nwano(1ifh(o

pP

Virology 282, 87–101 (2001)doi:10.1006/viro.2000.0819, available online at http://www.idealibrary.com on

The 39 End of Hepatitis E Virus (HEV) Genome Binds Specificallyto the Viral RNA-Dependent RNA Polymerase (RdRp)

Shipra Agrawal, Dinesh Gupta,1 and Subrat Kumar Panda2

Department of Pathology, All India Institute of Medical Sciences, Ansari Nagar, New Delhi 110029, India

Received May 16, 2000; returned to author for revision June 20, 2000; accepted December 26, 2000

Hepatitis E virus (HEV) is the major cause of acute epidemic and sporadic hepatitis in the developing world. It is apositive-strand RNA virus with a genome length of about 7.2 kb. The replication mechanism of this virus is virtuallyunexplored. Identification of the regulatory elements involved in initiation of replication may help in designing specificinhibitors for therapy. In the positive-stranded RNA viruses the initiation of replication requires interaction of the 39 end ofgenome with its RNA-dependent RNA polymerase (RdRp) and possibly host-derived cofactors for synthesis of the minus-strand replicative intermediate. Secondary structure prediction of the conserved 39 end of the infectious HEV genome wascarried out to identify possible stem-loop structures necessary for RNA-protein interaction and the model was confirmed bystructure probing experiments. Electrophoretic mobility-shift assays showed specific binding of purified and refoldedrecombinant HEV RdRp protein to the 39 end of its RNA genome containing the poly(A) stretch. Mutations at the 39 end, inwhich the stem-loop structures were partially or completely destroyed or recreated revealed that the two stem-loopstructures SL1 and SL2 at the 39 end and the poly(A) stretch are necessary for this binding. The interacting nucleotides insuch an interaction were further identified by generating footprints of the complex by Pb(II)-induced hydrolysis. This specificbinding of viral RdRp to the 39 end of HEV RNA directs the synthesis of complementary-strand RNA and thus such a binding

domain might assume the role of a possible cis-acting element as a potential site for the initiation of replication. © 2001

Academic Press

fcc1ea

INTRODUCTION

Hepatitis E virus (HEV) is the major etiological agentresponsible for large epidemics as well as many spo-radic cases of acute viral hepatitis in much of the devel-oping world (Khuroo, 1980, 1991; Nanda et al., 1994a;Panda et al., 1989; Ray et al., 1991; Reyes et al., 1991;Wong et al., 1980). New recommendations of the Inter-

ational Committee on the Taxonomy of Viruses (http://ww.ncbi.nlm.nih.gov/ICTV/) now place HEV into a sep-rate family called hepatitis E-like viruses. The viral ge-ome is a single-stranded ;7.2-kb polyadenylated RNAf positive sense containing three open-reading frames

ORFs) (Panda and Jameel, 1997; Purdy et al., 1993). ORFencodes the putative nonstructural polyprotein includ-

ng domains representative of (a) a viral methyltrans-erase, (b) a papain-like cysteine protease, (c) a RNAelicase, and (d) a viral RNA-dependent RNA polymerase

Koonin et al., 1992). However, the exact cleavage sitesn the nonstructural polyprotein giving rise to various

1 Dr. Dinesh Gupta is currently undergoing a bio-informatics trainingrogram funded by WHO, in the Department of Biology at University ofennsylvania, PA.

2 To whom correspondence should be addressed at Department of

Pathology, AIMS, Ansari Nagar, New Delhi 110 029, India. Fax: 91-11-686-2663. E-mail: pandask@hotmail.com; skpanda@medinst.ernet.in.

87

unctional domains are yet to be identified. ORF 2 en-odes a ;88-kDa glycoprotein that is the major viralapsid protein (Jameel et al., 1996) and ORF 3 encodes a3.5-kDa phosphoprotein of unknown function (Zafrullaht al., 1997). The coding sequences in the HEV genomere flanked by 59 and 39 noncoding regions (NCRs) which

are 27 and 68 nucleotides long, respectively (Tam et al.,1991). The noncoding regions of the positive-strand viralRNA genomes are known to function as cis-acting ele-ments for the genomic RNA replication via interactionwith viral or cellular proteins (Oh et al., 2000; Hwang andBrinton, 1998; Kuhn et al., 1990; Rohll et al., 1994; Songand Simon, 1995; Tiley et al., 1994; Yu and Leibowitz,1995a). The 39 end of the viral RNA has been specificallyimplicated as the site for the initiation of replication inthese viruses.

Recently we have developed an infectious cDNA cloneof HEV, which not only produces replicative intermedi-ates but also processed viral proteins and infectiousvirus (Panda et al., 2000). These infection studies indi-cated that the HEV follows a replication strategy involv-ing a negative-strand intermediate similar to those ofother positive-strand RNA viruses. In lieu of this fact, oneapproach to study HEV replication would be to worktoward the identification of the cis-acting elements in the

RNA and the viral and the cellular proteins interactingwith it to possibly form a replication complex. Information

0042-6822/01 $35.00Copyright © 2001 by Academic PressAll rights of reproduction in any form reserved.

ttoslhpm

aR

S

iB(aiAMa

sn

ses arn plex a

88 AGRAWAL, GUPTA, AND PANDA

regarding the replication control may help to designstrategies for intervention.

In the present study we have focused on the interac-tion of the recombinant viral RNA-dependent RNA poly-merase with the 39 end of HEV genome because such aninteraction would possibly offer a potential initiation stepin the replication of the HEV genome. Computer-assistedprediction of the thermodynamically stable structure ofthe 39 end of HEV RNA has been carried out to identifyhe elements essential for RNA-protein interaction. Solu-ion structure studies by metal ion and enzymatic probingf the RNA have been done to confirm the predictedtructure. RNA-RdRp protein interaction has been ana-

yzed by binding studies and major interacting motifsave been identified by mutational analysis, com-

FIG. 1. (A) Secondary structure prediction of the 39 end (nt 7084–7194tem-loop structures, SL1 and SL2, comprise nt 7173–7194 and 7089–7t. The SL1 structure involves the poly(A) stretch at its 39 end. Hairp

designated. Nucleotide variations found in other isolates are indicatedpredicted structure is 224.9 kcal/mol. (B) Summary of the experimentnative RNA that were determined to be susceptible to Pb(II) and RNa

uclease). Nucleotides prone to Pb(II) hydrolysis in the RNA-RdRp com

ounded by RNA footprinting experiments. In vitro poly-erase activity of the recombinant RdRp is also studied

St

t the 39 end to produce a complementary strand of HEVNA.

RESULTS

tructural analysis of the 39 end

The nucleotide sequence analysis of the 39 noncod-ng region of the full-length HEV sequences in Gen-ank [India (AF076239), Pakistan (M80851), Myanmar

M73218), China (L08816), and Mexico (M74506)] showedhigh degree of homology with very few C3U variations

n Pakistani, Myanmar, and Chinese isolates and a single3G variation in the Mynamar isolate (Fig. 1A). Theexican isolate had 9 nucleotides extra at the 39 end

nd showed quite a few variations within the sequence.

HEV RNA (Indian isolate) using the MFOLD (Zuker) program. The twopectively, and the single-strand region (SS) extends from 7164 to 7172

, interior loop, and stem regions a and b within SL1 have also beenrows (PAK, Pakistan; CHI, China; MYN, Mynamar). Free energy of the

of chemical and enzymatic structure probing. Nucleotides within thee labeled (p, Pb21; o, ribonuclease I; s, S1 nuclease; m, mung beanre shown in brackets.

An) of163, resin loop

by aral data

econdary structure prediction of the last 300 nucleo-ides at the 39 end of five different isolates indicated the

t

wagRcp

dtr

89RNA-RdRp INTERACTIONS AT THE 39 END OF HEV RNA

presence of a number of stem and loops, two stem-loopstructures of which at the extreme 39 end were found tobe conserved among all viral isolates with minor differ-ences in the Mexican isolate. This conserved regionspans nucleotide positions 7084 to 7194 in the Indianisolate of HEV and the predicted structure of the last 110bases of the Indian isolate is shown in Fig. 1A. Stem-loopstructures 1 and 2 (SL1, SL2) comprise nucleotides 7173–7194 and 7089–7163, respectively, separated by a single-strand region (SS) of nt 7164–7172. The SL1 structureinvolves the poly(A) stretch at its 39 end in base pairing.All the nucleotide variations in other isolates were foundin the bulge regions (Fig. 1A). In the Mexican isolate, SL1involves four A residues in base pairing instead of threeas observed in others, and the SL2 structure also bifur-cates into two hairpin loops unlike other isolates (datanot shown).

