .l, z4,w~_.__ jo 4) 17y ,.-, . . . .

I u m

?Eco FII

? 6 46 OL-~,~a4,t, tCa

Fig. 6. Mapping of 3' termini of GAPDH mRNAs. S! nuclease mapping experiments with the EcoRI-Sall fragments A and B from phage 6y and 17y, respectivel~: Hpall-digested pBR322 DNA size markers (lane I); fragments A and B hybridized with chicken mRNA (lane 2); fragment B with yeast RNA (lane 3); fragment A with yeast RNA (lane 4); fragment A and B with yeast RNA (lane 5). Lane 6 demonstrates the approximate relative levels of the mRNAs from the two GAPDH genes as explained in RESULTS, section e. (B) Diagram of the 3'-end mapping experiments. The bracketed sequences are repeated in the 5'-nontranscribed sequences previously described (Holland and Holland, 1980), and are located just upstream of the sequences shown in Fig. 5C.

It is interesting to note that the transcripts for each gene terminate within sequences that are repeated in the 5'-non-transcribed region for the same gene (Holland and Holland, 1980) at positions - 123 to - 1 0 0 for 6y and - 1 0 6 to - 9 5 in 17y. These sequence elements, common to the 5' and 3' ends of each gene, are shown in brackets in Fig. 6B but are not present in the region shown in Fig. 5.

(e) Measurement of the relative amounts of GAPDH messages

To detect the relative levels of mRNA from each of the two G A P D H genes, the experimental con- ditions were adjusted to give approximately the same concentration of 3'-labeled ends for each gene in the S1 hybridization mapping experiments (Fig. 6,

lane 6). In this way, the intensity of the resulting hybrid bands provides a direct measure of the relative concentration of the mRNA for the two genes since the S 1 digestion destroys hybrids that arise from cross-hybridization. The transcripts from each gene appear to be expressed at comparable levels. However, between the two alternative ter- mination points within the gene partially contained in fragment A of phage 6y, the termination site corresponding to the 142 nucleotide long hybrid represents the preferred one.

DISCUSSION

When a chicken cDNA clone with part of the GAPDH coding region was used as probe in hybridi- zation with EcoRI digested yeast DNA, significant homology was detected. The probe hybridized to the three EcoRI fragments previously shown (Holland et al., 1979) to carry the three copies of the yeast GAPDH gene. The origin of ~ fourth 2.2-kb EcoRl fragment is not known. Thus, the strong protein homology among the GAPDH enzymes of different organisms is refected in homology at the nucleic acid level even though the degeneracy of the genetic code could result in considerable DNA sequence differ- ences. Taking advantage of this strong homology among the coding regions of the three GAPDH genes (Holland et al., 1979; Holland and Holland, 1980), a subcloned fragment of the initial gene isolate, pp6y, was used to isolate another copy of the GAPDH gene from a partial EcoRI yeast library. These two isolates, 6y and 17y, appear to carry yeast DNA fragments identical to the two genes described by Holland and Holland (1980) as judged by restriction enzyme analysis.

These cloned yeast genes were used in studies to localize the 5' and 3' termini of the GAPDH mRNAs. The gene mapping within the 12-kb EcoRI fragment of the recombinant A phage 6y codes for an RNA with a 5'-non-coding sequence that is 38 nucleotides long. Assuming that these ends represent primary transcription products, the transcription of this mRNA appears to start with a C or A residue, one nucleotide apart (Fig. 5C). This result was shown both by S 1 nuclease mapping and by primer extension of a 55-bp DNA fragment containing

141

30 bp of the coding region (Fig. 5C). Sequence TATATAA, similar to the "TATA" box involved in eukaryotic transcription initiation (Corden et al., 1980), maps at a position 143 bp upstream from the ATG translation initiation codon (Holland and Holland, 1980). Thus, there are 105 bp between the hypothetical promoter region and the 5' terminus of the message. A similar extended region between the "TATA" box and the 5' terminus of a messenger RNA sequence has also been reported for both the alcohol dehydrogenase I (Bennetzen et al., 1982) and the phosphoglycerate kinase genes of yeast (Dobson et al., 1982; Hitzeman et al., 1982). Since both these enzymes, like the GAPDH enzyme, are involved in the glycolytic pathway, it appears that this long spacing region may be a peculiarity of the glycolytic enzyme genes. Other yeast genes for which the 5' termini have been mapped (e.g. actin, Gallwitz et al., 1981; iso- l-cytochrome c, Faye et al., 1981; and his-3, Struhl and Davis, 1981)do not show this long spacing region; the distance is usually between 40 to 80 bp.

