This article appeared in a journal published by Elsevier. The attachedcopy is furnished to the author for internal non-commercial researchand education use, including for instruction at the authors institution

and sharing with colleagues.

Other uses, including reproduction and distribution, or selling orlicensing copies, or posting to personal, institutional or third party

websites are prohibited.

In most cases authors are permitted to post their version of thearticle (e.g. in Word or Tex form) to their personal website orinstitutional repository. Authors requiring further information

regarding Elsevier’s archiving and manuscript policies areencouraged to visit:

http://www.elsevier.com/copyright

Author's personal copy

Trafficking of the Potato spindle tuber viroid between tomato and Orobanche ramosa

T. Vachev a, D. Ivanova a, I. Minkov a, M. Tsagris b,c, M. Gozmanova a,⁎a Department of Plant Physiology and Molecular biology, University of Plovdiv, 24 Tsar Assen St., 4000 Plovdiv, Bulgariab Institute of Molecular Biology and Biotechnology, Foundation for Research and Technology-Hellas, P.O. Box 1527, GR-71110 Heraklion/Crete, Greecec Department of Biology, University of Crete, P.O. Box 2208 Heraklion, Greece

a b s t r a c ta r t i c l e i n f o

Article history:Received 22 July 2009Returned to author for revision11 August 2009Accepted 12 December 2009Available online 27 January 2010

Keywords:PSTVdOrobanche ramosaParasitic plant-host interactionsViroid-host interactions

Viroids, small RNA pathogens capable of infecting flowering plants, coexist in the field with parasitic plantsthat infest many crops. The ability of viroids to be exchanged between host and parasitic plants and spread inthe latter has not yet been investigated.We studied the interaction between the Potato spindle tuber viroid (PSTVd) and Branched bromrape(Orobanche ramosa) using the tomato, Solanum lycopersicon, as a common host.We report the long distance trafficking of PSTVd RNA via the phloem from tomato to O. ramosa, but not viceversa. Furthermore, we identify O. ramosa as a novel host with the ability to facilitate the replication andprocessing of PSTVd. Finally, molecular variants of PSTVd with single nucleotide substitutions that replicatewith different efficiencies in tomato were isolated from O. ramosa.

© 2010 Elsevier Inc. All rights reserved.

Introduction

Viroids are subviral pathogens that cause widespread infection inseveral crop plants, resulting in considerable yield losses (Diener,1999). The intriguing feature of these RNA pathogens is their small,circular, non-protein coding genome (246–401nt) that uses hostproteins in a sequence-specific, structure-dependent manner toachieve autonomous replication, systemic movement and pathoge-nicity (Tabler and Tsagris, 2004; Flores et al., 2005; Tsagris et al.,2008).

The Potato spindle tuber viroid (PSTVd) is the causal agent of thespindle tuber disease in potato crops (Owens, 2007). In addition topotatoes, PSTVd can infect several other types of crops, ornamentalplants and weeds (Singh, 1973; Singh et al., 2003; Matousek et al.,2007; Verhoeven et al., 2004). Identification of asymptomatic carriersamong hosts is of special importance because of their potential toserve as reservoirs for infection of other susceptible hosts, or to adopta symptomatic phenotype following a genetic or environmentalchange. Inside the plant, PSTVd exists as a population of similar, butnot identical, variants called a quasispecies (Holland et al., 1992;Codoner et al., 2006; Sardanyes et al., 2008). PSTVd variants that varyin RNA length from 341 nt ( Acc.No. Z34272.1) (Wassenegger et al.,1994) to 364nt (Acc.No. DQ308555, AY372395.1) have been isolatedand described in different hosts. Numerous studies on the accumu-lation profile of nucleotide substitutions and their effect on PSTVdstructure, replication, movement and pathogenesis have been

reported (Zhong et al., 2008; Matousek et al., 2004; Qi and Ding,2002; Owens et al., 1996; Hammond, 1994), rev in (Ding, 2009).

The molecular nature and life cycle of PSTVd makes it ideal forintracellular and intercellular RNA trafficking studies due to its simplestructure and relatively short length, as well as the differences inreplication and pathogenicity between strains. The PSTVd molecule isdivided into five domains: a central conserved domain (C), apathogenicity domain (P), a left terminal domain (TL), a variabledomain (V) and a right terminal domain (TR) (Keese and Symons,1985). Bulges, loops or metastable structures integrated within adomain are recognized as motifs that may attract host proteins forspecific functions. Besides the structural features of the circular PSTVdrod, additional metastable structures have been described, such as thespecific evolutionarily-conserved hairpins, HPI and HPII, and thecentral conserved (HI-CCR) sequence as well as the alternative stem-loop HPI structure it forms (Schmitz and Steger, 2007). The HI-CCRstructure was recently determined to be important in directing theimport of PSTVd into the nucleus (Abraitiene et al., 2008). Nucleartargeting is a crucial step in PSTVd infection because it ensures accessto the site of replication. Virp1 is a tomato protein localized in thenucleus that is necessary for PSTVd infection at the cellular level, andis a candidate for facilitating the nuclear import of PSTVd (Martinez deAlba et al., 2003; Kalantidis et al., 2007). However, PSTVd motifs andhost proteins that play a role in nuclear export remain unidentified. Inaddition, a selective strand specific intracellular localization has beendetermined for PSTVd. Newly synthesized circular genomic strands ofPSTVd appear to be sequestered primarily in the nucleolus, andantigenomic RNA is mainly localized to the nucleoplasma (Harderset al., 1989; Qi and Ding, 2003). This suggests that PSTVd is subject toselective intranuclear distribution, which may differ from viroid to

Virology 399 (2010) 187–193

⁎ Corresponding author.E-mail address: mariank@uni-plovdiv.bg (M. Gozmanova).