In order to confirm the predicted structure at the 39end, Pb21 ions induced cleavage and RNase probing ofhe RNA transcript of the 39 end with a poly(A) stretch

[39(1)An] was performed. Catalysis by Pb21 is known tobe specific at the single-stranded regions, loops, andbulges, leaving out the double-stranded RNA stretches(Ciesiolka et al., 1992a,b, 1998). In our structure probingstudies, Pb21 hydrolysis gave a more descriptive pictureof the structure than the enzymatic probing utilizing dif-ferent single-strand cutting ribonucleases like ribonucle-ase I, S1 nuclease, and mung bean nuclease. This mightbe due to the ability of smaller Pb21 ions having betteraccess into the folded RNA structure than the enzymes.The digestion pattern observed is summarized in Fig. 1Band the representative structure probing gel is shown inFig. 2. Pb21 and RNases including S1 nuclease andmung bean nuclease cut at every single nucleotide fromnt 7164 to 7172 which forms a single-strand region (SS) inthe computer-predicted structure model. Occasional cutswithin this region were observed by ribonuclease I en-zyme too. Pb21 ions could identify and thus confirm theloops and bulge regions in SL1 and SL2, the reactivitiesbeing shown by the nt 7177, 7182–7183, 7189–7193 and7198–7199 in SL1 structure and nt 7094–7097, 7113–7119,7125–7127, 7130–7133, 7136, 7141, 7154, and 7159 in theSL2 structure. Occasional hydrolysis was observed ateither ends of the loops like nt 7098, 7100, 7111, 7112,7124, indicating toward some conformational flexibility inthese regions. Different RNases cleaved at the bulge andloop regions of SL1 and SL2 as depicted in Fig. 1B. Priorto the reaction with Pb(OAc)2, the end-labeled RNA tran-scripts were denatured and then cooled slowly for effi-cient folding and obtaining a maximum number of nativemolecules. However, omission of this procedure had noeffect on the probing profiles obtained (Fig. 2), suggest-ing that the RNA secondary structure as determined inthese experiments forms rapidly and reproducibly under

the chosen conditions.

Various point mutants and deletion mutants were con-

structed (Fig. 3A) based on the secondary structuremodel. The predicted structure of the mutants is demon-strated in Fig. 3B.

Viral RNA-dependent RNA polymerase protein

Earlier observations on sequence homology search(Koonin et al., 1992) with other positive-strand RNA vi-ruses defined the coding region of RdRp in the HEVgenome. The recent computer-derived structure analysisdata of HEV RdRp based on the crystal structure ofpoliovirus and HCV RdRps corroborate the sequencehomology results (Panda et al., unpublished data). RdRpwas expressed as a 63-kDa His-tagged protein, in E. coli(Fig. 4). The 63-kDa band is composed of ;59-kDa RdRpand ;4-kDa His tag from the vector sequence. Theexpressed RdRp could be detected in the Western blotassay using acute-phase HEV-infected patient serumand rabbit anti-RdRp antibodies (data not shown). The

FIG. 2. Chemical and enzymatic probing of the secondary struc-ture of 39 end of HEV RNA. Cleavage products obtained by hydro-lysis of 59 end-labeled RNA transcripts with Pb21 ions and digestion

ith single-strand-specific RNases (Ribonuclease I, S1 nuclease,nd mung bean nuclease) were separated on 15% polyacrylamideel and given short and long runs. Prior to the reaction, the labeledNA transcripts were supplemented with tRNA and brought to aoncentration of 8 mM and subjected to a denaturation/renaturationrocedure. Lane A: control incubation of the RNA without Pb21 ions

or RNases. Lane B: limited RNase T1 hydrolysis under denaturingconditions: cutting at every G residue. Some of the numbers of Gresidues in the RNA sequence are depicted on the left. Lane C:formamide ladder. Lanes D and E: Pb(II)-induced hydrolysis at 2.5and 5 mM Pb(OAc)2. Lane F: same as 5 but with the omission of the

enaturation/renaturation procedure. Lanes G, H, and I: diges-ion with ribonuclease I, S1 nuclease, and mung bean nuclease,espectively.

recombinant RdRp protein was expressed in highamounts in E. coli and purified and refolded on a Ni-NTA

o

iR

pcco

shc

ume kcal/mok , 226.4

90 AGRAWAL, GUPTA, AND PANDA

column. SDS-PAGE analysis of the eluted fractionsshowed a relatively pure RdRp protein (Fig. 4, lane P).

Interaction of viral RdRp with the 39 end of HEV

An in vitro RNA EMSA was developed to study bindingf purified and refolded RdRp protein to the 39 end of

positive-sense HEV genomic RNA. Binding of RdRp wasobserved with the wild-type transcript with the poly(A)stretch [39(1)An] (Fig. 5A, lane 2), but not with a similarRNA lacking the poly(A) stretch [39(1)] (Fig. 5A, lane 4).The binding to [39(1)An] RNA showed a concentrationresponse since the band intensity increased on increas-ing the amount of RdRp for a fixed amount of RNA probe(Fig. 5B). The binding showed a saturation effect and anoptimal binding condition of 5 mg RdRp protein for 1 ng(105 cpm) of input RNA was used for subsequent exper-ments. The specificity of the complex formation betweendRp and [39(1)An] was evaluated in competition assays

(Figs. 5C and D). While a specific competitor, unlabeled[39(1)An] RNA, disrupted the RNA-RdRp complex com-

letely at 10–25 times the molar excess, a nonspecificompetitor such as E. coli tRNA failed to disrupt the

FIG. 3. (A) Schematic diagram and description of RNA transcripts corsed for binding analysis. (B) Secondary structure prediction of variousutants were generated using PCR mutagenesis in the laboratory for a

nergies of these predicted structures of mutants are: 39(1), 222.8cal/mol; 39(1)M1, 222.8 kcal/mol; 39(1)M2, 223.0 kcal/mol; 39(1)M3

omplex even at a 50-fold molar excess (Fig. 5C). To ruleut the possibility that the poly(A) stretch itself confers all

pecificity to this RNA-RdRp interaction, polyadenylateduman placental mRNA was also used as a nonspecificompetitor. It could not disrupt the [39(1)An] RNA-RdRp

complex even at a 60-fold molar excess (Fig. 5D). Use ofunlabeled 39 end RNA without poly(A) stretch, [39(1)], asa competitor also could not disrupt the [39(1)An] RNA-RdRp complex (data not shown). In another competitionassay, oligo(dT) also failed to compete with the [39(1)An]RNA-RdRp complex at a 60-fold molar excess (Fig. 5D). Inyet another experiment, a nonspecific protein, heparin,failed to bind to the [39(1)An] probe under similar bindingconditions, as used for [39(1)An]-RdRp interaction (datanot shown). In the supershift assay (Fig. 5E), addition ofrabbit anti-RdRp sera shifted the specific complex (C) toa higher position in the gel (band marked S). This shiftedcomplex was absent with the preimmune sera, though anonspecific band was observed in both the sera abovethe complex S (Fig. 5E).

Localization of RdRp binding site in the 39 endof HEV RNA

To identify domains within the 39 end of the HEV

ding to the native [39(1)An] and mutant forms of the 39 end of HEV RNAforms of 39 end of HEV RNA using the MFOLD (Zuker) program. These. Arrow indicates point mutation. Arrow with D indicates deletion. Freel; 39(1)D, 217.2 kcal/mol; 39(1)dAn, 218.2 kcal/mol; s39(1)An, 26.7kcal/mol; 39(1)M4, 219.9 kcal/mol.

responmutantnalysis

genome involved in interaction with RdRp, a mutationalstudy was carried out. Various deletion and point muta-

t

—Continued

91RNA-RdRp INTERACTIONS AT THE 39 END OF HEV RNA

tions of the 39 end transcripts were made and assayedfor their binding activity with the purified viral RdRpprotein. The results are summarized in Fig. 6. A majordeletion of the nucleotides 7163–7194 (last 32 nucleo-tides) from the 39 NCR as well as omission of the 39poly(A) stretch [39(1)D] (Fig. 3Bii) completely abolishedbinding with RdRp, indicating the requirement of thisregion in complex formation (Fig. 5A, lane 6). The lightband seen in lane 6 corresponding to the position ofRNA-RdRp complex was not observed consistently and,whenever seen, was completely abrogated by nonspe-cific competition. Further, a negligible amount of bindingwas observed with the wild-type 39 end lacking only thepoly(A) stretch [39(1)] (Fig. 3Bi), even with increasedconcentrations of RdRp. This clearly suggested that the39 end poly(A) sequences are essential for binding ofRdRp to the 39 end. From the secondary structure models(Fig. 3Bi) it is apparent that removal of poly(A) disruptsthe necessary structure in SL1 which may be required forbinding. To further analyze the 39 end-RdRp interaction,two major deletions in the 39 end were generated,

n n

FIG. 3

{[39(1)dA ] and [s39(1)A ]} (Fig. 3Biii, iv). While both ofhese mutants contained the poly(A) stretch at their 39

FIG. 4. Expression and purification of HEV RdRp protein. Coomassiebrilliant blue-stained SDS–10% polyacrylamide gel showing the expres-sion and purification of recombinant HEV RdRp protein in E. coli as a63-kDa band. E. coli BL21(DE3) cells were transformed with pRSET Cvector containing HEV RdRp coding sequence (nt 3493–5163) in-frameand induced with 1 mM IPTG. The expressed RdRp protein containingthe 6 His tag was purified on a Ni-NTA column. U, uninduced lane; I,induced lane; P, lane showing the band of purified RdRp protein; M,

high molecular weight marker (Life Technologies). Arrow indicates theexpressed protein band.