The GAPDH gene that is included in the insert of the recombinant 2 phage 17y, and is contained in the 5.8-kb EcoRI fragment, has a 5'-non-coding region that is 48 nucleotides long as shown in Fig. 5C. The putative initiation site for transcription of the second GAPDH gene has been localized by S1 nuclease mapping and is also represented by two termini, both A residues one nucleotide apart. The region between the "TATA" box at position - 134 and the 5' ter- minus of the message is, therefore, 86 bp long in the case of the second gene (Fig. 5C). As shown by Holland and Holland (1980), there is considerable homology in the DNA around the 5'-end positions of the two GAPDH genes.

The DNA sequences around the 5'-end positions of the GAPDH genes have several features in common with other yeast genes. Dobson et al. (1982) have recently compared the pdmaD" structures of the 5'-flanking regions of many yeast genes. Almost all have a "TATA" sequence while highly expressed yeast genes generally have a C + T-rich stretch about 50 to 100 bp downstream from the "TATA" box. A CAAG sequence usually follows about 8 to 12 bp downstream from this CT region. They have mapped the 5' end of the phosphoglycerate kinase gene approximately to within 10 bp of the CAAG in this gene. We show here that both GAPDH genes have

142

transcripts ~ith 5' ends in a CAAG sequence with a T-rich stretch about 7-8 bp upstream. The alcohol dehydrogenase I gene has two 5'-end sites in two closely spaced CAAG sequences with an upstream C + T-rich region (Bennetzen and Hall, 1982). Thus, the GAPDH genes share 5'-flanking region se- quences with other highly expressed yeast genes, and the 5'-end positions reported here are analogous to those for other yeast glycolytic genes.

The 3' termini of the two messages have also been mapped. The GAPDH gene included in the 12-kb EcoRl fragment from 6y has two major sites for transcription termination. One is located at 104 bp and the other 114 bp downstream from the TAA stop codon as shown in Fig. 6B. The gene that is contained in the 5.8-kb EcoRl fragment from 17y has a unique transcription termination site that is located 130 bp downstream from the TAA codon. All three of the termination sites described above are included within a 10-bp sequence that is repeated in the 5'-non-transcribed region of the corresponding gene 20 bp downstream from the "TATA" sequence. These repeat flanking sequences were previously described (Holland and Holland, 1980) but at that time no RNA mapping data had appeared in the literature. We have now shown that these repeat flanking sequences are located at the transcriptional termination site for two of the GAPDH genes. Whether these sequences have a termination function or play some other role on the 5' side of the GAPDH genes is not known at present.

Zaret and Sherman (1982) have compared the 3'-flanking regions of a number of yeast genes in an attempt to identify the features involved in transcrip- tion termination and polyadenylafion. A!though some homologies were noted, they are not as striking Orr as extensive as those seen for the 5'-flanking region (Dobson et al., 1982). The GAPDH 3' ends identified here for the gene in phage 6y do correspond closely to the regiot~ identified by Zaret and Sherman (~982) as a potential ~.errnination/polyadenylation site while the 3' end of the 17y gene maps well downstream from the predicted site. THUS, the sequences involved in transcription termination in yeast cannot yet be as readily predicted from sequence comparison as the initiation sites.

The S I nuclease mapping experiments also demonstrate that the level of mRNA is about the same for both genes when the carbon source is

glucose. Thus, both genes appear to be highly active. It will be of interest to obtain the third GAPDH gene and measure its mRNA level and to measure relative mRNA levels of the different GAPDH genes when the cells are grown on carbon sources other than glucose.

ACKNOWLEDGEMENTS

We would like to thank Dr. Gregory Thill for encouragement and helpful discussion. Thanks to May Liu for help in preparing the manuscript.

REFERENCES

Alwine, J.C., Kemp, D.J., Parker, B.A., Reiser, J., Renart, J., Stark, G.R. and Wahl, G.M.: Detection of specific RNAs or specific fragments of DNA by fractionation in gels and transfer to diazabenzyloxymethyl paper, in Wu, R. (Ed.), Methods in Enzymology, Vol. 68, Academic Press, New York, 1979, pp. 220-242.

Aviv, H. and Leder. P.- Purification of biologically active mes- senger RNA by chromatography on oligothymidylic acid- cellulose. Proc, Natl. Acad. Sci, USA 69 (1972) 14(,8-1412.

