Final Technical Report of KSCSTE (Back-to-lab) Project

TRACKING THE INVASION OF ACHATINA FULICA (BOWDICH, 1822) AND ITS ROLE IN SPREADING THE RAT LUNG WORM

ANGIOSTRONGYLUS CANTONENSIS.

Project Reference No: 06-32/WSD-BLS/2016/CSTE

Submitted By

Dr. Keerthy Vijayan Woman Scientist, BLP KSCSTE-KFRI

Dr. T. V. Sajeev, Scientist Mentor

DEPARTMENT OF FOREST ENTOMOLOGY FOREST HEALTH DIVISION

KSCSTE-KERALA FOREST RESEARCH INSTITUTE, PEECHI, THRISSUR, KERALA-680653

1 KSCSTE Reference no 735/2016/KSCSTE dtd 17.11.2016

2 Name of the Principal

Investigator

Dr. Keerthy Vijayan

3 Address

Molath House, Chuvattupadam, Panniyankara,

P.O, Palakkad, Kerala-678683

4 Department and

University/College

where the project has

been carried out

Department of Forest Entomology, Forest Health

Division, Kerala Forest Research Institute,

Peechi, Kerala-680653

5 Name and address of

the Mentor

Dr. T.V. Sajeev, Senior Principal Scientist, ,

Forest Health Division, Kerala Forest Research

Institute, Peechi, Kerala-680653

6 Title of the project Tracking the invasion of Achatina fulica

(Bowdich, 1822) and its role in spreading the rat

lung worm Angiostrongylus cantonensis.

7 Date of

implementation

December 2016

8 Tenure of the project 3 years eight months: From March 2016 to

August 2020

Contents

No Chapter Page No. Authorization 1

Acknowledgements 2-3

Abstract 4-5

1 Introduction 6-14

2 Review of literature 15-35

3 Objectives of the study 36

4 Materials and Methods 37-51

5 Results and Discussion 52-84

6 Summary 85-86

7 Outcomes of the Project (Brief summary) 87

i. Salient findings (in bullet points)

including technical details and innovations

87

ii. Publications 88

a) Journals (a. International, b. National), 88

b) Papers presented in Conferences 88-89

8 Scope of future work 90

9 Bibliography 91-111

1

Authorization

The work entitled - Tracking the invasion of Achatina fulica (Bowdich, 1822) and its role in spreading the rat lung worm Angiostrongylus cantonensis, by, Dr. Keerthy Vijayan was carried out under the Kerala State Council for Science

Technology and Environment, Women Scientist Division, Back to lab programme for

Women Scientists, Govt. of Kerala at Forest Health Division, Kerala Forest Research

Institute, Peechi. The project work was carried out under the mentorship of Dr. T.V.

Sajeev, Senior Principal Scientist Forest Health Division, Kerala Forest Research

Institute, Peechi. The project was initiated wide sanction735/2016/KSCSTE dtd

17.11.2016, with commencement date as 15/12/2016 and completion date as 20/08

/2020. The project was completed with financial expenditure of Rs. 19,45,000.

2

ACKNOWLEDGEMENTS

The work presented in this report would not have been possible without my smooth association

with many people. I take this opportunity to extend my honest gratitude and obligation to all

those who made this work possible.

First and foremost, I would like to extend my sincere gratitude to my mentor Dr. T.V. Sajeev

for introducing me to this exciting topic and for his dedicated help, advice, inspiration,

encouragement and continuous support, throughout the course of this work.

I express my heart-felt gratitude to the Director, Kerala Forest Research Institute and to all the

former Directors.

I am also extremely indebted to Ian Kendrich C. Fontanilla, Chris Wade, Fred Naggs, Menno

Schilthuizen, Annie Guiller, Robert Cowie, Dahira Beevi, Karuppachamy for their timely

advices when I was stuck. I expand my thanks to Dr. Jayashankar and Dr. Kamlesh Kumar

Mishra for providing samples for analysis.

I thank my friends Neethu, Maneetha, Soumya, Aswathy, Zaibin, Archana, Revathy,

Manjusha, Sowmya, Subin, Ratheesh, Presty, Majesh, Vimod, Muthukumar, Girija Chechi,

Anju, Alex, Bharath, Saranya and Bindu in the Entomology Department and Forest Health

Division for providing a wonderful working atmosphere. I wish to express my compassionate

appreciation to Siji for her affection and care.

My honest gratitude to all the farmers and friends who helped me in the field during sample

collections. My heartfelt regard to all the drivers of Kerala Forest Research Institute especially

to Late. Jayan for his love and care during field trips.

I gratefully acknowledge Kerala State Council for Science Technology and Environment, for

providing me financial support through the Women Scientist fellowship and Dr. K.R. Lekha,

head, Women Scientist division for her kind words.

3

I express my deepest gratitude and fondness to my family especially my son for their love, care

and patience during the course of my work. I owe my deepest gratitude towards my better half

Suganthan, for his endless support and understanding of my goals and aspirations.

As it is impossible to mention everyone, I thank one and all who helped me and for being with

me in tough times during the work.

__________________________________________________________________Abstract

4

ABSTRACT

The Giant African Snail Achatina fulica (Bowdich, 1822), a native to East Africa is one of the

rapid spreading invasive alien species in India. It has been classified among the worst 100

invasive species present in the world by IUCN. The snail was introduced from Mauritius to

India around mid-nineteenth century and has been spreading into many parts of India. The snail

invasion to south India happened in the first half of the twentieth century and parts of the state

of Kerala had been infested after 1950. The current project was attempted to track the invasion

of the Giant African Snail so to understand whether the invasion was a single event or whether

multiple introductions have happened and also to detect the presence of Angiostrongylus

cantonensis the nematode worm causing eosinophilic meningitis in children. The process of

tracking the invasion of the snail is important because since if it is a single event, the population

would have very limited genetic variability making it susceptible to population decline owing

to intrinsic factors like diseases. However, if multiple introductions have happened, the gene

pool will be quite wide making the populations persistent for a long time. Knowing the pathway

of the spread of the snail is essential in understanding its role in spreading the rat lung worm.

The snail infested localities were surveyed and samples were collected for molecular analyses.

Two mitochondrial markers 16s rRNA gene and cytochrome oxidase subunit I (COI) gene were

selected to trace the invasion events and its origin in south India and cytochrome oxidase

subunit I gene was used to detect the presence of Angiostrongylus cantonensis in the snail

populations of Kerala. A total of 268 snail infested localities were surveyed in South India, out

of which 208 samples were subjected to 16s rRNA gene amplification and 47 samples to

cytochrome oxidase subunit I (COI) gene amplification.

From this study a total of 18 16s rRNA haplotypes from India, among them 14 are unique to

this study and 13 COI haplotypes from the world were identified and among them 8 are from

India. The presence of Angiostrongylus cantonensis was detected from Kerala using the

Cytochrome oxidase subunit I gene. The most common 16s rRNA haplotype is C and the most

common COI haplotype is E in India. The study has also recorded haplotype H of 16s rRNA

gene from Kerala, which was previously known from Mayotte and Mauritius in the Indian

Ocean Islands. The COI haplotype analysis showed that the West African COI haplotypes are

derived from the Indian haplotype E, and the presence of a missing node between the haplotype

E and haplotype D from an unknown location in Africa in the network shows unsampled

5

putative haplotypes in the native range. The detection of the 16s rRNA haplotype H and

missing links in the COI network of haplotype analysis proves the hypothesis that the

introduction of Achatina fulica is through multiple introductions. The presence of the rat lung

worm from the populations of snail in Kerala shows that the spread of the snail could cause the

spread of the worms throughout.

Haplotype and nucleotide analyses of the Indian populations also shows that the snail has

higher genetic diversities than other invasive areas in the world. The wood import data of the

Cochin Port during the year 2016-2017 was corroborated with the molecular data. The data

showed that many different wood items were being imported from the snail infested countries

which includes Tanzania, a native range of the snail. The first known introduction in to India

was through snails brought to Calcutta from Mauritius. From Calcutta, the snails have spread

into many parts of South East Asia. Even though, haplotype C and H are present in Mauritius,

the haplotype H is not present in any of the South East Asian countries. With the evidence of

the 16s rRNA and COI gene sequences, which was supported by the heavy traffic of shipping

between snail infested countries and Kerala, the likelihood of the multiple invasion events to

India is proved and the presence of the rat lung worm Angiostrongylus cantonensis in the snail

populations of Kerala shows the importance of the spreading of the worm through the highly

invading movement of the snails.

______________________________________________________1: Introduction

6

1. INTRODUCTION

1.1 Biological invasion Biological invasion is considered to be a major threat to global biodiversity (Everett, 2000)

next to habitat fragmentation. Biological invasion occurs when a species breaches its

biogeographical barrier and extent its range. IUCN states that our planet is undergoing

biological homogenisation either through intentional or unintentional movement of species.

The human travel has increased rapidly during the last century and increase in trade and

commerce lead to an unprecedented movement of organisms across the globe. Human as they

disperse across the continents, have taken many other species along with them and helped those

to breach the geographical barriers. The animals and plants which these people have

domesticated also travelled along with them and settled in novel territories (Crosby, 1986).

Along with the domesticated species, representatives of non-domesticated species also have

hitch-hiked through several pathways that includes in having a ride on clothes, boats, wagons

and along domestic animals. These species forms the source of invasive species. The invasive

species ranges from micro-organisms, pathogens to plants, and from invertebrates to

vertebrates. The invasive species reaches an area, establishes itself on its own and spreads in

those areas where they are not native. The invasive alien species affects all environments

includes fresh water, marine, above ground and soil ecosystems, their services, human health

and culture. There are a plenty of evidences that a species which is not native to an area can

cause serious ecological and economic problems (Mooney et al., 2005). The invasive alien

species introduced into a new habitat will compete with the native flora and fauna for feeding

and other ecological necessities and thus completely replaces the native species. Thus, invasion

results in the complete loss of native species, which in turn indirectly affects the water

conservation, soil stabilization and pest control. Most of the agricultural pests are invasive in

nature (Pimentel, 1997). Invasive species directly affect human survival by clogging the water

ways, obstructing the navigation, destroying the homes and killing livestock and fisheries

(Mooney et al. 2005).

Invasive alien species are a threat to food security, human and animal health. The invasive alien

species causes extinction of some species globally and also threatens numerous native

7

species. On the IUCN analysis of the red list data, invasive alien species are considered to be

the second most severe threat associated with the extinction of amphibians, reptiles and

mammals (https://www.iucn.org/theme/species/our-work/invasive-species). The invasive alien

species are also affecting the global economy by incurring severe losses to agriculture and

forestry production sectors. Most of the invasive alien species are pathogens or weeds or pests

causing very huge damage to the crops, gardens and animals. They are posing serious health

risks to humans by acting as hosts to numerous pathogens. The invasive alien species also

affects food security. Their huge numbers in freshwater and oceans causes loss of fisheries also

(Pimentel, 2011).

The invasive alien species gets established into novel geographies through intentional and

accidental means. Intentional is the introduction in to a new area for purposes varied from food

sources, feed for poultry, livestock and fishery and horticultural trade etc., Accidental

introduction of the invasive alien species happens as seed contaminants, ballast water

discharge, hitch-hiking on vessels, or as packing or shipping materials. Accidental

introductions may occur through trade and commerce of wood materials, soil and manure etc.

When an invasive plant invades an area, it overtops the native species and competes with those

natives for soil and water and gradually replaces those species (Lockwood et al., 2007).

Molluscs are the second largest animal phylum after arthropods in numbers of the described

species so far with an estimated number of 200,000. Out of these 200,000 species of molluscs

40% comprises of land snails and hence they are potentially the most probable faunal invaders

(Cowie, 2000). Land snails are having a very low ability to move freely and to migrate, and

they have poor dispersal compared to other species. Even due to the low vagility and low

mobility, many of the land snails has become invasive pests in many places (Aubry et al.,

2006). Though the name sluggishness relates to the slow movement and lethargic activities of

molluscs, many species of both terrestrial and aquatic snails are found to be very efficient and

successful invaders (Gittenberger, 2012; Kappes and Haase, 2012; Pointier et al., 2005). The

rates of active dispersal of the snails differ seasonally, depending on meteorological characters

as well as changes in the state of vegetation and physiological state of snails during the year

(Baur, 1986). The intentional spread of the snails across continents is negligible as compared

to the rate at which the snails becomes invasive pests and the rate at which the snails colonise

in new areas. The snails aestivate during the seasons when the climate becomes extremely hot

(Jaremovic and Rollo, 1979) and this helps the snail from desiccation during long voyages and

8

many measurements showed that the temperature difference between ground and 6 cm above

the ground was 9.8° C. So, this aestivation helps the snails to reduce the water loss during hot

seasons. This is supposed to be the best adaptability of a snail to escape high temperatures

during cruises across oceans and to establish in newer destinations. When these snails get

dislodged from its aestivation sites for some reasons it will get attached to some other sources

like vehicles, train, animal or human which can act as a passive dispersal carriers. Wind and

water also transport species between two places and many studies shows that rafting might be

the most significant way of overseas dispersal of species (Vagvolgyi, 1976). Humans can also

act as the intentional as well as unintentional carriers of land snails. Humans transport the snails

for food also the snails hitchhike on vehicles and cargoes and gets transported. In the case of

an invasive species, many failed attempts can happen prior to the successful establishment of

the species in a location (Szalontayová, 2010). This poses the problem of predictability of the

invasion success. Among the molluscan invaders of the world, the most studied and widely

distributed one is the Giant African Snail Achatina fulica.

1.2 The Giant African Snail Achatina fulica Achatina fulica (Bowdich, 1822) is known as the Giant African Snail due to its size and its

nativity. It is native to East Africa especially Kenya and Tanzania. The snail is coming under

the Phylum Mollusca, Class Gastropoda, Order Stylammatophora, Family Achatinidae and

Genus Achatina (Mead, 1961). It is a protandrous simultaneously hermaphroditic land snail.

That means, each individual first matures as a male, producing only sperm, and becomes truly

hermaphroditic later (Tomiyama, 1996). The mature snail lays about 200 to 400 eggs per clutch

and the egg hatches in 7 days. The hatchlings feeds on the egg shells soon after hatching. About

six to eight months the snail reaches maturity with 7 whorls in its shell.

The giant African land snail Achatina fulica is a macro phytophagous and it feeds on around

500 species of plants (Figure 1.1). Due to this diet the Giant African Snail is considered to be

one among the World’s most devastating pest and listed in the Global Invasive Species

database as one among the hundred worst of the invasive species in the world. (Lowe et al.,

2000). As of now the Giant African snails are widespread in all the continents except Antarctica

and are highly invasive in at least 52 countries (https://www.cabi.org/isc/datasheet/2640, last

modified 6th December 2020).

9

Figure 1.1 Giant African Snail Achatina fulica

10

In addition to the 500 species of plants the snail consumes, the snail will also eat upon decaying

organic matter like dung, garbage, wet paper, cardboards, animals and dead snails of its own

type (Srivastava, 1992).

It is the largest gastropod mollusc and economically most important snail pest in the world.

Invasive molluscs can have important impacts on agriculture (Barker, 2002; Godan, 1983;

Henderson, 1989), biodiversity (Coote and Loève, 2003; Lydeard et al., 2004), and human

health (Hollingsworth et al., 2007; Hollingsworth and Cowie, 2006; Madsen and Frandsen,

1989; Pointier et al., 2005) and can become major public nuisances (Civeyrel and Simberloff

1996). Because of the voracious feeding and the speed of spread, the Giant African Snail is the

most harmful invasive species in the tropical region. This snail is known as a vector of at least

two human disease agents: the rat lung-worm Angiostrongylus cantonensis (Chen, 1935) and

a gram-negative bacterium, Aeromonas hydrophila, which causes a wide range of symptoms

(Dean et al., 1970; Mead 1956 & 1961; Mead and Palcy, 1992; Wallace and Rosen, 1969).

Outbreak of A. cantonensis meningitis has been reported among travellers returning from the

Caribbean (Slom et al., 2002).

The native range of Achatina fulica is considered to be East Coast of Africa especially from

Mozambique in the South to Kenya and Somalia in the North (Mead, 1949). Around 1800s the

snail has reached Mauritius from East Africa or Madagascar. From Mauritius it spread in to

British Dominions and Colonies of Comoros, Mayotte, Seychelles and Reunion Islands. In

1847 the snails were introduced to India and in 1900s the snail was introduced to Ceylon. Later

by 1900s to 1940s the snail has been reported from South East Asian Countries of Malaysia,

Singapore, Thailand, Vietnam and Indonesia. The snail has mainly spread through botanical

and horticultural shows of plant materials from Calcutta. The Chinese population has also

facilitated the dispersal in the above countries by using the snails as duck feeds and through

this only the snail has reached Hong Kong, Taiwan and China. The Second World War gave

the snail an opportunity to establish in many Indo-Pacific countries. The Japanese armed forces

and merchants carried the snail Southwards and introduced them to many islands include New

Guinea, New Britain and New Ireland on their conquest of the Pacific islands. The Japanese

also introduced the snail to Pacific islands of Saipan and Tinian in the Marianas Islands as a

food for the natives. Snails also reached the Hawaiian island during 1936 from Japan or

Formosa (Bequaert, 1950; Mead, 1949; Rees, 1950). The Giant African Snails were introduced

to Brazil from Indonesia for commercial snail farming in 1980s. When the venture became

11

failure, the snails were let loose and now whole of the country is invaded by this snail (Thiengo

et al., 2007). In the Lesser Antilles, the snail was first introduced in the year 1984 in

Guadeloupe and later spread to Martinique, Marie Galante and Saint Martin in the Caribbean

(Pollard et al., 2008). The snail has invaded Florida of United States of America in the year

1969 and was completely eradicated through massive campaigns and actions. A second

infestation was found in Miami in the year 2011 and the eradication is still continuing

(Ciomperlik et al., 2013; Poucher, 1975). The most recent introduction of the snail was

supposed to be in Argentina in the Paranense rainforest during 2010 (Gregoric et al., 2011).

The different pathways of spread of these invasive species includes sea freight, nursery trade,

cargos, live food trade, contaminations, pets, road vehicles, transportation, military, deliberate

introductions etc.The recorded invasion history of A. fulica in Kerala region dates back to 1955.

By then it was introduced to Elappully of Palakkad District in the erstwhile Madras Presidency

by a researcher who brought a pair of snails from Annamalai University Chidambaram. It

turned out to be a pest in 1970s onwards in Kerala. From 2003 onwards, intermittent occurrence

of this snail was found in other districts of Kerala also. The occurrence of the snail in a locality

Willington Island in Ernakulam district of Kerala is associated with the opening of a timber

depot near to the infested area. Timber is being imported from different countries across the

world and the timber is transported between different districts of Kerala from here. This makes

it necessary to collect and correlate the wood import data with the present study. In 2010 10

out of 14 districts in Kerala (except Thrissur, Wayanad, Kottayam and Idukki) were infested

by this snail. Recently this snail was spotted in a single locality from Thrissur district also in

2015. Major outbreaks were observed in Konni of Pathanamthitta district followed by

Palakkad, Kannur, Ernakulam and Trivandrum districts. Legally an issue regarding the snail A.

fulica has been filed in Ombudsman's court. This snail as a pest cause damage to agriculture

crops, paddy fields and are a nuisance in the habitation area where they found to content their

body requirements.

1.3 Molecular phylogeography and invasion Each taxon is having its unique role in the ecosystem it is living and is influenced by its

geographic origin (Wilson, 1961). The main goals of the molecular systematics are to describe

and classify species based on the evolutionary relationship. Phylogeography is considered to

be subset of this discipline (Lydeard and Lindberg, 2003). According to Avise (2000),

12

Phylogeography “is a field of study concerned with the principles and processes governing the

geographic distributions of genealogical linkages, especially those within and among closely

related species. It also attempts to build empirical and conceptual bridges between macro- and

micro evolutionary patterns and processes”. In other words, phylogeography deals with

historical, phylogenetic components of the spatial distribution of the gene linkages. Now, the

most common molecular phylogeny method is Polymerase Chain Reaction, which enables the

in vitro amplification of DNA fragments using primers. The amplified product is purified,

sequenced, aligned and analysed (Lydeard and Lindberg, 2003). However, the presence of

mucopolysaccharides present in the tissues of molluscs makes the isolation, purification and

digestion of mitochondrial DNA difficult.

Mostly for the molecular phylogeographic studies, the mitochondrial DNA is used. Animal

mitochondria generally have a circular genome, which is generally having a size less than 20kb

and the gene content present in them will be highly conserved (Lydeard and Lindberg, 2003).

The mitochondrial genome is inherited maternally (Simison and Boore, 2008; Thomaz et al.,

1996). From the mitochondrial genes 16s rRNA gene (Pfenninger et al., 2007; Pfenninger and

Posada, 2002; Thomaz et al., 1996) or their combination has been used in many phylogenetic

studies. Mitochondrial genomes of Mollusca also vary from the vertebrate genomes

particularly by much variation in gene order (Lydeard and Lindberg 2003). In general molluscs

have a high rate of gene rearrangement as compared to other phyla (Serb and Lydeard, 2003;

Simison and Boore, 2008). In different studies the rate of evolution is considered to be different

for arthropods and the estimated time period is 2.3 % per million years. For land snails it is

much higher with a rate of 5 % per million years. (Masta, 2000). The mitochondrial DNA

fragment 16s rRNA gene has shown massive reduction in the genetic diversity in the freshwater

snail Potamopyrgus antipodorum introduced in Europe, which is also invasive in Australia and

North America (Städler et al., 2005). And considerably low genetic variation was observed in

the invasive apple snail Pila conica and Pomacea canaliculate, based on the sequences of the

mitochondrial markers COI and ND6 (Tran et al., 2008).

The invasions could happen through a single founding event or through multiple introductions.

This postulation can be tested using genetic markers which can identify the pathways of

invasions and to count the number of introductions (Facon et al., 2003). In some species the

introduction can happen with a very few individuals with reduced the genetic variability, and

still it could turn as a successful invader with that limited founders. High propagule pressure

13

and multiple invasions helps in the elimination of founder effect and several introductory

events could help in the range expansion of the invasive species (Roman and Darling, 2007).

This study uses the mitochondrial markers of 16s rRNA and COI genes to track the invasion

events of the invasive Giant African Snail in south India, tries to identify the origin of invasion

of the snail and to understand the population genetic structure of the snail in the invaded range.

1.4 Angiostrongylus cantonensis The rat lung worm Angiostrongylus cantonensis was first described by Chen (1935) in China.

Various species of rats are the definitive hosts of the nematode and rats are the only hosts in

which the adult stage of the nematode is seen. Yet, the third-stage larvae are infective to humans

if they are consumed unintentionally. The worms when ingested would migrate to the central

nervous system and cause eosinophilic meningitis in human (Slom et al., 2002). Even though

prawns, crabs, slugs and other snails are their intermediate hosts and able to spread the disease

to humans, the worm load is so high in the Giant African Snail due to its huge body size. In

human beings, the clinical manifestations of the infestations are variable. It ranges from

meningoencephalitis, eosinophilic meningitis, and diverse ocular manifestations.

(Balamurugan, 2019). Infections can occur due to the consumption of vegetables contaminated

with the larvae from the snails or other sources (Tiwari et al., 2019). These larvae from snail

debris or digested snail tissue in considerable number could contaminate the drinking water

(Richards and Merritt 1967). Cheng and Alicata in 1964 observed that the third stage larvae of

the nematode could survive in water for 22-24 hours even though the snail is drowned. The

larvae could reach human beings when the contaminated water comes in contact with the open

wounds (Cowie, 2013). In Kerala the first report on the Angiostrongylus cantonensis causing

eosinophilic meningitis in children came to light when not less than ten children infested with

the worm got treated by a pediatric neurologist from Amrita hospital in Kochi. He reports that

all of the children were from Giant African snail infested localities around Kochi and the

possibility of ingestion of the nematode larvae through snails (The Hindu, 16th July, 2014).

Three cases of Eosinophilic meningitis were reported from the hilly areas of Kerala and it was

associated with the consumption of raw and unwashed vegetables (Varghese et al., 2019).

These vegetables could have been contaminated through the snails or other creatures. The

presence of Angiostrongylus cantonensis in rats were confirmed from Kottayam district in the

state of Kerala and they recommend regular awareness and surveillance (Thomas et al., 2015).