92 AGRAWAL, GUPTA, AND PANDA

l

sR

1

Tcas

cinor d

93RNA-RdRp INTERACTIONS AT THE 39 END OF HEV RNA

ends, mutant [39(1)dAn] was deleted of nt 7173–7194 andacked SL1, and mutant [s39(1)An] was deleted of nt

7084–7138 and did not form SL2. Both these mutantsshowed less than 5% of the binding observed with thewild-type 39 end containing poly(A) sequences. Thisclearly suggested that the presence of the SL1 and SL2sequences, along with the presence of the poly(A)stretch, is necessary for binding of the viral RdRp to the39 end of HEV genome.

To determine the elements in SL1 important for RdRpbinding, two point mutants {[39(1)M1] and [39(1)M2]}(Fig. 3Bv and vi) and two deletion mutants {[39(1)M3] and[39(1)M4]} (Fig. 3Bvii and viii) were generated. Thesemutants compromised the interaction at the optimal con-

FIG. 5. EMSA with purified and refolded viral RdRp protein and 39 enRdRp protein in the presence of excess of tRNA, and the reaction mix wLane 1, free probe of the native 39 end with poly(A) stretch [39(1)An]; lan

tretch [39(1)]; lane 4, [39(1)] with RdRp; lane 5, free probe of 39 end wdRp. (B) Effect of increasing amounts of RdRp on binding. Lane 1, free

lane 9, free probe of [39(1)]; lanes 10–16, increasing amounts of RdRp, free probe of [39(1)An]; lane 2, [39(1)An] with RdRp; lanes 3–6, sam

39(1)An); lanes 7–10, same as lane 2 with increasing molar excessnonspecific competitors. Lane 1, free probe of [39(1)An]; lane 2, [39(1)Ahuman placental mRNA; lanes 5 and 6, same as lane 2 with increasing m

he binding mix containing RNA-RdRp complex was further incubatedontrol. The entire reaction mix was then subjected to 5% nondenaturin

FIG. 6. Graphical representation of the effect of mutations at theorresponding to the native and mutant forms of 39 end of HEV RNA w

poly(A) stretch or of SL1 or SL2 brings down the binding to minimal. Mdegrees.

s lane 2 with 10 ml of anti RdRp rabbit sera; lane 4, same as lane 2 with 10upershifted complex of RNA-RdRp-anti RdRp antibody.

centration of RdRp protein by varying degrees. A singleG3A point mutation at nucleotide 7194 in [39(1)M1],which resulted in the disruption of SL1 by opening theinterior loop and stem region (a), reduced the binding to48% of the binding observed with the wild type. A com-pensatory C3T point mutation at nucleotide 7176 in the[39(1)M1] background was introduced in mutant[39(1)M2], which restored the original structure. Thismutant showed a slightly increased binding efficiency of;60% of the wild type, though not the same as the wildtype. The deletion mutant [39(1)M3] lacking the interiorloop and the three C residues showed only 13% of thebinding observed with the wild type, whereas the dele-tion mutant [39(1)M4] deleted of nt 7178–7188 and thus

EV RNA. (A) The labeled probes (;1 ng) were allowed to bind to 5 mgected to 5% nondenaturing polyacrylamide gel electrophoresis (PAGE).1)An] with RdRp; lane 3, free probe of the native 39 end without poly(A)eletion of 32 nucleotides at the 39 end [39(1)D]; lane 6, [39(1)D] withf [39(1)An]; lanes 2–8, increasing amounts of RdRp added to [39(1)An];to [39(1)]. (C) Competition experiment with RdRp and [39(1)An]. Lanene 2 with increasing molar excess of specific competitor (unlabeledspecific competitor (E. coli tRNA). (D) Competition experiment withRdRp; lanes 3 and 4, same as lane 2 with increasing molar excess of

xcess of oligodT (18 mer). (E) Supershift assay with RdRp and [39(1)An].bbit sera raised against RdRp or with the preimmune sera to serve as. Lane 1, free probe [39(1)An]; lane 2, [39(1)An] with RdRp; lane 3, same

of HEV RNA on the binding efficiency with RdRp. Different probeswed to bind to a fixed amount of RdRp protein (5 mg). Deletion of the

eletions and point mutations within SL1 effect the binding by varying

d of Has subje 2, [39(

ith a dprobe oaddede as laof non

n] witholar e

with rag PAGE

39 endere allo

ml of preimmune rabbit sera. F, free probe; C, RNA-RdRp complex; S,

eRiatnon

bT

ilo

IH

gvcftttlpirtCsdwe(cls8sg8bts3

ngriRtnpt

R

94 AGRAWAL, GUPTA, AND PANDA

lacking the hairpin loop still showed about 60% bindingof the wild type.

Pb(II) ions induced hydrolysis of the RNA-RdRpcomplex

Pb21-induced hydrolysis carried out on the native 39nd RNA molecule and the one complexed with viraldRp protein further confirmed the nucleotides involved

n such an interaction (Figs. 7 and 1B). Although thispproach limited the identification of interacting nucleo-

ides to the single-stranded regions, loops, and bulges,evertheless it was helpful in confirming the resultsbtained using different mutant forms of 39 end. Theucleotides that could still be hydrolyzed by Pb21 on

forming the RNA-RdRp complex are bracketed in Fig. 1B,thus representing the unmasked nucleotides in such aninteraction. It is quite evident from the footprinting datathat the RdRp interacting sites are spread over SL1, SL2,and SS regions. This is indeed shown by the experi-ments with deletion mutants [39(1)dAn, 39(1)D, ands39(1)An] wherein the deletion of either of these threeregions abrogates all the binding activity (Fig. 6). Finermutational analysis involving minor deletions in SL1 likelack of 3 C (7190–7192) in mutant 39(1)M3 (Fig. 3Bvii)

FIG. 7. Pb(II)-induced cleavage of the 59 end-labeled HEV 39 end RNAin the native form (D, E) and complexed with RdRp (F–H). Lane A:control incubation of RNA without Pb21 ions. Lane B: limited RNase T1hydrolysis under denaturing conditions: cutting at every G residue.Some of the numbers of G residues in the RNA sequence are depictedon the left. Lane C: formamide ladder. Lanes D and E: reaction of nativeform of RNA with 2.5 and 5 mM Pb21. Lanes F, G, and H: reaction of the

NA-RdRp complex with 5, 2.5, and 1.25 mM Pb21.

rings down the binding activity to 13% of the normal.his is in agreement with the Pb21 hydrolysis data of the

be

RNA-RdRp complex wherein all these three C residuesare masked and thus resistant to hydrolysis (Fig. 1B).

Some of the nucleotides in the double-stranded re-gions (7178 and 7176), which were resistant to hydrolysisin the native form of RNA, become exposed to Pb21 ionsn the RNA-RdRp complex (Fig. 1B). This might be due toocal conformational changes during complex formationf RNA with RdRp protein.

n vitro RNA synthesizing activity of recombinantEV RdRp

Figure 8A (lane 2) shows that the 39 end of HEVenome with poly(A) stretch acts as a template for the initro synthesis of complementary RNA catalyzed by re-ombinant RdRp expressed in E. coli, purified, and re-

olded. This activity is primer independent and results inhe production of RNA, migrating a little faster than theemplate RNA. Control lanes without the added RdRp oremplate RNA did not show any incorporation (Fig. 8A,anes 3 and 4). The specificity of the newly synthesizedroduct was checked by a Northern hybridization exper-

ment using positive-strand 39 end RNA (nt 7084–7194) asiboprobe (Fig. 8B). Lane 1 in Fig. 8B shows the producto be of negative sense as picked by plus polarity probe.ontrol lanes for the RdRp activity assay do not show anyignal, which contain the template RNA without the ad-ition of RdRp (Lane 2) and in the presence of RdRpithout the template RNA (Lane 3). After checking for thexpression of RdRp in the TNT rabbit reticulocyte system

data not shown), a similar activity assay reaction wasarried out with RdRp produced in the TNT rabbit reticu-

ocyte lysate system and it showed the generation of aimilar band migrating slightly faster to the template (Fig.C, lane 2). In addition to this, another band similar inize to the template RNA was also observed. Back-round smearing was observed in this reaction lane (Fig.C, lane 2) and also in the reaction lane containing RdRput no added template RNA (Fig. 8B, lane 4). However,

he reaction lane (Fig. 8C, lane 3) without RdRp proteinhowed no incorporation even in the presence of added9 end RNA template.