Bailey, J,M. and Davidson, N.: Methylmercury as a reversible denaturing agent for agarose gel electrophoresis, Anal. Biochem. 70 (1976) 75-85.

Bennetzen, J.L, and Hall, B.D.: The primary structure of the Saccharomyces cerevisiae gene for alcohol dehydrogenase I. J. Biol. Chem. 257 (1982) 3018-3025.

Benton, W.D. and Davis, R.W.: Screening ~.gt recombinant clones by hybridization to single plaques in situ. Science 196 (1977) 180-182.

Berk, A. and Sharp, P.: Sizing and mapping of early adenovirus mRNAs by gel electrophoresis of S 1 endonuclease-digested hybrids. Cell 12 (1977) 721-732.

Bolivar, F., Rodriguez, R.L., Greene, P.L., Betlach, M.C., Heyneker, H.L. and Boyer, H.W.: Construction and charac- terization of new cloning vehicles, 11. A multipurpose cloning sytem. Gene 2 (1977) 95-113.

Bosttan, K.A., Lemire, J.M., Cannon, L.E. and Halvorson, H.O.: In vitro s)nthesis of repressible yeast acid phosphatase: Identification of multiple mRNAs and products. Proc. Natl. Acad. Sci. USA 77 (1980) 450~-4508.

Corden, J., Vvasylyk, B., Buchwalder, A., Sassone-Corsi, P., Kedinger, C. and Chambon, P.." Promoter sequences of eukaryotic protein coding genes. Science 209 (1980) 1406-1414.

Davis, R.W., Simon, M.N. and Davidson, N.: Electron microscope heteroduplex methods for mapping regions of base sequence homology in nucleic acids, in Grossman, L. and Moid~xe, K. (Eds.), Methods in Enzymology, Voi. 21, Academic Press, New York, 1971, pp. 413-428.

Dobson, M3., Tuite, M.F., Roberts, N.A., Kingsman, A.J.,

143

Kingsman, S.M., Perkins, R.E., Conroy, S.C., Dunbar, B. and Fothergill, L.A.: Conservation of high efficiency promoter sequences in Saccharomyces cerevisiae. Nucl. Acids Res. 10 (1982) 2625-2637.

Efstratiadis, A., Maniatis, T., Kafatos, F.C., Jeffrey, A. and Vournakis, J.N.: Full length and discrete partial reverse transcripts of giobin and chorion mRNAs. Cell 4 (1975) 367-378.

Faye, G., Leung, D.W., Tatcheil, K., Hall, B.D. and Smith, M.: Deletion mapping ofsequences essential for in vivo transcrip- tion of the iso-l-cytochrome C gene. Proc. Natl. Acad. Sci. USA 78 (1981) 2258-2262.

Gallwitz, D., Perrin, F. and Seidel, R.: The actin gene in yeast Saechare'ny~'es cerevisiae: 5' and 3' and mapping, flanking and putative regulatory sequence. Nucl. Acids Res. 9 (1981)

6339--635O. Granger, B.L. and Lazarides, E.: Desmin and vimentin coexist

at the periphery of the myofibril Z disc. Cell 18 (1979) 1053-1063.

Hagenbilchle, O., Bovey, R. and Young, R.: Tissue-specific expression of mouse ~-amylase genes: Nucleotide sequence ofisoenzyme mRNAs from pancreas and salivary gland. Cell 21 (1979) 179-187.

Hitzeman, R.A., Hagie, F.E., Hayflick, J.S., Chen, C.Y., Seeburg, P.H. and Derynck, R.: The primary structure of the Saccharo- myces cerevisiae gene for 3-phosphoglycerate kinase. Nucl. Acids Res. 10 (1982) 7791-7808.

Holland, M.J., Holland, J.P. and Jackson, K.A.: Cloning ofyeast genes coding for glycolytic enzymes, in Wu, R. (Ed.), Methods in Enzymology, Vol. 68, Academic Press, New York, 1979,

pp. 408-419. Holland, J,P. and Holland, M.J.: Structural comparison of two

non-tandemly repeated yeast glyceraldehyde-3-phosphate dehydrogenase genes. J. Biol. Chem. 255 (1980) 2596-2605.

Hopper, J.E., Bostian, K.A., Rowe, L.B. and Tipper, D.J. :Trans- lation of the L-species dsRNA gcnome ofthe killer-associated virus-like particles ofSaccharomyces cerevisiae. J. Biol. Chem. 252 (1977) 9010-9017.