14

Even-though the Eosinophilic meningitis caused by Angiostrongylus cantonensis is mostly

expressed in children, a 40-year-old woman from Southern Kerala also experienced the disease

in 2008. She has never consumed raw snails or lizards but the possible cause of the disease to

her is through contaminated vegetables, vessels or water since she was living in a surrounding

with high Giant African Snail infestation (Baheti et al., 2008). The latest case was reported

from a two-year old girl native of Annamanada Panchayat of Thrissur district in Kerala. She

was treated in Amrita hospital Kochi and the discharge summary reports Eosinophilic

meningitis (Pers comm). The Annamanada Panchayat and the nearby Mala Panchayat are

thoroughly infested with the Giant African snails and many other native snails are also seen.

The presence of this pathogen in the snails should be taken on a very serious manner because

there is an increase in the snail infested localities in Kerala year by year and the spread of the

species through flood waters.

________________________________________2: Review of Literature

15

2. REVIEW OF LITERATURE

2.1 Biological invasion and Invasive species An invasive alien species (IAS) is a species that is established outside of its natural past or

present distribution, whose introduction and/or spread threaten biological diversity” (IUCN).

Invasions occur when species are intentionally or accidentally introduced outside of their native

or historic range, and successfully spread in their new environment. The term ‘exotic species’

is used for a broader group that includes any species not native to a region, including livestock,

crops and garden plants. Only those exotic species that spread outside the human-dominated

environment are considered biological invaders (Levine, 2008). In the process of the

exploration of the new areas there has been a drastic breaking of the biogeographic barriers

which was surrounding the continents for millions of years. There are many examples of

invasive species changes the evolutionary paths of the native species by competitive

elimination, replacement of the niche, hybridization, and the transfer of genetic materials from

one species to another due to repeated back crossing, predation and ultimately extinction of the

species. The invasive species evolve in response to their interactions with native species as well

as their response to the new abiotic environment in which they are living in (Mooney and

Cleland, 2001). Sometimes before the rapid spread of the invasive species, there occurs a rapid

decline in many places and reasons for this remains mysterious. The widespread invasive snail

Achatina fulica and pondweed Elodea canadensis appear to be characterized by rapid spread

followed by rapid collapse. For the former species, disease may be the major cause of the

collapse, while the cause of the repeated collapse of the latter species remains unexplained.

Sometimes this decline may be due to a potent competitive invader (Simberloff and Gibbons,

2004). The invasive species are imposing high threat on the native taxa as well. The predation

by the invasive species and the competition with the invasive species has been the underlying

cause for the loss of the biodiversity in the invaded area and also there must be a prevention of

the further spread and public awareness creation is also important (Staples and Cowie, 2001).

2.2 Achatina fulica Bowdich, 1822 The tropical Giant African Snail Achatina fulica (=Lissachatina fulica) Bowdich, 1822 is one

of the most extensively studied snails because of its economic, ecological and medicinal

16

importance. A. fulica is a major crop pest in almost all plant species. A. fulica that originated

in East Africa is spreading in many places across the globe since 1800 (Figure 2.1) by human

activities (Mead, 1961 & 1979; Raut and Barker, 2002; Srivastava, 1992). The World

Conservation Union (IUCN) has listed A. fulica as one of the world’s 100 most invasive species

(Lowe et al., 2000). The snail also serves as the intermediate host of the rat lung worm

Angiostrongylus cantonensis (Fontanilla and Wade, 2012).

Achatina fulica is a large snail with a shell length ranging from 5 to 10 cm, with some

specimens even reaching 20 cm. The conical shell is light brown in colour, though the colour

pattern may vary. The presence of streaks is associated with a dominant allele such that

homozygous recessive individuals have un streaked shells (Allen, 1983). However, variation

in shell morphology in terms of size, shape and colour exists and has been largely attributed to

environmental conditions (Mead, 1961). A typical A. fulica has a life span of 5-6 years,

becoming sexually mature as early as five months. Although hermaphroditic, A. fulica cross-

fertilizes and lays eggs 8-20 days after mating. The number of eggs laid can vary depending on

the age of the snail but can reach up to 1800 in a year in a tropical setting. If conditions become

unfavorable, the snail can aestivate by burrowing underground and covering its shell opening

with a calcareous membrane, called an epiphragm, until such time as the environment improves

(Mead, 1979; Raut and Barker, 2002). A. fulica is a classic example of an introduced species.

Introduced species, also known as exotic species, are those found outside their natural range

due to human activity. Species may be introduced deliberately to benefit Man, with examples

including agricultural plants and animals for human consumption, decorative plants for

gardening, and animals for hunting or fishing. Other species may be introduced unintentionally

such as parasites or pests found in deliberately introduced species and those that “hitchhike”

with transported goods (Freeland, 2005).

Not all species become easily established once translocated into a new area, but characteristics

such as a rapid reproduction rate, high fecundity and generalist food and habitat requirements

can increase the success of an introduced species (Cowie, 2000). Organisms that become

invasive are also most likely to possess traits that facilitate their transport by humans, the ability

to withstand the severities of transport, the capacity to tolerate varying environmental

conditions, and the predilection to thrive in human disturbed areas (Suarez and Tsutsui, 2008).

17

Figure 2.1 Global spread of the Giant African Snail from Africa (After Raut and Barker, 2002)

18

The success of an introduced species in a new area can also be influenced by the genetic

composition of its population. In many cases, introduced species are represented by a few

individuals with a reduced amount of genetic variation when compared to their source

population, a phenomenon called a founder effect. After many generations, a population

bottleneck ensues where genetic variation is considerably reduced and allele frequencies

undergo massive shifts (Dlugosch and Parker, 2008).

As a consequence, some beneficial adaptive traits that could otherwise improve the survival

and fitness of the species in the new habitat may be lost (Kolbe et al., 2007). However, this low

genetic variability as a result of founder events and bottlenecking could be counteracted by

multiple introductions from different source populations (Dlugosch and Parker, 2008). Man

has always been drawn to the Giant African Land Snail for reasons including its large size,

supposed medicinal properties and its potential as a human or animal food source (Kliks and

Palumbo, 1992; Mead, 1979; Raut and Barker, 2002). It is for these reasons that Achatina fulica

has been spreading globally primarily through human factors, and its success as an introduced

species can be attributed to several factors. First, the biology of A. fulica makes it eminently

suitable as an introduced species. The snail has a high reproductive capacity, producing

between 10 and 400 eggs per clutch and as many as 1800 eggs per year, they also become

sexually mature between 5 and 8 months (Raut and Barker, 2002). Second, A. fulica possesses

traits that facilitate its transport by humans. For instance, the snails can easily be transported in

consigned cargoes, whether accidentally or on purpose, and survive the journey of several days

with little adverse effect on the “hitchhikers.” This was demonstrated by a tourist who came

from Hawaii and inadvertently brought a live snail to the mainland USA over a period of ten

days (Mead, 1979). During these periods of long-distance travel, the snails can undergo

aestivation to avoid desiccation (Mead, 1961). Furthermore, A. fulica has a wide tolerance for

different environmental conditions despite being a tropical snail (Mead, 1979; Raut and Barker,

2002). Third, A. fulica is commonly introduced deliberately and is therefore transported in large

numbers and properly cared for, which then increases its chance of survival. In Brazil, A. fulica

was introduced in 1988, probably from Indonesia, when it was heralded as an alternative source

of meat.

19

2.3 Achatina fulica invasion, Global Distribution

The native range of Achatina fulica is considered to be East Coast of Africa especially from

Mozambique in the South to Kenya and Somalia in the North (Mead, 1949). In Tanzania the

species is found abundantly along the East Usambara, West Usambara; T. Uluguru and Nguru

(Tattersfield, 1998). Rees (1950) suggests the voyage of the snail across the Pacific, tropical

and semi-tropical countries for the last 150 years. And he believes that the snail has reached

Mauritius from East Africa or Madagascar about 1800s. The odyssey of the Giant African

Snail from its native range across the globe has been described in many papers. The snail has

made its way to Mauritius from East Africa nearly by 1800s (Jerret, 1931). The dense

vegetation of the Mauritius is very rich in the snail population. The Ile aux Aigrettes of

Mauritius is experiencing a huge stress in the natural flora and fauna with the introduction of

the invasive Giant African Snail. Many trials are being done to eradicate the snail completely

from the island (Craze and Mauremootoo, 2002).

Malaysia and Singapore harbored the snail as early as 1911 and 1917, and Jarrett (1949)

believes that the snail reached Malaysia from India and Singapore from Malaysia. In these

countries the snail continues to be a pest in vegetables and crops (Srivastava, 1992). There was

a controversy in the influx of the snail into Indonesia. The snail first reached Java of Indonesia.

According to Kalshoven (1950), the snail has reached Bogor from Singapore in 1922, where

as in another report it says that the snail has reached the country from Ceylon (Sri Lanka) in

1925 along with the grass plants. Based on the assumption of Mead (1979), snail was not

considered to be a major pest in Indonesia. And it was found everywhere in the country like

West New Guinea, Biak Islands, Ternate, Halmahera, South Celebs, Southern Sumatra etc.

In China the snails were first reported from the Amoy University compound in 1931. There

was the presence of new plants in the University garden which was brought from Singapore

(Jarrett, 1949). Thus, he assumes that the snail has come there through these plants. This entry

later on spread the snail to South China and now the snails are found in great numbers in the

main land of China. By 1930s the snail has reached Borneo also. As mentioned earlier the snail

was transported as a feed for the poultry as carried across the livestock. The snail got

established and became a pest in late 1930s (Jarret, 1931). The snail moved to Taiwan as the

Taiwan Government introduced the snail in 1932. The snails died of cold weather and later

20

more specimen were brought in 1933 and those survived and started breeding there. This served

as the stock population to be introduced to Japan and Micronesia in 1942. The snail later on

spread to agricultural farms, vegetable gardens and citrus groves nearby (Srivastava, 1992). In

1937, the snail reached Hongkong and Thailand through the Chinese duck-keepers. Though

the snail spread to many parts across the country within ten years in Hongkong, the snail was

confined to the peninsular strip of the country in Thailand. The snail became a huge pest along

the agricultural lands and gardens, but later on the extreme climatic conditions has checked the

number of the snail and it drastically reduced in number in Hongkong (Mead, 1979). The

proliferation continues in Thailand.

The snail has been introduced and naturalized in the Pacific Caribbean and the Indian Ocean

islands (Fontanilla, 2010; Meyer and Picot, 2001). The Giant African Snail was introduced into

the Pacific Islands in 1938 from its home range. The snails have reached the Pacific Island

Saipan during the 1950s. But the local inhabitants believe that the snail was there in the island

ten years before. Townes (1946) has reported Achatina fulica from Saipan, Tinian, Rota, and

Guam in the Marianas and from Koror, Ponape (near Colonia), southern Babelthuap, Peleliu,

and part of Truk (DubIon) in the Carolines. Now it has become established in American Samoa,

Federated States of Micronesia, French Polynesia, Guam, Marshall Islands (on Kwajalein

atoll), New Caledonia, Northern Marianas, Palau, Papua New Guinea, Wallis/Futuna, and

Western Samoa. So far, GAS has not been reported from Cook Islands, Fiji, Kiribati, Nauru,

Niue, Pitcairn Island, Solomon Islands, Tokelau and Tonga. In 1995 and 1996 the snail was

reported from Western Samoa and Tuvalu in the islands of Vaitupu (Ag Alert, 1996).

Thailand served as the source of origin of the Giant African Snail to Japan. According to the

notes of Takahashi (1942) the entry of the Giant African Snail in Japan dates back to 1935, but

Mead (1961) suggests that the snail appeared in Japan in the same year as it appeared in

Formosa i.e., 1933.The snail was introduced to the Andaman and Nicobar Islands during

1937. It was introduced as a food for the World war prisoners who were kept in the Jail in Port

Blair in Andaman Island. It later spread to a large number of places in Andaman and Nicobar

Islands like North, Middle, South and Little Andamans, Long Island, Car Nicobar, Katchal,

Nancowry and Great Nicobar Islands. They were found to be consuming more than 225

varieties of plants (Prasad et al., 2004). Later in 1940s the snail reached the islands of

Phillippines, 1950s in Vietnam, Maldives and afterwards in 1960s in Cambodia and Myanmar

(Srivastava, 1992). The Giant African Snail has been considered as an agricultural pest and

21

carrier of diseases in Venezuela and it has been expanded to many parts of Venezuela since its

introduction there in 1997 (Escarbassiere, et al., 2008) and a single specimen introduction of

the snail happened in Caracas, Venezuela (Escarbassiere and Moreno, 1997). The snail has

reached the islands of Wallis and Futuna in the years of 1987 and 1991 respectively and turned

out to be a major invasive pest there.

The Giant African Snails were introduced into Mauritius first as a pig feed (Craze and

Mauremootoo, 2002) and later it has turned out to be an invasive species. The local fauna was

not able to control the snails so later on it become an invasive pest in the island. There is a vast

distribution of the Giant African Snail in Brazil. In Brazil also the snail became an invasive

species because of the introduction of the species as fish and poultry feed. The snail is

established across Brazil and the spread is found to be very rapid (Thiengo, et al., 2007). The

snail is widely distributed along the cities of Lauro de Freitas, Bahia state (Albuquerque et al.,

2008). The snail is first introduced in Brazil at São Paulo in April 1996 (Teles et al., 1997).

Later the distribution has been expanded to many places across Brazil like states of Amazonas,

Bahia, Espirito Santo, Goiás, Maranhão, Minas Gerais, Pará, Paraíba, Paraná, Pernambuco,

Piauí, Rio de Janeiro, Rondônia, Santa Catarina and São Paulo (Paiva, 2001). Human

establishment and spread turns out to be one of the major factor for the distribution of the Giant

African snail, where the snail is most abundant in places with high human density and another

factor is food preference. The snails are mostly feeding on vascular plants. So, they are

generally found in areas with high vegetation cover which suits its feeding preferences

(Albuquerque et al., 2008).

The entry of the snail which is able to make changes in the local flora and fauna into the

protected areas or national parks will be a big menace since it will be hampering the

biodiversity of the protected areas. In Argentina at Puerto Iguazú City, which is located at the

extreme northwestern corner of Misiones Province, which shares a border with Brazil and

Paraguay. The site of infestation is surrounded by protected areas such as the Iguazú National

Park (area of 676.2 km2), Puerto Península Provincial Park (area of 69 km2), and Urugua-í

Provincial Park with an area of 840 km2 (Gregoric et al., 2011). Only a single happening of the

massive eradication of the Giant African Snail happened in the world and it was in Florida.

Where the snail was introduced in 1966 and was completely eradicated with the combined

effort of the people and the Government machinery and awareness created among common

society (Poucher, 1975).

22

In the Lesser Antilles, a group of islands in the Caribbean Sea, the snail was introduced in the

year 1984 in a National Park in Guadeloupe intentionally and the attempts for its eradication

became in vain. Later the snail has spread to the islands of Martinique in 1988, Marie Galante

in the year 1995, and Saint Martin during 1995 (Pollard et al., 2008). The Giant African Snail

was also detected from Barbados in 2000 and from St. Lucia in 2002. Achatina fulica is also

present in Anguilla (Connor, 2006), Antigua, Dominica (Pollard et al., 2008) and also in and

Trinidad (Ministry of Agriculture, Land and Marine Resources, Trinidad and Tobago, 2009).

Many national parks and biodiversity rich areas of Sri Lanka are affected with the Giant African

Snail. In many agricultural fields and gardens the Giant African Snails are a major threat and

in Sri Lanka it was believed that the snail was introduced by a British Planter and it was spread

thought the country (Bambaradeniya, 2002). The Lunama-Kalametiya wetland system and

other wetland systems and forest fringes of Sri Lanka are infected with the invasive Achatina

fulica (Ekanayake et al., 2005). The anthropologically altered locations of Oahu and Kaneohe

in Hawaii and in these sites these snails were found to be feeding on other slugs (Meyer III et

al., 2008). Rosy wolf snail Euglandina rosea was introduced in Hawaii in 1958 to control the

Giant African Snail, but it was not successful (Mooney and Cleland, 2001). Humans introduced

the snail in the Chagos Archipelago in the western Indian Ocean (Peake, 1971). The snail could

have reached Nepal from the adjacent areas of India. Very high populations of A. fulica was

observed in Nepal’s eastern urban areas by Raut in 1999. The presence of snail population in

Biratnagar, Jaleshwor, and Birgunj indicated the occurrence of the snail there 60-70 years ago.

Budha and Naggs (2008) has reported the spread to western limits of the Western Development

Region of the Terai and extended north across the Siwalik Hills to Makwanpur, Chitwan and

Tanahun. The snail has crossed the Mid Hill range and ascended to the lower slopes of the

Mahabharat Range at Baglung, Parbat, Arghakhanchi, Gulmi, Dhading Kaski and Syangjha in

Nepal.

The pestiferous snail was reported in Esmeraldas Province of Ecuador in 2005, and is now

spread into most of the coastal provinces Ecuador. Also, through the Amazonian sides of

Ecuadorian Andes and also detected in the Santa Cruz Islands in Galapagos islands in 2010

(Ciomperlik, et al., 2013). The latest country of the South America in which the snail has

arrived lastly is Paraguay in 2012 (Senave, 2012). Fontanilla (2010) reported that many places

across French Polynesia are infested with the invasive snail. The most recent introduction of

23

the Giant African Snail was to Columbia in 2010 and the snail was spread to different parts of

Columbia like Arauca, Boyacá, Caquetá, Casanare, Guainía, Huila, Meta, Nariño, Putumayo,

Santander, Tolima, Valle del Cauca and Vaupés (Ossa-Lacayo et al., 2012).

2.4 Achatina fulica invasion in India and Kerala Giant African Snails were introduced into India by W.H. Benson during 1847 into Calcutta. It

was believed that the first set of the snails has reached India from Mauritius. Later the snails

were spread to North and North East India. The snails were unable to survive in extreme cold

conditions in some places but in many other places the snails survived and expanded its

invasive range. British introduced the Giant African Snails in South India in the premises of

My Lady Garden in Madras by the British and it is believed to be the origin of introduction of

the snail in South India (Raut and Ghose, 1984). The snails from Madras spread across the city.

The invasion of the Giant African Snail in Kerala happened in Palakkad district when a

researcher named Mr. Rajakrishna Menon who was doing research on the reproductive biology

of the Giant African Snail in Annamalai University has brought in his research materials from

the University campus to his home premises during early 1950s. The snails were then

accidentally discarded to his home gardens and they spread into different places of Palakkad

district soon. Where these snails proliferated and created high peril. The newspaper reports of

the 1970s explain the menace created by the snail in the Palakkad city. Different trials were

done by the Government to control the spread of the snail into more places. These methods

included the introduction of the bio-control agents and manual picking up of the snails. Later

on, the snail invasion stopped for a while and the second stage of invasion in Kerala happened

in Konni of the Pathanamthitta District during 2009-2010 and Elappully of Palakkad during

2008-2009. From Konni the spread of the snails were very rapid. The snails spread to different

parts of the Southern districts of Kerala. At the same time Willington Island in Ernakulam

District of Kerala state was also experiencing the devastating invasive events of the Giant

African Snail. The extent of the spread of the Giant African Snail was visible during our field

trips to the spots. The people residing in the staff quarters of the Willington island shifted to

some other places due to the attack of the snails. The snails climbed up the walls of the houses

and reached kitchen and bed rooms. They were even blocking the pipes in those places. Now

more than 250 localities in the state of Kerala which covers thirteen out of fourteen districts

are affected with this invasive snail (Data collected from field work between 2013 – 2018).

24

In Kerala the snail is a crop pest as well as a menace in human habitations. The condition is

different in other states of India where the snails are mainly acting as a crop pest. In Tamil

Nadu state, the snail is present mainly in mulberry gardens, banana plantations (Padmanabhan,

2000) and vanilla plantations (Vanitha et al., 2010). The mulberry clusters of the

Gobichettipalayam in Tamil Nadu like Kombuthottam, Thottampalayam, Periyathottam etc.,

are highly affected with the snail infestation. On a field visit some more mulberry plantations

of nearby places like Sathyamangalam were affected with the snail infestation. From a

newspaper report in The Hindu Tamil, new sites of infestation were detected from Coimbatore

Tamil Nadu. In the vanilla plantations in Valanthayamaram and Kotur in Coimbatore district,

Tamil Nadu, the snails mostly prefer to have terminal leaves of the vanilla plants. Where the

snails also prefer the cauliflower and cabbage leaves too (Vanitha et al., 2011). Padmanaban

(2000) describes the severity of the infestation of the Giant African Snail in banana plantation

in Villupuram District in Tamil Nadu. He found two to eight snails per plant of banana and two

to six leaves per plant were damaged by the snail. The snail was observed first in the Kolar

district of Karnataka as mere harmless creatures by the farmers and later they were found to be

producing high amount of crop loss and damage to the local agricultural farms. The problem

was revealed in a study conducted in Melthayaluru village in Mulbagal taluk of Kolar district

(Sridhar et al., 2012).

Karnataka is widely invaded by this snail. In Karnataka the first report of the snail affecting

ornamental plants and vegetables in Bangalore (Veeresh et al., 1979). Shree et al., (2006) and

Basavaraju et al., (2010) reported invasion of giant African snail in different agriculture and

horticulture crops in Karnataka including commercial crops, vegetable crops and ornamental

crops. In Hubballi taluk severe infestation of the snail is prevailing along the drainage canal

covering Mavanur, Katnur, Giriyal, Veeralapur and other villages. Shree et al., (2006) reported

the presence of the invasive snail in the mulberry gardens of Koratagere and Madhugiri Taluk.

Mallekavu, Beerdevanahalli, Sukakallupalya, Reddihalli, Doganahalli are some of the infested

places in Koratagere district where as the infested localities of the Madhugiri Taluk are Byala,

Kodiyapura, Puravara, Kalenahalli etc. The snail has infested the mulberry gardens of the

Bangalore rural, Ramanagaram, Mandya and Tumkur. The snail is also found to be present on

crops like coffee, mango, papaya, rubber, cotton, coconut, sunflower, gram, beans, peas,

brinjal, pumpkin, cucumber, cabbage, cauliflower, sponge gourd, ladies finger, banana, ragi,

marigold, mulberry etc. (Narendrakumar et al., 2011). The snail is causing considerable

25

damage to the sericulture industry in Ramanagaram district of Karnataka. The infestation is

high during July to December (Ramanjaneyulu et al., 2011). The molluscan pest is found to be

causing damage in local vegetation and mulberry plants in Hoskote. They are found to be

attacking the mulberry plants after the dusk (Sreenivas et al., 2011).

Jayashankar and Reddy (2010) reported the possibility of the Giant African Snail shell acting

as a breeding house for the mosquitos. They say that the shell and the meat solution of the

mosquito acting as a good breeding house for the mosquito. This is of very much

epidemiological importance. Studies on the life cycle of the Giant African Snail was conducted

at Shimoga Karnataka. Field observations showed the presence of the snail in Darwad, Honali,

Chickodi and Mudhol in Karnataka State. High incidence of the snail entering and devastating

coffee plantations in Visakha Agency areas of Andhra Pradesh. The nearby areas of this

plantation like Arakuvalley, Padmapuram Gardens, Attaguda AASAV, Malivalasa, Tudum and

Chompi, Yendapallivalasa, Kothavalasa, Araku, Thuraiguda, Karaiguda etc. In these places it

is believed that the snail has been noticed in these areas since 1996 and it was brought by some

farmer from Orissa because of his fascination of the Giant African Snail (Reddy and

Shreedharan, 2006). Shevale and Bedse (2009), in their study related to the different poison

baits to manage the Giant African Snails has revealed the presence of the snail in the soybean

plants and other crops of Nashik like Songaon area of Niphad tehsil since 2000.

Mulberry plantations of Aurangabad in Maharashtra were experiencing severe cocoon loss due

to the leaf loss due to the infestation of the snail in plants and also due to the stinking smell of

the snail mucous since the snails crawling over the plants. The silkworms were found to be

avert in feeding such leaves and this creates large economic loss to the farmers (Avhad, et al.,

2013). The snail was first reported from Madhya Pradesh in the Varahmihir Forest Nursery

Malhar Ashram Campus and later it spread in an alarming rate to different parts of the state

(Jha, 2012). The agricultural yield is reduced in Assam due to the Giant African Snail in the

agricultural fields of the state. The quality of the vegetables was also reduced by the snail by

soiling the crops with slime and feces. The snail affected portions of the fruits and vegetables

were also found to be rotten during storage (Borkakati et al., 2009). Behura (1986) reported

snail from Balasore district in Orissa and Singh and Birat (1969) noted snail from Bihar. Raut

and Ghose (1984) described the presence of Achatina fulica in horticultural gardens of Cuttack,

Bhubaneswar and Konark (Puri). The snail was also reported Calcutta, Barrockpore (West

26

Bengal), Guwahati (Assam) and Baripada (Orissa), western parts of Assam and Guwahati

(Srivastava, 1992) and also from Panchawati in Rajasthan in 1996 (Tehsin and Sharma, 2000).