0042-6822/$ – see front matter © 2010 Elsevier Inc. All rights reserved.doi:10.1016/j.virol.2009.12.022

Contents lists available at ScienceDirect

Virology

j ourna l homepage: www.e lsev ie r.com/ locate /yv i ro

Author's personal copy

viroid of the same group. For example, strains of the related viroid,CEVd (Citrus exocortis viroid), have not been found in the nucleolus(Bonfiglioli et al., 1996).

PSTVd is also a good model system for the study of long-distanceRNA trafficking; (Di Serio and Flores, 2008; Ding et al., 2005). PSTVdsystematically infects the plant by moving from cell to cell throughplasmodesmata and the vascular tissue phloem (Zhu et al., 2001, 2002). Selectivity in systemic traffickingwasobserved at the intercellular andinter-organ level (Qi and Ding, 2002). A bipartite RNAmotif was foundto be responsible for trafficking of the viroid from the bundle sheath tothe mesophyll, while a tertiary structural motif is required fortrafficking from non-vascular into vascular tissues (Qi et al., 2004;Zhong et al., 2007). Recently, several loops, clustered in the variableand right terminal domains and at the junction between thepathogenicity domain and central region, were reported to beimportant for systemic trafficking (Zhong et al., 2008). Overall, efficientlong-distancemovement by PSTVd likely results from the formation ofspecific RNA-protein complexes (Ding, 2009; Qi and Ding, 2002;Maniataki et al., 2003). Complexes have been detected both in vivo andin vitro between phloem lectin PP2 and Hop stunt viroid (HSVd)(Gomez and Pallas, 2001; Gomez and Pallas, 2004; Owens et al., 2001)as well as between a tomato protein Virp1 and PSTVd (Martinez deAlba et al., 2003; Maniataki et al., 2003). Grafting experiments in theformer case suggested a role of PP2 in viroid systemic trafficking(Gomez and Pallas, 2004), while inability of Virp1 suppressed N.bentamiana protoplasts to sustain viroid infection suggests a role ofVirp1 in initial nuclear trafficking (Kalantidis et al., 2007).

In addition to viroids, studies on phloem-based RNA traffickingnetwork have been performedwith viruses (Gal-On et al., 2009) usingbromrape-tomato and bromrape-tobacco system as well as anaturally formed graft union of a dodder grown on tomato anddodder parasitizing pumpkin (Roney et al., 2007). Comprehensivereviews on long-distance trafficking and its role in the control ofcellular processes and on the growth and development of the planthave been published (Lee and Cui, 2009; Ding et al., 2005; Di Serio andFlores, 2008).

Our primary interest was to investigate cross-species trafficking ofPSTVd. Therefore, we chose to study the interaction between a hostplant, tomato (Solanum lycopersicum, former Lycopersicum esculen-tum), and the holoparasitic plant, Orobanche ramosa. In this model, aphloem linkage is established between O. ramosa and the host, whichfacilitates the study of the potential inter-species exchange of PSTVdand other RNA molecules (Dorr and Kollmann, 1995; Roney et al.,2007). In this work, a detailed analysis of PSTVd movement fromtomato to O. ramosa and vice versa has been performed. The potentialof O. ramosa to replicate and transmit PSTVd is also discussed.

Results

Transfer of PSTVd (+) RNA from tomato to O. ramosa

We first examined whether PSTVd is able to move from infectedtomato host plants to the O. ramosa parasitic plants that infest themduring growth.

The tomato plants were grown under standard greenhouseconditions in the presence of Orobanche seeds (see Materials andmethods). At the true leaves stage, the tomatoes were infected with invitro synthesized PSTVd (+) RNA transcript (approximately 250 ng).Four weeks after infection, tomato plants exhibited PSTVd specificsymptoms. The stems of the parasitic O. ramosa plants emerged fromthe soil four to five weeks later. The infestation of tomato seedlingswith O. ramosa did not influence the severity of the observed PSTVdsymptoms (data not shown). RNA samples were collected fromtomato leaves, the O. ramosa tubercle (the attachment organ totomato roots) and the O. ramosa stem after O. ramosa developedabove the ground. Northern blot analysis was performed with an in

vitro synthesized 32P-labeled PSTVd (−) RNA probe. This experimentwas repeated at least two times, and the results are presented inFig. 1A. Autoradiography detected a signal corresponding to themonomeric linear and circular forms of (+) PSTVd in all tested RNAsamples. This result demonstrated that PSTVd RNA is able to movefrom the infected tomato plant to the attached non-photosyntheticO. ramosa parasitic plant.