DISCUSSION

HEV has a positive-sense polyadenylated RNA ge-ome consisting of three open-reading frames. Theenomic organization of HEV distantly mimics alpha vi-

uses (Purdy et al., 1993). The nonstructural protein cod-ng region (ORF 1) is located at the 59 end of the cappedNA and the structural region (ORF2) at the 39 end. The

hird ORF overlaps ORF 2 substantially and ORF 1 by oneucleotide. Based on the replication strategy of otherositive-strand RNA viruses and the genomic organiza-

ion of HEV, a basic replication mechanism for HEV has

een hypothesized earlier (Reyes et al., 1993). Uponntering the cell, the nonstructural gene products are

abr

h(

KaadC

h(tmcbmtcptbcc

errf7dmenptaLsalr[

95RNA-RdRp INTERACTIONS AT THE 39 END OF HEV RNA

presumably expressed from the full-length positive-sense genome, which are then involved in the earlieststages of replication. The replicase unit, i.e., RdRp eitheralone or in association with cellular proteins, subse-quently directs the synthesis of negative-sense pre-genomic RNA from the 39 end of the viral genome. Such

negative-strand HEV RNA intermediate has indeedeen detected earlier (Nanda et al., 1994b) and in the

FIG. 8. RdRp activity assay. (A) In vitro RNA synthesis by recombinantRdRp expressed in E. coli, purified, and refolded using RNA transcriptscontaining the 39 end of HEV genome with poly(A) stretch as thetemplate. RdRp was added to the template in the presence of rNTPsand radiolabeled UTP in an appropriate reaction buffer and incubatedfor 2 h at 25°C. After phenol:chloroform extraction and ethanol precip-itation, the reaction products were run in a 8% polyacrylamide gelcontaining 7 M urea and visualized by autoradiography. Lane 1, labeled[39(1)An] RNA as a size marker; lane 2, RNA synthesized by recombi-nant RdRp; lane 3, activity reaction mix without added RdRp; lane 4,activity reaction mix without added template [39(1)An] RNA. (B) North-

rn blot analysis of newly synthesized RNA produced by reaction of theecombinant RdRp on 39 end-positive sense RNA of HEV genome. Theeaction products were run on 2% formaldehyde-agarose gel, trans-erred to nylon membrane, and probed using positive sense 39 end (nt084–7194) riboprobe. Lane 1, RNA synthesized by recombinant RdRp,etected as antisense HEV RNA; lane 2, template RNA in the activityix without the addition of recombinant RdRp and probed with HEV 39

nd positive RNA; lane 3, activity reaction mix containing the recombi-ant RdRp without the template RNA and probed with HEV 39 endositive RNA. (C) RdRp produced in the transcription coupled transla-

ion (TNT) rabbit reticulocyte lysate system used for the activity assaynd the products run on a 8% polyacrylamide gel containing 7 M urea.ane 1, labeled [39(1)An] RNA as a size marker; lane 2, RNA synthe-ized by recombinant RdRp in the rabbit reticulocyte lysate; lane 3,ctivity reaction mix containing template RNA but the rabbit reticulocyte

ysate without RdRp; lane 4, activity reaction mix containing the rabbiteticulocyte lysate with recombinant RdRp but no added template39(1)An] RNA.

ecent infection studies (Panda et al., 2000). Subse-quently, the synthesis of progeny positive-strand RNA

dm

takes place using the de novo-synthesized negativestrand as the template. Thus, the entire process of rep-lication of HEV RNA genome minimally utilizes an inter-action between viral and possibly host cell proteins andthe 39 and 59 terminal RNA motifs. Similar interactions

ave been characterized in Japanese encephalitis virusChen et al., 1997), west nile virus (Blackwell and Brinton,

1995), encephelmoyocarditis virus (Cui et al., 1993), al-falfa mosaic virus (Graff et al., 1995), hepatitis A virus(Kusov et al., 1996), brome mosaic virus (Quadt et al.,1993), mouse hepatitis virus (Yu and Leibowitz, 1995a,b),sindbis alphavirus (Pardigon et al., 1993), and hepatitis Cvirus (Yen et al., 1995). In light of the proposed replicationmodel, this study was undertaken to analyze the RNA-viral RdRp interactions that occur at the 39 end of HEVRNA, which might possibly serve as the key step in theinitiation of replication of the viral genome. To our knowl-edge this is the first report describing the interaction ofviral RdRp with the 39 end of the HEV genome. The reportalso attempts to deal with the RNA elements and sec-ondary structures responsible for the formation of thesespecific RNA-protein complexes.

Chemical and enzymatic probing of the 39 end of HEVRNA of the Indian isolate (AF076239) with 5 A residuesconfirmed the computer-predicted structure model de-rived by the MFOLD program (Figs. 1A and 1B). Chemicalprobing utilized Pb21 which not only discriminates thesingle-stranded regions and loops from double-strandedstem structures, but also has the ability to distinguishbetween regions of increased conformational flexibilityas well as altered conformation of RNA (Ciesiolka et al.,1992a,b, 1998). The approach of Pb(II)-induced hydrolysishas been successfully applied in structural studies ofseveral RNA molecules, like tRNA (Behlen et al., 1990;

rzyzosiak et al., 1998; Marciniec et al., 1989; Sampson etl., 1987), mouse U1 small nuclear RNA (Zietkiewicz etl., 1990), and E. coli 16 S RNA (Gornicki et al., 1989) andifferent prokaryotic 5S rRNA (Ciesiolka et al., 1992b;iesiolka and Krzyzosiak, 1996).The 39 ends of several positive-strand RNA viruses like

epatitis C virus (Oh et al., 2000), alfalfa mosaic virusAAMV) (Graff et al., 1995), poliovirus (Pata et al., 1995)urnip crinckle virus (TCV) (Song and Simon, 1995), hu-

an rhinovirus (Todd et al., 1995), and encephalomyo-arditis virus (Cui et al., 1993) are known to specificallyind to their respective RNA-dependent RNA poly-erases. Using gel-shift assays we demonstrated that

he purified and refolded HEV RdRp protein binds spe-ifically to the 39 end of the HEV RNA genome with theoly(A) stretch. tRNA was included in the binding reac-

ion mix in sufficient quantity to avoid any nonspecificinding. The specificity of the interaction was furtheronfirmed by competition and supershift assays. Specificompetitors, i.e., cold RNA corresponding to the probe,

isrupted the retarded complex even at 10- to 25-foldolar excess, but the nonspecific competitors like E. coli

p

Rapltfct

sHRasmssprticmtthadRnsapmpcscw1

rwtfssiee

S

l

96 AGRAWAL, GUPTA, AND PANDA

tRNA could not abolish the complex formation even atconcentrations as high as 50-fold molar excess. Super-shift assay using anti-RdRp antibodies further confirmedthe specificity of interaction. The 39 end lacking thepoly(A) stretch showed an almost negligible amount ofbinding to RdRp, even with increased amounts of protein(20 mg). Thus, the interaction between 39 end and RdRpshows an absolute requirement for the poly(A) stretch,which might be due to its participation in the formation ofSL1 (Fig. 1A). A similar requirement for the poly(A) tailhas been established earlier for encephalomyocarditisvirus (Cui et al., 1993). Functional relevance of a 39

seudoknot that includes part of the 39 poly(A) tail hasbeen shown for efficient replication of bamboo mosaicpotexivirus RNA (Tsai et al., 1999). Specificity of the viral

dRp binding to the viral sequences rather than to poly-denylated RNA was confirmed by the inability of theolyadenylated mRNA and 39 end RNA of HEV genome

acking the poly(A) stretch to compete with the interac-ion. Deletion mutants lacking either SL1 or SL2 did notorm the complex with RdRp. This suggests that theomplete 39 end domain, including two stem loops and

he poly(A) stretch is recognized by the viral RdRp. Pb21-induced hydrolysis of the RNA-RdRp complex revealedthat the interacting sites were indeed spread over theSL1, the SL2, and even the SS region. Modifications inSL1 by deletion and point mutations affected the bindingby varying degrees (Fig. 6). Opening of the interior loopand stem region (a) by a point mutation brings down thebinding efficiency to 48% of the wild type. A compensa-tory point mutation that restores SL1 base pairing wasable to partially restore binding to 60% of the wild type.Incomplete restoration of binding to wild type (normal-ized to 100%) might be due to the sequence dependenceof the interaction in addition to the structure depen-dence. Deletion of three cytosines in the interior loopeffects the RNA-RdRp interaction drastically, bringing itdown to merely 13% of the wild type. In contrast, removalof stem region (b) and hairpin loop had little effect onbinding. These combined results suggest that both struc-tured RNA motifs and sequence elements (CCC in theinterior loop or the nt modified in M2 mutant) are impor-tant for RdRp binding.

Recombinant HEV RdRp, expressed in E. coli, purified,and refolded and used in this study, was able to synthe-size RNA in vitro using 39 end HEV RNA with poly(A)stretch as the template in a primer-independent manner.Such an in vitro RdRp activity of synthesizing RNA denovo has been demonstrated earlier for hepatitis C virusby Oh et al. (1999). Another study (Luo et al., 2000) hasshown a de novo initiation of RNA synthesis by the HCVRdRp expressed in baculovirus system. Cui et al. (1993)have shown a similar activity of E. coli-expressed re-combinant RdRp in encephalomyocarditis virus using

Oligo(dT) as the primer. Other reports of RdRp activityfrom viral RdRps purified from native and recombinant

