Histochem Cell Biol (2007) 127:625–632

DOI 10.1007/s00418-007-0271-0

ORIGINAL PAPER

The calcium-sensing protein synaptotagmin 7 is expressed on diVerent endosomal compartments in endocrine, neuroendocrine cells or neurons but not on large dense core vesicles

Carole Monterrat · Florence Grise · Marie Noëlle Benassy · Agnès Hémar · Jochen Lang

Accepted: 10 January 2007 / Published online: 3 February 2007© Springer-Verlag 2007

Abstract Synaptotagmin (syt) isoforms function ascalcium sensor in post-Golgi transport although theprecise transport step and compartment(s) concernedare still not fully resolved. As syt7 has been proposedto operate in lysosomal exocytosis and in exocytosis oflarge dense core vesicles (LDCVs), we have addressedthe distribution of endogenous syt7 in insulin-secretingcells. These cells express diVerent syt7 isoforms compa-rable to neurons. According to subcellular fraction-ation and quantitative confocal immunocytochemistry,syt7 is not found on LDCVs or on synaptic-like micro-vesicles but colocalizes with Rab7 on endosomes andto structures near to or at the plasma membrane. Simi-larly, endogenous syt7 was absent from LDCVs inpheochromocytoma PC12 cells. In contrast, syt7 local-ised to lysosomes in both, PC12 cells and hippocampalneurons. In conclusion, endogenous syt7 shows a widerdistribution than previously reported but does notqualify as vesicular calcium sensor in SLMV or LDCVexocytosis according to its localisation.

Keywords Exocytosis · Endocytosis · Synaptotagmin · Insulin · Pancreatic �-cells · Hippocampal neurons

Introduction

Synaptotagmins (syt) form a family of transmembraneproteins containing C2 domains and are implicated inthe regulation of membrane fusion in vesicular trans-port through interaction with SNARE proteins andmembrane lipids. The most studied synaptotagmins,syt1 and 2, bind phospholipids and SNARE proteins ina calcium-dependant fashion via the C2-domains andthereby attach to lipid membranes and protein com-plexes involved in exocytosis (Jahn et al. 2003). More-over, genetic, electrophysiological and biochemicalevidences have established their role as a calcium-sen-sor in membrane fusion during exocytosis (Sudhof2004). The 16 synaptotagmins currently known can beclassiWed according to their biochemical properties andby sequence alignment (Craxton 2004). Calcium-dependant phospholipid binding has been reported forsyt1, 2, 3, 5, 7 and 9 (Li et al. 1995; Rickman et al. 2004)and these isoforms have been implicated in the regula-tion of membrane fusion in diVerent models.

Several isoforms have been localised on deWnedsubcellular compartments suggesting their implica-tion in deWned transport steps. Whereas syt1, 2, 5 and9 are found on synaptic vesicles and/or large densecore vesicles (Fukuda et al. 2002a; Geppert et al. 1991;Lang et al. 1997), syt3 and 6 are present on plasmamembranes or adjacent structures (Butz et al. 1999;Gut et al. 2001), syt4 resides in proximity of the trans-Golgi network (Berton et al. 2000; Gut et al. 2001;Ibata et al. 2000) and syt8 on post-Golgi vesicles (Mont-errat et al. 2006). DiVerent and sometimes controversialsubcellular localisations have been reported for syt7such as plasma membrane in neurons or lysosomes inWbroblasts (Martinez et al. 2000; Sugita et al. 2001).

C. Monterrat · F. Grise · M. N. Benassy · J. Lang (&)Institut Européen de Chimie et Biologie, Université de Bordeaux 1, JE 2390, 33607 Pessac/Bordeaux, Francee-mail: j.lang@iecb.u-bordeaux.fr

A. HémarUniversité Bordeaux 2, Physiologie Cellulaire de la Synapse UMR 5091, Bordeaux, France

123

626 Histochem Cell Biol (2007) 127:625–632

Moreover, syt7 was found on large dense core vesiclesupon its overexpression in neuroendocrine or endo-crine cells and regulates exocytosis in these cell types(Fukuda et al. 2004; Gao et al. 2000; Wang et al. 2005).In addition, recombinant C2 domains of syt7 inhibitthe exocytosis of insulin (Gut et al. 2001). However,the latter observation may reXect the aYnity for syteVectors rather than the real function of the endoge-nous protein.

In view of the close relationship between exo- andendocytotic pathways (Rorsman and Renstrom 2003;Sudhof 2004), precise subcellular localisation of theendogenous protein has to be determined to draw con-clusions from functional assays. As overexpressionmay alter the localisation of a given protein, we wereinterested to investigate the subcellular distribution ofendogenous syt7 in secretory cells such as the endo-crine insulin-secreting �-cells, neuroendocrine PC12cells as well as in hippocampal neurons. Our data dem-onstrate that syt7 targets to distinct endosomal com-partments in addition to lysosomes, depending on thecell type investigated, but is clearly not present onlarge dense core vesicles.