Hopper, J.E., Broach, J. and Rowe, L.: Regulation of the galactose pathway in Saccharomyces cerevisiae: induction of url:lyl- transferase mRNA and dependency on GAL 4 gene function Proc. Natl. Acad. Sci. USA 75 (1978) 2878-2882.

Jones, G.M.T. and Harris, J.l.: Glyceraldehyde-3-phosphate dehydrogenase: Amino acid sequence ofenzyme from baker's yeast. FEBS Lett. 22 (1972) 185-189.

Kramer, R.A. and Andersen, N.: Isolation of yeast genes with mRNA levels controlled by phosphate concentration. Proc. Natl. Acad. Sci. USA 77 (1980) 6541-6545.

Laemmli, U.K.: Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227 (1970)

680--685. Malamud, D. and Drysdale, J.W.: lsoelectric points of proteins:

A table. Anal. Biochem. 86 (1978) 620-647. Maniatis, T., Keb, S.G., Efstratiadis, A. and Kafatos, F.C.:

Amplification and characterization of a ~giobin gene synthe- sized in vitro. Cell 8 (1976) 163-182.

M~.xam, A. and Gilbert, W.: Sequencing end-labeled DNA with base-specific chemical cleavage, in Grossmann, L. and

Moldave, K. (Eds.), Methods in Enzymology, Vol. 65, Academic Press, New York, 1980, pp. 499-560.

McMaster, G.K. and Carmichael, G.G.: Analysis of single- and double-stranded nucleic acids on polyacrylamtde and agarose gels by using gloxal and acridine orange. Proc. Natl. Acad. Sci. USA 74 (1977) 4835-4838.

Olsen, K.W., Moras, D., Rossmann, M.G. and Harris, J.l.: Sequence variability and structure of D-glyceraldehyde 3-phosphate dehydrogenase. J. Biol. Chem. 250 (1975) 9313-9321.

Paterson, B.M. and Bishop, J.O.: Changes in the mRNA popula- tion of chick myoblasts during myo~enesis in vitro. Cell 12 (1977) 751-765.

Paterson, B.M. and Roberts, B.E.: Structural gene identification utilizing eukaryotic cell-free translational systems, in Chirikjian, J.G. and Papas, T.S. (Eds.), Gene Amplification and Analysis, Vol. 2, Elsevier/North-Holland, Amsterdam, 1981, pp. 417-437.

Pelham, H.R.B. and Jackson, R.J.: An efficient mRNA-depen- dent translation system from reticulocyte-lysates. Eur. J. Biochem. 67 (1976) 247-256.

Rigby, P.W., Deickmann, M., Rhodes, C. and Berg, P.: Labeling deoryribonucleic acid to high specific activity in vitro by nick translation with DNA polymerase i. J. Mol. Biol. ! 13 (1977) 237-251.

Roberts, B.E. and Paterson, B.M.: Efficient translation of tobacco mosaic virus RNA and rabbit globin 9S RNA in a cell-free system from commercial wheat germ. Proc. Natl. Acad. Sci. USA 70 (1973) 2330-2334.

Southern, E.M.: Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98

(1975) 503-520. Strohman, R.C., Moss, P.S., Micou-Eastwood, J., Spector, D.,

Przybyla, A. and Paterson, B.: Messenger RNA for myosin polypeptides: Isolation from single myogenic cell cultures.

Cell l0 (1977) 265-273. Struhl, K. and Davis, R.W.: Promoter mutants of the ),east his3

gene. J. Mol. Biol. 152 (1981) 553-568. Studier, F.W.: Analysis of bacteriophage T7 early RNAs and

proteins on slab gels. J. Mol. Biol. 79 (1973) 237-248. Thayer, R.E.: An improved method for detecting foreign DNA

in plasmids of Escherichia coll. Anal. Biochem. 98 (1979)

60-63. Thomas, P.S.: Hybridization ofdenatured RNA and small DNA

fragments transferred to nitrocellulose. Proc. Natl. Acad. Sci.

USA 77 (1980) 5201-5205. Westmoreland, B.C., Szybalski, W. and Ris, H.: Mapping of

deletions and substitutions in heteroduplex DNA molecules of bacteriophage lambda by electron microscopy. Science,

163 (1969) 1343-1348. ~,V.~olford, J.L. and Rosbash, M.: The use of r-looping foc

structural gene identification and mRNA purification. Nucleic Acids Res. 9 (1981) 5021-5036.

Zaret, K.S. and Sherman, F.: DNA sequence required for efficient transcription termination in yeast. Cell 28 (1982)

563-573.

Communicated by A.-M. Skalka.