(i

sources have come from poliovirus (Neufeld et al., 1991;Plotch et al., 1989), rhinovirus (Morrow et al., 1985), den-gue virus (Tan et al., 1996), and brome mosaic virus(Quadt and Jaspars, 1990). Synthesis of slightly fastermigrating RNA species by HEV RdRp might be due toinitiation at a specific site on the 39 end RNA template[39(1)An] or due to premature termination. Such an ob-

ervation was also made when the 98 nt X region RNA ofCV 39 end was used as a template by recombinant HCVdRp expressed in E. coli (Oh et al., 1999). Production ofcomplete hairpin dimer product is less likely, because

uch a product would migrate very much faster than theonomer (Luo et al., 2000). The polarity of the newly

ynthesized product was confirmed to be of negativeense by Northern hybridization with the positive polarityrobe. RdRp expressed in TNT rabbit reticulocyte lysate

esulted in the synthesis of RNA species similar in size tohe template RNA in addition to the slightly faster migrat-ng band. This can be attributed to the presence of someellular factors in the rabbit reticulocyte lysate, whichight assist RdRp in its replicase activity to initiate syn-

hesis from the start site and hold it onto the template tillhe end. Interaction of cellular proteins with the 39 endas indeed been observed in our other studies (Panda etl., unpublished data). Background smearing might beue to nonspecific RdRp activity on internally presentNAs in the TNT rabbit reticulocyte lysate. The fact thato smearing was observed when rabbit reticulocyte ly-ate without RdRp was used suggests the absence ofctivity on HEV 39 end template due to any cellularolymerase. For many viral RdRps, activity on homopoly-ers has been demonstrated using complementary

rimers or even in a primer-independent manner at highoncentrations of rNTPs (Luo et al., 2000). Cowpea mo-aic virus (CPMV) RdRp has been shown to efficientlyopy CPMV RNA and various unrelated RNAs in vitrohile binding specifically only to CPMV RNA (Zabel et al.,

974).Here we report the specific binding of purified and

efolded HEV RdRp to the 39 end of the viral genome,hich requires the structured SL1 and SL2 domains and

he poly(A) stretch. Multiple sequence and structuralactors are recognized by RdRp, which may explain thepecificity of recognition of the HEV RNA. By forming thepecific binding site for viral RdRp and as a template for

n vitro synthesis of complementary-strand RNA, the 39nd of HEV might assume a possible role as a cis-actinglement for the initiation of replication of HEV genome.

MATERIALS AND METHODS

tructural modeling of the 39 end

Sequences of five geographically different HEV iso-ates including those from India (AF076239), Pakistan

M80851), Myanmar (M73218), China (L08816), and Mex-co (M74506) were analyzed for conserved domains

IisMuavs

psfwBmd

Cs

ci

ue

tip

t3wtfTtlbraepU

t

3

TACGA

97RNA-RdRp INTERACTIONS AT THE 39 END OF HEV RNA

within the 39 noncoding region using clustal (DNAStarnc.). The terminal 300 nucleotide sequences of all thesolates at the 39 end followed by the poly(A) stretch wereubjected to secondary structure prediction using theFOLD 2.3 program (Zuker, 1989). RNA parameters were

sed as given by Walter and Turner (1994). All the optimalnd suboptimal conformers predicted by MFOLD wereisualized by ESSA, an interactive tool for analyzing RNAecondary structure (Chetouani et al., 1997). A more

elaborate secondary structure analysis of the last 110bases of the Indian isolate (Accession No. AF076239)was carried out based on the conserved stem-loop struc-tures found at the 39 end of various isolates with added

oly(A) stretch. These were equivalent to nucleotide po-itions 7084–7194 nt of the Indian isolate (AF076239)

ollowed by five adenosine residues. All further studiesere carried out using sequences of the Indian isolate.ased on the structure model, we designed variousutants, in which stem-loop structures were deleted,

estroyed, or recreated (Figs. 1 and 3).

onstruction of recombinant plasmids andequencing

A PCR-based strategy was used to generate the cDNAlones for the production of RNA transcripts correspond-

ng to the 39 end of the HEV genome and its variousmutant forms from the infectious clone described by usearlier (Panda et al., 2000). A schematic representationand description of the constructs is shown in Fig. 3A.Forward and reverse primers were designed using theOLIGO 4.0 software and synthesized on an automatedDNA synthesizer (Model 392, Applied Biosystems) (Table1). These were used to amplify regions of the 39 end

sing a HEV cDNA 6046–7194 nt pCRScript clone (Pandat al., 1995) as a template and a combination of Taq

(Promega) and Pfu (Stratagene) DNA polymerases. Theforward primer contained the T7 promoter sequence

T

Primers Used for the Amplification of the 3

Probe Positive-sense 59 primera

9 (1) An pT7-7084-GCTCCAGCGCCTTAAGATGAA39 (1) pT7-7084-GCTCCAGCGCCTTAAGATGAA39 (1) D pT7-7084-GCTCCAGCGCCTTAAGATGAA39 (1) dAn pT7-7084-GCTCCAGCGCCTTAAGATGAAs39 (1) An pT7-7139-TTGTGCCCCCCTTCTCTCTG39 (1) M1 pT7-7084-GCTCCAGCGCCTTAAGATGAA39 (1) M2 pT7-7084-GCTCCAGCGCCTTAAGATGAA39 (1) M3 pT7-7084-GCTCCAGCGCCTTAAGATGAA39 (1) M4 pT7-7084-GCTCCAGCGCCTTAAGATGAA

a pT7 represents the T7 RNA polymerase promoter sequence (TGTAAgenome at which the positive-sense primers begin.

immediately upstream of the HEV sequence. The ampli-fied products were gel-purified, polished with a Klenow

aU

fragment of DNA polymerase (Amersham International),and phosphorylated with polynucleotide kinase (Amer-sham International). Subsequently these fragments werecloned into pUC18 vector (Ready to go pUC18 SmaI/BAP 1 ligase) (Pharmacia biotech., Sweden) and se-quenced by Sanger’s dideoxy chain termination methodusing the Sequenase version 2.0 sequencing kit (Amer-sham International).

Production of RNA transcripts

For the generation of run-off transcripts, plasmidswere linearized using the appropriate restriction enzymeat the 39 end of the insert. The XhoI restriction enzymesite present in the 39 end primer was used to linearizethe clones [39(1)An] and [s39(1)An] and the BamHI site ofhe vector MCS was used for other mutants (Table 1). Ann vitro transcription reaction was performed with T7 RNAolymerase (Life Technologies) in the presence of 500

mM each of ATP, CTP, and GTP along with 1 mM UTP and50 mCi [a-33P]UTP (2500 Ci/mmol; Amersham Interna-ional or BARC, India) and 40 U RNasin (Promega) at7°C for 1 h. The reaction mixtures were then treatedith 30 U of RNase-free DNase I (Amersham Interna-

ional) for 30 min at 37°C, extracted with phenol:chloro-orm, and precipitated twice with ethanol. Soluble andCA-precipitable counts were measured in a liquid scin-

illation counter (Beckman) to estimate the incorporationevel. Total amount of RNA synthesized was determinedy the amount of limiting rNTP (UTP) present in the

eaction, the maximum theoretical yield, and the percent-ge incorporation. The specific activity of the probe wasxpressed as the total incorporated counts per minuteer total microgram of RNA synthesized (Promega, 1996).p to 60% incorporation of the [33P]UTP was routinely

achieved resulting in labeled transcripts with a specificactivity of typically 108 cpm/mg. The transcription reac-ion generated expected size transcripts as visualized on

f HEV RNA and Generation of Its Mutants

Negative-sense 39 primer

GCCTCGAGTTTTTCAGGGAGCGCGGAACGCAAGGGAGCGCGGAACGCAGAAATGAGAAATAAGCAACAGAGCAACAGAGAGAAGGGGGGCACATTTTTTGAGAAATAAGCAACAGCCTCGAGTTTTTCAGGGAGCGCGGAACGCATTTTTTAGGGAGCGCGGAACGCAGATTTTTTAGGGAGCGCGGAACGCAAAAATGTTTTTCGCGCGGAACGCAGATTTTTCAGGGAAGAAATGAGAAATAAGC

CTCACTATAGG); 7084 and 7139 are the nucleotide positions in the HEV

ABLE 1

9 End o

n 8% denaturing polyacrylamide gel (data not shown).nlabeled RNA was similarly transcribed using 500 mM

sc

ccr(Uar7p

;dsalsbfduast

augp(ptrCNifawepissTitcUm

98 AGRAWAL, GUPTA, AND PANDA

of each of NTPs, phenol:chloroform-extracted, and etha-nol-precipitated.

Radioactive end labeling of RNA transcripts

The in vitro-transcribed RNA from the HindIII linearizedclone [39(1)An] was treated with calf intestinal alkalinephosphatase (Promega) and purified on 8% polyacryl-amide/8 M urea gel. The RNA bands were visualized byUV shadowing using a fluorescent TLC plate, cut, andeluted overnight in a buffer containing 1% SDS and 2.5 Mammonium acetate. The transcripts were ethanol-precip-itated and 59 end-labeled using T4 polynucleotide kinase(Promega) and [g-32P]ATP (5000 Ci/mmol; BARC, India)and further purified on 8% polyacrylamide/8 M urea gel toremove the unincorporated nucleotides. Autoradio-graphic exposure of 1 min enabled the visualization ofthe labeled bands.