Materials and methods

Material

The following commercial monoclonal antibodies wereemployed: anti-EEA1, anti-Vti1b Cl7 (TransductionLaboratories, Erembodegem, Belgium); anti-GLUR2(BD Pharmingen, Le Pont de Claix, France) anti-cal-reticulin and anti-syntaxin 6 (Stressgen; Victoria, BC,Canada); anti-insulin K36, anti-�COP, anti-golgi 58K,anti-MAP, anti-Na+/K+ ATPase and anti-synaptophy-sin/SVP38 (Sigma, Lyon, France). Anti-syt7 serum(Sysy, Goettingen, Germany) is directed against a GSTfusion protein (amino acids 46 to 133) containing theconnecting sequence of the smallest nontruncatedsplice variant (Han et al. 2004; Sugita et al. 2001). If notstated otherwise, this antibody was used to detect syt7and was diluted to 1/6000 for immunoblots and 1/300for immunocytochemistry. Several antibodies werekindly donated: Anti-Ti VAMP Cl58.2 (Dr. T. Galli,Paris), monoclonal anti-ICA (Dr Michele Solimena,Dresden), anti-SV2C (Dr Richard Janz, Houston),anti-N-terminal syt7 (Dr Norma Andrews), anti-LAMP1 and anti-CgA (Dr. Marie Luisa Malosio,Milano). HRP-linked anti-mouse or anti-rabbit sec-ondary antibodies were purchased from AmershamBiosciences (Saclay, France). Alexa-labelled secondaryantibodies were obtained from Molecular Probes

(Leiden, Netherlands). A plasmid encoding peGFP-rab7 was kindly provided by B. van Deurs (PanumInstitute, Copenhagen). Trizol was obtained from Invi-trogen, ImProII™ Reverse Transcriptase and Wizard®SV PCR Clean-up System from Promega.

Cell culture and Xuorescence microscopy

MIN6, PC12 and INS-1E cells were cultured and trans-fected as published (Lajus et al. 2006; Monterrat et al.2006). PC12 were generously provided by Dr BrianRudkin (ENS, Lyon, France) and cultured in DMEMsupplemented with 7% foetal bovine serum and 7%horse serum. Primary hippocampal neurons were pre-pared from rat embryos as described previously (Mont-errat et al. 2006). For immunoXuorescence, cells werewashed thrice in Krebs-Ringer bicarbonate HEPESbuVer (KRBH, composition in mM: 135 NaCl, 3.6 KCl,5 NaHCO3, 0.5 NaH2PO4, 0.5 MgCl2, 1.5 CaCl2, 10HEPES, pH 7.4). Cells were Wxed in 4% paraformalde-hyde (in KRBH), washed for 3 £ 5 min, permeabilizedfor 30 min in PBS containing 0.1% saponin and subse-quently blocked for 1 h in PBS-5%BSA. Cells wereincubated with primary antibodies (in PBS-BSA) over-night at 4°C in a humid chamber, washed thrice, andincubated for 1 h with a secondary antibody at roomtemperature. After three additional washes, slideswere mounted using Vectastain (VectorLab, Burling-ton, USA). Preabsorption with the antigenic peptidewas performed at 10 �M of peptide for 1 h prior toincubation of Wxed and permeabilized cells. Imagingwas performed on a Zeiss LMS 510 Meta confocal lasermicroscope (Monterrat et al. 2006; Boal et al. 2004;Lajus et al. 2006). Stacks separated by 0.5 �m wereacquired using sequential acquisition for each channel.For quantiWcation, stacks were thresholded from 6 to 8cells and colocalisation of pixels and intensities deter-mined with Metamorph (Universal Imaging). Themeans determined for each cell were taken as singlevalue. Values are given as mean § SEM.

Post-nuclear supernatants and subcellular fractionation

Cells were washed twice with PBS pH 7.4 (withoutMg2+), detached by incubation with 10 mM EDTA-PBS for 5 min at 37°C and centrifuged at 800g for5 min at 4°C. Pelleted cells were resuspended in PBSand homogenized by sonication for 2 min on ice. Brainhomogenates were prepared as published (Monterratet al. 2006). Post-nuclear supernatants (PNS) wereobtained by a 10 min centrifugation of cell orbrain homogenates at 1,000g and at 4°C. Subcellular

123

Histochem Cell Biol (2007) 127:625–632 627

fractionation by velocity sedimentation on sucrose gra-dient was performed as described (Gut et al. 2001;Lang et al. 1995, 1997; Lang et al. ; Zhang et al. 1999).BrieXy, 108 cells were detached using EDTA, washedin PBS, cavitated for 20 min at 30 psi in a Parr bomband centrifuged for 10 min at 1,000g to prepare a post-nuclear supernatant. Samples were layered on a con-tinuous sucrose gradient and centrifuged at 100,000gfor 16 h in a swing-out rotor (SW41) with minimalacceleration/deceleration. Thirteen fractions weretaken from the top using a peristaltic pump. Total pro-tein contents were measured by Bradford assay (Bio-rad, Marnes-la-Coquette France) and insulin byELISA (Lajus et al. 2006). SDS-PAGE, immunoblots,visualisation and quantiWcation were performed aspublished (Boal et al. 2004, 2007; Monterrat et al.2006). Preabsorption with the antigenic peptide (1 �M)was performed for 1 h at room temperature.