In order to test whether the PSTVd (−) RNA is also able to movefrom infected tomato to O. ramosa we subjected all tested RNA

Fig. 1. (A) Northern blot analysis to detect the transfer of PSTVd (+) RNA from infectedtomato plants to O. ramosa. RNA was extracted from PSTVd-infected tomato plants andfrom O. ramosa attached to the infected plants: Hybridization was performed with invitro synthesized 32P-labeled PSTVd (−) transcript. Samples were analyzed by 6% urea/PAGE. Lane 1, DNA length marker (pBR322 cut with HinfI). Lane 2, RNA from PSTVdinfected tomato leaves (IT); Lane 3, RNA from attached O. ramosa tubercles (OT); Lane4, RNA from O. ramosa stems (OS). mc and ml denote monomeric circular andmonomeric linear PSTVd, respectively. (B) Northern blot analysis to detect the transferof PSTVd (−) RNA from infected tomato plants to O. ramosa. Hybridization wasperformed with in vitro synthesized non-radioactive DIG-labeled PSTVd (+) transcript.Monomeric PSTVd RNA, dimers and oligomers of PSTVd were labeled with m, d and t.PSTVd in vitro transcript marked with capital T was loaded as a control. (C) PSTVd (−)specific RT-PCR analysis as described in Materials and Methods. The amplified productswere analyzed on a 1% agarose gel stained with EtBr. Lane 1, Gel Pilot 100 bp PlusLadder; Lane 2, RNA from PSTVd infected tomato leaves (IT); Lane 3, RNA from attachedO. ramosa tubercles (OT); Lane 4, RNA from O. ramosa stems (OS). Lane 5, negativecontrol (dH2O) (NC); Lane 6, positive control (PC).

188 T. Vachev et al. / Virology 399 (2010) 187–193

Author's personal copy

samples to two independent analyses Northern blot and RT-PCRanalyses (Figs. 1B, C). The screening of the membrane was done withnonradioactive DIG-labeled PSTVd (+) RNA probe. The PSTVd specific(−) signal was observed in the infected tomato as monomeric RNA,dimers and oligomers, while in the O. ramosa tubercle and stemsamples only longer oligomers were detected (Fig. 1B), most probablydue to limited concentration. In RT-PCR experiment, the reversetranscription was performed with a PSTVd (−) strand-specific primer(PSTVd forward primer) in order to detect replication products. A PCRanalysis using PSTVd forward and reverse primers revealed onespecific band of the expected size and several less abundant highmolecular weight forms that could be different oligomers. (Fig. 1C).Both experiments prove the presence of replicative intermediates inO.ramosa. Whether these minus-strand PSTVd RNAs are truereplication intermediates in O. ramosa vascular tissue, or simplytrafficking molecules moving from tomato to O. ramosa, cannot bedetermined from these experiments.

In order to analyze the viroid population that hasmoved fromPSTVdinfected tomato to non-infected O. ramosa we have performed RT-PCRwith RNA samples isolated from tomato leaves and O. ramosa stem. Theamplified products were cloned in pCRII TOPO vector system (Invitro-gen). Several clones were analyzed by sequencing and the resultsshowed that only PSTVd WT was translocated to O. ramosa stem.

Transfer of PSTVd RNA from O. ramosa to tomato

In vitro synthesized PSTVd (+) RNA was mechanically appliedusing carborundum as an abrasive and pinpoint puncture of the stemof O. ramosa after the seedlings rose above ground. Four weeks afterinoculation, samples were collected from the stem and tubercle of theinfected O. ramosa, and from leaves of the tomato to which O. ramosawas attached. The extracted total RNA was analyzed by RT-PCRmethod. (Fig. 2). It showed the presence of both plus-strand andminus-strand PSTVd RNAs in the stem of O. ramosa that implies areplication of PSTVd in the O. ramosa stem. No trafficking of PSTVd ofeither polarity from infected O. ramosa to tomato was detected by RT-PCR analysis. (Fig. 2A).

Fig. 2. (A) RT-PCR analysis to detect the PSTVd RNA in PSTVd inoculated O. ramosa(4 weeks p.i.), and the tomato to which O. ramosa had parasitized. Strand specific RT-PCR amplified products were analyzed on a 1% agarose gel stained with EtBr. Lane 1,100 kb ladder (Invitrogen); Lane 2, positive control PSTVd infected tomato leaves, RT-PCR specific for detection of PSTVd (+) strand; Lane 3, PSTVd infected O. ramosa stem,detection of PSTVd (+) strand; Lane 4, PSTVd infected O. ramosa stem, detection ofPSTVd (−) strand; Lane 5, PSTVd infected O. ramosa tubercle, detection of PSTVd (+)strand; Lane 6, PSTVd infected O. ramosa tubercle, detection of PSTVd (−) strand; Lane7, tomato leaves from an infected O. ramosa parasitized plant, detection of PSTVd (+)strand; Lane 8, tomato leaves from an infected O. ramosa parasitized plant, detection ofPSTVd (−) strand; Lane 9, healthy tomato leaves; Lane 10, negative control (dH2O). (B)RT-PCR experiment, the reverse transcription was performed with PSTVd (−) strand-specific primer (PSTVd forward primer) in order to detect replication products; Lane M,Gel Pilot 100 bp. Plus Ladder; Lane 1, PSTVd infected O. ramosa stem, detection of PSTVd(−) strand; and with PSTVd (+) strand-specific primer (PSTVd reverse primer); Lane2, PSTVd infected O. ramosa stem, detection of PSTVd (+) strand; Lane 3, negativecontrol (dH2O) (NC); Lane 4, pHa106 plasmid as positive control (PC).

Fig. 3. Comparison of nucleotide sequence and secondary structure of the three PSTVd variants of O. ramosawith those of PSTVd isolate KF 440-2 at 28 °C as predicted by the MFoldRNA program (http://mfold.bioinfo.rpi.edu/cgi-bin/rna-form1-2.3.cgi).