2.5 Pathways of the spread of Achatina fulica The spread of the invasive species across the globe may be intentional or unintentional. The

introduction of the snail Achatina fulica happened both intentionally and accidentally.

Intentional introduction was as escargot (possible food item), as a pet, as an ornamental snail

or as a source of ‘baba de caracol' (snail slime) while it was accidentally introduced by two

main pathways: as ‘un- invited' freight through shipping and transportation sectors (Robinson,

1999). One of the most important factors for the establishment and dispersion of A. fulica is

anthropological presence (De Winter, 1989). As a food source and for its medicinal property

and its large size the snail draws the attraction of the human beings (Kliks and Palumbo, 1992;

Mead, 1979; Raut and Barker, 2002). It is for these reasons that the species has been spreading

worldwide mainly through human factors. A. fulica possesses traits that facilitate its transport

by humans. For instance, the snails can easily be transported in consigned cargoes, whether

accidentally or on purpose, and survive the journey of several days with little adverse effect on

the "hitchhikers" (Mead, 1979).

Historical records suggest the human mediated spread of the snail across the globe. According

to Bequaert (1950) the snails were not present in Mauritius before 1800s. He believes that snails

were taken to Mauritius by the wife of Governor for her medicinal purpose in 1803 and it got

established in the island. The snail has entered India through W.H. Benson, who collected

living specimens from Mauritius in February 1847. These snails were released in the

Chowringhie Gardens in Calcutta (Mead, 1961). Captain Hutton took some snails from

Calcutta to Mussoorie (Uttar Pradesh) but later severe winter eradicated them. Britishers

released the snails in My Lady garden in Chennai (Mead, 1961) during 1920s and later they

spread to different parts across Chennai, Annamalai Nagar etc. (Balasubramanian and

Kalyanasundaram, 1974). Oliver Collett, a conchologist introduced the snail in Sri Lanka at

Rozelle and it spread to almost every parts of Sri Lanka (Green, 1910). The Taiwanese

Government introduced these snails into Thiwan in the year 1932 (Srivastava, 1992). The

Taiwanese people are using these snails in their traditional dishes.

27

In the Andaman and Nicobar group of Islands the snails were introduced by the Japanese forces

as a food for the prisoners during second world war. Due to an improper domestic quarantine

measures, the snail has reached some human inhabited islands there (Prasad et al., 2004). Mead,

1961 reports the same route for the entry of the snail into Myanmar. The Japanese soldiers are

said to be the root cause for the introduction of the snail into Philippines from Formosa, Taiwan.

Before and after the Second World War in the Indo-Pacific, the Japanese soldiers and

merchants used the snails as food and sometimes as pets (Civeyrel and Simberloff, 1996; Kliks

and Palumbo, 1992). In Japan also, the snails were introduced from Formosa Taiwan many

times as a food source and for medicinal purposes. Where these snails were introduced into

Kobe, Osaka, Nagoya and Nara. In the Maldives Island the snail is present from 1957, this

may be probably due to the large amount of trade and commerce happening between the

Maldives Islands and Sri Lanka (Mead, 1961).

The high protein content and large size has probably made this snail a good source as duck,

fish and poultry feed. The snails were brought to Hong Kong from China as duck feed by the

duck keepers and it has spread to different places across the country. At least by 1937 the snail

has reached Thailand and they became highly established there, they were also brought to

Thailand as duck feed by the Chinese people who were looking after the ducks. The snails has

reached the Malayan peninsula from India or Sri Lanka and within Malaysia from Kedah the

snails were brought to different places by the Chinese duck keepers in 1922. The spread of the

snail in Java Indonesia there are different conflicting views about the entry of the snail. It was

assumed that the snail has reached there either from Singapore, or through grass plants from

Sri Lanka or through plant breeders. The snails are also used by the duck keepers to feed their

ducks (Srivastava, 1992).

Even through very excellent quarantine measures prevalent in Australia and United States of

America the snail has entered these places through students. The snail has reached Australia in

the late 1977 and it was taken by some students there (Raut and Barker, 2002). Four incidents

of the entry of Achatina fulica has been reported from America. The first major incident was

in Arizona (Mead, 1959), second in Vancouver in 1963, third in Canton, Ohio in 1969 all the

three were captured and destroyed. But the fourth incident was the most serious when a boy

took a few living specimens of the snail to his Grand mother in Miami in Florida. She released

them into her garden in 1966 but it has become noticeable by 1969 as the size of the infestation

28

was huge (Mead, 1979). The Hawaiian Islands were also infested in 1936, when a lady brought

these snails to Hawaii for some aesthetic purposes. Some more specimens reached the island

through mail from Japan for breeding and for medicinal purposes (Srivastava, 1992).

According to Mead 1979, the snail has spread into many parts of this group of islands.

During these periods of long-distance travel, the snails will remain safe as they undergo

aestivation (Mead, 1961). Additionally, Achatina fulica has a wide range of tolerance for

different environmental conditions regardless of being a tropical snail (Mead, 1979; Raut and

Barker, 2002). In Brazil, A. fulica was introduced in 1988, probably from Indonesia, when it

was indicated as an alternative source of meat. These snails were then distributed for

commercial purpose especially for poultry farming and they have grown them. As a result,

Brazil is now experiencing a hazardous stage of the invasion that is characterized by large

individuals that are widespread in urban areas, mostly in gardens (Thiengo et al., 2007). In

Nepal, the snails were introduced in local gardens and honored for its spiritual significance

(Budha and Naggs, 2008).

The natural dispersal is slower than intended spread. The main pathways of spread are through

the process of trade, transport of materials and tourism and smuggling of the snail for

ornamental purposes. On field visits the local people informed that, the snails are spreading in

different localities through contaminated soil, plants, manure, agricultural materials, fodder

grass, hitchhiking on vehicles etc.

In Kerala, Palakkad district is considered to be the first site of infestation of the Giant African

Snail. A researcher who was working in Annamalai University in Chidambaram, has brought

a pair of snails from the university to his home in Elappulli Palakkad during 1950s. Later on,

the snails were discarded to his garden and it became wide spread in Palakkad municipality

areas. The snails were big menace in Palakkad till 1970s and later the population came down.

After 2005, Konni in Pathanamthitta District and Willington Island in Ernakulam District

became the major spots of Snail infestation. It is firmly believed by the local people living

around Willington Island is that the snail infestation happened in Willington Island along with

the beginning of the timber depot there, where the timber is being imported from different

countries across the world where the snail infestation is prevalent (Data collected from field

between 2013 to 2018).

29

2.6 Nuclear and Mitochondrial markers for phylogenetic and phylogeographic studies Various molecular markers are available for determining evolutionary relationships. These

include the nuclear ribosomal RNA gene family. A molecular phylogeny and genetic variation

of the global population of the giant African snail was attempted in 2010 (Fontanilla, 2010)

and traced the route of the spread of the Giant African Snail. A phylogenetic analysis based on

partial sequences of the mitochondrial large ribosomal subunit (16S) gene in the land snail

Helix aspersa helped in the intra specific phylogeographical studies (Guiller, et al., 2010)

Wade et al., (2001 & 2006) described the use of the nuclear ribosomal RNA gene cluster to

infer phylogenetic relationships within the Stylommatophora. They amplified an

approximately 1460 nucleotide region of the rRNA (comprising approximately 80 nucleotides

of the 5.8S gene, the complete internal transcribed spacer (ITS) 2 region and approximately

840 nucleotides of the LSU gene) of which 843 (2001 study) and 823 (2006 study) nucleotide

sites could be aligned across all taxa and were therefore used in phylogeny reconstruction.

Another study dealing with the genetic diversity between native and non-native populations of

Cornu aspersum in Austral-South America was attempted with the mitochondrial cytochrome

b gene. The genetic diversity, the history of dispersal and establishment and biogeographic

forms of native and invasive populations, and multiple introductory pathways was spotted. The

study recognized multiple invasion routes of the snail with the presence of many haplotypes

(Gaitán-Espitia, et al., 2013).

Evolutionary relationships among different gastropod groups were evaluated by the small

subunit (SSU) rRNA gene. For example, Winnepenninckx et al., (1998) applied the full-length

SSU rRNA gene (approximately 1800 nucleotides), to reassess the groupings within the

Gastropoda. In addition to the ribosomal genes, the nuclear actin and histone 3 genes have also

been used to estimate phylogeny within the Mollusca. The actin gene encodes a protein that is

involved in various functions such as muscle contraction, cell division and differentiation

(Hernan, 1993; Fontanilla, 2010). A 784 bp fragment of the actin gene has been successfully

employed to show the monophyly of several groups within the coleoid cephalopods such as the

Octopodiformes, the Decapodiformes, the Octopoda and the Incirrata (Carlini et al., 2000). The

actin gene was also used together with the mitochondrial 16S and cytochrome c oxidase subunit

I (COI) genes to resolve the phylogeny within the ancestral archaeo gastropod monodontinetop

30

shells (family Trochidae) from the southern hemisphere, with three species of Austrocochlea

being transferred to the genus Chlorodiloma (Donald et al., 2005). Histone 3 was used, in

addition with the nuclear SSU and LSU rRNA genes and the mitochondrial COI gene, to

resolve the incongruence between molecular and morphological data for the gastropod

phylogeny (Colgan et al., 2003). Like the actin gene, the histone 3 gene has not been used in

the Achatinoidea. Using mitochondrial genes in concert with nuclear genes is desirable for

constructing phylogenetic trees as they tend to improve phylogenetic accuracy (Lake and

Moore, 1998; Steinke et al., 2004). Nuclear and mitochondrial genes evolve at different rates

and are not inherited in the same way; as such, they provide information at different levels of

phylogeny (Graybeal, 1994).

Mitochondrial genes generally evolve faster than nuclear genes; they are also maternally

inherited and are therefore not subject to recombination (Avise, 1994; Brown, 1985).

Mitochondrial DNA inherited predominantly through the female line has been exceptionally

useful for reconstructing phylogenies and this assumes that the mitochondrial evolution in

pulmonates is exceptionally fast (Thomaz et al., 1996). Two mitochondrial genes commonly

used for phylogenetic analyses are the cytochrome c oxidase subunit I (COI) gene, which codes

for an enzyme that accepts electrons from cytochrome c during the electron transport chain in

the mitochondrion (Fontanilla, 2010; Zubay et al., 1995), and the 16S rRNA gene, which

transcribes a ribosomal rRNA that is incorporated in the mitochondrial ribosome (Fontanilla,

2010; Lewin, 2008).

On a large scale molecular phylogenetic analysis of the Stylommatophora, sequences of the

ribosomal RNA gene cluster were examined and it allowed an independent test of classification

based on morphology (Wade et al., 2001). Comparison between the 16s r RNA sequences of

the different haplotypes in Cepea nemoralis showed a high rate of divergence in a region of

DNA that is usually conserved (Thomaz et al., 1996). Two mitochondrial gene fragments COI

and 16s rRNA and one complete nuclear gene, the ribosomal internal transcribed spacer (ITSI)

revealed the molecular phylogeny, taxonomy and evolution of the land snail genus Pyrenaeria

(Elejalde et al., 2009). The molecular phylogenetic study of the Triculine snails has been

examined using the partial sequences of COI, 16S and 28S genes and these resulted in the

reconstruction of phylogeny of Triculinae across China (Guan et al., 2008).Along with the

above mentioned markers 12s rRNA gene also helped in confirming the monophyly of the sub

families of the family Muricidae, a diverse family of carnivore gastropods (Barco et al., 2010).

31

Three consecutive mitochondrial genes (COI, tRNAval, 16s rRNA) were studied as markers

for 36 species from Helicarionidae and related groups and the genes 16s rRNA and COI showed

a high degree of compositional heterogeneity and compatibility of phylogenetic signal (Hyman

et al., 2007). The cluster analysis of the COI and the 18s gene has been analyzed and the cluster

pattern has been used for the phylogenetic studies in Hydrobiidae (Wilke et al., 2001).

Mitochondrial cytochrome oxidase sub unit I has been used for studying the single/multiple

introduction pattern of the invasive snail species, Pomacea snails and the mosaic distribution

and the high diversity found in the collection sites suggests multiple and secondary

introductions. These findings indicate the importance of preventing further intentional

introductions and call for appraisal of the risk posed by these snails in vulnerable areas (Lv et

al., 2011). The spread and the invasion mechanism of the species Cactoblastis cactorum (Berg)

also revealed by studying the mitochondrial COI gene (Marsico et al., 2011) and established a

multiple introduction of the species.

Away from the COI and the 16S rRNA genes, several other mitochondrial genes have also

been used for inferring deep level phylogenies within the gastropods. (Grande et al., 2004)

employed several mitochondrial genes, in addition to the 16S and COI, such as the tRNA-

valine, tRNA-argenine, tRNA-proline and the NADH dehydrogenase subunits 5 and 6 genes

in the study of the Euthyneura (opisthobranchs and pulmonates) in which their molecular data

rejected the monophyly of the pulmonates. A multigene phylogenetic study of the group

coenogastropoda include the markers 18s rRNA, 28s rRNA, 12s rRNA, cytochrome oxidase

subunit I and histone 3 (Colgan et al., 2007).

Genetic diversity studies using ISSR markers from different geographic populations of golden

apple snail (Dong et al., 2011), Ligula intestinalis (Bouzid et al., 2008) were also used for

variation analysis. A study on the extreme divergence of mitochondrial DNA within the

pulmonate land snails suggests that the mitochondrial evolution in pulmonates is fast and also

natural selection has acted to preserve their variation (Thomaz et al., 1996). Genetic variations

and phylogenetic relationship were also studied in the desert aquatic snail Nymphophilus

minckleyi (Moline et al., 2004) and limestone dwelling micro snail Gyliotrachela

hungerfordiana (Hoekstra and Schilthuizen, 2011). Microsatellites provide an ideal tool for

studying population structure and estimating gene flow among demes which may function as

metapopulations. In an attempt to trace back the history of the land snail, Helix aspersa, spread

in the western Mediterranean, anatomical, biochemical and molecular markers have been used

32

to explore genetic variation in native populations of the species (Guiller et al., 1994 & 1998;

Madec and Guiller 1994; Thomaz et al., 1996). Data derived from molecular genetic variation

in snail populations can yield useful information about the routes of introduction or dispersal

and colonization of a particular snail species into new areas (Davison, 2000; Gittenberger,

2012; Gittenberger et al., 2004; Gittenberger et al., 2006; Pinceel et al., 2005; Rawlings et al.,

2007).

Besides the molecular markers several biochemical markers are also has been used for the

animal phylogenetic studies. Among them the allozyme markers are which gains more

precision. The genetic structure of the land snail Helix aspersa was investigated for 21

populations and a total of 369 individuals were genotyped for five enzymatic markers and

seven microsatellite loci, and a sequential hierarchical F -statistics at different spatial scales

and spatial autocorrelation statistics was used to explore recent historical patterns involved in

the observed genetic distribution (Arnaud et al., 2001). Microsatellite loci are suitable for the

detection of small genetic clustering, and potential to gain further insight into the description

of spatial genetic variability over short temporal and geographical scales. The influence of self-

fertilization and population dynamics on the genetic structure of subdivided population has

been studied in the fresh water snail Bulinus truncatus by using microsatellite markers (Viard

et al., 1996).

2.7 Phylogenetic and phylogeographic studies of molluscs/invasive species Phylogeography according to Avise, (2000) “is a field of study concerned with the principles

and processes governing the geographic distributions of genealogical linkages, especially those

within and among closely related species”. In other words phylogeography deals with

historical, phylogenetic components of the spatial distribution of the gene linkages. The

statistical rigor of the phylogeography has increased over the last two decades largely resulting

from advances in the coalescent theory that enabled model based parameter estimation and

hypothesis testing (Hickerson et al., 2010). The future of the phylogeography thus increasing

becoming integrative, comparative (within and among taxon, species) that involves combining

spatially-explicit multiple taxon coalescent models, genomic studies of natural selection,

ecological niche modeling, studies of ecological speciation, community assembly and

functional trait evolution. This synthesis will allow one to determine the linkages between

33

geography, climate change, ecological interactions and the evolution and composition of taxa

across whole communities and assemblages (Hickerson, et al., 2010). The central goal of

phylogeographic research is to understand the factors that contribute to the formation of

population genetic structure. But it is complicated due to the stochastic variance inherent to

genetic processes (Carstens and Richards, 2007).

The biogeography of the land snail Cornu aspersum aspersum was attempted using the

morphometric and molecular data of 169 populations sampled across the Mediterranean and

the islands. Phylogenetic relationship studies revealed several clades of the snail and the snail

has been evolved from North Africa. High rate of endemism and high genetic diversity of the

snail in North Africa suggests this place as the place of diversification of the species. This study

also suggests the allopatric speciation of the snail populations due to geographical barriers of

the changes in the atlas (Sherpa et al., 2018)

Guiller et al., (2012) using five micro satellite loci, cytochrome b gene and 16s rRNA gene,

traces the invasion events of the land snail Cornu aspersum aspersum commonly known as the

brown snail, which is acting as an agricultural and garden pest in the introduced areas. This

forms the first step towards the identification of the source population and the mechanism of

the evolutionary process governing the invasion process. This study constructed the

introduction pathways of the snail across different continents over recent centuries. The

phylogeny of the two species of the carnivorous achatinoid land snails coming under the super

family Streptaxidae attempted using the DNA data from 114 taxa from East Africa, Indian

Ocean islands, Asia, South America and Europe. In all the analyses the superfamily

Streptaxidae are monophyletic while the subfamilies previously described are polyphyletic.

The biogeography and the fossil records suggest the cretaceous origin of the families. And

there are multiple waves of diversification from East Africa to South America, Asia and

Madagascar (Rowson et al., 2010).

Eobania vermiculata is a Mediterranean land snail which is cosmopolitan in distribution, which

makes it a suitable organism for the molecular phylogeny study. The phylogenetic relationships

between two populations of this snail is compared using molecular markers. The populations

are from Egypt and Saudi Arabia. The morphological and molecular analysis and comparison

between these two species suggest that they are two distinct groups. And it was concluded to

be two different sub species (Desouky and Busais, 2012).

34

Multiple origins of the non-native apple snails in Asia was detected using the COI gene of the

mitochondrion. Out of America the snail is acting as an agricultural and environmental pest.

Phylogenetic and genealogical analysis of the 783 snails from Asian locations and native South

American locations were done. The study reveals the multiple introductory events of this snail.

This is possibly the root cause for the success and spread of the species. This will further lead

to the understanding of the invasion patterns and processes (Hayes et al., 2008).

The invasive snail Sena pisana pisana has been wide spread through human mediated

interactions. The Mediterranean and the Atlantic cost are considered to be the native range of

this snail. This also has been introduced to some Micronesian islands. The routes of spread and

introduction of this species was understood by reconstructing the phylogeography of the

species using Cytochrome oxidase subunit I gene. The study revealed that human mediated

introductions favoured the spread of the snail into different parts of the globe rather than its

natural spread (Däumer et al., 2012). Seventeen distinct haplotypes of the sixty-five individuals

of the aquatic snail Potamopyrgus antipodarum using the 16s mitochondrial marker. Among

these haplotypes only two were found to be distinct. The marked divergence between distinct

haplotypes suggests the successful colonisation of the snail. The study also suggests that we

cannot rule out lack of proper sampling in some places, which would be the origin of one of

the haplotypes in the study (Städler et al., 2005). A long-term survey, mitochondrial DNA

studies and many quantitative experiments carried out in fresh water snails, showed that how

an ecological trait is being accumulated in an invasive population. Multiple introduction

processes govern these processes of accumulation of these traits and the sexual reproduction

happening in them multiplies these new trait combinations was detected using the

mitochondrial markers 12s rRNA and 16s rRNA genes (Facon et al., 2003).

Fontanilla et al., (2014) studied the extent of genetic diversity in the global Achatina fulica

population was attempted using the 16s rRNA gene. A total of 560 individuals were analysed

from 39 global populations. The results of the study revealed 18 global haplotypes of the snail.

This study assumed the lack of genetic variation in the introduced areas, this results in founder

effect in the populations. The study also assumed that the Indian Ocean islands as the earliest

known common source of the spread of the invasive Giant African Snail. A combined

molecular study involving Cytochrome oxidase Subunit I, 16s rRNA and ITS was attempted

in the globally invasive fresh water snail Physa acuta, which is native to North America to

35

elucidate its molecular phylogeography and population genetic structure. Two major clades of

the snail were studied and significant population genetic structure was observed in the native

range of the snail with some geographical barriers between the Western and Eastern

populations and also numerous independent source populations was recognized in North

America (Ebbs et al., 2018).

2.8 Angiostrongylus cantonensis

This snail is known as a vector of at least two human disease agents: the rat lung-worm

Angiostrongylus cantonensis (Chen 1935) and a gram negative bacterium, Aeromonas

hydrophila, which causes a wide range of symptoms (Mead 1956; 1961, Wallace an Rosen,

1969; Dean et al., 1970; Mead and Palcy, 1992). Angiostrongylus cantonensis is primarily a

parasite of wild rodents, but it is now generally recognized as the causative agent of human

eosinophilic meningitis, widely observed in the Pacific Islands, Southeast Asia and even some

parts of Northeast Asia. The worm requires a molluscan intermediate host for the completion

of its life cycle and the giant African snail is the most important carrier. Outbreak of A.

cantonensis meningitis has been reported among travellers returning from the Caribbean. 484

cases of eosinophilc meningitis have been reported from Thailand, 5 cases from Hawaii

(Natasha et al., 1975) and 52 cases from Japan. In places of outbreak public awareness were

increased and enhanced food safety measures. Recently in Kerala 9 cases of eosinophilic

meningitis has been reported. A PCR based method has been developed to detect the worm

directly from molluscan tissue.

_________________________________________________________ 3: Objectives

36

3. OBJECTIVES OF THE STUDY

1. Tracking the invasion of Achatina fulica using molecular markers by characterizing

the genetic variation within and between populations in Kerala

2. Screening the presence of Angiostrongylus cantonensis in the populations of Achatina

fulica and

3. To investigate the role of A. fulica in the dispersal of A. cantonensis causing

eosinophilic meningitis in humans.

__________________________________ 4: Materials and Methods

37

4. MATERIALS AND METHODS 4.1 Survey and Sampling The first and second waves of the invasion of Giant African snail occurred in the state of Kerala

in the year 1950s and 1970s respectively. The most recent wave of invasion started in the

districts of Ernakulam and Pathanamthitta during the year 2005. After the third invasion, the

spread of the snails were very rapid. The snails spread to different parts of the Southern districts

of Kerala. Willington Island in Ernakulam District of Kerala state is considered to be the major

hub of Giant African Snail infestation in Kerala. The place harbours a huge timber depot which

receives timber from many parts across the globe. It is firmly believed by the local people

living around Willington Island in Kochi is that the snail infestation happened along with the

starting of the timber depot.

A Giant African Snail survey has been conducted in the states of Kerala, Karnataka, Tamil

Nadu and West Bengal between the years 2013 and 2018. To reach the people about the

invasive nature of the snail and to collect information regarding the snail occurrence a

newspaper advertisement has been published in an all Kerala basis. The advertisement contains

all information regarding the invasiveness of the Giant African Snails and a helpline number

to report information regarding this issue. Numerous snail infested localities were received

through phone calls. Surveys were done in all the reported snail invasion localities. Posters,

fact sheets and brochures were printed and distributed. Posters were exhibited in many public

places including railway stations, bus stations and Local Self-Government offices. Extensive

surveys were done from all the contact points and samples were collected. Snail infestation

records of Tamil Nadu and Karnataka were collected from literature and newspaper reports and

from a few people including professors, farmers and media professionals. Snail samples have

been collected from snail infested localities in the states Karnataka and Tamil Nadu in South

India.

The collected samples were reared inside a glass house with numerous glass tanks. Each

population was reared separately for further analysis. Geographical coordinates were recorded

from every population with a hand-held Global Positioning system (GPS) GARMIN Oregon

650. All the points collected through GPS were plotted in GIS. The collected snail samples

38

were reared in a lab and eggs laid by them were separated and moved to new tanks. The

hatching young ones were also counted. Papaya leaves, cabbage leaves, egg shells and sepia

bone are the major food items provided to the growing snails. Dead samples were preserved in

ethanol, shells were washed dried and preserved.