RT-PCR

Total RNA was prepared using Trizol from culturedcells according to the manufacturer’s instructions andreverse transcribed using oligo(dT)15 primers and ImP-roII™ Reverse Transcriptase (Boal et al. 2007; Mont-errat et al. 2006). cDNAs from rat brain regions werekindly provided by Dr. G. Druitel (Bordeaux, France).To amplify rat Syt7 cDNA, we used the following pub-lished primers (Fukuda et al. 2002b) which amplify thespacer region: 5�AGCGCAAACTGGGCAAACGC3�

(sense) and 5�TGCAGCCCTCATGGGCCTC3� (anti-sense). PCR was conducted for 30 cycles, with eachround consisting of denaturation at 94°C for 1 min,annealing at 58°C for 30 s, and extension at 72°C for1 min.

Results

Several splice variants of syt7 have been described andgive raise to diVerentially expressed small or large iso-forms of the protein (Fukuda et al. 2002; Sugita et al.2001). We Wrst compared the expression of synaptotag-min 7 proteins in insulin-secreting MIN6 and INS-1Ecells, pheochromocytoma PC12 cells and brain homo-genates. As shown in Fig. 1, diVerent molecular weightforms were revealed by immunoblotting eitherbetween 40 and 50 or between 60 and 70 kDa in accor-dance with the reported isoforms (Chieregatti et al.2004; Han et al. 2004; Sugita et al. 2001). The mostprominent 42 kDa form was found in all preparationsused whereas the high molecular weight forms werebelow detection limits or absent in PC12 cells in

accordance with previous reports (Han et al. 2004;Sugita and Sudhof 2000; Zhang et al. 2002). Stainingwas speciWc as immunoreactive bands were abolishedby preincubation of the antibody with the antigenicpeptide (Fig. 1b). The presence of multiple splice vari-ants was further evidenced by RT-PCR using primerswhich amplify the diVerentially spliced linker betweenthe transmembrane domain and the C2-domains (Fuk-uda et al. 2002b). We found mainly two amplicons ofabout 280 and 410 bp (Fig. 1c), consistent with thepresence of syt7� and � splice variants coding for pro-teins of 44 and 49 kDa, respectively (Fukuda et al.2002b). The 280 bp form clearly represented the majorfrom detected. In addition, an amplicon of 610 bp wasdetected in INS-1E cells or hippocampus and faintlyvisible in fore brain (Fig. 1c, arrowheads) compatiblewith the presence of syt7 � (Fukuda et al. 2002b), cod-ing for a protein with the theoretical mass of 58 kDa. Incontrast, a band of 520 bp was only detected in INS-1Ecells and may represent an amplicon diVerent fromsyt7.

Fig. 1 Expression of synaptotagmin 7 isoforms and cDNAs ininsulin secreting cells and brain. a Homogenates (40 �g) of indi-cated cell lines or tissues (rat or mouse brain, mouse islets) wereseparated by SDS-PAGE and immunoblotted (anti-Syt7, 1/6000).Molecular weights (in kDa) are given. b Westernblot as in A butin the absence or presence of the antigenic peptide (1 �M). c PCRanalysis of syt7 transscripts in INS-1E cells, rat hippocampus (hip-poc) or forebrain. CON, reaction in the absence of added cDNA.Molecular weight markers are given (200, 300, 400, 500 and600 bp). Arrowheads 625 bp amplicon; asterisk 510 bp amplicon