189T. Vachev et al. / Virology 399 (2010) 187–193

Author's personal copy

Replication of PSTVd in O. ramosa, cloning and sequencing analysis ofPSTVd variants

We next examined whether replication of PSTVd in the stem of O.ramosa has an influence on the quasispecies population, and whetherspecific PSTVd mutants arise during replication. Therefore, we clonedand sequenced cDNAmolecules amplified by RT-PCR of RNA extractedfrom three individual PSTVd directly infected O. ramosa plants. PSTVdcDNA amplification products were cloned into the pCRII TOPO vectorsystem (Invitrogen). Of thirty clones sequenced, three PSTVd variantsof O. ramosa were identified which differ from the WT by a singlenucleotide substitution (Fig. 3). PSTVd variant C227-U was mapped tothe lower strand of the V domain, variant C208-U was located in thelower strand of the RY motif of the TR domain, and variant G241-C wasfound in the lower strand of the C domain of the viroid secondarystructure (Fig. 3). No sequence variation was detected in thepathogenicity (P) domain or in the left terminal domain (TL) of thePSTVd molecule.

Secondary structure analyses of all detected PSTVd variants wereperformed using the M-Fold RNA program (http://mfold.bioinfo.rpi.edu/cgi-bin/rna-form1-2.3.cgi; (Zuker, 2003)) (Fig. 3). RNAfolding at 28 °C revealed structural changes (a loss of the loop andgeneration of an elongated stem) in the PSTVd variant C227-U anddisruption of the RY motif in the TR domain in PSTVd variant C208-Ucompared to the wild-type PSTVd sequence. No major conformationaldifferences in secondary structure were detected in the PSTVd variantG241-C (Fig. 3).

Bioassay of tomato and O. ramosa infected with the PSTVd variants

In order to determine the infectivity of PSTVd mutants isolatedfrom O. ramosa, we infected tomato cv. Rentita with the threemutants, and cloned and sequenced the PSTVd-infected progeny ofthe plants. All PSTVd variants were cloned into a pHa106 plasmid togenerate longer-than-unit length PSTVd RNA transcripts under thecontrol of the SP6 promoter (Tsagris et al., 1991). The in vitrotranscribed PSTVd variants were applied to tomato leaves and, fourweeks after infection, the tomato plants were examined for PSTVdsymptoms. Interestingly, the G241-C variant elicited symptomssimilar to wild-type PSTVd (stunting, leaf deformation), while theC208-U variant was asymptomatic until late stage of infection (28 d.p.i). C227U variant was not able to infect tomato plants. RNA samplescollected from systemic leaves were subjected to Northern blotanalysis (Fig. 4A and B) and RT-PCR (Fig. 4C). The RNA samples wereresolved on 1.4 % formaldehyde gel. The screening was done with anon-radioactive DIG labeled PSTVd (−) RNA probe. PSTVd specificsignals were detected for the G241-C and C208-U PSTVd variants,while the C227-U variant was not detected in any of the inoculatedtomatoes (Fig. 4). We analyzed two plants per variant: the G241-Cvariant showedmaintenance of mutation in the tested plants, while incase of the C208-U variant, we observed either preservation of themutation or reversion to the wild-type sequence. The C227U variantwas not detected in the upper leaves of the inoculated tomato plants.

All variants were analyzed for replication in the inoculated tomatoleaves (Fig. 5). The RNA samples were subjected to Northern blotanalysis using a nonradioactive DIG-labeled PSTVd (−) RNA probe.Both PSTVd circular and linear forms were detected for G241-C andC208-U variants except for the non-infectious C227-Umutant (Fig. 5).

Fig. 4. PSTVd variants arising from a PSTVd infected O. ramosa were back inoculated into a tomato in order to determine their infectivity. PSTVd variants isolated and cloned fromdirectly infectedO. ramosawere transcribed in vitro and the transcripts mechanically inoculated into the tomato cv. Rentita. Two different plants were infected in each case (A and B).RNA extracts from systemic leaves were analyzed by Northern blotting using in vitro synthesized DIG-labeled PSTVd (−) RNA transcript (A, B) or RT-PCR (C). Lane IT, in vitro PSTVd(+) RNA transcript; Lane HC, healthy tomato control; Lane M, length marker (Gel Pilot 1 kb Plus ladder, Qiagen); LaneWT, 208, 227, 241, represent wild-type PSTVd and the G208U,C227U, and G241C variants, respectively. rRNAs were used as loading controls.

Fig. 5. Northern blot analysis to detect replication of PSTVd mutants in inoculatedtomato leaves. Lane T, in vitro PSTVd (+) RNA transcript; Lane M, length marker (RNALadder 0.1–1 kb USB); Lane WT, 208, 227, 241, represent wild-type PSTVd and theG208U, C227U, and G241C variants, respectively. The 5.8S rRNA was used as loadingcontrol. mc and ml denote monomeric circular and monomeric linear PSTVd,respectively.

Fig. 6. RT-PCR analysis to detect the PSTVd (−) strand in O. ramosa stem infected withPSTVd variants. Lane M, length marker (Gel Pilot 100 bp Plus ladder, Qiagen); Lane WT,241, 227, 208, represent wild-type PSTVd and the G208U, C227U, and G241C variants,respectively.

190 T. Vachev et al. / Virology 399 (2010) 187–193

Author's personal copy

The presence of circular form indicates that variants 241 and 208replicated on tomato.