4.2 DNA Isolation Methods The following DNA isolation methods has been adopted for the isolation of DNA from snail

tissue. Among them the CTAB method is found to be the most cost effective but the DNA

isolation from snail tissue using different kits were found to be more accurate qualitatively but

these methods were so expensive.

a) DNA Isolation from snail tissue using CTAB Method (Modified Winnepenninckx et

al., 1993).

DNA isolation from snail tissue using CTAB method makes use of the detergent Cetyl

Trimethyl Ammonium Bromide (CTAB). This is a very cheap method and could be adopted

for large number of tissue samples. The steps adopted for this method are:

1. For ethanol preserved tissues, the tissue slices were soaked in 1 ml TE buffer (10 mM

Tris-HCl, 1mM EDTA) for approximately 1 hour in order to remove excess ethanol to

soften the tissue prior to DNA extraction.

2. Foot muscle tissue of the snail was cut into small pieces, placed into 500 µl of CTAB

solution [100mM Tris-HCl pH 8, 20mM EDTA pH 8, 1.4 mM NaCl, CTAB 2% (w/v)]

and ground 38 using a homogenizer. CTAB (cetyltrimethyl ammonium bromide) is a

non-ionic detergent that helps precipitate polysaccharides and cell lysis (Richards et al.,

1995).

3. 20 µl of Proteinase K (10mg/ml), a protein digesting enzyme was added to each tube.

This was followed by 10 µl of β-mercaptoethanol, which precipitates polyphenolics

(Rolfs et al., 1992). The tubes were then vortexed several times and then incubated at

55° C since it is the optimum temperature of the activity of the proteinase K enzyme

for one to three hours until the complete lysis of the tissue.

39

4. 500 µl of ice-cold Phenol: chloroform: isoamyl alcohol (25:24:1) was added to the cell

lysate, then the tubes were inverted several times for 3 to 5 minutes for proper mixing.

This mixing separates the DNA from proteins (Rolfs et al., 1992). The tubes were then

centrifuged for 10 minutes at 14,000 rpm in cooling centrifuge at 4° Celsius. The upper

aqueous phase was transferred to a new tube).

5. The above step was repeated one or two times for the complete separation of the muco-

polysaccharides.

6. 2 times volume of ice-cold chloroform was added to the tubes and inverted several

times. The tubes were then centrifuged at 14,000 rpm for 10 minutes. Transfer the upper

layer to a new tube.

7. Add equal volume of ice cold iso-propanol to the tube and inverted 2-3minutes for

thorough mixing. The tubes were then incubated at -20° Celsius overnight. The tubes

were centrifuged at 14,000 rpm for 15 minutes then the supernatant was carefully

removed.

8. The remaining pellets were washed with 500 µl of ice-cold 70% ethanol and centrifuged

for five minutes at 13,000 rpm in order to remove salts and small organic molecules.

The ethanol was carefully removed afterwards.

9. The remaining pellets were air-dried for a maximum of 15 minutes. The pellets were

then resuspended in 150 µl TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.5).

10. The DNA was stored at -20° Celsius until further use.

b) DNA Isolation from snail tissue using NaOH Lysis method (Fontanilla, 2010). This method of obtaining DNA from snail tissue is also cost effective one. But this method

requires a large amount of snail tissue but the DNA yield is comparatively low. The major steps

for this method are:

40

1. Snail tissue slices were ground in micro-centrifuge tubes containing 200 µl of 0.1 N

NaOH using a homogenizer. The samples were boiled at 95-100° C for 20 minutes to

lyse the cells.

2. 100 µl of sterile distilled water and 300 µl of chloroform-isoamyl alcohol (24:1) were

added. The tubes were vortexed in a vortex mixer and then centrifuged at 13,000 rpm

for 10 minutes at 4° Celsius. The upper phase (~300µl) was collected and transferred

into new tubes.

3. An equal volume of isopropanol (~300µl) was added to precipitate the DNA. The

tubes were inverted several times, and then stored at -80° C for at least one hour.

4. The tubes were centrifuged at 13,000 rpm for 15 minutes after which the iso-propanol

was carefully removed.

5. The pellets were washed with 500 µl of 70% ice cold ethanol then centrifuged for 5

minutes at 13,000 rpm to remove salts and small organic molecules. The ethanol was

carefully removed.

6. The DNA pellets were air dried for a maximum of 15 minutes, after which they were

resuspended in 150 µl TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.5). Each

suspension was then boiled for 15 minutes at 100° C.

7. The DNA extracts were stored at -80° C until further use.

c) DNA isolation using QIAGEN DNeasyBlood and Tissue Kit This method provides the best quality DNA while comparing the 260/280 values on nanodrop.

But the method is costly per sample comparatively than the other methods. The isolation steps

are as per the instructions in the user’s manual.

1. Cut approximately 25 mg tissue (up to 10 mg spleen) into small pieces, and place in a

1.5 ml microcentrifuge tube. Add 180 µl Buffer ATL.

41

2. Add 20 µl proteinase K and blend thoroughly by vortexing. Incubate at 56° C until the

tissue slices are completely lysed. Mix the samples occasionally during incubation

using a vortex mixer for the complete lysis of the samples. The time for lysis varies

depending on the type of tissue processed. Lysis is usually complete in 1–3 h for

animal tissue pieces.

Optional: If RNA-free genomic DNA is required, add 4 µl RNase A (100 mg/ml),

mix thoroughly by vortexing, and incubate for 2 min at room temperature before

continuing with step 3.

3. Mix the samples using Vortex mixer for 15 seconds. Add 200 µl Buffer AL to the

sample, and blend thoroughly by vortexing. Later add 200 µl ethanol (96–100%), and

mix again thoroughly by vortexing.

4. Pipet the complete mixture from step 3 (including any precipitate) into the DNeasy

Mini spin column and place in a 2 ml collection tube (provided). Centrifuge the column

at 6000 x g (8000 rpm) for 1 min. Discard flow-through and collection tube.

5. Place the DNeasy Mini spin column in a new 2 ml collection tube (provided), add 500

µl Buffer AW1, and centrifuge for 1 min at 6000 x g (8000 rpm). Remove flow-

through and collection tube.

6. Place the DNeasy Mini spin column in a new 2 ml collection tube (provided), add 500

µl Buffer AW2, and centrifuge for 3 min at 20,000 x g (14,000 rpm) to dry the DNeasy

membrane. Discard flow-through and collection tube.

7. Place the DNeasy Mini spin column in a clean 1.5 ml or 2 ml microcentrifuge tube

(not provided), and pipet 200 µl Buffer AE directly onto the DNeasy membrane.

Incubate at room temperature for 1 min, and then centrifuge for 1 min at 6000 x g

(8000 rpm) to elute.

8. Recommended: For maximum DNA yield, repeat elution process once as described in

step 7.

42

d) Invitrogen™ PureLink™ Genomic DNA Mini Kit This method is also a costly method for the isolation of DNA. This kit was adopted for the

isolation of the DNA for the last-minute entry snail samples to cover up the time for DNA

isolation. The methods are as per the directions of the user’s manual.

1. Cut up to 25 mg tissue (up to 10 mg spleen) into small pieces, and place in a 1.5 ml

microcentrifuge tube and add 180 µl digestion buffer and 20 µl of proteinase K.

2. Incubate the tube at 55° C with occasional vortexing until lysis is complete.

3. Add 20 µl RNase A to the lysate, mix well by brief vortexing, and incubate at room

temperature for 2 minutes.

4. Add 200 µl PureLink™ Genomic Lysis/Binding Buffer and mix well by vortexing to

obtain a homogenous solution.

5. Add 200 µl of 96-100 % ethanol to the mixture and mix well by vortexing for 5 seconds

to yield a homogenous solution.

6. Add the lysate (~640 µl) prepared with PureLink™ Genomic Lysis/Binding Buffer and

ethanol to the PureLink™ Spin Column. Centrifuge the column with the collection tube

at 10,000 × g for 1 minute at room temperature.

7. Discard the collection tube and place the spin column into a clean and new PureLink™

Collection Tube supplied with the kit.

8. Add 500 µl Wash Buffer 1 to the column. Centrifuge column with the collection tube

at room temperature at 10,000 × g for 1 minute. Discard the collection tube and place

the spin column into a new and clean PureLink™ collection tube supplied with the kit.

43

9. Add 500 µl Wash Buffer 2 to the column. Centrifuge the column at maximum speed

for 3 minutes at room temperature to wash the undesired contents. Discard collection

tube.

10. Add 25-200 µl of PureLink™ Genomic Elution Buffer to the column, incubate at room

temperature for 1 minute and centrifuge the column at maximum speed for 1 minute at

room temperature.

11. To recover more DNA, perform a second elution step using the same elution buffer

volume as first elution, centrifuge the column at maximum speed for 1.5 minutes at

room temperature.

12. The tube contains purified DNA. Remove and discard the column.

13. Store the purified DNA at -20° C or use DNA for the further desired downstream

application.

4.3 Polymerase Chain Reaction-PCR The Polymerase Chain Reaction was adopted to amplify desired DNA fragment from the

complete genome of an organism. The major components in a PCR reaction are a good quality

DNA template, a set of primers, deoxynucleotide triphosphates (dNTPs) that are incorporated

in the growing chain, Taq DNA Polymerase enzyme and MgCl2 that acts as the enzyme co-

factor of the DNA polymerase. Fundamental in any successful PCR is the pair of primers that

can bind to specific regions of the complementary strands of the DNA and the DNA polymerase

that facilitates the amplification. There are three stages in PCR that are repeated over a number

of cycles based on the type of reaction that we are performing; these are: (1) denaturation at

94° C, which involves the separation of the double stranded DNA helix; (2) annealing of the

PCR primers to target genes of the DNA strand at specific temperatures (Which varies from

primer to primer); and (3) extension at 72° C which involves the increase in length of the DNA

strand with the activity of the DNA Polymerase (Reece, 2004).

44

4.4 PCR Primers For the successful amplification of the gene of interest using specific primers several factors

need to be considered. Firstly, the temperature of melting (Tm) of each primer in the primer

pair, calculated as 2(A+T) +4(C+G), where A, C, G and T refer to the nitrogenous bases of the

oligonucleotide, should be approximately alike so that they anneal to their specific sites at

almost the same time (Reece, 2004). Second, the primers should not have strings of repeated

nucleotides within their sequences that may prevent annealing of the primers to non-specific

target sites of the gene which displays strings of corresponding repeated nucleotides (Reece,

2004). Third, primers should not contain complementary sequences between each other or

within themselves as these sequences would result in primer dimer formation and secondary

structure formation, respectively, which would direct to non-amplification (Reece, 2004).

Fourth, the 3’ end of the primers should match perfectly the target region so that the polymerase

enzyme can properly extend the primer beginning at the 3’ end (Reece, 2004). Fifth, provided

that the 3’ ends of the primers should match perfectly with their targets otherwise some

mismatched pairing could form partial bonds between the primer and the target gene (Reece,

2004). The length of the PCR product to be amplified Sixth, the length of the product being

amplified by the primer pair would decide the duration of the extension step of the PCR

reaction. For example, 30 seconds are generally needed to amplify products which are less than

500 base pairs, 60 seconds for products between 500 and 1500 base pairs, and 90 seconds for

products longer than 1500 base pairs (Palumbi, 1996).

4.5 Snail PCR Primers - Mitochondrial Markers The commonly used mitochondrial markers for the molecular phylogeography approach are

the 16s rRNA gene, Cytochrome Oxidase subunit I gene (COI), 12s rRNA gene, 18s rRNA

gene etc. This study makes use of the 16s rRNA gene and COI gene of the Giant African snail.

a) 16S ribosomal (r) RNA gene The 16S rRNA gene transcribes a ribosomal RNA that folds into a secondary structure

following base pairing of the nucleotides within it, after which it is incorporated in the

mitochondrial ribosome and is used for translation of proteins (Lewin, 2008). 16s rRNA s are

used in re constructing phylogenies due to the slow rates evolution of this region of the gene.

45

Among the Mollusca, 16S exhibits extreme variation in length, among them Stylommatophora

being the shortest (Lydeard et al., 2000). Two primer sets have been used for the amplification

of the 293 base pair regions of the 16s rRNA gene of the snail genome. In some samples, they

failed to amplify with the first set of primer the second set of primer was used. The primer

sequences and other details have been listed in Table 4.1.

b) Cytochrome c oxidase subunit I gene Cytochrome c oxidase is an enzyme that transfers electrons from cytochrome c to O2 during

the electron transport chain reaction in the mitochondrion (Zubay et al., 1995). A typical

enzyme has three functional units among which subunits I and II contain the electron carriers

(Alberts et al., 2008). Even though the amino acid sequence of the subunit I of the cytochrome

oxidase is conserved across the different animal phyla, the nucleotide sequence is subject to

quiet mutations (Palumbi, 1996). In fact, the variability of the COI gene yields phylogenetic

signal and though it is a robust universal primer invariably used as a choice for DNA barcoding

in animals (Hebert et al., 2003). Two sets of COI primers have been used for the amplification

of the 650 base pair COI partial sequence. The primer sequences and other details have been

listed in Table 4.1. Table 4.1: The primers used for the amplification of 16s rRNA gene and COI gene

Gene Primer Sequence Fragment Size

Reference

16s rRNA STY_16Sarm: 5’ CTTCTCGACTGTTTATCAAAAACA 3’STY_16Sbrm: 5’ GCCGGTCTGAACTCAGATCAT 3’

420-500 Bonnaud et

al., 1994

16S_SLi: 5’ TGACTGTGCAAAGGTAGCATAA 3’16S_SSCP2i: 5’ CCTAGTCCAACATCGAGGTC 3’

293 Fontanilla, 2010

COI LCO-1490: 5’ GGTCAACAAATCATAAAGATATTGG 3’HCO-2198: 5’ AAACTTCAGGGTGACCAAAAAATCA 3’

655 Folmer et al., 1994

STY_LCOi: 5’ TCAACGAATCATAAGGATATTGG 3’STY_LCOii: 5’ ACGAATCATAAGGATATTGGTAC 3’STY_HCO: 5’ GAATTAAAATATATACTTCTGGGTG 3’

628-667 Fontanilla, 2010

46

4.6 PCR Amplification and Sequencing a) PCR Components The list of PCR components for the amplification of the 16s rRNA and the COI genes which

were used for the Molecular phylogeographic studies and population genetic structure analysis

are given in the following table 4.2.

Table 4.2 PCR Components with final volume

Component Initial Concentration Final Volume(µl) for 50 µl

Taq DNA Polymerase 1 unit/µl 0.5 µl

DNTP Mix 1.25 mM 5 µl

Primer I 10 mM 2 µl

Primer II 10 mM 2 µl

Buffer with MgCl2 10 X 5 µl

Sterile Distilled Water -- To make up to 50 µl

b) Thermocycling conditions PCR amplification was carried out in an Applied Biosystems veriti Dx Thermal Cycler. Two

different PCR conditions were standardized for the two different genes of interest through

various trial and error procedures. For the 16s rRNA gene approximately a 293 base pair long

portion was amplified and for the COI gene approximately a 406 base pair long fragment was

amplified.

The following is the PCR condition for the 16s rRNA gene with a hot start at 94° C for 2

minutes; 38 cycles of 94° C for 30 sec 45° C for 30 sec 65° C for 60 sec and a final extension

of 65° C for seven minutes. For the Cytochrome Oxidase I gene the condition is as follows.

94° C for 2 minutes; 38 cycles of 94° C for 30 sec 50° C for 45 sec 65° C for 60 sec and a final

extension of 65° C for seven minutes. 45° C and 50° C are found to be the optimum annealing

temperatures for the two mitochondrial markers.

47

c) Visualization of the PCR product - Gel Electrophoresis The following is the general protocol for the Agarose Gel Electrophoresis:

1. To make a 1.2% agarose gel, weigh 1.2 g of agarose in a weighing balance and dissolve

it in 100 ml of TBE buffer [54 g Tris, 27.5 g boric acid and 20 ml 0.5 M EDTA dissolved

in 1000 ml distilled water to make 5X TBE buffer, this is diluted to 1X prior to use].

To melt the agarose, use a microwave oven for 60 seconds and add 5 µl of Ethidium

bromide solution in distilled water. The molten agarose with ethidium bromide is casted

over to a gel casting tray with comb.

2. When the gel is set and hard, remove the combs from the gel and the wells will be

formed. The PCR products along with the tracking dye are added to the wells. The gel

was sunken in a tank containing 1X TBE buffer.

3. A current of 100-120 V was supplied to the gel using a portable power supply, the

wells with the PCR product will be placed near to the cathode and when current applies

the Products will move towards the anode.

4. When the PCR products had run their path all the way through the gel, the gel was

taken from the tank and visualized on a Life technology E-Gel Imager. (Gel

Documentation System).

5. The specific PCR bands were extracted from the gel using the Invitrogen™ PureLink™

Quick Gel Extraction Kit and the sequencing of the PCR product was done through

service providers.

d) Sequencing of the PCR product The principle of dideoxy chain termination is used for sequencing. In this method, each strand

of the template DNA like the PCR product is made amplified in two separate tubes with each

tube containing the forward and the reverse primers. A minute quantity of fluorescent labelled

di-deoxy nucleotide tri-phosphates (ddNTPs) was included in the sequencing mix. These

48

ddNTPs are different from the normal dNTPs in that they are having an H group rather than an

OH group on the third carbon of the ribose sugar. When a ddNTP was included as an alternative

of a dNTP in the growing chain, no other dNTP would bind to the 3rd carbon of the ribose

sugar since there is the absence of the OH group. Thus, it will prematurely terminate the

sequence. This will result in a combination of different sized pieces all of them ending in a

fluorescently labeled ddNTP. Soon after the sequencing reaction, these different length

fragments were run on a gel in an automated DNA sequencer in which the fragments are

separated according to size. When the samples passed through some point along the path of the

gel, an argon ion laser fluoresces the dye attached to the samples. Each ddNTP (A, C, G and

T) carried a dye that fluoresced at a specific wavelength, which were chosen up and registered

by a computer as a unique colour. A sequence corresponding to the template DNA was then

generated as a sequence of differently coloured peaks (Reece, 2004).

4.7 DNA sequence analyses The DNA sequences obtained were subjected to a BLAST search before moving on the

assembly, alignment and analysis. The similarity search derives the sequences present in the

database NCBI (National Centre for Biotechnology Information). The sequences would have

some unwanted base pairs at both the ends. This makes the sequences junk when used for

further procedure. Thus, the sequence has to be trimmed to certain lengths for further analysis.

The trimming of the sequences could be done by bringing the sequences into the BioEdit

software. BioEdit is a tool used align sequences and trim them at both the ends. BioEdit is

proposed to supply a single program that can handle most simple sequence and alignment

editing and management purposes that researchers are likely to do on a regular basis, as well

as a few basic sequences analyses (http://www.mbio.ncsu.edu/BioEdit/page2.html). The

sequences obtained from the sequence providers has to be trimmed before processing in order

to avoid confusing results when assembled and analysed. So, the 16s rRNA sequences and the

COI sequences of the snail had fed to the BioEdit tool and trimmed properly for analysis. The

trimmed sequences were saved into a FASTA format for further studies.

The trimmed sequences were assembled manually and aligned using ClustalW which is the

most suitable tool for aligning sequences globally. The aligned sequences were analysed using

Molecular Evolutionary Genetics Analysis (MEGA), which contains many analytical methods

and tools which could be used for the studies on phylogenomics and phylomedicine. Molecular

49

Evolutionary Genetics Analysis (MEGA) software provides many tools to perform analyses

like assembling sequence alignments, inferring evolutionary trees, estimating genetic distances

and genetic diversities, inferring ancestral sequences, calculating time trees, and testing

selections (Kumar et al., 2016 & 2018). The variations along the sequence lengths could be

traced in the MEGA tool with the help of colour code for respective nucleotide. Detection of

various haplotypes where haplotypes are “a group of genes within an organism that was

inherited together from a single parent or the inheritance of a cluster of single nucleotide

polymorphisms (SNPs), which are variations even at a single position in the DNA sequence

among individuals” (https://www.nature.com/scitable/definition/haplotype-haplotypes-142).

The obtained sequences of 16s rRNAgene and COI gene were aligned manually in the MEGA

tool. The sequences were aligned using ClustalW and assembled manually in MEGA version

7.0.26 (Kumar et al., 2016). The variations in the different nucleotide positions in the sequences

were noted and compared with the available sequences of both the gens in the NCBI.

In order to study the population genetic structure of the population of the Giant African Snail

in South India, the sequences obtained were examined using the DNAsp, a software package

for a comprehensive analysis of DNA polymorphism data. DNAsp version 6.12 (Rozas et al.,

2017) was used to identify different haplotypes, its frequency and calculating the haplotype

and nucleotide diversities. The variable nucleotide positions of all haplotypes were tabulated

manually. A further search was conducted in the NCBI Genbank for 16s rRNA and COI genes

of Achatina fulica and the available sequences were downloaded in FASTA format for further

analysis. A median joining network of all the available 16s rRNA and COI haplotypes from

Global and Indian populations were constructed using the Network version 5.0.1.0 program

(http://www.fluxus-engineering.com).

4.8 Collection of wood import data The wood import data was collected from the Plant Quarantine Station of the Directorate of

Plant Protection, Quarantine & Storage, Cochin Port at Willington Island in the state of Kerala,

to relate the invasion events and identify the possible routes of introductions because it was

speculated that the third wave of invasion in Kerala in the year 2005 was associated with the

starting up of a timber depot adjacent to a sea port. The collected data was containing all the

details of the wood such as barked and un-barked, country of origin and the name of the wood

item being imported.

50

4.9 Screening of Angiostrongylus cantonensis from snail body

a. Cut tissue pieces (6 to 53 mg) from the posterior end of the mollusc’s foot

b. Place the cut piece in 1 ml of 0.01% pepsin-0.7% HCl in individual wells of a 24 well

culture dish ( Corning Inc., Cornin, NY) for digestion of the tissue.

c. The larvae will be released.

d. The obtained larvae will be identified by morphological features.

4.10 Screening of Angiostrongylus cantonensis from snail mucus

a. Mucus were collected by keeping the snail individually in polystyrene petridishes (60

by 15 mm) overnight, with occasional prodding to stimulate secretion.

b. The mucus samples were treated with pepsin-HCl to facilitate collection of larvae.

c. Larvae will be identified through microscopic examinations.

4.11 Screening of Angiostrongylus cantonensis from snail excreta Baermann Technique will be used for screening. It will be done using a funnel fixed to a stand.

A short piece of tube will be attached to the stem of the funnel. A clam or spring clip will be

used to close the tubing. An appropriate amount of faecal matter (5-10g) will be taken with a

spoon or spatula and will be placed it on a cheese cloth or dental napkin. The cheese cloth

containing faecal matter will be folded from the four sides to form a pouch and it will be tightly

closed using a rubber band. A small stick will be pushed along with the rubber band and the

pouch will be placed in the funnel in lukewarm water. It will be left for 24 hours immersed. A

few millimeter of fluid from the stem of the funnel will be taken and centrifuged at 1000 rpm

for 2 minutes. The sedimented sample will be checked for the presence of larvae.

51

4.12 PCR-Based detection of Angiostrongylus Cantonensis

a. PCR-based method can be used to detect A. cantonensis directly from tissue slices as

well as mucous secretion of the molluscs (Qvarnstrom et al., 2007).

b. Fresh and frozen tissue will be used for the molecular analysis.

c. DNA will be extracted from purified nematode larvae and mucus samples by digestion

with Proteinase K and Tris HCl laureth and EDTA. The mucous will be again purified

using kits for the removal of PCR inhibitors.

d. PCR primers will be designed for mitochondrial genes like 18S rRNA genes, from the

available sequence of A. cantonensis 18S rRNA gene GenBank entry (accession

number AY295804).

e. PCR conditions for the designed primers will be standardised and amplification will be

done.

f. Sequencing of the PCR product will be done with service providers.

g. Comparison of the sequences will be done with the sequences available in NCBI.

h. Assumptions will be made based on the positive/negative presence of the larvae.

4.13 Awareness classes and snail Eradication Awareness classes were conducted in various localities in Kerala to make the people aware

about the pest status and the problems created by the pest. Large number of people participated

in various events. The participants of these meetings include local self-Government authorities,

common people, health authorities etc. Notices, postures and brochures were distributed to the

people in every meeting. The notices contain all the relevant information regarding the snail

and its infestations. Snail eradication programmes were conducted in many places and was

appreciated with a large number of people’s participation.