123

628 Histochem Cell Biol (2007) 127:625–632

To gain insight into the subcellular distribution of thevarious forms we preformed a subcellular fractionationof INS-1E cells on a continuous sucrose gradient. Wehave employed here a rather shallow gradient to opti-mize the separation of light compartments, such as syn-aptic-like microvesicles (SLMVs), from more denseorganelles. As given in Fig. 2a, b, the SLMV andendosomal marker protein SVP38/synaptophysin (Lin-stedt and Kelly 1991) was present in early fractions witha peak at fractions 2 and 3, whereas the LDCVs markersinsulin or Islet cell Autoantigen 512 (ICA) peaked atfraction 11. Between these markers for SLMVs andLDCVs we found ER-Golgi transport vesicles (�-COP)in fractions 4–9 and a widely distributing endoplasmicreticulum (calreticulin). The latter comigrated in partwith the plasma membrane marker Na+/K+ ATPase asdescribed previously (Lang et al. 1995). We have used anumber of additional markers to further describe thedistribution of organelles (Fig. 2c). The synaptic vesicleproteins SV2A and SV2B comigrated with SVP38/syn-aptophysin, whereas SV2C was distributed with moredense organelles, which were clearly distinct fromLDCVs. The endosomal SNARE Ti-VAMP migratedsimilar to SLMVs whereas the Golgi/post-GolgiSNARE Vti1b was separated from the SLMV markersand present at densities comparable to �-COP. The pro-tein complexin (CPX), a cytosolic component recruitedto plasma membrane SNARE complexes, was mainlyfound in the soluble fractions (fraction 1) as well as infraction 6 and 7. The latter fractions contained plasmamembranes as evidenced by the migration of Na+/K+

ATPase (see above). The protein synaptotagmin 9 (syt9)was evident in early fractions, comigrating with markersfor SLMVs and endosomal compartments, and peakedagain in late fractions containing markers for LDCVs.On close inspection at high magniWcation, the intermedi-ate fractions 6–9 contained a doublet and the lower bandmay represent non-glycosylated syt9 from the ER. Syt7was present in several fractions and large and smallforms exhibited a distinct distribution. The large formsof syt7 (60–70 kDa) distributed together mainly in frac-tions 2–4, thus slightly distinct from Ti-VAMP. Due tothe enrichment of syt7 in few fractions a more promi-nent staining was observed. The small forms of syt7migrated similarly but in addition peaked again at frac-tions 7 and 8 which contained ER and plasma mem-brane markers (see Fig. 2). We did not Wnd any syt7 athigher fractions indicative of its presence on LDCVs.Comparable results were obtained on fractionation ofinsulin-secreting MIN6 cells by a continuous sucrosegradient, i.e. migration at early (light) fractions andagain a peak at higher density distinct from LDCVs(data not shown).

We subsequently employed confocal laser micros-copy to further investigate and quantify the subcellulardistribution of synaptotagmin 7. As given in Fig. 3,staining with anti-syt7 in INS-1E cells and neurons wasabolished by preincubation of the antibody with theantigenic peptide (Fig. 3). Incubation of preparations

Fig. 2 Subcellular fractionation of INS-1E clonal �-cells. Postnu-clear supernatants were fractionated on a continuous sucrose gra-dient and fractions analyzed. a Distribution of density, totalprotein and immunoreactive insulin as determined by ELISA. bDistribution of marker proteins; synaptophysin/SVP38 (1/2000),�COP (1/2000), calreticulin (CALRET, 1/5000), Na+/K+ ATPase(1/1000) and islet cell autoantigen (ICA, 1/2000). Intensities aregiven as determined from immunoblots. c Immunoblots of SV2isoforms (1/500), vesicular SNAREs Vti1b (1/1000) and Ti-VAMP (1:1000), complexin (CPX, 1/2000), synaptotagmin 9(SYT9, 1/2000) and synaptotagmin 7 (SYT7, 1/6000) as well asICA. Molecular weights for SYT7 are indicated by horizontalbars (70, 60, 50 and 40 kDa)

123

Histochem Cell Biol (2007) 127:625–632 629

in the absence of the Wrst antibody did not result in anyappreciable staining (data not shown). In clonal INS-1E �-cells Syt7 was present on intracellular organellesand near or at the plasma membrane (Fig. 4a, arrow).Among the endogenous markers used for the endoso-mal compartments, only LAMP and Ti-VAMP distrib-uted to a small extent with syt7 whereas the transferrinreceptor (TfR) or synaptophysin (SVP38) did not dem-onstrate any signiWcant codistribution. Similarly, syt7did not signiWcantly colocalize with Ti-VAMP in HIT-T15 or primary �-cells (data not shown). In contrast,transiently expressed Rab7-eGFP, a marker of earlyand late endosomes (Vonderheit and Helenius 2005),colocalised to a signiWcant extent with syt7. Note thatthe colocalisation between Rab7-eGFP and syt7 israther high if staining for syt7 near the plasma mem-brane was not taken into account (see arrow Fig. 4a).In a separate series of experiments we controlled thatRab7-eGFP was indeed found on endosomes in INS-1E cells as evidenced by costaining for the marker pro-tein EEA1 (33.2 § 7.6% of pixels colocalising; n = 3;image not shown). A similar distribution of syt7 andLAMP or Rab7-eGFP was also found in HIT-T15,MIN6 or primary �-cells (data not shown). These dataindicate that syt7 is present in insulin-secreting cellsmainly on early and late endosomes and only to aminor extent on lysosomes.