PSTVd variants originating from O. ramosa were again mechani-cally inoculated on O. ramosa stems. After 20 days post infection, RNAwas isolated and the presence of (+) and (−) specific PSTVd RNAdetected by RT-PCR. All mutants replicated well on the host wherethey originally arose (Fig. 6). This result indicates that PSTVd variantC227U is able to replicate in the non photosynthetic host, but is noninfectious on tomato.

Discussion

The simplicity of the viroid genome, its pathogenic nature and itsmobility make it a good experimental system for the exploration ofthe intra-and intercellular movement of RNAs between host andparasitic plants. Additionally, a role for the weeds that are commonlyfound in potato fields (Chamomilla reculita, Anthemis arvensis, Vero-nica argensis and Amaranthus retroflexus) as alternative viroid hostsand/or transmitters has been reported (Matousek et al., 2007). Withregard to long-distance RNA trafficking, several different host systems(tomato, pumpkin, alfalfa and parasites Cuscuta, and Orobanchaceae)have been used to clarify interspecies translocation of endogenousRNAs and viruses (Roney et al., 2007). In our study we used tomato,one of the best hosts for potato spindle tuber viroid (no naturallyoccurring resistant tomatoes have been reported so far for PSTVd) andO. ramosa, which is an Orobanchaceae infecting tomato. Phloemcontinuity that forms the major long-distance symplastic transportpathway has been reported between O. ramosa and tomato (Dorr andKollmann, 1995; Hibberd and Jeschke, 2001). Therefore, this parasite/host plant pair is ideal for the study of PSTVd RNA transfer to and fromthe host.

PSTVd exploits the plant phloem system for its systemicmovement (Ding, 2009). Trafficking across specific cellular bound-aries and in different directions is believed to be a process tightlyregulated by molecular interactions (Zhong et al., 2008; Ding andItaya, 2007; Qi and Ding, 2002). Therefore, we sought to determinewhether parasitic plants are able to restrict viroid attack or act as ahost for it. The present study provides evidence that PSTVd can betransmitted from infected tomato plants to attached O. ramosa. Boththe linear and circular forms of the viroid were detected in tomato andO. ramosa. Furthermore, we provide evidence that O. ramosa can bemechanically infected with PSTVd RNA, and that replication of theviroid occurs in O. ramosa stems. However, replication was notdetected in the tubercle. Further, we could not detect the transfer ofPSTVd RNA from infected O. ramosa to tomato, suggesting that PSTVdmovement is unidirectional. The reason for this is most probably thatreplication is not supported in O. ramosa tubercles. It appears thatsuccessful replication of the viroid RNA is facilitated by currentlyunknown factors necessary for long distance movement though thephloem. Orobanche tubercles probably do not possess the necessaryhost factors. These observations suggest possible restrictions in cell tocell and/or long distance trafficking from the O. ramosa stem to thetubercle and finally to the host.

Mechanically infected O. ramosa stems were able to sustainreplicability of the pathogen RNA. Analysis of PSTVd progeny isolatedfrom O. ramosa revealed the presence of the wild-type PSTVdsequence and three sequences that contained a single point mutation.

The PSTVd variants isolated from O. ramosa revealed differences intheir pathogenicity and replicability when tested in tomato. Themutation in the G241-C PSTVd variant preserved the wild-typestructure and developed severe symptoms of PSTVd. The C227-Uvariant did not replicate or translocate into the upper leaves. At thisstage, we do not know whether this mutant is replication ortrafficking deficient in tomato. Bioinformatic structural analysis ofthe C227-U mutation performed both by us and another researchgroup revealed an elongated stem structure (Zhong et al., 2008) and

our data). C227-U PSTVd RNA was assessed by Zhong et al. (2008) tobe a trafficking defective mutant, at least in Nicotiana benthamiana.Detailed examination of all loops in the secondary structure of PSTVdshowed that the A135-C227 loop was important for trafficking butable to replicate on protoplasts (Zhong et al., 2008). Possibly, theelongated stem structure of this mutant renders it an efficientsubstrate for a plant Dicer Like enzyme (DCL) thus inhibiting itssystemic spread. Mutant C208-U showed symptoms at late stages ofinfection (28 d.p.i) in tomato. Structural analysis revealed significantdistortions in the structure of the RY motif, which is an importantdeterminant for binding to Virp1 (Gozmanova et al., 2003). PSTVdmutants with a disturbed RY motif were unable to interact with Virp1and exhibited compromised trafficking in tomatoes (Hammond,1994; Gozmanova et al., 2003).

All detected mutations may represent the rapid adaptation ofPSTVd in O. ramosa, which is a holoparasitic, non-photosynthesizingplant. Replication of PSTVd in this plant indicates that at least some ofthe physiological and biochemical reactions that occur duringphotosynthesis are not necessary for viroid replication.

Moreover the ability of viroid to infect non photosynthetic plant O.ramosa could highlight the role of asymptomatic viroid hosts and thepotential for PSTVd to spread from tomatoes to other crops viainfection of O. ramosa, which is important issue in the control ofviroids in agriculture.

Materials and methods

Plant material

O. ramosa L., section Trionychon is a root parasite that lackschlorophyll and is fully dependent on the host's nutrient supply(Musselman, 1994).

Seeds of O. ramosa and tomato were planted together in soil. TheOrobanche seeds were surface-sterilized using commercial bleach(5% sodium hypochlorite, containing 0.1% Tween) for 10 min and 70%ethanol for 2 min. The seeds were then rinsed three times with steriledistilled water (Batchvarova, R. personal communication). Tomatoplants (S. lycopersicum or L. esculentum), cv. Rentita, were grown at28 °C with a photoperiod of 14 /10 h light/ dark cycle.