_________________________________ 5: Results and Discussion

52

5. RESULTS AND DISCUSSION

5.1 Survey and Sampling Results Surveys were conducted in most of the snail infested localities in South India and sample

collection was done. The Giant African snail infestation in Kerala during 2015 was only in ten

districts out of the total fourteen districts of the state. Later the infestation has spread to three

more districts viz., Thrissur, Wayanad and Kottayam and the total number of snail infested

districts has reached thirteen as of the year 2019. Out of the fourteen districts in Kerala, only

Idukki district is devoid of snail infestation as of now. A total of 246 localities in Kerala, 17

from Tamil Nadu, 5 from Karnataka and one from West Bengal, totalling 268 localities in India

were identified by extensive field surveys (Figure 5.1). Palakkad, Ernakulam and

Thiruvananthapuram districts are found to be the most snail infested regions in Kerala. In Tamil

Nadu the snail infestation is prevalent in those areas which are moist throughout the years. The

snails are found to be affecting the home gardens in the state of Kerala while, in Tamil Nadu

mulberry plantations and agriculture crops are the most affected. Samples were also collected

from two snail infested localities in West Bengal. Participated in many snail eradication

programs conducted by several local self-government agencies and conducted awareness

classes for the representatives of the government authorities, Asha workers, Health workers,

Kudumbasree members and to the common people.

5.2 Colour Polymorphism in Giant African snail Achatina fulica Achatina fulica samples were collected from different localities in South India to identify

invasion routes using molecular markers and to identify the best control strategies for the

control of the snails. During the field surveys in 2016, three distinct body colourations among

the Giant African Snails were distinguished from the samples collected in South India viz.,

black, grey and white. Even though colour polymorphism is seen among gastropod molluscs,

body colour polymorphism is very rare. Especially in the African Achatinidae the snails are

very rarely exhibiting body colour polymorphism. No other reports are there about the body

colour polymorphism of the Giant African snail A. fulica. The colour polymorphs are seen in

equal proportion with the normal grey body coloured ones. The grey body coloured snails are

the most common among the Giant African snail population present in India.

53

Figure 5.1 Map of the Survey Localities in peninsular India

54

They are thoroughly distributed along all the snail infested localities. The white and the black

bodies snails are comparatively rare and found only in a few places. The black snails were

predominantly noticed from a locality Willington Island in Ernakulam district. This place is

considered to the major hub of the Giant African snail infestation in Kerala since the place is

having a timber depot which receives timber from different countries in the world and the snail

infestation in the locality is supposed to have started soon after the opening of the timber depot.

The white bodied snails were seen in a place called Konamoolai near to Sathyamangalam in

Coimbatore District of Tamil Nadu. The white bodied snails were not a single mutant albino

as they are found numerous in numbers in all the age groups. The white bodied snails and the

black bodied snails are seen in equal proportion with its grey counterparts. The young ones of

the white bodied snails were checked to know whether the snails are leached out due to the

manure applied in the fields. But the young snails were also having white bodies. But the eggs

laid by the white bodied snails failed to hatch in the laboratory conditions. The black bodied

snails are present in some more localities of Kerala apart from Willington Island. The localities

includes Perumbavoor, Kottayam, Angamali and Pinarayi. White bodied snails were present in

one more locality in 2017.They are seen in a village called Kenjanur in Tamil Nadu which was

very nearer to the first locality which is Konamoolai. The grey bodied snails are the most

common snails widely distributed in the southern states of India.

5.3 16s rRNA Haplotypes of Giant African Snail in India After the successful DNA isolation, PCR amplification and sequencing of the PCR product

was done through service providers. A total of 208 sequences for the 16s rRNA gene was

obtained. These sequences were stored in FASTA format. The 16s rRNA gene sequences were

aligned in ClustalW and trimmed in BioEdit. The sequences were assembled manually in

Molecular Evolutionary Genetic Analysis (MEGA) and the haplotypes were detected using

DNAsp Version 6.12 (Rozas et al., 2017).

From the 208 sequences of the 294 base pair 16s rRNA gene, 17 haplotypes were identified

from the study area which vary at 53 nucleotide positions (Table 5.1 & Figure 5.2). Among

these seventeen haplotypes, 14 haplotypes are new and unique to the present study. Fontanilla

et al., (2014) had earlier identified eighteen distinct haplotypes of Achatina fulica from the

world (A-R) based on 293 bp. They have suggested the Indian Ocean islands as the earliest

known common source of the infestation of the snail.

55

Table 5.1 Locality, sample size of the Giant African Snail and the summary of the distribution and frequency of the 16s haplotypes in India

Locality Sample Size (No. of Haplotypes)

Haplotype Name (No. of Individuals)

WEST BENGAL 1) Basirhat 2 (2) 1 (1), 2 (1) KARNATAKA 2) Mudhol 1 (1) C (1) 3) Chikkodi 1 (1) C (1) 4) Dharwad 1 (1) C (1) 5) Honnali 1 (1) C (1) 6) Bengaluru 2 (1) C (2) TAMIL NADU 7) Chennai 2 (1) C (2) 8) Erode 17 (4) 3 (1), 4 (1), 5 (1), C (14) 9) Coimbatore 5 (1) C (5) 10) Tirunelveli 2 (1) C (2) PONDICHERRY 11) Mahe 1 (1) C (1) KERALA 12) Kasaragode 4 (2) X (1), C (3) 13) Kannur 15 (5) T (1), U (1), V (1), Z (3), C (9)14) Wayanad 5 (1) C (5) 15) Kozhikode 34 (3) 6 (1), Y (1), C (32) 16) Malappuram 3 (1) C (3) 17) Palakkad 33 (3) H (13), C (19), 7(1) 18) Thrissur 6 (2) P (1), C (5) 19) Ernakulam 34 (2) P (2), C (32) 20) Alappuzha 10 (2) 6 (1), C (9) 21) Kottayam 1 (1) C (1) 22) Pathanamthitta 7 (2) W (1), C (6), 23) Kollam 6 (2) Z (1), C (5) 24) Thiruvananthapuram 15 (1) C (15)

TOTAL 208 (17)

56

Figure 5.2 Haplotype Table of 16s rRNA showing Nucleotide variable positions

57

This paper also considers Mauritius as the source of the snail infestation in India. They are also

not ruling out the possibility of a multiple introduction events into India since there are busy

trade routes between India and other parts of the world. From another study in India a new

haplotype from Odisha was identified which is haplotype S which is thought to be a derivative

of haplotype H (Ayyagari and Sreerama, 2017) is also included and used for the study.

The major haplotype present in the Indian sub-continent was found to be Haplotype C. This

haplotype is present in all the sampled localities except West Bengal. The distribution of the

most common haplotypes viz., haplotypes C, P and H which were reported from the global

populations and are present in the peninsular India is given in the (Table 5.2, Figure 5.3). Sampling was done from a single locality in West Bengal (Basirhat), since it is nearer to the

mother population of the first known introduction, and two haplotypes - haplotype 1 and 2 were

identified. These new haplotypes 1 and 2 are derived from the most common haplotype C. Five

samples were taken from Karnataka state from Mudhol, Chikkodi, Honali, Dharwad and

Bangalore and all of them were found to be of haplotype C.

Tamil Nadu state harboured four different types of haplotypes and the most common among

them was found to be haplotype C. The other haplotypes in Tamil Nadu are 3, 4 and 5. They

are the new and unique haplotype to the present study identified from the populations of

Sathyamangalam in Erode district of Tamil Nadu. The populations from Chennai, Pollachi and

Coimbatore are harbouring haplotype C only. The locality in Chennai was the first known

locality of the Giant African Snail introduction in south India. The new haplotypes 3, 4 and 5

are from a locality in Erode district called Konamoolai, where the remarkable body colour

polymorphism of the snail was found.

All the remaining haplotypes are from Kerala. The state is having a total of twelve haplotypes

and they are C, P, H, T, U, V, W, X, Y, Z, 6 and 7. Among the twelve haplotypes other than

the common haplotypes C, P and H all other nine are new haplotypes. The haplotype C is the

most common haplotype and found uniformly in all the sampled localities of Kerala. With the

addition of the haplotype 7 in this study, there is a deletion in the 294th position in all other

reported global and Indian haplotypes. ‘T’ nucleotide is present in the 294th position of the

haplotype 7 and rather than the 293 bp sequences globally identified by Fontanilla et al., (2014)

now it is 294 bp.

58

Haplotype P identified by Fontanilla et al., (2014) is present in Thrissur and Ernakulam

populations of Kerala. Earlier these haplotypes have been reported from Nagpur and Nasik in

Maharashtra state of India. In Thrissur, the haplotype P is identified from a single snail, which

was found from a nursery which transports ornamental plant materials in different parts of

India. The second individual of haplotype P is from Ernakulam district. It was from a snail

infested locality at Willington Island, which is supposed to be the hub of the Giant African

snail infestation in Kerala.

Table 5.2 Name, Total Number and Frequency of 16s haplotypes

Sl No.

Locality Name of the Haplotype

No. of Individuals

Percentage %

1 All other localities C 174 83.572 Palakkad H 12 6.283 Ernakulam, Thrissur P 3 1.454 Kannur T 1 0.485 Kannur U 1 0.486 Kannur V 1 0.487 Pathanamthitta W 1 0.488 Kasaragode X 1 0.489 Kozhikode Y 1 0.4810 Kannur, Kollam Z 4 1.9311 West Bengal 1 1 0.4812 West Bengal 2 1 0.4813 Erode 3 1 0.4814 Erode 4 1 0.4815 Erode 5 1 0.4816 Kozhikode, Alapuzha 6 2 0.9717 Ottapalam, Palakkad 7 1 0.48 Total 208 100.00

59

Figure 5.3 Map of the distribution of common global haplotypes of 16s rRNA gene in peninsular India from this study

60

The haplotype H which is present in the Indian Ocean islands of Mayotte and Mauritius was

identified from the Ottappalam population in the Palakkad district of the Kerala state. The

remaining one is haplotype 7 which is related to haplotype H.

Similar haplotypes was identified thrice in the same place in three different seasons. It is in

Kambil of Kannur district and the haplotype was Z. The same haplotype was identified from a

place called Kattuputhussery in Kollam district of Kerala. The two places are separated with a

road distance of 466 kilometres. Kannur in Kerala state shows the largest number of haplotypes

district wise with five haplotypes viz., T, U, V, Z and C. followed by Erode of Tamil Nadu

with four haplotypes. Chengannur, a place in the Alappuzha district of Kerala and a place

called Nadapuram, which is at a distance of 349 kilometres from Chengannur is sharing the

common haplotype, haplotype 6. Kozhikkode and Palakkad districts are having three

haplotypes in their populations.

In Palakkad haplotypes H, 7 and C are seen while in Kozhikkode the haplotypes 6, Y and C

are seen. Alappuzha, Ernakulam, Thrissur, Pathanamthitta and Kollam are having two

haplotypes each. Pathanamthitta another widely infested place in Kerala is having another

haplotype called haplotype W along with haplotype C. Thiruvananthapuram, Kottayam and

Wayanad are having only one haplotype. Kottayam, Thrissur and Wayanad are the recent

introductions of the snail in Kerala. The newly identified haplotypes from peninsular India is

given in Figure 5.4. In all the states except West Bengal from this study, haplotype C is present

and are in higher percentages. The haplotype C with 83.57% shows the highest percentage

among all the haplotypes in the study (Table 5.2) followed by haplotype H (6.28%). The

haplotypes Z, P and 6 are having 1.93, 1.48 and 0.97% respectively in the frequency

distribution. For all other haplotypes the contributory percentage was 0.48 %.

61

Figure 5.4 Map of the distribution of new haplotypes of 16s rRNA gene in peninsular India

62

5.4 Population genetic structure based on 16s rRNA gene The population genetic structure of the snail was calculated using DNAsp. To calculate the

global haplotype and nucleotide diversities, apart from the 208 sequences of the present study,

an additional nineteen sequences from India which includes the 12 sequences from Fontanilla

et al., (2014) were taken (Table 5.3). With this the remaining 548 of the 560 sequences of

Fontanilla et al., (2014) were also combined to calculate the global haplotype and nucleotide

diversity measures. For calculating the peninsular Indian haplotype and nucleotide diversities,

in addition to the 208 sequences, 16 sequences from the peninsular Indian states were utilized

(Table 5.3). Apart from this geographical region, only 3 sequences were available for the rest

of the India. The country wise calculation was not possible for India because the available

sequences were not representative of its actual distribution, especially if one considers the

magnitude of infestation in North East Indian states.

Table 5.3 Other sources of 16s rRNA sequences in India

Locality Sample Size

(No. of Haplotypes)

Haplotype Name (No. of Individuals)

NCBI Accession Number

BIHAR 1) Motihari 3 (1) C (3) KX514438.1,

KX514437.1, KX514436.1

ODISHA 2) Araupalli 2 (1) S (2) KP119753.1

KP317641.1 MAHARASHTRA 3) Nagpur 7 (1) P (7) JQ436751.1 4) Nashik 1 (1) P (1) Fontanilla et al., 20145) Pune 3 (1) C (3) -do- 6) Talegaon 1 (1) C (1) -do- ANDHRA PARADESH

7) Puttaparthi 1 (1) C (1) KX514435.1 KARNATAKA 8) Bengaluru 1 (1) C (1) KP317640.1 TOTAL 19 (3)

The mean haplotype and nucleotide diversity calculations were given in the Table 4.6. The

mean haplotype diversity and nucleotide diversity for peninsular India was found to be 0.354

and 0.002 from this study using 224 sequences. The haplotype diversity of the Global

population from a previous study was 0.445 and nucleotide diversity was 0.003. The East

African haplotype diversity was 0.797 and the nucleotide diversity was 0.012 and it is found to

63

be high since it is the native range of the snail. Indian Ocean islands yielded a haplotype

diversity of 0.535 and nucleotide diversity of 0.002. And outside Africa and Indian Ocean

Islands the haplotype diversity is 0.205 and the nucleotide diversity of 0.001 was found

(Fontanilla et al., 2014). The global haplotype and nucleotide diversities are recalculated with

incorporating the 208 sequences from this study and 7 other sequences from other sources with

the 560 global sequences. The recalculated haplotype and nucleotide diversity values are 0.415

and 0.004 respectively for a total of 33 haplotypes (Table 5.4). Table. 5.4 16s rRNA Haplotype and Nucleotide Diversity of the African and the Indian populations of Achatina fulica

Sl. No.

Region Haplotype Diversity

Nucleotide Diversity

Haplotypes

1 East Africa 0.797 0.012 7 2 Indian Ocean Islands 0.535 0.002 6 3 Rest of East Africa & Indian

Ocean Islands 0.202 0.001 5

4 Overall 0.445 0.003 18 5 Global recalculated 0.415 0.004 33 6 Peninsular India 0.354 0.002 18

1-4 Fontanilla et al., 2014

5.5 Network Analysis of 16s rRNA haplotypes The median joining network analysis of all the haplotypes from the global and the Indian

populations showed that all the Indian haplotypes S, T, U, V, W, X, Y, Z, 1, 2, 3, 4, 5, 6 and 7

are all clustered together and were linked to the haplotype C (Figure 5.5). Along with the global

haplotypes E, F and Q, the Indian haplotypes H, P, T, V, X and 6 are linked directly to the

haplotype C. Except haplotypes V and X, all others are showing a single nucleotide difference

from haplotype C and haplotypes S and 7 are derived from haplotype H. Whereas all other

haplotypes, even though they are linked to the haplotype C, there are one or two missing nodes

or unsampled locations between them. Haplotype 4 from Erode in Tamil Nadu is showing the

largest number nucleotide polymorphic sites. The sequence shows ten nucleotide difference from

haplotype C with a missing node in between. Another haplotype, haplotype 6 is also derived from

this missing node. The haplotype 6 represent two localities in Kerala. The haplotypes T and U

are connected to the haplotype C, they are also connected to a missing node from hap C.

Haplotype W is found to have been derived from Hap U. Similarly, haplotypes 1 and 2 are having

a common missing node from hap C. Haplotypes 3 and 5 are derivatives of hap C, with two

missing nodes between them.

64

Figure 5.5 Network Diagram of 16s r RNA haplotypes

65

5.6 COI haplotypes in India and the world From the total of 268 sampling localities in peninsular India (Figure 3.1), 47 representative

samples were subjected to COI sequencing. Unlike 16s rRNA gene, comparable global

sequences are not available for COI gene. So only a representative sequencing was done in

order to identify whether there is a considerable genetic variation in the gene. A total of 8

haplotypes were identified from these 47 sequences (E, F, G, H, I, J, K, L) from this study. A

total of twelve different haplotypes (A-L) of the COI gene from 90 sequences (includes the 47

sequences of this study from India) were distinguished globally (Figures 5.6 and 5.7). Out of

the 90 sequences, 43 are from Africa. In which 39 are from Cameroon (Woogeng et al., 2017),

3 are from Nigeria and 1 is from an unknown locality in Africa (Table 5.5). Among the total

43 sequences from Africa, 40 sequences belong to haplotype A of which 37 are from Cameroon

and 3 are from Nigeria. The other haplotypes are B and C each represented by single sequences

in Cameroon. The fourth haplotype D is also represented by a single sequence from an

unknown locality in Africa. The most common haplotype in Africa is A with a frequency of 93

%. Out of the remaining 47 sequences, 45 sequences were from this study. Of the remaining

two, one is from India and another is from an unknown locality in China. The haplotype E is

the most common haplotype in India with a frequency of 84.78%. All other haplotypes in India

are represented by single sequences.

The twelve haplotypes varied at 27 variable positions (Figure 5.7) The mean haplotype

diversity of the West African population based on the 42 sequences from Cameroon and

Nigeria was 0.10 and the mean nucleotide diversity is 0.001. The mean haplotype diversity of

the Indian population based on 46 sequences was 0.28 and the mean nucleotide diversity is

0.003. The overall mean haplotype diversity was 0.61 and the mean nucleotide diversity is

0.003 (Table 5.6).

5.7 Network Analysis of COI haplotypes

The median joining network analysis of the COI haplotypes (Figure 5.8) globally shows that

the three haplotypes from West Africa A, B and C are grouped together and were linked to the

India haplotype E. There occurs only a single mutation between E and A, and the haplotypes

B and C are found to be linked with the haplotype A with 1 and 4 mutations respectively. There

are two missing nodes in the haplotype network diagram. The African haplotype D is linked to

66

Figure 5.6 COI haplotypes of the Giant African Snail

67

Figure 5.7 Haplotype Table of COI gene showing Nucleotide variable positions

68

Figure 5.8 Network Diagram of COI haplotypes

69

the haplotype E with a missing node. This missing node is also linking haplotypes G and F

where the haplotype G is derived from haplotype E with a single mutation. The three other

haplotypes in India I, J and K are related to E with a second missing node and are clustered

together. The haplotype H is connected to the haplotype E with 6 mutation and haplotype L is

connected to E with a single mutation.

Table 5.5 Locality, sample size of the Giant African Snail and the summary of the distribution and frequency of the COI haplotypes.

Locality Sample Size(No. of

Haplotypes)

Haplotype Name (No. of

Individuals)

NCBI Accession Number

(Haplotype Name)

WEST AFRICA1 1) Tiko, Cameroon 19 (3) A (17), B

(1), C (1) KF512490.1 (A) KF512491.1 (B) KF512492.1 (C)

2) Tombel, Cameroon 20 (1) A (20) 2) Ibadan, Nigeria 3 (1) A (3) KT290317.1 (A)

KT290318.1 (A) KT290319.1 (A)

AFRICA 3) Locality not known 1 (1) D (1) AY148556.1(D)ASIA 4) Locality not known, China 1 (1) E (1) NC_024601.1 (E)INDIAN SUBCONTINENT 5) North 24 Parganas, West Bengal State, India

2 (2) F (1), G (1) LC440025.1 (F) LC440024.1 (G)

6) Khorda, Odisha State, India 1 (1) H (1) KP259270.1 (H)7) Bangalore, Karnataka State, India 2 (1) E (2) 8) Chennai, Tamil Nadu State, India 1 (1) E (1) LC440023.1 (E)9) Erode, Tamil Nadu State, India 3 (2) E (2), L (1) LC440030.1 (L)10) Coimbatore, Tamil Nadu State, India

2 (2) I (1), E (1) LC440027.1 (I)

11) Tirunelveli, Tamil Nadu State, India 2 (1) E (2) 12) Kasaragode, Kerala State, India 3 (2) E (2), J (1) LC440028.1 (J)13) Kannur, Kerala State, India 1 (1) E (1) 14) Kozhikode, Kerala State, India 1 (1) E (1) 15) Wayanad, Kerala State, India 1 (1) E (1) 16) Palakkad, Kerala State, India 7 (1) E (7) 17) Thrissur, Kerala State, India 2 (1) E (2) 18) Ernakulam, Kerala State, India 10 (2) K (1), E (9) LC440029.1 (K)19) Alappuzha, Kerala State, India 2 (1) E (2) 20) Kollam, Kerala State, India 2 (1) E (2) 21) Trivandrum, Kerala State, India 4 (1) E (4)

TOTAL 90 (12) 1 Woogeng et al., 2017

70

Table 5.6 Haplotype and Nucleotide diversities of COI haplotypes

Sl No.

Population Mean Haplotype Diversity

Mean Nucleotide Diversity

No. of Haplotypes

N

1 Global 0.61 0.003 12 902 West Africa 0.10 0.001 3 423 India 0.28 0.003 8 46

5.8 Wood Import data The wood import data collected from the Cochin Port of Kerala was between the years 2016 to

2017 spanning for eighteen months. The wood has been imported to Cochin port from 40

different countries of which 22 countries are thoroughly infested with the Giant African Snail.

27 different wood items/species have been imported to this port during this period from these

22 countries from 4 continents (Table 5.7). The wood imports belong to different categories

such as wood with bark, wood without bark, wooden crates and containers of different species.

These 22 countries include 10 African countries, 7 Asian countries, 1 country from North

America and 4 from South America. Among the 10 African countries, the wood import to

Cochin port is also done from Uganda and Tanzania where the snails are native. Though data

was only availed for a limited time period of eighteen months (due to the policy issues with the

Government of India), we were told that the wood imports to Cochin Port are mainly from

these 40 countries for a considerable time period (Plant Protection Officer, Cochin Port pers

comm). The major types of wood being imported into Kerala includes the Pyinkado logs which

is Xylia xylocarpa, which is distributed in Myanmar and India and extending eastward into

Cambodia and Thailand in South East Asia. X. xylocarpa is being imported in barked form

from Benin, Indonesia, Myanmar and Vietnam. Also they have been imported in a debarked

form from Myanmar and Vietnam. The other major wood imported into Kerala is teak which

imported in the barked form from three countries and as teak logs without bark from six

countries. The countries includes Benin, Nigeria, Tanzania, Togo and Uganda in Africa,

Myanmar and Columbia from Asia and South America. The countries in Africa are the native

range of the Giant African Snail and the other countries are thoroughly infested with the snail.

The other major wood species imported from Africa is Tali, which is Erythrophleum

suaveolens. It is imported from Cameroon, Ghana and Tanzania. It is being used in India for

all kind of heavy constructions. It is also used for decking, sheet pilings, sound barriers, stables

and piles. Along with the wood import from different countries to India through the Cochin

Port, the wood has been transported to different parts inside and outside the state of Kerala.

71

Table 5.7 Wood import data to Cochin Port in Kerala, India (2016-2017)

Sl. No Country Timber

With Bark Without Bark AFRICA 1 Benin Pyinkado logs Teak logs 2 Cameroon Tali Bilinga, Tali 3 Democratic Republic of

Congo Wenge wood Entandrophragma sp,

Sapeli4 Ghana Tali5 Madagascar Pine6 Nigeria Teak logs Teak logs 7 South Africa Eucalyptus grandis

8 Tanzania Mora wood, Tali, Teak logs

9 Togo Teak logs 10 Uganda Green heart, Teak Green heart, Mora wood,

Padauk logs, Sapeli, Teak logs

ASIA 11 China Wood assorted, wooden

crates12 Indonesia Pyinkado logs Merbau logs, Sappan,

Wodden pallets 13 Malaysia Merbau logs,

Sal/Selanganbatu 14 Myanmar Pyinkado logs, Teak Htauk kyant, Meranti,

Pyinkado logs, Teak logs15 Papua New Guinea Merbau logs 16 Singapore Mora wood, Rattan Rattan17 Vietnam Keruing, Meranti, Pyinkado

logsPyinkado logs

NORTH AMERICA 18 United States of

America Hickory logs, Pine Pine

SOUTH AMERICA 19 Brazil Eucalyptus grandis Eucalyptus grandis,

Tabebuia 20 Colombia Teak21 Guyana Green heart Green heart, Mora wood,

Peltogyne 22 Suriname Mora wood, Peltogyne Mora wood, Peltogyne

72

5.9 Detection of Angiostrongylus cantonensis from Achatina fulica The snail faces and tissue parts were examined for the presence of the larvae of Angiostrongylus

cantonensis. The snails were reared in a glass house without the presence of any soil material

to collect its faeces. The glass tanks in which the snails were kept was sterilized with Ethanol

to make the surface sterile and free from any contamination. The faeces from snails were

collected and kept in petri dishes and examined under a stereo microscope with 10X resolution.