We next asked whether endogenous syt7 may colo-calize with classical exocytotic vesicles as shown foroverexpressed syt7 in PC12 cells (Fukuda et al. 2004;Gao et al. 2000; Wang et al. 2005). In INS-1E cells, syt7did clearly not colocalise with LDCV markers such aschromogranin A (CgA) or insulin (Fig. 4b). Similarly,syt7 stained structures diVerent from those detected bysyntaxin 6 (SYX6), a marker of the trans-Golginetwork and immature granules (Kuliawat et al. 2004).In contrast, some colocalisation was evident for syt9.This may reXect localisation on similar endocytotic

compartments during recycling (Haberman et al.2005). Again, the absence of staining for syt7 onLDCVs was also evident in MIN6 cells where in addi-tion also an antibody against the N-terminal luminaldomain was used (data not shown).

As the presence of syt7 on Ti-VAMP and LAMPpositive compartments has been observed in several

Fig. 3 Immunostaining by anti-syt7 antibody is abolished bypreincubation with the antigenic peptide. Anti-syt7 antibody (1/300) was preincubated in the absence or presence of antigenicpeptide (10 �M) and images taken using identical parameters

Fig. 4 Confocal microscopy of synaptotagmin 7 immunoreactiv-ity in INS-1E clonal �-cells and PC12 pheochromocytoma cells. aCo-staining for syt7 and endosomal/lysosomal compartments inINS-1E cells. b Co-staining for syt7 and exocytotic compartmentsin INS-1E cells. c Co-staining for syt7 and exocytotic/endocytotic/lysosomal compartments in pheochromocytoma PC12 cells. Thefollowing markers were used: LAMP (1:10); Ti-VAMP (1:100);SVP38, synaptophysin (1:100); Tf-R, transferrin receptor (1:100);transiently expressed Rab7-eGFP; INS, insulin (1:200); CgA,chromogranin A (1:100); SYT9, synaptotagmin 9 (1:200); SYX 6,syntaxin 6 (1:100). The statistics of pixel distributions are givenbelow. In the case of rab7-eGFP distribution of the central com-partment (central) was also determined separately. Bars equal10 �m

123

630 Histochem Cell Biol (2007) 127:625–632

cell types (Andrew and Chakrabartia 2005), we alsoinvestigated this point in the neuroendocrine PC12cells. As shown in Fig. 4c, a substantial degree of colo-calisation was evident in these cells for both markers.Similar to endocrine cells; syt7 immunoreactivity didnot overlap with chromogranin A (CgA) suggestingthat endogenous syt7 is not expressed on LDCVs.

PC12 and pancreatic �-cells share numerous fea-tures with neurons in terms of expression of speciWcproteins and we determined whether the distributionof syt7 is comparable or not to endocrine or neuroen-docrine cells. In hippocampal neurons, syt7 is presentin a granular distribution mainly in the cell body andwe never observed any clear outlining of the plasmamembrane (Fig. 5a). As observed in PC12 and insulinsecreting cells, syt7 did not colocalize with the transfer-rin receptor. In contrast, a high degree of costainingwas observed for syt7 and the lysosomal markerLAMP1 as well as Ti-VAMP (Fig. 5a, b). We alsoemployed costaining for MAP to distinguish betweendendrites and axons. As shown in Fig. 5c, syt7 deco-rates the dendrites stained by MAP most likely due tothe presence of syt7 in axons running along dendrites.Indeed, syt7 was present in a number of synaptophy-sin-positive elements indicating its expression at syn-apses. This localisation was also indicated by co-staining with an antibody against the type 2 glutamatereceptor (Fig. 5c, GLUR2). Note that pre- and post-synaptic localisation cannot be distinguished at thelevel of resolution provided by confocal microscopy.The observed axonal staining may therefore representsynapses impinging on the axons.

Discussion

Synaptotagmin isoforms function as calcium sensor inpost-Golgi transport although the precise transport stepand compartment(s) concerned are still not fullyresolved. Insulin-secreting cells provide a useful modelas their physiology is well characterized and the distribu-tion of several other isoforms has been elucidatedincluding syt1, 2, 3, 4, 8 and 9 (Gut et al. 2001; Iezzi 2004;Lang et al. 1997; Monterrat et al. 2006). Moreover, theyexpress a considerable amount of syt7 as shown here,which oVers a certain advantage in comparison to PC12cells. Currently 10 diVerent splice variants have beendeposited at NCBI encoding proteins with calculatedmolecular weights ranging from 44 to 80 kDa. Theexpression pattern in terms of small and large syt7 wascomparable to those observed in brain extracts here andreported previously (Chieregatti et al. 2004; Han et al.2004; Sugita et al. 2001). In addition, analysis by

RT-PCR revealed amplicons comparable to previouslypublished splice variants (Fukuda et al. 2002b).