Metal ion and enzymatic probing of RNA secondarystructure

Prior to reaction, the 32P-labeled RNA transcripts wereupplemented with carrier tRNA (Calbiochem) to a finaloncentration of 8 mM and subjected to a denaturation/

renaturation procedure by heating the samples at 65°Cfor 3 min and slow cooling to 25°C over 60 min. Therenaturation step was performed in the buffer containing10 mM Tris/HCl, pH 7.2, 10 mM MgCl2, and 40 mM NaClfor lead ion-induced cleavage and in the respective en-zyme buffers for enzymatic cleavage reaction. Subse-quently, Pb(OAc)2 (Sigma) solution was added to the final

oncentration of 2.5 and 5 mM, and the digestion wasonducted at 25°C for 15 min. For enzymatic cleavage,ibonuclease I (0.1 U) (Promega), S1 nuclease (0.4125 U)Amersham International), and mung bean nuclease (0.1) (Amersham International) were independently addednd the reaction proceeded at 25°C for 10 min. All the

eactions were quenched by adding an equal volume ofM urea and 10 mM EDTA solution and loaded on 15%

olyacrylamide/7 M urea gel at ;104 cpm/well. Electro-phoresis was performed in 0.53 TBE buffer at 2000 V for

1.5–4 h for short and long runs, respectively. Autora-iography was performed at 280°C with an intensifyingcreen (DuPont). The RNA cleavage products were runlong with the products of alkaline RNA hydrolysis and

imited ribonuclease T1 (Calbiochem) digestion of theame RNA. An alkaline hydrolysis ladder was generatedy incubating the RNA with formamide in boiling water

or 15 min. Partial T1 digestion was performed underenaturing conditions (50 mM sodium citrate, pH 4.5, 7 Mrea) with 0.05 U of enzyme at 55°C for 10 min. Thebove-mentioned procedure was carried out after the

tandardization of reaction, gel electrophoresis, and au-

oradiography conditions.

Cloning and expression of the HEV RdRp domain

The RdRp coding region covering nucleotide positions3546–5106 in the HEV genome (Koonin et al., 1992) was

mplified as a larger fragment (3493–5163 nt) by PCRsing a combination of Taq (Promega) and Pfu (Strata-ene) DNA polymerases from a HEV cDNA clone com-rising nucleotides 2346–5163 in the pCRScript vector

Ansari et al., 2000). The primers used were forwardrimer, ACAGctcgagcccgggGCATGATTCAGTCG nucleo-

ides 3493 to 3523 (GenBank Accession No. AF076239);everse primer, GCGaagcttCggtaccTGGTCGCGAAC-CATGG nucleotides 5163 to 5131 (GenBank Accessiono. AF076239). The forward primer sequence was mod-

fied at the 59 end to create the restriction enzyme sitesor XhoI and SmaI (lowercase nt in the primer sequence)nd the start codon ATG. Similarly the reverse primeras modified at the 59 end to incorporate the restrictionnzyme sites for KpnI and HindIII (lowercase nt in therimer sequence). The amplified fragment was cloned

nto pGEM-T vector (Promega) and sequenced as de-cribed earlier. It was then subcloned into the expres-ion vector pRSET (Invitrogen) as a XhoI-KpnI fragment.he recombinant pRSET C- RdRp clone was transformed

nto E. coli BL21-DE3 (Stratagene) and its overnight cul-ure (O/N) grown in Luria-Bertani (LB) medium. The O/Nulture was inoculated at 1% in NZ-amine medium (Difco,.S.A.) supplemented with 0.4% glucose, 13 M9 salts, 1M MgSO4, and 50 mg/ml ampicillin and the culture

incubated at 37°C with shaking. Isopropyl-b-D thiogalac-topyranoside (IPTG) was added at 1 mM concentrationwhen the culture attained an optical density of 0.5. Theculture was further incubated at 37°C with shaking for3 h. Cells were pelleted, solubilized in 23 Laemmilisample buffer (100 mM Tris-HCl, pH 6.8, 2% b-mercap-toethanol, 4% SDS, 0.2% bromophenol blue, 20% glycerol)and the extracts were separated on a sodium dodecylsulfate (SDS)–10% polyacrylamide gel along with highmolecular weight marker (Life Technologies). The proteinbands were visualized by Coomassie blue staining. Thespecificity of the expressed protein was determined byimmunoblotting either with rabbit sera raised against theE. coli-expressed RdRp region (Ansari et al., 2000) orpatient sera as the source of primary antibodies andperoxidase-conjugated swine anti-rabbit and anti-humanimmunoglobulins (Sigma), respectively, as secondary an-tibodies. Color development was carried out with 3,39-diaminobenzidine (Sigma) as the substrate.

Purification of RdRp protein

The overexpressed hexa-histidine-tagged recombi-nant protein corresponding to RdRp was purified onNi21-NTA-agarose (Qiagen, Germany) as per the manu-facturer’s instructions. The protein was refolded while

immobilized on the column to avoid the formation ofmisfolded aggregates. Renaturation was carried out over

[

m

ur

ptcsmpscsraQ

muwicm

P

P

o

99RNA-RdRp INTERACTIONS AT THE 39 END OF HEV RNA

a period of 1.5 h using a linear 6M–1 M urea gradient in500 mM NaCl, 20% glycerol, Tris/HCl, pH 7.4, containingphenylmethylsulfonyl fluoride (PMSF) (Sigma) as a pro-tease inhibitor. After refolding, the bound protein waseluted by the addition of 250 mM imidazole (Sigma). Theeluted fractions were checked on SDS–10% polyacryl-amide gel and those containing high amounts of RdRpprotein were further concentrated using the Centrisart Istarter kit (20,000 cutoff Da) (Sartorius, Germany). Proteinconcentration was determined by the Bradford assay(BioRad).

Electrophoretic mobility-shift assay (EMSA)

EMSA was standardized for protein concentration,buffer conditions, reaction temperature and time, type ofgel, and electrophoresis conditions. In the standard bind-ing assay 5 mg of purified RdRp protein and ;1 ng of

33P]UTP-labeled RNA probe (;105 cpm) were incubatedat 28°C for 20 min in a buffer containing 10 mM HEPES(pH 7.6), 0.3 mM MgCl2, 60 mM KCl, 2% glycerol, and 1

M DTT. Prior to addition of the labeled RNA probe, 20mg of E. coli tRNA (Calbiochem) was added to the reac-tion mixture and incubated for 10 min at 28°C. RNA-RdRpcomplex was then subjected to electrophoresis on a 5%nondenaturing polyacrylamide gel (acrylamide:bisacryl-amide ratio 5 60:1) containing 5% glycerol in 0.53 Tris-borate-EDTA (TBE) buffer at 250 V at 4°C. Gels werefixed, dried, and autoradiographed.

Partially purified and refolded RdRp protein was addedto the binding reaction mix at concentrations rangingfrom 1 to 20 mg. To confirm the specificity of RdRp-RNAinteraction, specific and nonspecific competitor RNAswere added to the binding reaction mix prior to additionof the probe. Unlabeled RNA corresponding to the probeas a specific competitor and E. coli tRNA as a nonspe-cific competitor were used at a molar excess of 5- to50-fold with respect to the probe. Human placentalmRNA and oligo(dT) (18 mer) were also used at a molarexcess of 20- to 60-fold as nonspecific competitors. Un-labeled 39 end RNA lacking the poly(A) stretch was also

sed as a competitor at 50-fold molar excess. In anothereaction, 5 mg heparin (as a protein control) was added

to the binding reaction mix containing the [39(1)An] RNArobe. Supershift assay was performed to further confirm

he specificity of RNA-RdRp interaction. The RNA-RdRpomplex in the binding mix was incubated with the rabbitera raised against E. coli-expressed RdRp region for 20in at 30°C. The rabbit serum was earlier verified for the

resence of anti-RdRp antibodies by immunoblotting (An-ari et al., 2000; Panda et al., 2000). The RNA-RdRpomplex was incubated with preimmune sera also in aeparate reaction mix to be used as a control. Theeaction mix was then subjected to nondenaturing poly-

crylamide gel electrophoresis as described above.uantitative estimation of binding was performed by

easuring the ratio of RNA probe bound to RdRp to thenbound probe under optimal binding conditions. Thisas accomplished by cutting the gel piece correspond-

ng to the bound and unbound probe and measuring theounts by scintillation. Percentage binding was deter-ined as follows:

ercentage binding 5 bound probe/

~bound probe 1 unbound probe! 3 100.

b(II)-induced cleavage of RNA-RdRp complex

The 59 end-labeled probe of [39(1)An] was allowed tobind to RdRp protein as noted above and the complexwas subjected to reaction with Pb(OAc)2 at final concen-tration of 1.25, 2.5, and 5 mM at 25°C for 10 min. Thereaction was stopped by the addition of EDTA to a finalconcentration of 10 mM, extracted with water-saturatedphenol, and RNA precipitated with ethanol. The sampleswere dissolved in 7 M urea/10 mM EDTA solution andloaded on the gel as described above.

In vitro RdRp activity assay

For the in vitro RdRp activity, an RNA synthesis reac-tion was undertaken in vitro using 39 end of HEV RNA astemplate in the presence of [33P]UTP. Briefly the reactionwas carried out in 40 ml volume containing 50 mMHEPES (pH 8.0); 7 mM MgCl2; 5 mM DTT; 500 mM each

f ATP, CTP, and GTP; and 20 mCi of [a-33P]UTP (2500Ci/mmol: Amersham International or BARC, India); 40 Uof RNasin (Promega); 0.15 mg of template RNA, [39(1)An]2110 nt, and 5 mg of recombinant RdRp expressed in E.coli, purified, and refolded as described earlier. After 2 hof incubation at 25°C, the mixture was phenol:chloro-form-extracted and ethanol-precipitated. The labeledRNA products were separated in 8% polyacrylamide gelcontaining 7 M urea and identified by autoradiographyusing an intensifying screen (DuPont) and Kodak X-OmatXK-5 film. Control reactions were also put simultaneouslythat did not contain either recombinant RdRp or templateRNA.