The nematodes were noticed from the snail faeces under the microscope and the best one

among them was chosen for taking photographs. The morphological detection of the nematodes

was done using the characteristics of the nematodes.

Angiostrongylids are roundworms (nematodes) with thin cylindrical bodies. Research has

focused primarily on Angiostrongylus cantonensis and species closely related to it. Adults are

filiform in both sexes, tapering at the anterior end. Females are larger and more robust. The

adult male nematodes are 15.5-23.0 mm long and 0.25-0.35 mm wide. They are transparent,

with a smoothly rounded head. Two- or three-minute triangular teeth are located at the base of

the oral cavity. The esophagous is 0.29-0.35 mm long. The intestine is wide but thin-walled.

The excretory pore located in the region of the esophageal-intestinal junction. Females are

larger, measuring 18.5-33.0 mm in length and 0.28-0.5 mm wide. The head, esophagous, and

intestine are similar to the male. The ovaries fill the posterior region. The vulva is a transverse

slit located about 0.25 mm from the posterior end First stage larvae are about 0.3 mm long and

0.015 mm in width; second stage larvae are about 0.45 by 0.03 mm; third stage larvae are

similar in size, though a little thinner; fourth stage larvae reach about 1.0 by 0.4 mm. The newly

moulted sub-adults are about 2 mm by 0.06 mm; they grow to about 12 mm (females) and 11

mm (males) before leaving the rat's brain and migrating to the pulmonary arteries (see the life

cycle section, below), where they mature, reaching a size of up to about 35 by 0.6 mm (females)

and 25 by 0.4 mm (males). Genera and subgenera of Angiostrongylidae can be distinguished

based on the appearance of the adult male caudal bursa, the apparatus used to clasp the female

during mating. However, species of Angiostrongylus have rather few characters that serve to

distinguish them and they are therefore difficult to identify. From the microscopic examination

of the nematodes, the presence of Angiostrongylus cantonensis was detected from the snail

populations of Kerala.

73

Tissues from 30 Achatina fulica were tested for the presence of A. cantonensis. Since PCR

analysis was incompatible with the pepsin treatment necessary for morphological

identification, it was not possible to examine the same samples by both methods. Good Quality

Snail DNA was isolated with different methods. From all the tested samples of Giant African

Snail, five snail samples were found to be containing Angiostrongylus cantonensis with

molecular analysis of Cytochrome Oxidase Subunit I gene with about 500-600 bp. The five

population are Ernakulam, Alappuzha, Palakkad, Thiruvananthapuram, and Kannur. The

obtained sequences were done a similarity searching with BLAST in NCBI and has shown

more than 96% similarity with the available Angiostrongylus cantonensis sequences in the

database. Thus, the presence of the rat lung worm in the populations of Giant African Snail in

Kerala has been confirmed.

Data of the Eosinophilic meningitis affected cases has been collected from different localities

of Kerala. The discharge summary of the infected children was collected from the hospitals

and confirmed the presence of the disease in those areas affected with the Giant African Snail.

The latest news for the presence of the disease was confirmed from Thrissur District and the

place was visited and the discharge summary was collected. Doctors of various hospitals in

Ernakulam was consulted. All the consulted doctors were specialised in paediatric neurology.

The doctors stated that, more than five cases of Eosinophilic meningitis is reported every week

from the snail infested areas of Kerala.

5.10 Discussion and Conclusion The COI haplotype distribution of the A. fulica shows (Figure 5.6) that the major number of

the haplotypes are present in India (8). The invasive range in Africa hosts 3 haplotypes (A, B

& C) and one (D) comes from an unknown locality in Africa. The haplotype A is present in

Tiko and Tombel of Cameroon and Ibadan in Nigeria. The haplotype B and C are present in

Tiko of Cameroon. The haplotype E is distributed in all the sampled locations in India except

West Bengal where the snail was first introduced. The haplotype E is present in Bangalore in

Karnataka, Chennai, Erode, Tirunelveli and Coimbatore districts in Tamil Nadu and

Kasaragode, Kannur, Kozhikode, Wayanad, Palakkad, Thrissur, Ernakulam, Alappuzha,

Kollam and Thiruvananthapuram districts of Kerala. The haplotypes F and G are present in the

Basirhat of West Bengal which is situated 55 kilometres northeast of the original locality of

Introduction in Kolkata in 1847. The haplotype H is from Odisha state. The haplotypes I and

74

L are from Coimbatore and Erode districts of Tamil Nadu respectively. The haplotypes J and

K are from Kasaragode and Ernakulam districts of Kerala state. Along with these four

haplotypes (I, J, K & L) the haplotype E is also present in the respective localities. The

haplotype in China taken from NCBI genbank is haplotype E.

The median joining network diagram of the COI haplotypes shows that the haplotypes in the

invasive range of West Africa A, B and C are related to the most common Indian haplotype E.

The haplotypes A, L and G are found to be evolved from haplotype E with single mutation.

Haplotypes B and C have arisen from haplotype A with 4 and 1 mutations respectively. The

haplotype G is from West Bengal and its locality is closer to the first locality of introduction in

India. The second haplotype in West Bengal is F which is derived from haplotype G with 2

mutations. The haplotypes G and E are linked to missing node with a single mutation, which

is linked to the African haplotype D by 2 mutations. This missing node could represent an

unsampled putative haplotype either in its native range in Africa or from the Indian Ocean

Islands. There is another missing node in the network diagram with 4 mutations from haplotype

E. This missing node gives rise to haplotypes I and K with 2 mutations each. The haplotype J

is connected to haplotype K by a single mutation. The maximum number of mutations are

between haplotype E and H with 6 mutations. The snail introduction in West Africa dates back

to 1980s where the A. fulica is introduced from its native range in East Africa as a food source.

It could imply that the haplotype E could be present in East Africa as well. With the absence

of samples from East Africa, we could not rule out the possibility of the introductions from

East Africa. It is corroborated with the wood import data which shows that the wood is being

imported from the native range countries of Tanzania and Uganda into India. And also, the

wood is imported from West African countries that include Cameroon and Nigeria where the

haplotypes A, B and C are present. In addition to wood, large quantities of cashew nuts are

being imported to India from Ghana, which is thoroughly infested with Giant African Snails.

The haplotype D from an unknown locality in Africa could be from its native range since it is

linked to the haplotype E with a missing node. The missing link between the Indian and the

African haplotypes E and D is due to the lack of sampling in the global populations.

According to Fontanilla et al., (2014), the Indian Ocean island are the earliest known common

source for the spread of this species using 16s rRNA gene. But they were unable to ascertain

the presence of the emergent haplotype as they failed to detect it from the native range in East

Africa due to sample limitations. This missing link of the COI haplotype may be present

75

somewhere else in the global population from where busy trade is happening to the ports in

India. The genetic variation of the population of Achatina fulica in West Africa is low. This

could be due to continuous farming of the species using a few individuals that could pose a

founder effect and bottleneck. This is supported by a very low mean haplotype and nucleotide

diversities. But the haplotype and nucleotide diversities are higher in the Indian populations

than the West African Populations even though, West Africa is connected to the native range

of the snails through road and railway networks.

A global study has revealed 18 distinct haplotypes of the 16s rRNA gene of Giant African snail

in the world. Among them majority of the haplotypes belong to its native range East Africa and

Indian ocean islands. In which eight haplotypes were isolated from its native range in East

Africa. They are haplotypes O, I, J, K, L, M, N and R. The haplotypes in the Indian Ocean

islands are six in number they are A, B, C, D, G, H. Haplotypes in the Indian sub-continent

were C and P. South East Asia yielded only haplotype C in most of the localities and only one

location yielded haplotype E. In the Pacific islands also except in Caledonia which yielded a

haplotype F, haplotype C is seen. South America yielded haplotypes C, D and Q. This study

also proposes the low genetic variation of the snail outside East Africa due to a low haplotype

and nucleotide diversities and it points to a founder effect or genetic bottleneck with an

introduction process involving a very few individuals. This study also proposes Indian Ocean

islands as the earliest known common source of the snail invasion. (Fontanilla et al., 2014).

In India, from the present study the major haplotype identified was hap C. But along with the

common haplotype, fourteen new haplotypes were identified. From an earlier study two

haplotypes were identified from India. The presence of the haplotype H in Kerala proves the

multiple introductory events of the Giant African snail in India. Other than the first invasive

route from Mauritius, more routes of the invasion could have happened into India. Most of the

countries in the South East Asia receives the first stock of the snails from India, Sri Lanka or

Mauritius. But from the global haplotype data it is clear that no one of these places harbours

the haplotype H, even though thorough sampling has been done from many of these places.

This also indicates the possibility of another pathway or multiple pathways of the introduction

of the snail into India.

In the East Africa and the other snail infested localities of Africa, very less sampling and

analysis has been done. This makes the possibility of the presence of all the haplotypes in its

76

native range or some other unsampled localities of the world. The haplotype H also may be

present in the native range of East Africa since it is present in the Mayotte and Mauritius which

are lying very closer to Africa. The haplotype P which was identified by Fontanilla et al.,

(2014) in Maharashtra state of India was identified from two more localities in Thrissur and

Ernakulam districts of the state of Kerala. The spread of this haplotype between different places

in India is a typical example of the spread of the snails through road networks. The snail in

Thrissur was collected from a locality nearer to a nursery, which moves ornamental plants

between different places and the snail from Ernakulam was collected near to a timber depot in

Willington Island.

The timber depot in Willington Island adjacent to Cochin Port was started in the year 2004 and

the snail infestation in the place started in the following year. The timber depot is receiving

timber from different parts of the world. Among these timber importing countries, many are

thoroughly infested with the snail. The quarantine data collected from the Plant protection

office in Willington Island justifies this. The wood is being transported from this depot to

different parts of Kerala. Many places of Kerala are having snail infested localities nearer to

timber depots. For example, Nadapuram in Calicut and Perumbavoor in Ernakulam district.

There are examples for the presence of the same haplotype in Kerala. They are the haplotype

6 and haplotype Z. The former haplotype was from Chengannur in Alappuzha district and

Nadapuram in Kozhikkode district. The later one is from Kambil in Kannur district and

Kattuputhussery in Kollam district. In both the cases areal distance between these two places

is more than 300 kilometres. This also an example of the spread of the snail between places

through roads. The spread of the snail through railway lines were reported very early during

the first half of the twentieth century by Godwin-Austen, (1908). He reported that the snails

have travelled as long as 170 miles in railway carriers. The spread of the snail through railway

lines is happening in Kerala also. In Poonkunnam of Thrissur district, the local people say that

the snails are seen near to the railways station first. So, it is believed that the snails crawled on

goods train compartments and reached Thrissur. Angamaly in Ernakulam also experience the

presence of snails nearer to railway lines. But here another relevant thing to be noted at

Angamaly is the presence of a transformer manufacturing company, which is bringing in their

products and raw materials in large containers and carriers from major ports and within

different places in India.

77

While in Tamil Nadu and Karnataka, huge snail infestation was found in Mulberry gardens and

other moist areas. The snail infestation was spreading between different places through the

sharing of the plant materials between different places doing the same kind of cultivation. The

other pathways through which the snails are being transported is through soil, manure,

ornamental plants, hitchhiking on vehicles, on fodder grasses etc. In Chakkittappara of

Kozhikode district of Kerala, it was believed that the snails were transported along with cow

dung which was brought in from snail infested place as a manure for rubber cultivation. Soil

was imported from Cambodia for the purpose of Metro rail construction in Kerala, which could

also act as a carrier of the snails and their eggs. On field visit people informed that in a place

called Quilon in Kerala state is receiving cashew from many West African countries, which

are highly infested with the snails. Several other pathways of the spread of snails within the

state of Kerala have been identified in this study. A sewage farm is situated in Valiyathura,

where the treatment of solid waste from Thiruvanathapuram is taking place. The fodder grass

is cultivated in this farm and transported to different parts of the district. The place is

completely infested with the Giant African snail. So along with the fodder grass the snail is

also been transported. This makes the spread of the snail quick in Thiruvananthapuram distict.

The road and railway network map of India where the snails are mainly dispersed within the

country is shown in the Figures 5.9 and 5.10.

The Achatina fulica invasion history in India dates back to 1847, when the British Malacologist

W.H. Benson collected a few samples of the live snails of A. fulica from Mauritius and later

released them in Calcutta in the Garden of the Royal Asiatic Society (Naggs, 1997). The snail

soon established in Calcutta and its surroundings. The snails were then reached many faraway

places through railways and spreading into many North and North-East Indian states of India

such as Bihar, Manipur, Assam, Meghalaya, Nagaland, Orissa and Tripura. It was believed that

the snails were introduced to different parts of India along with the transport of Plant materials

from Calcutta Botanical Garden (Godwin-Austen, 1908; Rees, 1950). In South India, the snails

were first introduced in the ‘My Lady garden’ in Madras, which is some 1600 km south of the

original place of invasion in Calcutta during the British period. But the exact year of

Introduction in South India is not known and probably the snails were introduced before 1940

in Madras. The snails were then established in Madras and researchers brought these snails to

different laboratories in the state of Tamil Nadu from the stock population. Research accounts

confirms that the snails were introduced into another University Campus for research purposes

in 1942 (Meenakshi, 1951; Natarajan, 1960; Raut & Ghose, 1984).

78

Figure 5.9 Road map of peninsular India showing the possible movement of 16s rRNA haplotypes

79

Figure 5. 10 Railway map of peninsular India showing the possible movement of 16s rRNA haplotypes

80

The first wave of invasion in Kerala, the southern state of India started with a researcher

bringing the snails from a university in Tamil Nadu to his home in a town called Palakkad

around 1950s. The snails were later accidentally released in a home garden and later established

its population and turns out to be invasive in the districts and neighbouring areas in 1950s. We

were told that during the field surveys that the snails the researcher had brought to Kerala were

imported from Singapore for research purpose. The snails were introduced to Singapore in

1910 and was believed to be introduced from Malaysia several times (Mead, 1961). The

pathway of invasion into Malaysia was believed to be either from Myanmar via Calcutta or

from Sri Lanka in the same year 1910. The second wave of invasion in the state of Kerala was

in 1970s and the third wave is during 2005, where the sources of invasions are not known.

When the third wave of invasion started in the year 2005, the snails were present only in 3

districts of the Kerala state and till 2019 January the snails were present in thirteen out of the

total fourteen districts of the state. The third wave of invasion in Kerala started the year 2005

following the establishment of a timber depot in the previous year adjacent to a port in Cochin.

The timber depot was said to receive shipments of wood logs from the port which was imported

from different parts of the world. From the wood import data, it is clear that 27 different items

of timber are being imported from 22 snail infested countries of the world which includes 10

African countries, 7 Asian countries, 1 country from North America and 4 from South America

(Figure 5.11). The African countries includes the East African countries like Tanzania and

Uganda which are the native range of the Giant African snails. The invasion in different

districts of Kerala has followed after the transportation of timbers from this port and depot to

different timber storing yards. And also, it has been noticed that the snails were found to be

transported to new areas through transport of plant materials, manure and soil. There are reports

that the snails are hitchhiking on trains and other public transportation facilities to reach new

areas in Kerala.

To conclude, this study revealed 12 distinct haplotypes of COI gene in the invasive range of

Achatina fulica. The major haplotypes are A and E in West Africa and India respectively. The

median joining network analysis has showed that the African haplotypes are derived from the

Indian haplotype E which points out the origin of invasion in India to its native range. The

missing node between the haplotype E and haplotype D from an unknown location in Africa in

the network shows unsampled putative haplotypes in the native range. Given the long invasion

history of over 170 years after the arrival of A. fulica to India, the wood import data showed

that there could be multiple invasion events from the native and invasive ranges.

81

Figure 5.11 Map showing the wood import to Cochin port during 2016-17 from Achatina fulica infested and native countries

82

This is supported by the relatively higher haplotype and nucleotide diversities in Indian

population than the West African population. Further sampling in the native East African and

other infested countries to elucidate the source and movement of the invasive snail A. fulica is

essential.

The possibility of the presence of the multiple introductory events of the Giant African snail

using COI gene is confirmed with the data from the 16s rRNA gene with 17 haplotypes from

India. The presence of multiple haplotypes in India points to a multiple introductory event like

the snail non-native populations of Cornu aspersum in Austral-South America (Gaitán-Espitia,

et al., 2013) which proves multiple introductory events with the presence of many haplotypes.

Also, the presence of a relatively high genetic diversity of an introduced species in its invasive

range suggests either there is the presence of a large inoculum of invasion which means that

high propagule pressure and the presence of multiple invasions (Ghabooli et al., 2011). The

haplotype H which has identified from the Ottappalam of Palakkad district and its presence in

the Indian Ocean islands Mayotte and Mauritius are the straight away proof for the presence of

more than one pathway of introduction. Fontanilla et al., (2014) also suggests the possibility

of more than one introductory event of the snail into India owing to the busy trade routes to

India from other countries in the past and present. He also suspects the new haplotypes could

have emerged from the haplotype C, however he could not rule out the possibility of the

presence of these haplotypes in the native range due to lack of sampling. The wood import

data for the year 2016-2017 also shows many wood importing countries to India is highly

infested with the snail and many of these countries are its native range too. So, this study proves

that there are multiple introductory events of the snail Achatina fulica into India.

The presence of the nematode Angiostrongylus cantonensis from the populations of Kerala

suggests the strong presence of the species in the state. The spread of the snail is one of the

cause of the spread of the nematode in the state. Proper control measures has to be adopted in

the state against the spread of the snail and thus the spread of the nematode will also be

controlled. Public education can go a long way toward reducing the probability of human

infection. Consumption of raw or undercooked terrestrial molluscs should be discouraged both

by humans and captive primates. Similarly, paratenic hosts should not be consumed without

cooking. The importance of raw vegetable or vegetable juice consumption as a route of

infection is more questionable. Although it is possible for vegetables to be contaminated by

some species of molluscs containing infective third-stage juvenile nematodes, it is rare and

83

seems improbable if normal sanitary practices are followed. Commercially produced

vegetables should have little likelihood of being contaminated, as the soil is tilled, weeds are

suppressed, and pesticides are applied as needed.

5.11 Social Relevance of the Project The project has started on 15th December 2016. With the support of the project I have surveyed

more than 270 Giant African Snail infested localities in the state of Kerala. The snail is an

invasive species with its native range in East Africa. The snail invasion started in India during

1847 and in Kerala during 1950s. The last wave of invasion of the snail happened in Kerala

during 2004-2005. It is proven through the study of the molecular phylogeography of the Giant

African Snail that the snail invasion into India is through multiple pathways and the imported

wood and other materials across from different countries are causing the inlet of the invasive

species. This result proposes the need of a strict quarantine measures has to be adopted by the

quarantine authority in the national and international scenario. The study also aims to find out

the role of the Giant African Snail in spreading the Rat Lung Worm Angiostrongylus

cantonensis causing Eosinophilic Meningitis in human beings. As a part of the study we could

able to identify ten cases of Eosiniphilic Meningitic cases from the distict of Ernakulam, one

case from Thrissur and one case from Trivandum. All of these cases were in close vicinity with

the snail infested localities and more than 90 percent of the patients had direct contact with the

snails. In order to collect the data of the meningitis cases in different districts, many visits were

done in the district hospitals and Medical colleges of Alappuzha, Ernakulam and Thrissur and

had meeting with the superintends and District Medical Officers. Two new snail infestations

were recorder during the monsoon season of 2019 and visited those places. Interacted with the

Local-self Government authorities of these localities and distributed posters and notices

regarding the invasiveness and health hazards caused by the snails. In a place called Thavanur

in Malappuram District, a special Gramasabha will be held on August 1st 2019 to discuss about

the problems of snail infestation in that area and its control methods that could be adopted to

control them. As a part of this project Iam also leading a talk there. Till date awareness classes

were given in Vadavannur in Palakkad District, Mala and Poonkunnam of Thrissur District,

Chakkittappara and Nadapuram of Calicut District, Eloor, Willington Island and Palluruthy of

Ernakulam District, Thanneermukkam of Alappuzha District, Muzhuppilangad of Kannur

District etc. I was able to be a part of the snail eradication programmes of Vadavannur,

Willington Island, Chakkittappara, Thannermukkam, Cherthala, Poonkunnam etc. The snail

84

population of two places came to a decline in Vadavannur of Palakkad and Muzhuppilangad

of Kannur due to continuous efforts, awareness classes and Eradication from our side and also

with the co-operation of the Government. So with the advancement of this project, more people

will be aware of the menaces caused by the polyphagous Giant African Snail, the disease

caused by the snail and its control methods. Along with the public the authorities will also be

equipped with the correct procedures to eradicate the snail and the disease caused by it.

____________________________________________________________6: Summary

85

6. SUMMARY

The Giant African Snail Achatina fulica (Bowdich, 1822), a native to East Africa is one of the

rapid spreading invasive alien species in India. It has been classified among the worst 100

invasive species present in the world by IUCN. The snail was introduced from Mauritius to

India around mid-nineteenth century and has been spreading into many parts of India. The snail

invasion to south India happened in the first half of the twentieth century and parts of the state

of Kerala had been infested after 1950. The current project was attempted to track the invasion

of the Giant African Snail so to understand whether the invasion was a single event or whether

multiple introductions have happened and also to detect the presence of Angiostrongylus

cantonensis the nematode worm causing eosinophilic meningitis in children. The process of

tracking the invasion of the snail is important because since if it is a single event, the population

would have very limited genetic variability making it susceptible to population decline owing

to intrinsic factors like diseases. However, if multiple introductions have happened, the gene

pool will be quite wide making the populations persistent for a long time. Knowing the pathway

of the spread of the snail is essential in understanding its role in spreading the rat lung worm.

The snail infested localities were surveyed and samples were collected for molecular analyses.

Two mitochondrial markers 16s rRNA gene and cytochrome oxidase subunit I (COI) gene were

selected to trace the invasion events and its origin in south India and cytochrome oxidase

subunit I gene was used to detect the presence of Angiostrongylus cantonensis in the snail

populations of Kerala. A total of 268 snail infested localities were surveyed in South India, out

of which 208 samples were subjected to 16s rRNA gene amplification and 47 samples to

cytochrome oxidase subunit I (COI) gene amplification.

From this study a total of 18 16s rRNA haplotypes from India, among them 14 are unique to

this study and 13 COI haplotypes from the world were identified and among them 8 are from

India. The presence of Angiostrongylus cantonensis was detected from Kerala using the

Cytochrome oxidase subunit I gene. The most common 16s rRNA haplotype is C and the most

common COI haplotype is E in India. The study has also recorded haplotype H of 16s rRNA

gene from Kerala, which was previously known from Mayotte and Mauritius in the Indian

Ocean Islands. The COI haplotype analysis showed that the West African COI haplotypes are

derived from the Indian haplotype E, and the presence of a missing node between the haplotype

E and haplotype D from an unknown location in Africa in the network shows unsampled

86

putative haplotypes in the native range. The detection of the 16s rRNA haplotype H and

missing links in the COI network of haplotype analysis proves the hypothesis that the

introduction of Achatina fulica is through multiple introductions. The presence of the rat lung

worm from the populations of snail in Kerala shows that the spread of the snail could cause the

spread of the worms throughout.

Haplotype and nucleotide analyses of the Indian populations also shows that the snail has

higher genetic diversities than other invasive areas in the world. The wood import data of the

Cochin Port during the year 2016-2017 was corroborated with the molecular data. The data

showed that many different wood items were being imported from the snail infested countries

which includes Tanzania, a native range of the snail. The first known introduction in to India

was through snails brought to Calcutta from Mauritius. From Calcutta, the snails have spread

into many parts of South East Asia. Even though, haplotype C and H are present in Mauritius,

the haplotype H is not present in any of the South East Asian countries. With the evidence of

the 16s rRNA and COI gene sequences, which was supported by the heavy traffic of shipping

between snail infested countries and Kerala, the likelihood of the multiple invasion events to

India is proved and the presence of the rat lung worm Angiostrongylus cantonensis in the snail

populations of Kerala shows the importance of the spreading of the worm through the highly

invading movement of the snails.