The lysosomal expression of syt7 has clearly beenestablished in a large number of cell lines, mainly ofendothelial origin, as well as its role in regulating thefusion of this organelle with the plasma membrane(Andrew and Chakrabartia 2005). As shown here,endocrine cells such as pancreatic �-cells clearly diVerfrom neuroendocrine cells and primary hippocampalneurons as syt7 is mainly expressed on endocytic

Fig. 5 Distribution of synaptotagmin 7 in hippocampal neurons.a, b Distribution and quantitative analysis of synaptotagmin 7(SYT7, left column), transferrin receptor (TfR, 1/100), LAMP1(1/10) and Ti-VAMP (1/100). c Co-staining of Syt7 and somato-dendritic MAP (1/100), presynaptic SVP38/synaptophysin (SVP,1/100) and postsynaptic glutamate receptor 2 (GLUR2, 1/100).Staining for syt7 is given in the left columns (green), staining withindicated antibodies (red) in the adjacent column. Bars equal10 �m

Fig. 5 Distribution of synaptotagmin 7 in hippocampal neurons.a, b Distribution and quantitative analysis of synaptotagmin 7(SYT7, left column), transferrin receptor (TfR, 1/100), LAMP1(1/10) and Ti-VAMP (1/100). c Co-staining of Syt7 and somato-dendritic MAP (1/100), presynaptic SVP38/synaptophysin (SVP,1/100) and postsynaptic glutamate receptor 2 (GLUR2, 1/100).Staining for syt7 is given in the left columns (green), staining withindicated antibodies (red) in the adjacent column. Bars equal10 �m

123

Histochem Cell Biol (2007) 127:625–632 631

compartments. It should, however, be pointed out thatprevious reports mainly examined the long splice vari-ants and that, at least, overexpression of a short form inrat kidney cells results in a considerable degree oflocalisation at early endosomes (Martinez et al. 2000).As the short splice variants constitute the major iso-forms in both PC12 (Han et al. 2004; Sugita and Sudhof2000; Zhang et al. 2002) and, as shown here, in clonal�-cells, the diVerential localisation may be due ratherto diVerences in the cellular organisation than to thepresence of distinct splice variants.

In addition to its localisation in the endosomal/lyso-somal pathway, we also observed the presence of syt7nearby or at the plasma membrane in insulin-secretingcells. This observation is in line with biochemical andultrastructural data from neurons (Sugita et al. 2001;Virmani et al. 2003) and also explains its presence onsynaptophysin containing structures, i. e. synapses,observed here. The precise subcellular localisation isunclear but does not include synaptic vesicles (Sugitaet al. 2001). Interestingly, the short splice variant ofsyt7 is directed to clathrin-coated pits where it may reg-ulate the pit assembly (von Poser et al. 2000). Such alocation may explain the presence of syt7 at the plasmamembrane in insulin-secreting cells and in synapses.

Our data on the distribution of endogenous synapto-tagmin 7 in endocrine and neuroendocrine cells suggesta role for this isoform in endocytotic traYc but do notsupport a role in exocytosis of large dense core vesi-cles. Indeed, syt7 did not colocalize with secretory insu-lin granules in subcellular gradients in contrast to theisoforms syt9. The absence of syt7 from insulin-con-taining secretory granules is also suggested by the phe-notype of syt7 knock-out mice. They have a normal lifespan which would not be expected if syt7 would play amajor role in insulin secretion (Chakrabarti et al.2005). In addition, a previous report on syt7 expressionon secretory granules in �-cells was based on low reso-lution imaging without quantiWcation (Gao et al. 2000).Another class of exocytotic vesicles in endocrine andneuroendocrine cells is represented by SLMVs carry-ing synaptophysin. SLMVs of clonal �-cells are knownto harbour the isoforms syt1, 2 (Lang et al. 1997) and,as shown here, also contain syt9. Again, we did notobserve any colocalisation for synaptic-like microvesi-cles in line with the reported absence of syt7 from syn-aptic vesicles (Sugita et al. 2001). It should be pointedout that we used a rather shallow gradient for betterresolution. This allowed also separating markers forsecretory granules from SV2C which has previouslybeen claimed to be expressed on secretory granules(Iezzi et al. 2005). Our observations here are, however,in accordance with the original report demonstrating

the codistribution of SV2C with microsomes but notwith secretory granules in chromaYn cells (Janz andSüdhof 1999).

In conclusion, our data demonstrate that syt7 has awider distribution within the endocytic/lysosomal path-way than generally assumed and its precise localisationmay be cell-type dependent. Moreover, the absence ofendogenous syt7 from large dense core vesicles ques-tions its physiological role in the exocytosis of secre-tory granules although it may be important duringsubsequent endocytosis and recycling of vesicle com-ponents. Calcium regulates endosomal fusion includingtraYc from late endosomes to lysosomes and calmodu-lin has been invoked as a major eVector (Bourgoyneand Clague 2003). The distribution of syt7 as demon-strated here suggests that this synaptotagmin isoformsmay also play a role as calcium sensor during endoso-mal traYc in addition to its well documented role in thefusion of lysosomes with the plasma membrane.