To check for the specificity of the newly synthesizedRNA, Northern hybridization was carried out. Briefly, RNAsynthesis reaction was performed as described abovewith cold UTP (500 mM) instead of radiolabeled UTP, andthe products were electrophoresed on a 2% formalde-hyde-agarose gel. Control reactions were also run simul-taneously that did not contain either recombinant RdRpor template RNA. After the run, the gel was washed inwater for 30 min followed by 23 SSC wash (203 SSC is3 M NaCl, 0.3 M trisodium citrate 2H2O, pH 7). Transferof RNA from the agarose gel to Hybond -N nylon hybrid-ization transfer membrane (Amersham International) wasdone by the capillary transfer method. The positive po-

larity 39 end HEV RNA 39 riboprobe (7084–7194 nt) wasprepared as noted above under Production of RNA tran-

B

C

C

C

C

C

C

C

G

G

H

J

K

K

K

K

K

K

L

M

M

N

N

100 AGRAWAL, GUPTA, AND PANDA

scripts. The gel blot was UV-crosslinked (CL-1000 Ultra-violet Crosslinker, Stratagene) for 5 min and then put inprehybridization solution (63 SSC, 53 Denhardt’s solu-tion, 0.5% SDS, 100 mg/ml calf thymus DNA) for 6 h at65°C in a hybridization oven (Schel Lab, Model 1004).Prehybridization solution was replaced by hybridizationsolution which contained the probe (;106 cpm) in addi-tion and the hybridization was carried out at 65°C for;16 h. After hybridization the blot was washed twice in23 SSC for 20 min each, followed by a 30-min wash with23 SSC and 0.1% SDS, followed by a wash in 0.13 SSCfor 10 min. The blot was rinsed in 23 SSC, dried, andexposed to Kodak X-Omat XK-5 film with an intensifyingscreen (DuPont) at 270°C overnight.

Alternative reaction was carried out using RdRp ex-pressed in the transcription coupled translation (TNT)rabbit reticulocyte lysate system (Promega). For this, theRdRp coding region was subcloned into eukaryotic ex-pression vector pSG1 (pSGI derived from pSG5; Jameelet al., 1996) as a SmaI-HindIII fragment from a previouslydescribed pGEM-T-RdRp clone. The TNT protocol wasfollowed as per the manufacturer’s guidelines. First,RdRp was synthesized as a [35S]methionine-labeled pro-tein and checked on SDS-PAGE and then later unlabeledRdRp protein was synthesized for the purpose of mea-suring RdRp activity. Twenty-five microliters of the TNTlysate containing expressed RdRp protein was added tothe activity assay reaction mix. TNT rabbit reticulocytelysate reaction mix without the addition of pSG1-RdRpDNA template was used as control in the activity assay.

ACKNOWLEDGMENTS

This study was funded by grant-in-aid programs from the Departmentof Science and Technology and Department of Biotechnology, Govern-ment of India to Prof. S. K. Panda. Shipra Agrawal is a Research Fellowof Council of Scientific and Industrial Research at the Department ofPathology, AIIMS, India. We acknowledge the critical appraisal given byDr. Ben Berkhout during the preparation of the manuscript.

REFERENCES

Ansari, I. H., Nanda, S. K., Durgapal, H., Agrawal, S., Mohanty, S. K.,Gupta, D., Jameel, S., and Panda, S. K. (2000). Cloning, sequencingand expression of the hepatitis E virus (HEV) nonstructural openreading frame 1 (ORF1). J. Med. Virol. 60, 275–283.

ehlen, L., Sampson, J. R., DiRenzo, A. B., and Uhlenbeck, O. C. (1990).Lead-catalyzed cleavage of yeast tRNAPhe mutants. Biochemistry 29,2515–2523.

Blackwell, J. L., and Brinton, M. A. (1995). BHK cell proteins that bindsto the 39 stem loop structure of the West Nile virus genome RNA.J. Virol. 69, 5650–5658.

hen, C. J., Kuo, M. D., Chien, L. J., Hsu, S. L., Wang, Y. M., and Lin, J. H.(1997). RNA-protein interactions: Involvement of NS3, NS5 and 39noncoding regions of Japanese encephalitis virus genomic RNA.J. Virol. 71, 3466–3473.

hetouani, F., Monestie, P., Thebault, P., Gaspin, C., and Michot, B.(1997). ESSA: An integrated and interactive computer tool for ana-lysing RNA secondary structure. Nucleic Acids Res. 25, 3514–3522.

iesiolka, J., Lorenz, S., and Erdmann, V. A. (1992a). Structural analysisof three prokaryotic 5SrRNA species and selected 5S rRNA-riboso-

mal-protein complexes by means of Pb(II)-induced hydrolysis. Eur.J. Biochem. 204, 575–581.

iesiolka, J., Lorenz, S., and Erdmann, V. A. (1992b). Different confor-mational forms of Escherichia coli and rat liver 5S rRNA revealed byPb(II)-induced hydrolysis. Eur. J. Biochem. 204, 583–589.

iesiolka, J., and Krzyzosiak, W. J. (1996). Structural analysis of two plant5S rRNA species and fragments thereof by lead-induced hydrolysis.Biochem. Mol. Biol. Int. 39, 319–328.

iesiolka, J., Michalowski, D., Wrzesinski, J., Krajewski, J., and Krzyzo-siak, W. J. (1998). Patterns of cleavages induced by lead ions indefined RNA secondary structure motifs. J. Mol. Biol. 275, 211–220.

ui, T., Sankar, S., and Porter, A. G. (1993). Binding of encephelomyo-carditis virus RNA polymerase to the 39 noncoding region of the viralRNA is specific and requires the 39 poly A tail. J. Biol. Chem. 268,26093–26098.

ornicki, P., Baudin, F., Romby, P., Wiewiorowski, M., Krzyzosiak, W. J.,Ebel, J. P., Ehresmann, C., and Ehresmann, B. (1989). Use of Pb(II) toprobe the structure of large RNAs. Conformation of 39 terminaldomain of E. coli 16S rRNA and its involvement in building the tRNAbinding sites. J. Biomol. Struct. Dynam. 6, 971–984.

raaff, M. D., Thorburn, C., and Jaspars, E. M. J. (1995). Interactionbetween RNA dependent RNA polymerase of alfalfa mosaic virusand its template: Oxidation of vicinal hydroxyl groups blocks in vitroRNA synthesis. Virology 213, 650–654.

wang, Y. K., and Brinton, M. A. (1998). A 68-nucleotide sequence withinthe 39 noncoding region of simian hemorrhagic fever virus negativestrand RNA binds to four MA104 cell proteins. J. Virol. 72, 4341–4351.

ameel, S., Zafrullah, M., Ozdener, M. H., and Panda, S. K. (1996).Expression in animal cells and characterization of the hepatitis Evirus structural proteins. J. Virol. 70, 207–216.

huroo, M. S. (1980). Study of an epidemic of non A, non B hepatitis:Possibility of another human hepatitis virus distinct from post trans-fusion non-A, non-B type. Am. J. Med. 68, 818–823.

huroo, M. S. (1991). Hepatitis E: The enterically transmitted non A, nonB hepatitis. Indian J. Gastroenterol. 10, 96–100.

oonin, E. V., Gorbalenya, A. E., Purdy, M. A., Rozanov, M. N., Reyes,G. R., and Bradley, D. W. (1992). Computer-assisted assignment offunctional domains in the nonstructural polyprotein of hepatitis Evirus: Delineation of an additional group of positive-strand RNA plantand animal viruses. Proc. Natl. Acad. Sci. USA 89, 8259–8263.

rzyzosiak, W. J., Marciniec, T., Wiewiorowski, M., Romby, P., Ebel, J. P.,and Giege, R. (1998). Characterisation of Pb(II) induced cleavages intRNAs in solution and effect of the Y-base in yeast tRNAPhe. Biochem-istry 27, 5771–5777.

uhn, R. J., Hong, Z., and Strauss, J. H. (1990). Mutagenesis of the 39nontranslated region of Sindbis virus RNA. J. Virol. 64, 1465–1476.

usov, Y., Weitz, M., Dollenmeier, G., Muller, V. G., and Siegl, G. (1996).RNA-protein interactions at the 39 end of the hepatitis A virus RNA.J. Virol. 70, 1890–1897.

uo, G., Hamatake, R. K., Mathis, D. M., Racela, J., Rigat, K. L., Lemm, J.,and Colonno, R. J. (2000). De novo initiation of RNA synthesis by theRNA-dependent RNA polymerase (NS5B) of hepatitis C virus. J. Virol.74, 851–863.arciniec, T., Ciesiolka, J., Wrzesinski, J., and Krzyzosiak, W. J. (1989).Identification of magnesium, europium and lead binding sites in E.coli and lupine tRNAPhe by specific metal ion induces cleavages.FEBS Lett. 243, 293–298.orrow, C. D., Lubinski, J., Hocko, J., Gibbons, G. F., and Dasgupta, A.(1985). Purification of a soluble template-dependent rhinovirus RNApolymerase and its dependence on a host cell protein for viral RNAsynthesis. J. Virol. 53, 266–272.

eufeld, K. L., Richards, O. C., and Ehrenfeld, E. (1991). Purification,characterization, and comparison of poliovirus RNA polymerase fromnative and recombinant sources. J. Biol. Chem. 266, 24212–24219.

anda, S. K., Kezbau, Y., Panigrahi, A. K., Acharya, S. K., Jameel, S., and

Panda, S. K. (1994a). Etiological role of hepatitis E virus in sporadicfulminant hepatitis. J. Med. Virol. 42, 133–137.