In vitro transcription and inoculation of plants

Experiments were performed with PSTVd isolate KF-440-2(Accession number X58388, Gene Bank). The longer-than-unit-lengthPSTVd (+) RNA was obtained by in vitro transcription with Sp6 RNApolymerase as described previously (Hammann et al., 1997) usingEcoRI-linearized pHa106 plasmid as template (Tsagris et al., 1991).To infect the plants, 250 ng of RNA was applied to each young tomatoplant (cv. Rentita) and 500 ng was applied to O. ramosa. The transcriptwas rubbed into the tomato leaf and pin-point punctured into the O.ramosa stem.

RNA extraction

Four weeks after inoculation, total RNA was extracted from eachplant as described previously (Papaefthimiou et al., 2001). The qualityof the RNA preparations was checked with 1% agarose gels stainedwith ethidium bromide and visualized under UV light. The quantitywas determined spectrophotometrically.

Northern blot analysis

RNA samples (10 μg) were separated on a 1.4% formaldehydeagarose gel. Samples were blotted on nylon membrane overnight bycapillary transfer using 2×SSC. The membrane was stained withmethylene blue and then prehybridized in hybridization buffer

191T. Vachev et al. / Virology 399 (2010) 187–193

Author's personal copy

(5×SSC, 50% Formamide, 1×Denhardt's-solution, 1% SDS, 100 μg/mlheat-denatured yeast tRNA) at 68 °C for 1–2 h.

Hybridization was performed in the buffer described above byadding the in vitro synthesized PSTVd (−) RNA probe (pHa106,linearized withHindIII and transcribedwith T7 RNA polymerase (NewEngland Biolab), in the presence of 32P-UTP) using approximately2×105 cpm/ml of hybridization solution. The membrane wasincubated overnight at 68 °C, and then washed once with 2×SSC for5 min and twice with 2×SSC containing 0.2 % SDS for up to 30 minuntil the background was sufficiently low.

The same RNA samples (7 μg) were also separated on 10% urea-PAGE and electro blotted (7V, 40 mA) onto a Nylon membrane using0.5×TBE buffer. Prehybridization and hybridization were performedat 68 °C as described above.

Hybridization with digoxigenin-labeled in vitro synthesized PSTVd(−) transcript was also performed. The labeling reaction wasperformed according to the instructions in the DIG Northern StarterKit (Roche). 1 μg pHa106 plasmid, linearized with HindIII, wastranscribed with T7 RNA polymerase using DIG-labeled UTP for 1 h at42 °C. Prehybridization was performed with high SDS buffer (7% SDS,50% deionized formamide, 5×SSC, 2% blocking reagent, 0.1% (w/v) N-laurylsarcosine, 50 mM sodium phosphate, pH 7.0) at 68 °C for 1 h.Hybridization was carried out overnight at 68 °C in the same bufferwith the addition of DIG-labeled PSTVd (−) RNA transcript (100 ng/ml hybridization buffer). After hybridization, the membrane waswashed twice for 5 min in 2×SSC containing 0.1% SDS at roomtemperature, followed by another two washes for 15 min in 0.1×SSCcontaining 0.1% SDS at 68 °C. The hybridized probes were detectedwith anti-digoxigenin-AP and Fab fragments, and visualized by colorreaction with NBT/BCIP Ready-to-Use Tablets (Roche).

RT-PCR analysis

Total RNA (1 μg) from tomato leaves and the tubercle and stem ofO. ramosa was reversed transcribed with 40 U of M-MuLV RT and1mMof NTPs in 1×RT buffer (New England Biolab). The primers usedin cDNA synthesis were either PSTVd forward (ATCCCCGGG-GAAACCTGGAGCGA) or PSTVd reverse (CCCTGAAGCGCTCCTCCGAG)(Weidemann and Buchta, 1998). The reverse transcribed PSTVd DNAwas amplified by PCR with both primers listed above. The amplifica-tion reaction was performed according to the following program:94 °C for 5 min, followed by 25 cycles of 94 °C for 30 s, 63 °C for 30 s,72 °C for 40 s, and a final extension step at 72 °C for 10 s. The amplifiedproduct was run on 1% agarose gel and stained with EtBr.

Cloning of PSTVd variants isolated from O. ramosa

After RT-PCR was performed with Vent DNA polymerase (NewEngland Biolab), the amplification products were cloned into a pCRIITOPO vector system (Invitrogen), according to the manufacturer'sinstructions. Sequencing was performed with Sp6 and T7 primer(AGOWA, Germany; or Microchemistry lab, IMBB, Crete).

Acknowledgments

We thank Prof. Sauerborn's laboratory at University of Hohenheim,Stuttgart, Germany and Dr. Maurizio Vurro, Instituto di. Scienze delleProduzioni Alimentari, Bari, Italy for providing uswithO. ramosa seeds.

Our research was supported by the Greek-Bulgarian BilateralProgramme (BG4-GR2161 and KA2161) and the VU204 Bulgariancontract.

References

Abraitiene, A., Zhao, Y., Hammond, R., 2008. Nuclear targeting by fragmentation of thepotato spindle tuber viroid genome. Biochem. Biophys. Res. Commun. 368 (3),470–475.

Bonfiglioli, R.G., Webb, D.R., Symons, R.H., 1996. Tissue and intra-cellular distribution ofcoconut cadang cadang viroid and citrus exocortis viroid determined by in situhybridization and confocal laser scanning and transmission electron microscopy.Plant J. 9, 457–465.