Acknowledgments We thank Delphine Bouchet for excellenttechnical assistance. This work was supported by grants from theNational Ministry of Research, the Region of Aquitaine and theUniversity of Bordeaux I (BQR2004/5).

References

Andrew NW, Chakrabartia S (2005) There’s more to life thanneurotransmission: the regulation of exocytosis by synapto-tagmin VII. Trends Cell Biol 15:626–631

Berton F, Cornet V, Iborra C, Garrido J, Dargent B, Fukuda M,Seagar M, Marqueze B (2000) Synaptotagmin I and IV deW-ne distinct populations of neuronal transport vesicles. Eur JNeurosci 12:1294–1302

Boal F, Le Pevelen S, Cziepluch C, Scotti P, Lang J (2007) Cyste-ine-string protein isoform � (Csp �) is targeted to the trans-Golgi network as a non-palmitoylated CSP in clonal �-cells.Biochim Biophys Acta 1773:109–119

Boal F, Zhang H, Tessier C, Scotti PA, Lang J (2004) The vari-able C-terminus of cysteine string proteins modulates exocy-tosis and protein-protein interactions. Biochemistry43:16212–16223

Bourgoyne RD, Clague MJ (2003) Calcium and calmodulin inmembrane fusion. Biochim Biophys Acta 1641:137–143

Butz S, Fernandez-Chacon R, Schmitz F, Jahn R, Sudhof TC(1999) The subcellular localizations of atypical synaptotag-mins III and VI. Synaptotagmin III is enriched in synapsesand synaptic plasma membranes but not in synaptic vesicles.J Biol Chem 274:18290–18296

Chakrabarti S, Andrade LO, Andrews NW (2005) Trypanosomacruzi invades synaptotagmin VII-deWcient cells by a PI-3 ki-nase independent pathway. Mol Biochem Parasitol 141:125–128

Chieregatti E, Chicka MC, Chapman ER, Baldini G (2004)SNAP-23 functions in docking/fusion of granules at lowCa2+. Mol Biol Cell 15:1918–1930

Craxton M (2004) Synaptotagmin gene content of the se-quenced genomes. BMC Genom 5:43. doi:10.1186/1471–2164-5-43

123

632 Histochem Cell Biol (2007) 127:625–632

Fukuda M, Kanno E, Satoh M, Saegusa C, Yamamoto A (2004)Synaptotagmin VII is targeted to dense-core vesicles andregulates their Ca2+ -dependent exocytosis in PC12 cells. JBiol Chem 279:52677–52684

Fukuda M, Kowalchyk JA, Zhang X, Martin TF, Mikoshiba K(2002a) Synaptotagmin IX regulates Ca2+-dependent secre-tion in PC12 cells. J Biol Chem 277:4601–4604

Fukuda M, Ogata Y, Saegusa C, Kanno E, Mikoshiba K (2002b)Alternative splicing isoforms of synaptotagmin VII in themouse, rat and human. Biochem J 365:173–180

Gao Z, Reavey-Cantwell J, Young RA, Jegier P, Wolf BA (2000)Synaptotagmin III/VII isoforms mediate Ca2+-induced insu-lin secretion in pancreatic islet �-cells. J Biol Chem275:36079–36085

Geppert M, Archer BT 3rd, Sudhof TC (1991) Synaptotagmin II.A novel diVerentially distributed form of synaptotagmin. JBiol Chem 266:13548–13552

Gut A, Kiraly CE, Fukuda M, Mikoshiba K, Wollheim CB, LangJ (2001) Expression and localisation of synaptotagmin iso-forms in endocrine �-cells: their function in insulin exocyto-sis. J Cell Sci 114:1709–1716

Haberman Y, Ziv I, Gorzalczany Y, Fukuda M, Sagi-Eisenberg R(2005) Classical protein kinase C(s) regulates targeting ofsynaptotagmin IX to the endocytic recycling compartment. JCell Sci 118:1641–1649

Han W, Rhee JS, Maximov A, Lao Y, Mashimo T, RosenmundC, Sudhof TC (2004) N-glycosylation is essential for vesicu-lar targeting of synaptotagmin 1. Neuron 41:85–99

Ibata K, Fukuda M, Hamada T, Kabayama H, Mikoshiba K(2000) Synaptotagmin IV is present at the Golgi and distalparts of neurites. J Neurochem 74:518–526

Iezzi M, Kouri G., Fukuda M., Wollheim C.B. (2004) Synaptotag-min V and IX isoforms control Ca2+-dependent insulin exo-cytosis. J Cell Sci 117:3119–3127