_________________________________7: Outcomes of the Project

87

7. OUTCOMES OF THE PROJECT (BRIEF SUMMARY)

A total of 268 snail infested localities were surveyed in South India, out of which 208 samples

were subjected to 16s rRNA gene amplification and 47 samples to cytochrome oxidase subunit

I (COI) gene amplification. From this study a total of 18 16s rRNA haplotypes from India,

among them 14 are unique to this study and 13 COI haplotypes from the world were identified

and among them 8 are from India. The presence of Angiostrongylus cantonensis was detected

from Kerala using the Cytochrome oxidase subunit I gene. The most common 16s rRNA

haplotype is C and the most common COI haplotype is E in India. The study has also recorded

haplotype H of 16s rRNA gene from Kerala, which was previously known from Mayotte and

Mauritius in the Indian Ocean Islands. The COI haplotype analysis showed that the West

African COI haplotypes are derived from the Indian haplotype E, and the presence of a missing

node between the haplotype E and haplotype D from an unknown location in Africa in the

network shows unsampled putative haplotypes in the native range. The presence of the rat lung

worm Angiostrongylus cantonensis in the snail populations of Kerala shows the importance of

the spreading of the worm through the highly invading movement of the snails.

i) SALIENT FINDINGS INCLUDING TECHNICAL DETAILS AND INNOVATIONS

Multiple invasion events of the Giant African snail were confirmed.

Corroborating the wood import data to the Cochin port, the origin of invasion of the

snail to India was confirmed from Mayotte and Mauritius.

The presence of the rat lung worm Angiostrongylus cantonensis in the populations of

Kerala was confirmed from the study.

Usage of the molecular tool for tracking the invasion of a species has been successfully

used in this study.

88

ii) PUBLICATIONS

a) Journal Publications International

Vijayan K, Suganthasakthivel R, Sajeev TV, Soorae PS, Naggs F, Wade CM. 2020.

Genetic variation in the Giant African Snail Lissachatina fulica (Bowdich, 1822) in the

invasive ranges of Asia and West Africa. Biological Journal of the Linnean Society,

131(4): 973–985. https://doi.org/10.1093/biolinnean/blaa171 Published: 16 November

2020. [Impact Factor: 1.961, NAAS Rating 8.5]

National

Vijayan K, Suganthasakthivel R, Sajeev TV. 2019, First record of body colour

polymorphism in giant African snail Achatina fulica (Bowdich, 1822) - a comparative

study using mitochondrial cytochrome oxidase subunit I (COI) gene. Entomon, 44(2): 155-

160. [NAAS Rating 4]

Journal artciles under Review

Vijayan K, Suganthasakthivel R, Sajeev TV. 2019. Enemy at the gates: Giant African

Snail Lissachatina fulica enters Western Ghats of Kerala. Manuscript submitted to the

Journal of Threatened taxa. MS Submitted. Under peer review

b) Papers presented in Conferences International

Vijayan K, Suganthasakthivel R, Sajeev TV. 2019. Multigene analysis reveals multiple

invasion of the Giant African Snail into India. In Abstracts of “Research and Development

conference on Invasive Alien Species management and Biosecurity measures” held

between 8-12 July 2019 at Manila, Philippines.

89

Suganthasakthivel, R, Vijayan K, Sajeev TV and others 2019. Molecular

characterization and Ecological Niche Modelling of the invasive Red Cabomba

Cabomba furcata (Schult. & Schult.f. 1830) in India. In Abstracts of “Research and

Development conference on Invasive Alien Species management and Biosecurity

measures” held between 8-12 July 2019 at Manila, Philippines.

National

Vijayan K, Suganthasakthivel R, Sajeev TV. 2018. Molecular evidences suggest the

multiple invasion waves of the Giant African Snail into India. p. 53 In Abstracts of

“Workshop on economic and Ecological Impacts of Invasive alien species” conducted

by Indian Statistical Institute (ISI) and Asia Pacific Forestry Invasive Species Network

(APFISN) held between 21- 23 February 2018 at Kolkata. – Best 2nd Poster Presentation

Award -Silver Medal.

Suganthasakthivel R, Vijayan K, Sajeev TV. 2018. Predicting the past, present and

future distribution of the Giant African Snail. p. 59 In Abstracts of “Workshop on

economic and Ecological Impacts of Invasive alien species” conducted by Indian

Statistical Institute (ISI) and Asia Pacific Forestry Invasive Species Network (APFISN)

held between 21- 23 February 2018 at Kolkata. – Best 3rd Oral Presentation Award –

Bronze Medal.

_____________________________________8: Scope of Future Work

90

8. SCOPE OF FUTURE WORK

1. The study can be extended to other snail infested localities of India.

2. Most of the states in India is experiencing the snail infestation problems.

3. The spread of the rat lung worm Angiostrongylus cantonensis can be much extensively

studied using other genes.

4. The usage of the molecular markers for tracking the invasion of an invasive species is

a novel approach and this could be approached for other plant as well as animal invasive

species also.

5. The other invasive snail species can be also taken for this kind of a study and other

nematode species in these organisms causing diseases to plants and animals can also be

taken into consideration for further studies.

_____________________________________________________9: Bibliography

91

9. BIBLIOGRAPHY

Ag. Alert, 1996. Introduction of the Giant African Snail to various Pacific Islands. A weekly

newspaper for California Agriculture.

Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K. and Walter, P. 2008. The Molecular

Biology of the Cell, 5th ed. Garland Science, Taylor & Francis Group, New York, 1268 pp.

Albuquerque, F.S., Peso-Aguiar, M.C. and Assunção-Albuquerque, M.J.T. 2008. Distribution,

feeding behavior and control strategies of the exotic land snail Achatina fulica (Gastropoda:

Pulmonata) in the northeast of Brazil. Brazilian Journal of Biology, 68: 837–842.

Allen, J.A. 1983. The inheritance of a shell colour polymorphism in Achatina fulica Bowdich

from east Africa. Journal of Conchology, 31: 185-189.

Arnaud, J.F, Madec, L., Guiller, A. and Bellido, A. 2001. Spatial analysis of allozyme and

microsatellite DNA polymorphisms in the land snail Helix aspersa (Gastropoda: Helicidae).

Molecular Ecology, 10: 1563-1576.

Aubry, S., Labaune, C., Magnin, F., Roche, P. and Kiss, L. (2006) Active and passive dispersal

of an invading land snail in Mediterranean France. Journal of Animal Ecology, 75: 802-813.

Avhad, S.B., Shinde, K.S., and Hiware, C.J. 2013. Giant African snail (Achatina fulica

Bowdich, 1822) - As a Molluscan Pest record on mulberry from Aurangabad, (M.S), India.

Flora and Fauna, 19(1): 93-94.

Avise, J.C. 1994. Molecular Markers, Natural History and Evolution. Chapman & Hall,

London, 511 pp.

Avise, J.C. 2000. Phylogeography: The History and Formation of Species. Harvard University

Press, Cambridge, Massachusetts. 447 pp.

Ayyagari, V.S. and Sreerama, K. 2017. Evaluation of haplotype diversity of Achatina fulica

(Lissachatina) [Bowdich] from Indian sub-continent by means of 16S rDNA sequence and its

92

phylogenetic relationships with other global populations. 3 Biotech, 7: 252. doi:

10.1007/s13205-017-0877-4.

Baheti, N., Sreedharan, M., Krishnamoorthy, T., Nair, M.D., Radhakrishnan K, 2008.

Neurological picture. Eosinophilic meningitis and an ocular worm in a patient from Kerala,

south India. Journal of Neurology, Neurosurgery, and Psychiatry, 79(3): 108-111.

Balamurugan, S. 2019. Commentary: Angiostrongylus cantonensis in anterior chamber. Indian

Journal of Ophthalmology, 67(1): 161-162.

Balasubramanian, M. and Kalyanasundaram, P. 1974. A note on the incidence of Giant African

Snail Achatina fulica Bowdich. Annamalai University Agricultural Research Annual, 4 & 5:

217.

Bambaradeniya, C. 2002. The status and implications of alien invasive species in Sri Lanka.

Zoos' Print Journal, 17(11):930-935.

Barco, A., Claremont, M., Reid, D.G., Houart, R., Bouchet, P., Williams, S.T, Cruaud, C.,

Couloux, A. and Oliverio, M. 2010. A molecular phylogenetic framework for the Muridae, a

diverse family of carnivorous gastropods. Molecular Phylogenetics and Evolution, 56: 1025-

1039.

Barker, G.M. 2002. Molluscs as Crop Pests. CAB International Publishing, Wallingford. 468

pp.

Bartlett, J. M. S. and Stirling, D. 2003. "A Short History of the Polymerase Chain Reaction".

Methods in Molecular Biology, 226: 3–6.

Basavaraju, B.S., Girish, A.C., Thyagaraj, N.E. and Chakravarty, A.K. 2010, Giant African

snail, Achatina fulica Bowdich: A menace in Hassan district, southern transitional zone of

Karnataka: A Survey. Paper presented In: 34th Ann. Conf. of ethological Society of India and

Colloquium on Ethology from organism Down to Ethobiomolecule, Centre for Arthropod

Bioresources and Biotechnology (CABB), University of Kerala, Thiruvananthapuram and

Ethological Society of India, December, 16-18, p.38.

93

Baur, B. 1986. Patterns of dispersion, density and dispersal in alpine populations of the land

snail Arianta arbustorum (L.) (Helicidae). Holarctic Ecology, 9: 117-125.

Behura, B.K. 1986, Depredations of the giant African land snail, Achatina fulica (Ferussac) in

Balasore (Orissa), Journal of the Bombay Natural History Society, 54: 287.

Beltramino, A., Vogler, R., Rumi, A., Guzmán, L., Martin, S. M. and Peso, J.G. 2018. The

exotic jumping snail Ovachlamys fulgens (Gude, 1900) (Gastropoda: Helicarionidae) in urban

areas of the Upper-Paraná Atlantic Forest. Anais da Academia Brasileira de Ciências, 90, 1-

13.

Bequaert, J.C. 1950. Studies in the Achatininae, a group of African land snails. Bulletin of the

Museum of Comparative Zoology, 105(1): 1-216.

Bouzid, W., Tefca, J.F., Hyps, V., Leka, S., Scholz, T., Legal, L., Hassine, O.K.B. and Loot,

G. 2008. Geography and host specificity: Two forces behind the genetic structure of the

freshwater fish parasite Ligula intestinalis (Cestoda: Diphyllobothriidae). International

Journal for Parasitology, 38: 1465–1479.

Budha, P.B. and Naggs, F. 2008. The Giant African Land Snail Lissachatina fulica (Bowdich)

in Nepal. The Malacologist, 50: 19–21.

Capinha, C., Essl, F., Seebens, H., Moser, D. and Pereira, H.M. 2015. The dispersal of alien

species redefines biogeography in the Anthropocene. Science, 348(6240): 1248-1250.

Carlini, D.B., Reese, K.S. and Graves, J.E. 2000. Actin gene family evolution and the

phylogeny of coleoid cephalopods (Mollusca: Cephalopoda). Molecular Biology and

Evolution, 17(9): 1353-1370.

Carstens, B.C. and Richards, C.L. 2007. Integrating coalescent and ecological niche modeling

in comparative phylogeography. Evolution, 61(6): 1439-1454.

Chen H. 1935. A new pulmonary nematode of rats, Pulmonema cantonensis ng, nsp from

Canton. Annals of Parasitology, 13: 312–317.

94

Cheng TC, and Alicata J. 1964. The possible role of water in the transmission of

Angiostrongylus cantonensis (Nematoda: Metastrongylididae). J Parasitology, 50 No 30

Section 2 Supplement. P39.

Ciomperlik, M.A., Robinson, D.G., Gibbs, I.H., Fields, A., Stevens, T. and Taylor, B.M. 2013.

Mortality to the Giant African Snail, Lissachatina fulica (Gastropoda: Achatinidae), and Non-

Target Snails using Select Molluscicides. Florida Entomologist, 96(2): 370-379.

Civeyrel, L. and Simberloff, D. 1996. A tale of two snails: is the cure worse than the disease?

Biodiversity and Conservation, 5: 1231-1252.

Colgan, D.J., Ponder, W.F., Beacham, E. and Macaranas, J. 2007. Molecular phylogenetics of

Caenogastropoda (Gastropoda: Mollusca). Molecular Phylogenetics and Evolution, 42: 717-

737.

Colgan, D.J., Ponder, W.F., Beacham, E. and Macaranas, J.M. 2003. Gastropod phylogeny

based on six segments from four genes representing coding or non-coding and mitochondrial

or nuclear DNA. Molluscan Research, 23: 123-148.

Connor, R. 2006. Distribution, habitat association, species abundance and perceptions of

residents towards Achatina fulica in Anguilla (unpublished MSc thesis), University of Exeter,

Devon, UK.

Coote, T. and Loeve, É. 2003. From 61 species to five: Endemic tree snails of the Society

Islands fall prey to an ill-judged biological control programme. Oryx, 37: 91–96.

Cowie R. 2013. Pathways for Transmission of Angiostrongyliasis and the Risk of Disease

Associated with Them. Hawai‘I Journal of Medicine & Public Health, 72(6): Supplement 2.

Cowie, R.H., 2000. Non-indigenous land and freshwater molluscs in the islands of the Pacific:

conservation impacts and threats. In: Sherley, G. (ed.) Invasive species in the Pacific: A

technical review and draft regional Strategy. SPREP, 143-166.

95

Craze, P. G., and Mauremootoo, J. R. 2002. A test of methods for estimating population size

of the invasive land snail Achatina fulica in dense vegetation. Journal of Chemical Ecology,

39: 653-660.

Crosby, A.W. 1986. Ecological Imperialism: The Biological Expansion of Europe, 900-1900.

Cambridge University Press.

Däumer, C., Greve, C., Hutterer, R., Misof, B. and Haase, M. 2012. Phylogeography of an

invasive land snail: Natural range expansion versus anthropogenic dispersal in Theba pisana

pisana. Biological Invasions, 14: 1665-1682.

Davison, A. 2000. An East-West distribution of divergent mitochondrial haplotypes in British

populations of the land snail, Cepaea nemoralis (Pulmonata). Proceedings of the Royal Society

of London B: Biological Sciences, 70: 697–706.

De Winter, A.J. 1989. New records of Achatina fulica Bowdich from the Côte d’Ivoire.

Basteria, 53: 71-72.

Dean, W. W., A. R. Mead, and W. T. Northey. 1970. Aeromonas liquefaciens in the giant

African snail, Achatina fulica. Journal of Invertebrate Pathology, 16: 346-351.

Demke, T. and Adams, R.P. 1992. The effect of plant polysaccharides and buffer additives of

PCR. Biotechniques, 12: 332-334.

Desouky, M. M. and Busais, S. 2012. Phylogenetic relationships of the land snail; Eobania

vermiculata (Müller, 1774) from Egypt and Saudi Arabia. A combined morphological and

molecular analysis. The Journal of Basic and Applied Zoology, 65(2): 144-151.

Dlugosch, K.M. and Parker, I.M. 2008. Founding events in species invasions: genetic variation,

adaptive evolution, and the role of multiple introductions. Molecular Ecology, 17(1): 431-449.

Donald, K.M., Kennedy, M. and H.G. Spencer. 2005. The phylogeny and taxonomy of austral

monodontine topshells (Mollusca: Gastropoda: Trochidae), inferred from DNA sequences.

Molecular Phylogenetics and Evolution, 37: 474-483.

96

Dong, S., Shentu, X., Pan, Y., Bai, X., Yu, X. and Wang, H. 2011. Evaluation of genetic

diversity in the golden apple snail, Pomacea canaliculata (Lamarck), from different

geographical populations in China by inter simple sequence repeat (ISSR). African Journal of

Biotechnology, 10(10): 1777-1783.

Ebbs, E.T., Loker, E.S. and Brant, S.V. 2018. Phylogeography and genetics of the globally

invasive snail Physa acuta Draparnaud 1805, and its potential to serve as an intermediate host

to larval digenetic trematodes. BMC Evolutionary Biology, 18:103.

Ekanayake,S.P., Bambaradeniya, C.N.B., Perera, W.P.N., Perera, M.S.J., Rodrigo, R.K.,

Samarawickrama, V.A.M.P.K. and Peiris, T.N. 2005. A Biodiversity Status Profile of Lunama

- Kalametiya Wetland Sanctuary. Occasional Papers of IUCN Sri Lanka No. 8: 42 pp.

Elejalde, M.A., Madiera, M.J., Prieto, C.E., Backeljau, T. and Gomez-Moliner, B.G. 2009.

Molecular phylogeny taxonomy and evolution of the land snail Pyrenaearia (Gastropoda:

Helicoidea). American Malacological Bulletin, 27: 69-81.

Escarbassiere, M.R. and Martínez M.E. 1997. Nota acerca de la Achatina (Lissachatina) fulica

(Bowdich, 1822), peligroso caracol africano (Pulmonata Achatinidae) introducido en

Venezuela. Acta Biologica Venezuela, 17: 37-40.

Escarbassiere, M.R., Martínez M.E. and Castillo, O. 2008. Distribución geográfica de Achatina

(Lissachatina) fulica (Bowdich, 1882) (Gastropoda-Stylommatophora- Achatinidae) en

Venezuela. Mem. Fundac. La Salle Ciencias, 68: 93-106.

Facon, B., Pointier, J.P., Glaubrecht, M., Poux, C., Jarne, P. and David, P. 2003. A molecular

phylogeography approach to biological invasions of the New World by parthenogenetic Thiarid

snails. Molecular Ecology, 12: 3027–3039.

Folmer, O., Black, M., Hoeh, W., Lutz, R. and Vrijenhoek, R. 1994. DNA primers for

amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan

invertebrates. Molecular Marine Biology and Biotechnology, 3(5): 294-299.

97

Fontanilla, I.K.C. and Wade, C.M. 2012. First report of Angiostrongylus cantonensis in the

giant African land snail Achatina fulica in French Polynesia detected using the SSU rRNA

gene. Tropical Biomedicine, 29(4): 642-645.

Fontanilla, I.K.C., 2010. Achatina (Lissachatina) fulica Bowdich: Its Molecular Phylogeny,

Genetic Variation in Global Populations, and its possible role in the spread of the Rat

Lungworm Angiostrongylus cantonensis (Chen). Unpublished PhD Thesis submitted to the

University of Nottingham for the degree of Doctor of Philosophy. 617 pp.

Fontanilla, I.K.C., Sta. Maria, I.M.P., Garcia, J.R.M., Ghate, H. and Naggs, F. 2014. Restricted

Genetic Variation in Populations of Achatina (Lissachatina) fulica outside of East Africa and

the Indian Ocean Islands Points to the Indian Ocean Islands as the Earliest Known Common

Source. PLoS ONE, 9(9): e105151. doi:10.1371/journal.pone.0105151.

Freeland, J.R. 2005. Molecular Ecology. John Wiley & Sons, Chichester.

Gaitán-Espitia, J.D., Scheihing, R., Poulin, E., Artacho, P. and Nespolo, R.F. 2013.

Mitochondrial phylogeography of the land snail Cornu aspersum: tracing population history

and the impact of human-mediated invasion in austral South America. Evolutionary Ecology

Research, 15: 61–78.

Ghabooli, S., Shiganova, T.A., Zhan, A., Cristescu, M.E., Eghtesadi-Araghi, P. and MacIsaac,

H.J. 2011. Multiple introductions and invasion pathways for the invasive ctenophore

Mnemiopsis leidyi in Eurasia. Biological Invasions, 13: 679-690.

Gittenberger, E. 2012. Long-distance dispersal of molluscs: ‘Their distribution at first

perplexed me much’. Journal of Biogeography, 39: 10–11.

Gittenberger, E., Groenenberg, D.S.J., Kokshoorn, B., and Preece, R.C. 2006. Biogeography:

molecular trails from hitch-hiking snails. Nature, 436(26): 409.

Gittenberger, E., Piel, W.H. and Groenenberg, D. 2004. The Pleistocene glaciations and the

evolutionary history of the polytypic snail species Arianta arbustorum (Gastropoda, Helicidae).

Molecular Phylogenetics and Evolution, 30: 64-73.

98

Godan, D. 1983. Pest Slugs and Snails: Biology and Control. Springer Verlag, Berlin,

Heidelberg. pp 445.

Godwin-Austen, H.H. 1908. The dispersal of land shells by the agency of man. Proceedings of

the Malacological Society of London, 8: 146-147.

Grande, C., Templado, J., Cervera, J.L. and R. Zardoya. 2004. Molecular phylogeny of the

Euthyneura (Mollusca: Gastropoda). Molecular Biology and Evolution, 21(2): 303-313.

Grapputo, A., Bisazza, A. and Pilastro, A. 2006. Invasion success despite reduction of genetic

diversity in European populations of eastern mosquitofish (Gambusia holbrooki). Italian

Journal of Zoology, 73(1): 67-73.

Graybeal, A. 1994. Evaluating the phylogenetic utility of genes: a search for genes informative

about deep divergences among vertebrates. Systematic Biology, 43: 174-193.

Green, E. E., 1910, Report on the outbreak of Achatina fulica. Circulars and Agricultural

Journal of the Royal Botanical Gardens, 5 (7): 55-64.

Gregoric, G.D.E., Núñez, V., Vogler, R.E. and Rumi. A. 2011. Invasion of the Argentinean

Paranense Rainforest by the Giant African Snail Achatina fulica. American Malacological

Bulletin, 29: 135–137.

Guan, F., Niu, A., Attwood, S.W., Li, Y.I., Zhang, B. and Zhu, Y.H. 2008. Molecular

phylogenetics of Triculine snails (Gastropoda: Pomatiopsidae). Molecular Phylogenetics and

Evolution, 48: 702-707.

Guiller, A. and Madec, L. 2010. Historical biogeography of the land snail Cornu aspersum: a

new scenario inferred from haplotype distribution in the Western Mediterranean basin. BMC

Evolutionary Biology, 10: 18. doi: 10.1186/1471-2148-10-18.

Guiller, A., Bellido, A., and Madec, L., 1998. Genetic distances and ordination: The Land Snail

Helix aspersa in North Africa as a test case. Systematic Biology, 47(2): 208-227.

99

Guiller, A., Coutellec, V., Madec, L. and Deunff, J. 2010. Evolutionary history of the land snail

Helix aspersa in the Western Mediterranean: preliminary results inferred from mitochondrial

DNA sequences. Molecular Ecology, 10: 81–87.

Guiller, A., Madec,L.and Aguzan. J. D. 1994. Geographical patterns of genetic differentiation

in the land snail Helix aspersa Muèller (Gastropoda : Pulmonata). Journal of Molluscan

Studies, 60: 205-221.

Guiller, A., Martin, M-C., Hiraux C. and Madec, L. 2012. Tracing the invasion of the

Mediterranean Land Snail Cornu aspersum aspersum becoming an agricultural and garden pest

in areas recently introduced. PLoS ONE 7(12): e49674.

https://doi.org/10.1371/journal.pone.0049674.

Hayes, K.A., Joshi, R.C., Thiengo, S.C. and Cowie, R.H. 2008. Out of South America: multiple

origins of non-native apple snails in Asia. Diversity Distribution, 14(4): 701-712.

Hebert, P.D.N., Cywinska, A., Ball, S.L., and deWaard, J.R. 2003. Biological identifications

through DNA barcodes. Proceedings of the Royal Society of London B, 270: 313–321.

Henderson, I.F. 1989. Slugs and snails in world agriculture. British Crop Protection Council,

Monograph No. 41.

Hernan, I.M. 1993. Actin isoforms. Current Opinion in Cell Biology, 5: 48-55.

Hickerson, M.J., Carstens, B.C., Cavender-Bares, J., Crandall, K.A., Graham, C.H., Johnson,

J.B., Rissler, L., Victoriano, P.F. and Yoder, A.D. 2010. Phylogeography’s past, present, and

future: 10 years after Avise, 2000. Molecular Phylogenetics and Evolution, 54: 291–301.

Hoekstra, P. and Schilthuizen, M. 2011. Phylogenetic relationships between isolated

populations of the limestone‐dwelling microsnail Gyliotrachela hungerfordiana (Gastropoda:

Vertiginidae). Journal of Zoological Systematics and Evolutionary Research, 49(4): 266–272.