Codoner, F.M., Daros, J.A., Sole, R.V., Elena, S.F., 2006. The fittest versus the flattest:experimental confirmation of the quasispecies effect with subviral pathogens. PLoSPathog. 2 (12), e136.

Di Serio, F., Flores, R., 2008. Viroids: molecular implements for dissecting RNAtrafficking in plants. RNA Biol. 5 (3), 128–131.

Diener, T.O., 1999. Viroids and thenature of viroiddiseases. Arch. Virol. Suppl. 15, 203–220.Ding, B., 2009. The biology of viroid–host interactions. Annu. Rev. Phytopathol. 47, 105–131.Ding, B., Itaya, A., 2007. Control of Directional Macromolecular Trafficking Across Specific

Cellular Boundaries: A Key to Integrative Plant Biology. JIPB. 49 (8), 1227–1234.Ding, B., Itaya, A., Zhong, X., 2005. Viroid trafficking: a small RNA makes a big move.

Curr. Opin. Plant Biol. 8 (6), 606–612.Dorr, I., Kollmann, R., 1995. Symplastic sieve element continuity between Orobanche

and its host. Bot. Acta 108, 47–55.Flores, R., Hernandez, C., Martinez de Alba, A.E., Daros, J.A., Di Serio, F., 2005. Viroids and

viroid-host interactions. Annu. Rev. Phytopathol. 43, 117–139.Gal-On, A., Naglis, A., Leibman, D., Ziadna, H., Kathiravan, K., Papayiannis, L.,

Holdengreber, V., Guenoune-Gelbert, D., Lapidot, M., Aly, R., 2009. Broomrapecan acquire viruses from its hosts. Phytopathology 99 (11), 1321–1329.

Gomez, G., Pallas, V., 2001. Identification of an in vitro ribonucleoprotein complexbetween a viroid RNA and a phloem protein from cucumber plants. Mol. Plant-Microbe Interact. 14 (7), 910–913.

Gomez, G., Pallas, V., 2004. A long-distance translocatable phloem protein fromcucumber forms a ribonucleoprotein complex in vivo with Hop stunt viroid RNA.J. Virol. 78 (18), 10104–10110.

Gozmanova, M., Denti, M.A., Minkov, I.N., Tsagris, M., Tabler, M., 2003. Characterizationof the RNA motif responsible for the specific interaction of potato spindle tuberviroid RNA (PSTVd) and the tomato protein Virp1. Nucleic Acids Res. 31 (19),5534–5543.

Hammann, C., Hormes, R., Sczakiel, G., Tabler, M., 1997. A spermidine-inducedconformational change of long-armed hammerhead ribozymes: ionic requirementsfor fast cleavage kinetics. Nucleic Acids Res. 25 (23), 4715–4722.

Hammond, R.W., 1994. Agrobacterium-mediated inoculationof PSTVdcDNAsonto tomatoreveals the biological effect of apparently lethal mutations. Virology 201 (1), 36–45.

Harders, J., Lukacs, N., Robert-Nicoud, M., Jovin, T.M., Riesner, D., 1989. Imaging ofviroids in nuclei from tomato leaf tissue by in situ hybridization and confocal laserscanning microscopy. EMBO J. 8 (13), 3941–3949.

Hibberd, J.M., Jeschke, W.D., 2001. Solute flux into parasitic plants. J. Exp. Bot. 52 (363),2043–2049.

Holland, J.J., De La Torre, J.C., Steinhauer, D.A., 1992. RNA virus populations asquasispecies. Curr. Top. Microbiol. Immunol. 176, 1–20.

Kalantidis, K., Denti, M.A., Tzortzakaki, S., Marinou, E., Tabler, M., Tsagris, M., 2007.Virp1 is a host protein with a major role in Potato spindle tuber viroid infection inNicotiana plants. J. Virol. 81 (23), 12872–12880.

Keese, P., Symons, R.H., 1985. Domains in viroids: evidence of intermolecular RNArearrangements and their contribution to viroid evolution. Proc. Natl. Acad. Sci.U.S.A. 82 (14), 4582–4586.

Lee, Y.Y., Cui, W., 2009. Non Cell autonomous RNA trafficking and long distancesignalling. J. Plant Biol. 52, 10–18.

Maniataki, E., Martinez de Alba, A.E., Sagesser, R., Tabler, M., Tsagris, M., 2003. ViroidRNA systemic spread may depend on the interaction of a 71-nucleotide bulgedhairpin with the host protein VirP1. RNA 9 (3), 346–354.

Martinez de Alba, A.E., Sagesser, R., Tabler, M., Tsagris, M., 2003. A bromodomain-containing protein from tomato specifically binds potato spindle tuber viroid RNAin vitro and in vivo. J. Virol. 77 (17), 9685–9694.

Matousek, J., Orctova, L., Steger, G., Skopek, J., Moors, M., Dedic, P., Riesner, D., 2004.Analysis of thermal stress-mediated PSTVd variation and biolistic inoculation ofprogeny of viroid “thermomutants” to tomato and Brassica species. Virology 323(1), 9–23.

Matousek, J., Orctova, L., Ptacek, J., Patzak, J., Dedic, P., Steger, G., Riesner, D., 2007.Experimental transmission of pospiviroid populations to weed species character-istic of potato and hop fields. J. Virol. 81 (21), 11891–11899.