Iezzi M, Theander S, Janz R, Loze C, Wollheim CB (2005) SV2Aand SV2C are not vesicular Ca2+ transporters but control glu-cose-evoked granule recruitment. J Cell Sci 118:5647–5660

Jahn R, Lang T, Sudhof TC (2003) Membrane fusion. Cell112:519–533

Janz R, Südhof T (1999) SV2C is a synaptic vesicle protein withan unusually restricted localization: anatomy of a synapticvesicle protein family. Neuroscience 94:1279–1290

Kuliawat R, Kalinina E, Bock J, Fricker L, McGraw TE, Kim SR,Zhong J, Scheller R, Arvan P (2004) Syntaxin-6 SNAREinvolvement in secretory and endocytic pathways of culturedpancreatic �-cells. Mol Biol Cell 15:1690–1701

Lajus S, Vacher P, Huber D, Dubois M, Benassy MN, UshkaryovY, Lang J (2006) �-latrotoxin induces exocytosis by inhibi-tion of voltage-dependent K+ channels and by stimulation ofL-type Ca2+ channels via latrophilin in �-cells. J Biol Chem281:5522–5531

Lang J, Fukuda M, Zhang H, Mikoshiba K, Wollheim CB (1997) TheWrst C2 domain of synaptotagmin is required for exocytosis of

insulin from pancreatic �-cells: action of synaptotagmin atlow micromolar calcium. EMBO J 16:5837–5846

Lang J, Nishimoto I, Okamoto T, Regazzi R, Kiraly C, Weller U,Wollheim CB (1995) Direct control of exocytosis by recep-tor-mediated activation of the heterotrimeric GTPases Giand G(o) or by the expression of their active G alpha subun-its. EMBO J 14:3635–3644

Li C, Ullrich B, Zhang JZ, Anderson RG, Brose N, Sudhof TC(1995) Ca2+-dependent and -independent activities of neuraland non-neural synaptotagmins. Nature 375:594–599

Linstedt AD, Kelly RB (1991) Synaptophysin is sorted fromendocytotic markers in neuroendocrine PC12 cells but nottransfected Wbroblasts. Neuron 7:309–317

Martinez I, Chakrabarti S, Hellevik T, Morehead J, Fowler K,Andrews NW (2000) Synaptotagmin VII regulates Ca2+-dependent exocytosis of lysosomes in Wbroblasts. J Cell Biol148:1141–1149

Monterrat C, Boal F, Grise F, Hemar A, Lang J (2006) Synapto-tagmin 8 is expressed both as a calcium-insensitive solubleand membrane protein in neurons, neuroendocrine andendocrine cells. Biochim Biophys Acta 1763:73–81

Rickman C, Craxton M, Osborne S, Davletov B (2004) Compar-ative analysis of tandem C2 domains from the mammaliansynaptotagmin family. Biochem J 378:681–686

Rorsman P, Renstrom E (2003) Insulin granule dynamics in pan-creatic � cells. Diabetologia 46:1029–1045

Sudhof TC (2004) The synaptic vesicle cycle. Annu Rev Neurosci27:509–547

Sugita S, Han W, Butz S, Liu X, Fernandez-Chacon R, Lao Y,Sudhof TC (2001) Synaptotagmin VII as a plasma membraneCa2+ sensor in exocytosis. Neuron 30:459–473

Sugita S, Sudhof TC (2000) SpeciWcity of Ca2+-dependent proteininteractions mediated by the C2A domains of synaptotag-mins. Biochemistry 39:2940–2949

Virmani T, Han W, Liu X, Südhof TC, Kavalali ET (2003) Syn-aptotagmin 7 splice variants diVerentially regulate synapticvesicle recycling. EMBO J 22:5347–5357

von Poser C, Zhang JZ, Mineo C, Ding W, Ying Y, Sudhof TC,Anderson RGW (2000) Synaptotagmin regulation of coatedpit assembly. J Biol Chem 275:30916–30924

Vonderheit A, Helenius A (2005) Rab7 associates with early en-dosomes to mediate sorting and transport of Semliki forestvirus to late endosomes. PLoS Biol 3:e233

Wang P, Chicka MC, Bhalla A, Richards DA, Chapman ER(2005) Synaptotagmin VII is targeted to secretory organellesin PC12 cells, where it functions as a high-aYnity calciumsensor. Mol Cell Biol 25:8693–8702

Zhang H, Kelley WL, Chamberlain LH, Burgoyne RD, Lang J(1999) Mutational analysis of cysteine-string protein func-tion in insulin exocytosis. J Cell Sci 112:1345–1351

Zhang X, Kim-Miller MJ, Fukuda M, Kowalchyk JA, Martin TF(2002) Ca2+-dependent synaptotagmin binding to SNAP-25is essential for Ca2+-triggered exocytosis. Neuron 34:599–611

123