100

Hollingsworth, R.G. and Cowie, R.H. 2006. Apple snails as disease vectors. In: R. C. Joshi and

L. C. Sebastian, eds., Global Advances in Ecology and Management of Golden Apple Snails.

Philippine Rice Research Institute, Muñoz, Nueva Ecija, Philippines. Pp. 121-132.

Hollingsworth, R.G., Kenata, R., Sullivan, J.J., Bishop, H.S., Qvarnstrom, Y., Da silva, A.J.

and Robinson, D.G. 2007. Distribution of Parmarion cf. martensi (Pulmonata: Helicarionidae),

a new semi-slug pest on Hawai’i Island, and its potential as a vector for human

angiostrongyliasis. Pacific Science, 61(4): 457–467.

Hyman, I.T., Ho, S.Y.W. and Jermiin, L.S. 2007. Molecular phylogeny of Australian

Helicarionidae, Euconulidae and related groups (Gastropoda: Pulmonata: Stylommatophora)

based on mitochondrial DNA. Molecular Phylogenetics and Evolution, 45(3):792-812.

Jaremovic, R. and Rollo, D. 1979. Tree climbing by the snail Cepaea nemoralis (L.): a possible

method for regulating temperature and hydratation. Canadian Journal of Zoology, 57: 1010-

1014.

Jarret, V.H.C. 1931. The Spread of giant African snail to South China. Hong Kong Naturalist,

2: 262-264.

Jarret, V.H.C. 1949. Achatina's odyssey. The Times (London), No. 51,482, p. 5. Sept. 9

Jayashankar, M. and Reddy, M.S. 2010. Breeding of mosquitoes in Giant African Snail,

Achatina fulica (Bowdich) Shells. Insect Environment, 16(1): 38-39.

Jha. K.B. 2012. Giant African land snail invading Madhya Pradesh threatens to consume plants

and infect. Times of India, October 19.

Kalshoven, L.G.E., 1950. In His: De plagen van de cultuurgewassen in indonesie, 2. S

Gravenhage, Bandoeng, Van Hoeve, 1: 46-59.

Kano, Y., Neusser, T., Fukumori, H., Jörger, K. and Schrödl, M. 2015. Sea-slug invasion of

the land. Biological Journal of the Linnean Society, 116(2): https://doi.org/10.1111/bij.12578

101

Kappes, H. and Haase, P. 2012. Slow, but steady: dispersal of freshwater molluscs. Aquatic

Sciences, 74: 1–14.

Kliks, M.M. and Palumbo, N.E. 1992. Eosinophilic meningitis beyond the Pacific Basin: the

global dispersal of a peridomestic zoonosis caused by Angiostrongylus cantonensis, the

nematode lungworm of rats. Social Science and Medicine, 34(2): 199-212.

Kolbe, J.J., Glor, R.E., Rodriguez-Schettino, L., Chamizo-Lara, A., Larson, A. and Losos, J.B.

2007. Multiple sources, admixture, and genetic variation in introduced Anolis lizard

populations. Conservation Biology, 21: 1612–1625.

Kumar, S., Stecher, G. and Tamura, K. 2016. MEGA7: Molecular Evolutionary Genetics

Analysis Version 7.0 for Bigger Datasets. Molecular Biology and Evolution, 33(7): 1870-1874.

Kumar, S., Stecher, G., Li, M., Knyaz, C. and Tamura, K. 2018. MEGA X: Molecular

Evolutionary Genetics Analysis across Computing Platforms. Molecular Biology and

Evolution, 35(6): 1547–1549.

Lake, L.A. and Moore, J.E. 1998. Phylogenetic analyses and comparative genomics. Trends in

Bioinformatics, 16(1): 22-23.

Levine, J.M., 2008. Biological invasions. Current Biology, 18(2): 57-60.

Lewin, B. 2008. Genes IX. Jones and Bartlett Publishers, U.S.A., 892 pp.

Liu, H.P. and Hershler, R. 2009. Genetic diversity and population structure of the threatened

Bliss Rapids snail (Taylorconcha serpenticola). Freshwater Biology, 54: 1285–1299.

Lockwood, J.L., Hoopes, M.F. and Marchetti, M.P. 2007, Invasion Ecology Second Edition,

Wiley and Blackwell. 428pp.

Lowe S., Browne M., Boudjelas S. and M. De Poorter. 2000. 100 of the World’s Worst Invasive

Alien Species A selection from the Global Invasive Species Database. Published by The

Invasive Species Specialist Group (ISSG) a specialist group of the Species Survival

102

Commission (SSC) of the World Conservation Union (IUCN), 12 pp. First published as special

lift-out in Aliens 12, December 2000. Updated and reprinted version: November 2004.

Lv, S., Zhang, Y., Steinmann, P., Yang, G., Zhou, X. and Utzinger, J. 2011. The emergence of

Angiostrongyliasis in the People’s Republic of China: the interplay between invasive snails,

climate change and transmission dynamics. Freshwater Biology, 56: 717–734.

Lydeard, C. and Lindberg, D.R. 2003. Molecular Systematics and Phylogeography of

Mollusks. Smithsonian Series in Comparative Evolutionary Biology, Smithsonian Books,

Washington. 328 pp.

Lydeard, C., Cowie, R.H., Ponder, W.F., Bogan, A.E., Bouchet, P., Clarke, S.A., Cummings,

K.S., Frest, T.J., Gargominy, O., Herbert, D.G., Hershler, R., Perez, K.E., Roth, B., Seddon,

M., Strong, E.E. and Thompson, F.G. 2004. The global decline of non-marine mollusks.

Bioscience, 54, 4: 321–330.

Lydeard, C., Holznagel, W.E., Schnare, M.N. and Gutell, R.R. 2000. Phylogenetic analysis of

molluscan mitochondrial LSU rDNA sequences and secondary structures. Molecular

Phylogenetics and Evolution, 15(1): 83-102.

Madsen, H. and Frandsen, F. 1989. The spread of fresh water snails including those of medical

and veterinary importance. Acta Tropica, 46: 139-149.

Marsico, T.D., Wallace, L.E., Ervin, G.N., Brooks, C.P., McClure, J.E. and Welch, M.E. 2011.

Geographic patterns of genetic diversity from the native range of Cactoblastis cactorum (Berg)

support the documented history of invasion and multiple introductions for invasive

populations. Biological Invasions, 13:857–868.

Masta, S.E. 2000. Phylogeography of the jumping spider Habronattus pugillis (Araneae:

Salticidae): recent vicariance of sky island populations? Evolution, 54(5): 1699-1711.

Mead, A.R. 1956. Disease in the Giant African snail Achatina fulica Bowdich. Science, 123:

1130-1131.

103

Mead, A.R. 1959. Increasing complexity in the problem of the giant African snail. Journal of

the Colorado-Wyoming Academy of Science, 4(11): 51-52. (Also in American Malacological

Union, Ann. Kept., 1959:39.)

Mead, A.R. 1961. The Giant African Snail: A Problem in Economic Malacology. University

of Chicago Press, Chicago. 257 pp.

Mead, A.R. 1979. Economic malacology with particular reference to Achatina fulica. In:

Pulmonates, Ed. Fretter, V. and Peake, J., Academic Press, London, p150.

Mead, A.R. and Palcy, L. 1992. Two giant African land snail species spread to Martinique,

French West Indies. The Veliger, 35: 74-77.

Mead, A.R., 1949. The giant snails. Atlantic Monthly, 184(2): 38-42.

Meenakshi, V.R. 1951. The distribution of vitamin C in some common gastropods and its

biosynthesis in Pila virens Lamarck (MOLLUSCA-GASTROPODA). Current Science, 5: 136-

137.

Meyer III, W.M., Hayes, K.A. and Meyer, A.L. 2008. Giant African snail, Achatina fulica, as

a snail predator. American Malacological Bulletin, 24: 117-119.

Meyer J‐Y and Picot F. 2001. Achatines attack! The impact of Giant African land snails on

rare endemic plants in La Réunion Island (Mascarene Is., Indian Ocean). Aliens, 14: 13‐14.

Ministry of Agriculture, Land, and Marine Resources, Trinidad and Tobago, 2009. Joint press

release; giant African snail advisory. Press release 14 Aug. 2009. 2 pp.

Moline, A.B., Shuster, S.M., Hendrickson, D.A. and Marks, J.C. 2004. Genetic variation in a

desert aquatic snail (Nymphophilus minckleyi) from Cuatro Ciénegas, Coahuila, Mexico.

Hydrobiologia, 522: 179–192.

Mooney, H.A. and Cleland, E. 2001. The evolutionary impact of invasive species. Proceedings

of the National Academy of Sciences of the United States of America, 98: 5446-51.

104

Mooney, H.A., Mack, R.N., McNeely, J.A., Neville, L.E., Schei, P.J. and Waage, J.K. 2005.

Invasive Alien Species: A New Synthesis. Vol. 63 of SCOPE, Washington, London (Island

Press). 368 pages.

Naggs, F. 1997. William Benson and the early study of land snails in British India and Ceylon.

Archives of Natural History, 24(1): 37-88.

Narendrakumar, J.B., Shekhar, M.A and Qadri, S.M.H. 2011. Giant African Snail in Mulberry:

Physiology and management. Indian Silk, 1(12): 4-5.

Natarajan, R. 1960. Further cytological studies in Pulmonata (Mollusca: Gastropoda). Journal

of the Zoological Society of India, 12(1): 69-79.

O'Hanley, J.R. 2009. NeuralEnsembles: a neural network based ensemble forecasting program

for habitat and bioclimatic suitability analysis. Ecography, 32(1): 89–93.

Ossa-Lacayo, L.D., Ossa V.J.D. and Lasso, V.C.A., 2012. Registro del caracol africano gigante

Achatina fulica (Bowdich 1822) (Mollusca: Gastropoda-Achatinidae) en Sincelejo, costa

Caribe de Colombia. Biota Colombiana, 13(2): 247-252.

Paiva, C.L. 2001. Achatina fulica (Mollusks) new agricultural pest and threat to public health

in Brazil. Printed and digital information sources. UNICAMP Memory Center (GEHT / CMU).

Available online at: http://www.geocities.com/lagopaiva/achat_tr.htm.

Palumbi, S.R. 1996. Nucleic Acids II: The Polymerase Chain Reaction. In: Hillis, D.M.,

Moritz, C. and Mable, B.K. (ed.), Molecular Systematics, 2nd ed. Sinaue Associates, Inc.,

USA, pp. 205-247.

Peake, J.F., 1971. The Evolution of Terrestrial Faunas in the Western Indian Ocean.

Philosophical Transactions of the Royal Society of London, Series B, Biological Sciences 260

(836), A Discussion on the Results of the Royal Society Expedition to Aldabra 1967-68: 581-

610.

105

Pfenninger, M. and Posada, D. (2002) Phylogeographic history of the land snail Candidula

unifasciata (Helicellinae, Stylommatophora): fragmentation, corridor migration and secondary

contact. Evolution, 56(9): 1776-1788.

Pfenninger, M., Nowak, C. and Magnin, F. 2007. Intraspecific range dynamics and niche

evolution in Candidula land snail species. Biological Journal of the Linnean Society, 90: 303-

317.

Pimentel, D. 1997. Techniques for Reducing Pesticides: Environmental and Economic

Benefits. Wiley, Chichester, UK.

Pinceel, J., Jordaens, K. and Backeljau, T. 2005. Extreme mtDNA divergences in a terrestrial

slug (Gastropoda, Pulmonata, Arionidae): Accelerated evolution, allopatric divergence and

secondary contact. Journal of Evolutionary Biology, 18: 1264–1280.

Pointier, J-P., DeJong R.J., Tchuem Tchuenté, L.A., Kristensen, T.K. and Loker, E.S. 2005. A

neotropical snail host of Schistosoma mansoni introduced into Africa and consequences for the

schistosomiasis transmission: Biomphalaria tenagophila in Kinshasa (Democratic Republic of

Congo). Acta Tropica, 93:191-199.

Pollard, G. V., Fields, A. and Taylor, B. 2008. Giant African snail in the Caribbean sub-region.

Proceedings of the Caribbean Food Crops Society, 44: 126–134.

Poucher, C. 1975. Eradication of the Giant African Snail in Florida. Proceedings of the Florida

State Horticultural Society, 88: 523-524.

Prasad, G.S., Singh, D.R., Senani, S. and Medhi, R.P. 2004. Eco-friendly way to keep away

pestiferous Giant African snail, Achatina fulica Bowdich from nursery beds. Current science,

87(12): 1657-1659.

Ramanjaneyulu, H.S., Sarvamangala, H.S., Vijayakumar, H.V. and Subrahmanyam, M.R.

2011. Giant African Snail strolls in mulberry garden. Indian Silk, 1(49): 6-8.

106

Raut, S. K. and G.M. Barker. 2002. Achatina fulica Bowdich and other Achatinidae as pests in

tropical agriculture. In: Barker, G.M. (ed.) Molluscs as Crop Pests. CAB International

Publishing, Wallingford. pp. 55-114.

Raut, S. K. and Ghose, K. C. 1984. Pestiferous land snails of India. Zoological Survey of India,

Bani Press, Calcutta, p. 151.

Rawlings, T.A., Hayes, K.A., Cowie, R.H. and Collins, T.M. 2007. The identity, distribution,

and impacts of non-native apple snail s in the continental United States. Evolutionary Biology,

7(1): 97.

Reddy, K. B. and Sreedharan, K. 2006. Record of giant African snail, Achatina fulica Bowdich

on coffee in Visakha agency areas, Andhra Pradesh. Indian Coffee, 70(12): 17-19.

Reece, R.J. 2004. Analysis of Genes and Genomes. John Wiley & Sons, Ltd., U.K., 469 pp.

Rees, W.J. 1950. Achatina’s Odyssey. Ravages of a globe-trotting Giant Snail. Loris, 5(4): 59-

161.

Richards, C.S., Merritt, J.W. 1967. Studies on Angiostrongylus cantonensis in molluscan

intermediate hosts. The Journal of Parisitology, 53: 382-388.

Richards, E., Reichardt, M. and Rogers, S. 1995. Preparation of Genomic DNA from Plant

Tissue. In: Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A.

and Struhl, K. (ed.) Current Protocols in Molecular Biology. John Wiley & Sons, Inc., U.S.A.,

pp. 2.3.1-2.3.7.

Robinson, D.G. 1999. Alien invasions: The effects of the global economy on non-marine

gastropod introductions into the United States. Malacologia, 41: 413-438.

Rolfs, A., Schuller, I., Finckh, U. and Weber-Rolfs, I. 1992. PCR: Clinical Diagnostics and

Research. Springer-Verlag, Germany, 271 pp.

107

Roman, J. and Darling, J.A. 2007. Paradox lost. Genetic diversity and success of aquatic

invasions. Trends in Ecology and Evolution, 22(9): 454-464.

Rowson, B., Tattersfield, P. & Symondson, W. O. C. 2010. Phylogeny and biogeography of

tropical carnivorous land‐snails (Pulmonata: Streptaxoidea) with particular reference to East

Africa and the Indian Ocean. Zoologica Scripta, 40: 85–98.

Rozas, J., Ferrer-Mata, A., Sánchez-Delbarrio, J.C., Guirao-Rico, S., Librado, P., Ramos-

Onsins, S.E. and Sánchez-Gracia, A. 2017. DnaSP 6: DNA Sequence Polymorphism Analysis

of Large Datasets. Molecular Biology and Evolution, 34: 3299-3302. DOI:

10.1093/molbev/msx248.

Senave, P. 2012. Notoficación de Plaga - Lissachatina fulica (Caracol Gigante Africano). Press

release Oct 2012. 2 pp.

Serb, J.M. and Lydeard, C. (2003) Complete mtDNA Sequence of the North American

Freshwater Mussel, Lampsilis ornata (Unionidae): An Examination of the Evolution and

Phylogenetic Utility of Mitochondrial Genome Organization in Bivalvia (Mollusca) –

Molecular Biology and Evolution, 20(11): 1854-1866.

Sherpa, S., Ansart, A., Madec, L., Martina, M., Dréanob, S. and Guiller, A., 2018. Refining the

biogeographical scenario of the land snail Cornu aspersum aspersum: Natural spatial

expansion and human-mediated dispersal in the Mediterranean basin. Molecular Phylogenetics

and Evolution, 120: 218-232.

Shevale, B.S, and Bedse, V.L. 2009. Evaluation of different poison baits for the Management

of giant African snail, Achatina fulica Bowdich. Pest Manage. Horticultural Ecosystems,

15(2): 147-149.

Shree, M. P., Ravi Kumar, K. and Nagaveni, V. 2006. Infestation of giant African snail on

Mulberry. Indian Silk, 45(6): 14-16.

Simberloff, D. and Gibbons, L., 2004. Now you see them, now you don’t! -population crashes

of established introduced species. Biological Invasion, 6: 161–172.

108

Simison, W.B. and Boore, J.L. 2008. Molluscan Evolutionary Genomics –In Ponder, W.F. and

Lindberg, D.R (eds.) Phylogeny and Evolution of the Mollusca. Regents of the University of

California.

Singh, C. and Birat, R.B.S. 1969. The giant African land snail, Achatina fulica Bowdich in

Bihar. Journal of Bombay Natural History Society, 66: 201-203.

Slom, T.J., Cortese, M.M., Susan I.G., Roderick C.J., Timothy, H.H., Adriana, S. L., Carlos,

H.Z., Robert, L.S., Sakolvaree, Y., Wanpen, C., Barbara, L.H. and Stuart J. 2002. An outbreak

of eosinophilic meningitis caused by Angiostrongylus cantonensis in travelers returning from

the Caribbean. The New England Journal of Medicine, 349 (9): 668-675.

Sreenivas, B.T., Shekhar, K.V., Anantharaman, K.V. and Narendrakumar, J.B. 2011. Giant

African Snail infestation in Hoskote too. Indian Silk, 1(49): 9.

Sridhar, V., Jayashankar, M., Vinesh, L.S. and Abraham, V. 2012. Severe occurrence of the

giant African snail, Achatina fulica (Bowdich) (Stylommatophora: Achatinidae) in Kolar

District, Karnataka. Pest Management Horticultural Ecosystems, 18(2): 228-230.

Srivastava, P.D. 1992. Problem of Land Snail Pests in Agriculture: A Study of the Giant African

Snail. Concept Publishing Company, New Delhi. 234 pp.

Städler, T., Frye, M., Neiman. M. and Lively, C.M. 2005. Mitochondrial haplotypes and the

New Zealand origin of clonal European Potamopyrgus, an invasive aquatic snail. Molecular

Ecology, 14: 2465–2473.

Staples, G.W. and Cowie, R.H. 2001. Hawaii’s invasive species. Bishop Museum, Honolulu,

Hawaii.

Steinke, D., Albrecht, C. and Pfenninger, M. 2004. Molecular phylogeny and character

evolution in the Western Paearctic Helicidaes. l. (Gastropoda: Stylommatophora). Molecular

Phylogenetics and Evolution, 32, 724-734.

109

Suarez, A.V. and Tsutsui, N.D. 2008. The evolutionary consequences of biological invasions.

Molecular Ecology, 17(1): 351-360.

Szalontayová, V. 2010. Dispersal, Molecular Phylogeny and Phylogeography of Land Snails

with Focus on the Family Clausillidae. Thesis submitted to the Department of Zoology, Charles

University in Prague. 29pp.

Takahashi, K. 1942. ("Observation on the locomotion of the giant snail"; in Japanese) Kagaku

Nanyo "Science of the South Seas," Journal of Palau Tropical Biology, Sta, 4(3): 68-74.

Tattersfield, P., Seddon, M.B., Meena, C., Kayumbo,N. and Kasigwa, P. 1998. Ecology and

Conservation of the land snails of the Eastern Arc mountains. Journal of East African Natural

History, 87: 119-138.

Tehsin, H. R. and Sharma, S. 2000. First record of giant African land snail, Achatina fulica

from Rajasthan. Zoos Print Journal, 15(3): 231.

Teles, H.M.S., Vaz, J.F., Fontes, L.R., and Domingos, M.F. 1997. Occurrence of Achatina

fulica Bowdich, 1822 (Mollusca, Gastropoda) in Brazil: Intermediate snail host of

angiostrongyliasis. Revista Saúde Pública, 31(3): 310-312.

Thiengo, S.C., Faraco, F.A., Salgado, N.C., Cowie, R.H. and Fernandez, M.A. 2007. Rapid

spread of an invasive snail in South America: the giant African snail, Achatina fulica, in Brasil.

Biological Invasions, 9: 693-702.

Thomas, M., Thangavel, M, and Thomas, R.P., 2015. Angiostrongylus cantonensis (Nematoda,

Metastrongylidae) In bandicoot rats in Kerala, South India. International Journal of Pure and

Applied Zoology, 3(1): 51-52.

Thomaz, D., Guiller, A. and Clarke, B. 1996. Extreme divergence of mitochondrial DNA

within species of pulmonate land snails – Proceedings of the Royal Society London B:

Biological Sciences, 263: 363-368.

110

Tiwari, U.S., Aishwarya, A.,Gandhi, S and Sisodia, P., 2019. Angiostrongylus cantonensis in

anterior chamber: Case Report. Indian Journal of ophthalmology, 67(1): 158-160.

Tomiyama, 1996. Mate Choice Criteria in a Protandrous Simultaneosly Hermaphroditic Land

Snail Achatina fulica (Ferrusac) (Stylommatophora: Achatinidae). Journal of Molluscan

Studies, 62, 101-111.

Tran, C.T., Hayes. K.A. and Cowie, R.H. 2008. Lack of mitochondrial DNA diversity in

invasive Apple snails (Ampullariidae) in Hawaii. Malacologia, 50(1): 351-357.

Vagvolgyi, J. 1976. Body size, aerial dispersal and origin of the Pacific land snail fauna.

Systematic Zoology, 24: 465-488.

Vanitha, K., Karappuchamy, P., Sivasubramanian, P. and Vidya, D. 2010. Comparative

effectiveness of certain botanicals and bait substances against giant African snail attacking

Vanilla. Proceedings of the. Non Chemical Insect Pest Management, Elite Publishing House,

Pvt. Ltd., New Delhi, pp. 75-77.

Vanitha, K., Karuppuchamy, P., Sivasubramaniam, P. 2011. Record of gastropod pests on

vanilla and their population dynamics in relation to weather parameters. Pest Management in

Horticulture Ecosystems, 17(1): 56-59.

Varghese, B., Menon, M.K., Pratap, T, Moheen, A., Mathew,J., Vijayan,T.P.,Tomy,M.P. and

Jalal, M.J.A., 2019. Eosinophilic meningitis: Report of three cases from a hilly area in Kerala.

Annals of Indian Academy of Neurology, 2(1): 108-111.

Veeresh, G. K., Rajagopal, D. and Puttarudraiah, M. 1979. First record of African giant snail,

Achatina fulica Bowdich (Mollusca: Gastropoda) as a serious pest of ornamental crops in

Bangalore. Current Research, 8: 202-204.

Viard, F., Bremond, P., Labbo, R., Justy, F., Delay, B. and Jarne, P. 1996. Microsatellites and

the Genetics of Highly selfing Populations in the Freshwater Snail Bulinus truncatus. Genetics,

142: 1237-47.

111

Wade, C.M., Mordan, P.B. and Clarke, B. 2001. A phylogeny of the land snails (Gastropoda:

Pulmonata). Proceedings of the Royal Society of London, 268: 413-422.

Wade, C.M., Mordan, P.B. and F. Naggs. 2006. Evolutionary relationships among the

pulmonate land snails and slugs (Pulmonata, Stylommatophora). Biological Journal of the

Linnaean Society, 87: 593-610.

Wallace, G.D. and Rosen, L. 1969. Techniques for recovering and identifying larvae of

Angiostrongylus cantonensis from Mollusks. Malacologia, 7: 427-438.

Wilke, T., Davis, G.M., Falniowsky, A., Giusti, F., Bodon, M. and Szarowska, M. 2001.

Molecular systematics of Hydrobiidae (Mollusca: Gastropoda: Rissooidea): testing monophyli

and phylogenetic relationships. Proceedings of the Academy of Natural Sciences of

Philadelphia, 151, 1-21.

Wilson, E.O. 1961. The nature of the taxon cycle in the Melanesian ant fauna. American

Naturalist, 95, 169–193.

Winnepenninckx, B., Steiner, G., Backeljau, T. and De Wachter, R. 1998. Details of gastropod

phylogeny inferred from 18S rRNA sequences. Molecular Phylogenetics and Evolution, 9(1):

55-63.

Zubay, G.L., Parson, W.W. and Vance, D.E. 1995. Principles of Biochemistry. W.C. Brown

Publishers, U.S.A., 863 pp.