O

O

P

P

P

P

P

P

P

P

P

Q

Q

R

R

R

R

S

S

T

T

T

T

T

T

W

W

Y

Y

Y

Z

Z

Z

101RNA-RdRp INTERACTIONS AT THE 39 END OF HEV RNA

Nanda, S. K., Panda, S. K., Durgapal, H., and Jameel, S. (1994b). Detec-tion of negative strand of hepatitis E virus RNA in the livers ofexperimentally infected rhesus monkeys: Evidence for viral replica-tion. J. Med. Virol. 42, 237–240.

h, J. W., Ito, T., and Lai, M. M. (1999). A recombinant hepatitis C virusRNA-dependent RNA polymerase capable of copying the full-lengthviral RNA. J. Virol. 73, 7694–7702.

h, J. W., Sheu, G. T., and Lai, M. M. (2000). Template requirement andinitiation site selection by hepatitis C virus polymerase on a minimalviral RNA template. J. Biol. Chem., in press.

anda, S. K., Datta, R., Kaur, K., Zuckerman, A. J., and Nayak, N. C.(1989). Enterically transmitted non-A, non-B hepatitis: recovery ofvirus like particles from an epidemic in South Delhi and transmissionstudies in rhesus monkeys. Hepatology 10, 466–472.

anda, S. K., Nanda, S. K., Zafrullah, M., Ansari, I. H., Ozdener, M. H.,and Jameel, S. (1995). An Indian strain of hepatitis E virus (HEV):Cloning, sequencing and expression of structural region and anti-body responses in sera from individuals from an area of high-levelHEV endemicity. J. Clin. Microbiol. 33, 2653–2659.

anda, S. K., and Jameel, S. (1997). Hepatitis E virus: from epidemiologyto molecular biology. Viral Hepatitis Rev. 3, 227–251.

anda, S. K., Ansari, I. H., Durgapal, H., Agrawal, S., and Jameel, S.(2000). The in-vitro synthesized RNA from a cDNA clone of hepatitisE virus (HEV) is infectious. J. Virol. 74, 2430–2437.

ardigon, N., Lenches, E., and Strauss, J. H. (1993). Multiple bindingsites for cellular proteins in the 39 end of sindbis alphavirus minus-sense RNA. J. Virol. 67, 5003–5011.

ata, J. D., Schultz, S. C., and Kirkegaard, K. (1995). Functional oligomer-ization of poliovirus RNA dependent RNA polymerase. RNA 1, 466–477.

lotch, S. J., Palant, O., and Gluzman, Y. (1989). Purification and prop-erties of poliovirus RNA polymerase expressed in Escherichia coli.J. Virol. 63, 216–225.

romega (1996). Promega protocols and applications guide, III ed.,Determination of percent incorporation and specific activity, pp. 118–119. Promega, Madison, WI. (ISBN 1-882274-57-1).

urdy, M. A., Tam, A. W., Huang, C. C., Yarbough, P. O., and Reyes, G. R.(1993). Hepatitis E virus: A non-enveloped member of the ‘alpha-like’RNA virus supergroup. Sem. Virol. 4, 319–326.

uadt, R., and Jaspars, E. M. (1990). Purification and characterization ofbrome mosaic virus RNA-dependent RNA polymerase. Virology 178,189–194.

uadt, R., Kao, C. C., Browning, K. S., Hershberger, R. P., and Ahlquist,P. (1993). Characterization of a host protein associated with bromemosaic virus dependent RNA polymerase. Proc. Natl. Acad. Sci. USA90, 1498–1502.

ay, R., Aggarwal, R., Salunke, P. N., Mehrotra, N. N., Talwar, G. P., andNaik, S. R. (1991). Hepatitis E virus genome in stools of hepatitispatients during large epidemic in north India. Lancet 338, 783–784.

eyes, G. R., Yarbough, P. O., Tam, A. W., Purdy, M. A., Huang, C. C., Kim,J. S., Bradley, D. W., and Fry, K. E. (1991). Hepatitis E virus (HEV): Thenovel agent responsible for enterically transmitted nonA, non Bhepatitis. Gastroenterol. Jpn. 26(Suppl. 3), 142–147.

eyes, G. R., Huang, C. C., Tam, A. W., and Purdy, M. A. (1993).Molecular organisation and replication of hepatitis E virus (HEV).Arch. Virol. (Suppl. 7), 15–25.

ohll, J. B., Percy, N., Ley, R., Evans, D. J., Almond, J. W., and Barclay,W. S. (1994). The 59 untranslated regions of picornavirus RNAs

contain independent functional domains essential for RNA replica-tion and translation. J. Virol. 68, 4384–4391.

ampson, J. R., Sullivan, F. X., Behlen, L. S., DiRenzo, A. B., andUhlenbeck, O. C. (1987). Characterization of two RNA catalyzed RNAcleavage reaction. Cold Spring Harbor Symp. Quant. Biol. 52, 267–275.

ong, C., and Simon, A. E. (1995). Requirement of a 39 terminal stemloop in in vitro transcription by an RNA dependent RNA polymerase.J. Mol. Biol. 254, 6–14.

am, A. W., Smith, M. M., Guerra, M. E., Huang, C. C., Bradley, D. W., Fry,K. E., and Reyes, G. R. (1991). Hepatitis E virus (HEV): Molecularcloning and sequencing of the full-length viral genome. Virology 185,120–131.

an, B. H., Fu, J., Sugrue, R. J., Yap, E. H., Chan, Y. C., and Tan, Y. H.(1996). Recombinant dengue type 1 virus NS5 protein expressed inEscherichia coli exhibits RNA-dependent RNA polymerase activity.Virology 216, 317–325.

iley, L., Hagen, M., Matthews, J. T., and Krystal, M. (1994). Sequencespecific binding of the influenza virus RNA polymerase to sequenceslocated at the 59 ends of the viral RNAs. J. Virol. 68, 5108–5116.

he International Committee on the Taxonomy of Viruses, 8th report (inpress). http://www.ncbi.nlm.nih.gov/ICTV/

odd, S., Nguyen, J. H. C., and Semler, B. L. (1995). RNA-protein inter-actions directed by the 39 end of human rhinovirus genomic RNA.J. Virol. 69, 3605–3614.

sai, C. H., Cheng, C. P., Peng, C. W., Lin, B. Y., Lin, N. S., and Hsu, Y. H.(1999). Sufficient length of a poly(A) tail for the formation of a potentialpseudoknot is required for efficient replication of bamboo mosaicpotexivirus RNA. J. Virol. 73, 2703–2709.

alter, A. E., and Turner, D. H. (1994). Sequence dependence of stabilityfor coaxial stacking of RNA helixes with Watson-Crick base pairedinterfaces. Biochemistry 33, 12715–12719.

ong, D. C., Purcell, R. H., Sreenivasan, M. A., Prasad, S. R., and Pauri,K. M. (1980). Epidemic and endemic hepatitis in India: Evidence for anon A, non B hepatitis virus aetiology. Lancet 2, 876–879.

en, J. H., Chang, S. C., Hu, C. R., Chu, S. C., Lin, S. S., Hsieh, Y. S., andChang, M. F. (1995). Cellular proteins specifically bind to the 59noncoding region of hepatitis C virus RNA. Virology 208, 723–732.

u, W., and Leibowitz, J. L. (1995a). A conserved motif at the 39 end ofmouse hepatitis virus genomic RNA required for host protein bindingand viral RNA replication. Virology 214, 128–138.

u, W., and Leibowitz, J. L. (1995b). Specific binding of host cellularproteins to multiple sites within the 39 end of mouse hepatitis virusgenomic RNA. J. Virol. 69, 2016–2023.

abel, P., Weenen-Swaans, H., and van Kammen, A. (1974). In vitroreplication of cowpea mosaic virus RNA. I. Isolation and properties ofthe membrane-bound replicase. J. Virol. 14, 1049–1055.

afrullah, M., Ozdener, M. H., Panda, S. K., and Jameel, S. (1997). TheORF3 protein of hepatitis E virus is a phosphoprotein that associateswith the cytoskeleton. J. Virol. 71, 9045–9053.

ietkiewicz, E., Ciesiolka, J., Krzyzosiak, W. J., and Slomski, R. (1990).The secondary structure model of mouse U1, snRNA as determinedfrom the results of Pb21 induced hydrolysis. In “Nuclear Structure andFunction” (J. R. Harris and J. B. Zbraski, Eds.), pp. 453–457. Plenum,New York.

Zuker, M. (1989). On finding all suboptimal foldings of an RNA molecule.Science 244, 48–52.