Musselman, I.J., 1994. Taxonomy and spread of Orobanche. In: Pieterse, A.H.,Verleij, J.A.C, ter Borg, S.J. (Eds.), Biology and management of Orobanche,Proceedings of Third International Workshop on Orobanche and Related StrigaResearch. Royal Tropical Institute. Amsterdam, Netherlands, pp. 27–35.

Owens, R.A., 2007. Potato spindle tuber viroid: the simplicity paradox resolved. Mol.Plant Pathology 8 (5), 549–560.

Owens, R.A., Steger, G., Hu, Y., Fels, A., Hammond, R.W., Riesner, D., 1996. RNA structuralfeatures responsible for potato spindle tuber viroid pathogenicity. Virology 222 (1),144–158.

Owens, R.A., Blackburn, M., Ding, B., 2001. Possible involvement of the phloem lectin inlong-distance viroid movement. Mol. Plant-Microbe Interact. 14 (7), 905–909.

Papaefthimiou, I., Hamilton, A., Denti, M., Baulcombe, D., Tsagris, M., Tabler, M., 2001.Replicating potato spindle tuber viroid RNA is accompanied by short RNAfragments that are characteristic of post-transcriptional gene silencing. NucleicAcids Res. 29 (11), 2395–2400.

Qi, Y., Ding, B., 2002. Replication of potato spindle tuber viroid in cultured cells oftobacco and Nicotiana benthamiana: the role of specific nucleotides in determiningreplication levels for host adaptation. Virology 302 (2), 445–456.

Qi, Y., Ding, B., 2003. Differential subnuclear localization of RNA strands of oppositepolarity derived from an autonomously replicating viroid. Plant Cell 15 (11),2566–2577.

192 T. Vachev et al. / Virology 399 (2010) 187–193

Author's personal copy

Qi, Y., Pelissier, T., Itaya, A., Hunt, E., Wassenegger, M., Ding, B., 2004. Direct role of aviroid RNA motif in mediating directional RNA trafficking across a specific cellularboundary. Plant Cell 16 (7), 1741–1752.

Roney, J.K., Khatibi, P.A., Westwood, J.H., 2007. Cross-species translocation ofmRNA from host plants into the parasitic plant dodder. Plant Physiol. 143 (2),1037–1043.

Sardanyes, J., Elena, S.F., Sole, R.V., 2008. Simple quasispecies models for the survival-of-the-flattest effect: the role of space. J. Theor. Biol. 250 (3), 560–568.

Schmitz, A., Steger, G., 2007. Potato spindle tuber viroid. Plant Viruses 1 (1), 1–10.Singh, R.P., 1973. Experimental host range of the potato spindle tuber “virus”. Potato J.

50, 111–123.Singh, R.P., Ready, K.F.M., Nie, X., 2003. Viroids: biology. In: Flores, R., Hadidi, A.,

Randles, J.W., Semancik, J.S (Eds.), “Viroids”, 1 vols. CSIRO Publishing, CollinwoodAustralia, pp. 30–48.

Tabler, M., Tsagris, M., 2004. Viroids: petite RNA pathogens with distinguished talents.Trends Plant Sci. 9 (7), 339–348.

Tsagris, M., Tabler, M., Sanger, H.L., 1991. Ribonuclease T1 generates circular RNAmolecules from viroid-specific RNA transcripts by cleavage and intramolecularligation. Nucleic Acids Res. 19 (7), 1605–1612.

Tsagris, E.M., Martinez de Alba, A.E., Gozmanova, M., Kalantidis, K., 2008. Viroids. CellMicrobiol. 10 (11), 2168–2179.

Verhoeven, J.T., Jansen, C.C., Willemen, T.M., Kox, L.F., Owens, R.A., Roenhorst, J.W.,2004. Natural infections of tomato by Citrus exocortis viroid, Columnea latentviroid, Potato spindle tuber viroid and Tomato chlorotic dwarf viroid. Eur. J. PlantPathol. 110, 823–831.

Wassenegger, M., Heimes, S., Sanger, H.L., 1994. An infectious viroid RNA repliconevolved from an in vitro-generated non-infectious viroid deletion mutant via acomplementary deletion in vivo. EMBO J. 13 (24), 6172–6177.

Weidemann, H., Buchta, U., 1998. A simple and rapid method for detection of Potatospindle tuber viroid by RT-PCR. Potato Res. 41, 1–8.

Zhong, X., Tao, X., Stombaugh, J., Leontis, N., Ding, B., 2007. Tertiary structure andfunction of an RNA motif required for plant vascular entry to initiate systemictrafficking. EMBO J. 26 (16), 3836–3846.

Zhong, X., Archual, A.J., Amin, A.A., Ding, B., 2008. A genomic map of viroid RNA motifscritical for replication and systemic trafficking. Plant Cell 20 (1), 35–47.

Zhu, Y., Green, L., Woo, Y.M., Owens, R., Ding, B., 2001. Cellular basis of potato spindletuber viroid systemic movement. Virology 279 (1), 69–77.

Zhu, Y., Qi, Y., Xun, Y., Owens, R., Ding, B., 2002. Movement of potato spindle tuberviroid reveals regulatory points of phloem-mediated RNA traffic. Plant Physiol. 130(1), 138–146.

Zuker, M., 2003. Mfold web server for nucleic acid folding and hybridization prediction.Nucleic Acids Res. 31 (13), 3406–3415.

193T. Vachev et al. / Virology 399 (2010) 187–193